- Jul 2021
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260907: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PEDV was propagated in Vero cell line (ATCC CCL-81, LGC Standards).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 control: SARS-CoV-2 control (nCoV-ALL-Control plasmid, Eurofins Genomics, Germany) was seeded into raw wastewater samples collected from five different WWTP in Portugal (as described below), following quantification by reverse transcription digital PCR (RT-dPCR) using two assays from the Charité protocol (Corman et al., 2020): E_Sarbecco and RdRp assays (Supplementary Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nCoV-ALL-Control</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses: All data analyses were performed with SPSS Statistics 26 (IBM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260351: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All underlying studies were conducted to conform to regulations on the protection of individuals participating in medical research and in accordance with the principles of the Declaration of Helsinki (2013) and received ethical approval by the responsible institutional review boards.<br>Consent: Written informed consent was obtained from all participants at the time of sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All samples from subjects undergoing spironolactone treatment and placebo controls were from the HOMAGE trial, a prospective, randomized, open-label, blinded-endpoint (PROBE), multicentre design, in which people at increased risk of developing HF were randomly assigned to receive either spironolactone or standard of care (“control”) - not receiving spironolactone or other mineralocorticoid receptor antagonists (ClinicalTrials.gov Identifier: NCT02556450).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All samples from subjects undergoing spironolactone treatment and placebo controls were from the HOMAGE trial, a prospective, randomized, open-label, blinded-endpoint (PROBE), multicentre design, in which people at increased risk of developing HF were randomly assigned to receive either spironolactone or standard of care (“control”) - not receiving spironolactone or other mineralocorticoid receptor antagonists (ClinicalTrials.gov Identifier: NCT02556450).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Distribution of the CoV50 scoring was evaluated using MedCalc (version 12.1.0.0, MedCalc Software, Mariakerke, Belgium; https://www.medcalc.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02556450</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Bioprofiling Response to Mineralocorticoid Receptor Antagoni…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260647: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This activity was reviewed by the institutional review boards of the Centers for Disease Control and Prevention (CDC) and other participating institutions and was conducted consistent with applicable federal law and CDC policy.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These results were subject to several limitations. First, because Johnson & Johnson’s Janssen vaccine uptake in the general population was limited during the study period, participants vaccinated with the Janssen vaccine were not included in this analysis. Including the 22 vaccinated participants who received Janssen vaccine (4 in cases, 18 in controls) resulted in similar estimates of VE (Supplemental Table 2). Second, surveillance populations at the study sites are not representative of the U.S. population, and this analysis did not evaluate VE by race and Hispanic ethnicity. Additional evaluation of VE among racial/ethnic groups disproportionately affected by the pandemic and among other specific populations, such persons with underlying health conditions, are needed. Third, because we relied on vaccine documentation to determine vaccination status, we may have missed unrecorded vaccine doses. However, estimates including self-reported doses, without documentation, showed similar VE (Supplemental Table 2). Finally, unmeasured selection bias based on healthcare seeking behaviors and potential for differential participation response is a possible risk in the test-negative design. As of July 1, 2021, 55% of the U.S. population had received at least one dose of a COVID-19 vaccine [14]. A growing number of vaccine effectiveness studies have provided evidence that mRNA vaccines confer similar protection against COVID-19 in real-world conditions as in clinical trials, reducing ri...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260919: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:4.2 Limitations: Our study has several limitations. First, we can only definitively conclude the underestimation of Singapore’s COVID-19 cases in the early stages of the pandemic based on the exponential increase of confirmed cases in later months, but the degree of underestimation is still unclear due to our lack of understanding of the virus. The degree of under-reporting of cases can only be estimated by conducting a serological surveillance, which relies on the detection of COVID-19 antibodies as a result of a past COVID-19 infection (WHO, 2020). Hence, serological tests are much more reliable and accurate for detecting previous infections in individuals with few or no COVID-19 symptoms (CDC, 2020a). However, Singapore has primarily been adopting the use of polymerase chain reaction (PCR) tests, which involves the extraction of a swab sample from the nose and/or throat from the patient (ICA, 2021). Given the lack of Singapore serological testing results and data, we can only make predictions of the true COVID-19 case counts, subject to the pandemic developing in a similar manner to that of our chosen statistical distributions and accuracy of our parameters based on assumptions made during the development of the models. Second, the model assumes individuals infected with COVID-19 either recover or die, with no reinfection taking place. New research suggests this might not be true, with countries such as Mexico, Sweden and South Korea all reporting cases of COVID-19 reinfec...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260746: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation of our work is that our estimates reflect the epidemiological situation with a delay of approximately 19 days (the delay from an infection to a death [53]). Nevertheless, our short-term forecasts and transmissibility estimates provide a valuable global overview and continuous insights into the dynamic trajectory of the epidemic in different countries. They also provide indirect evidence about the effectiveness of public health measures. Future research could investigate integrating more data streams into the models. In addition to the weekly reports that we publish, our work has also contributed to other international forecasting efforts [22, 48, 55]. We developed a simple heuristic to combine past estimates of transmissibility and a decline in the proportion of susceptible population to produce medium-term forecasts. We were able to achieve good model performance in forecasting up to 4 weeks ahead. Consistent with findings from other modelling studies [22], we found that the model error was unacceptably high beyond 4 weeks, suggesting that forecasting beyond this horizon is difficult. Importantly, our characterisation of the epidemic phase using weighted estimates of transmissibility were largely in agreement with that using short-term transmissibility estimates. Thus, our method was successful at capturing the broad trends in transmission up to 4 weeks ahead. The medium-term forecasts can therefore serve as a useful planning tool as governments around the world...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260577: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was conducted with Stata v16.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stata</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our findings have several limitations. First, response rates were low, especially during India’s lockdown. However, much of the non-response was because CPHS randomly sampled only 50% of households during the lockdown. We employ non-response weights to adjust non-response. Moreover, non-responding households in one round may report deaths from that round in subsequent rounds; we estimate excess deaths using that data in the Supplement. Second, CPHS may not be as representative as official excess-death numbers 6. We estimate a higher baseline death rate in 2019 than Global Burden of Disease 4. However, official all-cause mortality is only available for 10 states (out of 28) and the two sources give comparable answers.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260278: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Study setting: This cross-sectional study among the health care workers (HCWs) was executed at a tertiary care hospital, Kolkata after obtaining approval from the Institutional Ethics Committee,<br>Consent: Among the 3,997 HCWs in the tertiary care center, 313 HCWs (11 Administrative staff, facility manager and clerical staff, 66 Junior doctors, 38 Medical officer, 81 Nursing staff, 24 Paramedical staff and research scientist, 93 Support staff, GDA, security, kitchen staff) were randomly selected and included in the study with their informed consent for serosurvey during November 2020 to January 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among the 3,997 HCWs in the tertiary care center, 313 HCWs (11 Administrative staff, facility manager and clerical staff, 66 Junior doctors, 38 Medical officer, 81 Nursing staff, 24 Paramedical staff and research scientist, 93 Support staff, GDA, security, kitchen staff) were randomly selected and included in the study with their informed consent for serosurvey during November 2020 to January 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A structured questionnaire comprising demographics, prior symptoms with their duration, prior COVID-19 test results, working location (in terms of working in COVID or Non-COVID unit), co-morbidities were collected prior to the blood collection for SARS-CoV-2 antibody testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological analysis of IgG and total antibody (IgG, IgM and IgA) were performed using enhanced chemiluminescence technology by Vitros ECiQ (Ortho Clinical Diagnostics, New Jersey, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>total antibody ( IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When horseradish peroxidase (HRP) labelled murine monoclonal anti-Human IgG antibodies were added as conjugate, the conjugate interacted specifically to the antibody portion of antigen-antibody complex which is measured by a luminescent reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260858: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260836: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained.<br>IRB: Ethical approval: Ethical approval was obtained from University of Bristol faculty ethics committee (Reference 115084).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted in STATA 16.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Students were well informed about the limitations of tests, often describing test results as just one piece of information, and using them with caution to inform their behaviour [23]. Many students had done their own research, had discussions with their friends, family, tutors and lecturers to maximise their knowledge of testing. This highlights the need for improved communications from universities to enable students to make their own informed decisions. Indeed, recent research that has shown basic and simple messages may not be suitable for communicating complex information about how to behave during the pandemic [24] and students are likely to appreciate having the opportunity to access information about the sensitivity and specificity of the tests. Despite concerns that testing would increase risky contact, we did not find evidence to support this. Students were well informed about the limitations of the tests, and used them with caution to inform behavioural decisions. What this study adds: A key strength of this research is the use of a mixed methods approach. Additionally, though some other universities have evaluated their LFT programmes [25, 26] we are not aware of any reporting data on testing uptake and exploring demographic variations in uptake among the whole student body. This is a unique strength of our work provides crucial information to inform future university testing strategies. Our work identified several ways in which engagement may be enhanced. As many ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260707: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260855: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study staff entered data in the field on tablets using REDCap (Research Electronic Data Capture)24 and had refresher training on specimen collection and the identification of respiratory signs and symptoms each week.<br>IRB: Ethics: The PHIRST protocol was approved by the University of Witwatersrand Human Research Ethics Committee (Reference 150808) and amended to include enrollment and testing for COVID-19 on 24 June 2020 and was registered on clinicaltrials.gov on 6 August 2015 and updated on 30 December 2020 (https://clinicaltrials.gov/ct2/show/NCT02519803).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Households were randomly selected, from the HDSS database in the rural site and using Global Positioning System (GPS) coordinates in the urban site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study staff entered data in the field on tablets using REDCap (Research Electronic Data Capture)24 and had refresher training on specimen collection and the identification of respiratory signs and symptoms each week.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted all statistical analyses using STATA version 14.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study had several limitations. We included two communities and households with >2 members, potentially limiting generalisability of study findings. The finding of very different attack rates in the two communities suggests substantial heterogeneity in disease transmission in different geographic areas. Participants were sampled using mid-turbinate nasal swabs because of potential SARS-CoV-2 transmission risk with a collection of more sensitive nasopharyngeal swab specimens. This could have led to some missed infections. However, the strong association between rRT-PCR- and serology-confirmed infection in individuals with both specimen types available suggests that the majority of infections were detected. Repeated questioning on symptoms twice weekly may be associated with participant fatigue and under-reporting. Participants may have been informed of their disease status before developing symptoms, potentially affecting reporting. We implemented several measures to reduce this potential bias including weekly retraining of field workers on symptom collection and regular field supervisory visits to evaluate data collection and symptom recording. A study of influenza infection in the same population with similar study design found that 56% of individuals infected with influenza were symptomatic, suggesting the robustness of our data.22 Our study covered a 9-month period, and we cannot speculate on the duration of natural immunity and risk of reinfection over longer timescale...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02519803</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Unknown status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Prospective Household Observational Cohort Study of Influe…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260792: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After obtaining informed written consent, data with regard to demographic variables, clinical history with regard to symptomatology in case of past history of COVID 19, infection prevention and control measures adopted etc were captured on to a structured proforma approved by Institutional Ethics Committee.<br>IRB: After obtaining informed written consent, data with regard to demographic variables, clinical history with regard to symptomatology in case of past history of COVID 19, infection prevention and control measures adopted etc were captured on to a structured proforma approved by Institutional Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 seroprevalence in healthcare workers of dedicated-COVID hospitals and non–COVID hospitals of District Srinagar, Kashmir] Sampling: From 3550 HCWs at GMCT, 979 HCW were selected by stratified random sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Random sample numbers were generated and data analysis was performed Using R software (R version 3.6.2 (2019-12-12) Copyright (C) 2019 The R Foundation for Statistical Computing Platform: x86_64-w64-mingw32/x64 (64-bit)) and SPSS version 16.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260728: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement, participants, and sample processing: This study was approved by the Ethics Committee for Clinical Research of the Center for Research Promotion and Support at Fujita Health University (authorization number HM20-526 and HM21-167).<br>Consent: All participants provided written informed consent before undergoing any study procedure.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed three times with PBS containing 0.1% Tween 20 (PBS-T), peroxidase-labelled anti-human IgM or IgA antibody (Midrand Bioproducts) was added as secondary antibody and incubated at room temperature for 60 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the bound and free fractions were separated, 50 μL of peroxidase-labelled anti-human IgG antibody was added and incubated at 37°C for 3 min, followed by separation of the bound and free fractions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism version 8.4.3 for windows (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260802: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethical Committee for Research of Federal University of Mato Grosso do Sul (CAAE: 43289221.5.0000.0021).<br>Field Sample Permit: We selected cases who had an ARI, received a positive SARS-CoV-2 RT-PCR test during the study period of 17 January 2021 to 2 July 2021 with sample collection date within 10 days after symptom onset, and without a positive SARS-CoV-2 RT-PCR test in the previous 90 days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The protocol, including statistical analysis plan, further details of study design, and power calculations, is publicly available (https://github.com/juliocroda/VebraCOVID-19).</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes and Covariates: We estimated the effectiveness of ChAdOx1 against the primary outcome of symptomatic Covid-19 during the period ≥28 days after a single vaccine dose, and 0-13 and ≥14 days after two vaccine doses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In the specific context of VOC emergence and spread, national programs should consider the reduced vaccine effectiveness of a single dose against the Gamma and Delta VOCs in the elderly, together with vaccine supply limitations, speed of vaccination, and logistics, when quantifying the benefits of dose-spacing strategies. The design of this study lends strength to our findings. The six-month period during which the Gamma variant-associated epidemic and vaccination campaign occurred provided the opportunity to obtain robust estimates of single-dose effectiveness beyond 28 days, and effectiveness of the completed schedule in the same population for direct comparison. The test-negative design reduces bias caused by healthcare-seeking behavior35, and we have controlled for additional sources of bias by matching on several predictors of healthcare access and utilization and Covid-19 risk36. We used a negative control exposure of vaccine effectiveness within 13 days of receiving the first dose to detect bias in our estimates, and found limited measured effectiveness in this period. This null association suggests that unvaccinated and vaccinated individuals were similar in their underlying risk of Covid-19 and healthcare-seeking behavior23. The large sample size allowed us to produce robust estimates even against rare outcomes such as death and to perform subgroup analyses. Our study has several limitations. We could not estimate the effectiveness against Gamma and non-Gamma Covid-1...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260815: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We removed primers, adapter sequences, and low-quality bases with “bbduk” in the BBTools software package (69), then removed PCR duplicates with BBTools “dedupe.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBTools</div><div>suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260522: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The simple model underlying this analysis has notable limitations. We assumed a homogenous population encompassing all persons—students, faculty, and staff—living and working in close, regular physical proximity to one another in a campus setting. We did not explicitly take into account non-random mixing patterns, age-dependent transmission, or any of the other evident differences between students and university employees, although non-student members of the college community include a higher proportion of older, more medically vulnerable individuals. Also, we do not distinguish between students living in dormitories and those living in off-campus settings. These are important distinctions deserving further exploration, but they are beyond the scope of the present analysis. Recent guidance documents for IHEs from the Centers for Disease Control and Prevention, the American College Health Association, the Massachusetts Higher Education Testing Group, and other organizations have been released to support decision-making by IHE officials preparing for a safe reopening for the fall 2021 semester while restoring at least a significant degree of normalcy to the on-campus experience.6, 13, 14 Our work aims to inform and enhance that work, providing a tool that illuminates the complex interplay of choices available to them as they consider their institutional circumstances, priorities, and needs in the face of an ongoing and uncertain public health threat.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260694: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260759: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The study was approved by the National Bioethics Committee of Iceland (VSN 20-078).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Confidence intervals were obtained by 2000 bootstrap resamplings of a randomly selected imputed dataset.[16] Model discrimination was quantified using the C-statistic.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">A formal sample size calculation was not performed because all available data were used.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cowplot package[21] was used to create multipanel figures and tableone[22] was used to create summary tables.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cowplot</div><div>suggested: (cowplot, RRID:SCR_018081)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Finally, CKD was associated with more severe outcomes which is consistent with prior studies.[29] While the strength of this study resides in the population-based approach, there are possible limitations that may decrease the generalizability of our findings. The clinical threshold at which an outpatient visit is considered to be indicated will likely vary between cultures and healthcare systems. This variation in clinical thresholds also exists for hospitalizations and ICU admissions, but is probably considerably less than for outpatient evaluation. In addition, the clinical severity score was loosely defined and was largely based on the clinical impression of the physician conducting the enrollment interview. Inter-rater variability was not quantified and we are therefore unable to speculate how this predictor will generalize to other settings. As the need for in-person evaluation at the COVID Outpatient Clinic was also determined by the same healthcare professionals during telephone interviews, it is perhaps not surprising that the clinical severity score was predictive. However, the clinical severity score during the enrollment interview also predicted the need for hospital admission, ICU care and death which downplays the possibility. Furthermore, a study examining the humoral response to SARS-CoV-2 in an overlapping cohort found a strong correlation between the clinical severity score and higher antibody levels, supporting the validity of the clinical severity score.[7]
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260779: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260726: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Use of residual SARS-CoV-2 positive specimens and collection of student status and on-campus residence were approved by the Institutional Review Board at the University of Michigan (Protocol HUM185966).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To determine whether the contextual genomes were biasing our results, we generated a total of ten random subsamples of the global data using the schema described above and analyzed the data in the same manner (Figure S2C).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of Raw Sequence Reads: We mapped reads to the Wuhan/Hu-1/2019 reference genome (GenBank MN908947.3) with BWA-MEM (Li, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We determined consensus sequences with samtools mpileup and iVar 1.2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned genomes with MAFFT as implemented in augur.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We inferred a maximum likelihood phylogeny with IQ-TREE with a GTR model and 1000 ultrafast bootstraps (Nguyen et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used TempEst to fit and plot a root-to-tip regression of divergence over time (Rambaut et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also performed Bayesian ASR using BEAST 1.10.4 using a fixed tree topology derived from TreeTime (Alpert et al., 2021; Drummond and Rambaut, 2007).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are other important limitations. First, we were not able to access specimens from commercial testing sites, and the number of detected transmission introductions is certainly an underestimate. It is likely that many singletons in our data are in fact linked to a small number of other student cases. It is also possible that there were differential contact patterns between students who obtained testing at Michigan Medicine sites and those who did not. Next, our study is not an epidemiologic investigation with contact tracing and individual behavioral information. It is difficult to reliably assess the effectiveness of any single mitigation measure that was implemented during the fall semester from these data alone. In particular, it is difficult to disentangle whether the lack of spread from students into the community is the result of university and county case identification and isolation measures for students, partitioning of social structures between IHE and the surrounding communities, or a combination of both. Thorough contact tracing investigations of IHE-associated outbreaks with dense genomic surveillance across populations may be able to resolve these questions in greater detail. It is also possible that these dynamics could have played out differently with earlier emergence of a highly transmissible variant, such as B.1.1.7 (Alpert et al., 2021; Washington et al., 2021). This work will be a valuable point of comparison for future studies examining the effects o...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260445: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: It has been approved by the Research ethics board of the CHU de Québec-Université Laval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To account for time-varying likelihoods of SARS-CoV-2 exposure and vaccination [15], a density sampling approach was used with 10 randomly-sampled controls per case matched by week of reference date.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations, foremost related to its observational design, subject to bias and confounding, and reliance on surveillance data subject to misclassification and missing information. Like others we could not fully adjust for differential exposure risk or fully ascertain the symptom profile notably after specimen testing. Despite easy access to testing, some asymptomatic infections were likely missed. HCWs with undetected infections before the study period could not be excluded leading to bias due to undiagnosed cases among vaccinated (overestimation) or unvaccinated (underestimation) participants [26]. A Ministerial order issued on April 9 requiring unvaccinated HCWs to be systematically tested every 3 days [27] may have increased detection of asymptomatic infections in unvaccinated individuals potentially leading to overestimation of VE against any infection at the end of the follow-up period but without affecting VE against COVID-19 or hospitalization. HCWs are active and relatively young adults and these results may not apply to older adults [28,29]. Even if adjustment for comorbidities did not change VE estimates, HCWs with medical conditions at high risk of severe disease were frequently removed from direct patient care duties during the pandemic and their VE might be lower than the estimates for all HCWs [22]. Despite these limitations, our study has strengths including its extended post-single-dose follow-up of a large and well-defined cohort and its severa...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260735: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Python package scikit-learn was used to convert the segmented sentences into unigram and bigram tokens and to calculate the counts of tokens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Although we attempted to analyze Japanese posts on Twitter to gauge public opinion and sentiment throughout Japan, our data may not be representative of the country’s population at large, especially the elderly. According to statista[42], in 2021, about 17% of the Twitter population worldwide is aged 50 or above, leaving 83% in the 49 or younger category. Goldstein et al. [43]showed that the cumulative rate of COVID-19 infection in the community is high among people younger than 35 years old, while transmission in middle or high schools is robust. The opinions of adults over 40 need to be further investigated by modifying the study design, but there is an urgent need to explore the opinions and acceptance of vaccination in younger populations. Moreover, according to Twitter’s user privacy protection principles, our study did not further examine the demographic characteristics of users, such as age, gender, and geographic location. Since large-scale vaccination began in Japan on May 24, 2021, our nearly year-long data analysis includes only one month after that time; thus, we will continue to monitor and conduct long-term trend analysis.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260693: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by our institution’s ethics committee and all subjects provided an oral informed consent.<br>Consent: The study was approved by our institution’s ethics committee and all subjects provided an oral informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination with Covishield had started in our institution on 16th January 2021, though some of our HCWs could receive the other vaccine by travelling to other areas.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covishield</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data on vaccination status, type of vaccine, test positivity, presence of symptoms and comorbidities were collected using a telephonically administered questionnaire, captured using EpiCollect5 application and analysed using STATA V14.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The case-control design that we used, despite its several limitations, has the advantage of permitting assessment of association of intervention with disease even when only a few cases are available, and thus allowed us to detect this effect. Though our analysis did show a statistically significant protection against moderately severe disease after Covishield, the confidence intervals of the estimate are relatively broad and further data on this association may be needed to improve our confidence in this observation. Our study has two key limitations. First, the study design used relies heavily on reporting for RT-PCR testing. Thus, it may overestimate the benefit of vaccination if the vaccinated HCW, whether asymptomatic or having symptoms suggestive of Covid-19, were to believe that they were unlikely to have Covid-19 and decide not to report for testing. Second, since genomic sequencing of SARS-CoV-2 had not been done in our study participants, we were unable to assess the VE separately for the ancestral strain and variant strains of the virus. In conclusion, our data show that Covishield vaccination, either as one dose or in a 2-dose schedule, was effective in halving the frequency of Covid-19 disease among HCWs in a period when B.1.617.2 strain of SARS-CoV-2 was the dominant strain circulating in our area, and had an even greater effect on preventing a more severe and clinically relevant form of this disease.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260808: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260817: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several caveats to our results. First, we did not have explicit data on the level of virus introduction or the effects of lack of boosting on the duration of protection provided to infants by transplacentally-acquired antibodies to RSV. Although we explored a range of values, it is possible that the real values are outside of the range in our models. Our model predictions are most sensitive to the level of RSV introduction. Additional data on these factors will be helpful for future modeling of RSV transmission dynamics. Research on the relationship between virus exposure and the duration of transplacentally-acquired immunity in infants may also help to explain discrepancies in the efficacy of maternal vaccines across different transmission settings.50 Second, we used historical inpatient data to fit our transmission models. However, the intensity and seasonality of RSV epidemics may have changed over the past few years. To address this possibility, we explored a variety of intensity levels and both annual and biennial cycles with data from different states in our sensitivity analysis (see Figure S7-S16). Also, ongoing RSV surveillance data from California,51 Florida,52 Minnesota,53 Oregon,54 and Texas55 suggests that RSV activity has been very consistent over recent years. Finally, there are other possible factors influencing re-emergent RSV epidemics, such as the impact of introduction of RSV vaccines and monoclonal antibody.56 As the extended half-life antibody a...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260744: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the Ethics Committee of NCGM, Japan (the approved number: NCGM-A-004175).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also qualitatively measured the IgG against the SARS-CoV-2 nucleocapsid protein (Abbott ARCHITECT®; positive threshold: ≥1.40 [S/C]) to exclude those with previous undiagnosed SARS-CoV-2 infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260555: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Data collection and ethics approvals: Data were collected by 15 field teams and 3 lab teams.<br>Consent: An informed written individual consent was taken from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Thus, a total of around 100 households were sampled from every ward, including all consenting and available males and females aged ≥10 years from each household.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sampling procedure: About 30 wards were selected using a simple random sampling technique from the list of 150 wards in the GHMC area.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">However, the IgG antibody test results were shared with each individual for their information.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody titre assays and measurement: The samples were tested for total SARS-CoV-2 antibodies via electrochemiluminescence immunoassay using Elecsys Anti-SARS-Cov2 kit (Roche Cobas E411) based on a recombinant protein representing the nucleocapsid (N) antigen for antibody determination, as per manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>total SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-Cov2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analysed and visualised using SPSS v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">22 and ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:An important caveat to note is that antibody testing kits used in seroprevalence surveys aren’t very sensitive, nor are they all uniform and direct comparisons of results from different studies should be interpreted cautiously. We found gender-specific differences in seropositivity levels as also documented by some of the above-mentioned serosurveys in India. Females appear to generate better protective antibody responses than do males following vaccination against influenza, yellow fever, dengue, and several other viruses [11]. Differential exposure and susceptibility, and behavioural and immunological divergence between the genders have been cited to account for higher seroprevalence found in other surveys in the country. A recent review looking at global seroprevalence rates concluded that in most other countries, however, males had a slightly higher seropositivity than females, or there was no difference found between the genders [12]. Though we found no correlation with any known comorbidities some difference in seroprevalence was seen with smoking, which causes the upregulation of ACE-2 receptor [13]. Most of the survey subjects appeared to be asymptomatic for the known COVID-19 symptoms prevalent in the first wave of infections, and were likely unaware of their infected status. It is unclear whether genetic and/or environmental and behavioural differences contribute to any of the observed differences among individuals. Larger studies in these target groups are needed f...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21259093: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study protocol was approved by the public health emergency operational research review board of National Centre for Disease Control to initiate this analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed all the analysis using Microsoft Excel 2018 and Open Epi (an open-source epidemiologic statistics for public health) Version 3.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We faced limitations in our analysis with regard to the provisional nature of mortality data extracted from the Integrated Disease Surveillance Programme special surveillance portal up to November 16, 202 0. We tried to validate the mortality data with daily COVID 19 bulletins released by the states to ensure greater accuracy; some inconsistencies with the final mortality numbers cannot be ruled out. However, they are unlikely to impact the estimate and standardized mortality rates for comparison between the states and age groups.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260706: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: With the exclusion of the samples collected in March 2020, that were stored at -80°C immediately after the sampling, all samples were preserved at 4°C and analysed within 24 hours from the collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260679: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260579: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol for this research project was approved by the Ethics Committee of the institution, it conforms to the provision of the Declaration of Helsinki (Committee of the Association of EISEIKAI Medical and Healthcare Corporation Minamitama Hospital, Approval No. 2020-Ack-19) and written consent was obtained from all the participants.<br>Consent: The protocol for this research project was approved by the Ethics Committee of the institution, it conforms to the provision of the Declaration of Helsinki (Committee of the Association of EISEIKAI Medical and Healthcare Corporation Minamitama Hospital, Approval No. 2020-Ack-19) and written consent was obtained from all the participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical Analyses: A sample size of 475 participants was determined based upon 70% power, 0.05 significance level, 0.8 effect size, 37 allocation ration, and 20% attrition.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We obtained 5-ml blood samples from the intermediate cubital vein and calculated the anti-SARS-CoV-2 spike-specific antibody titer for each participant (Elecsys® Anti-SARS-CoV-2 S RUO, Roche Diagnostics K.K.) 1) before vaccination (baseline), 2) seven to twenty days after the first dose of the vaccination (first antibody test), and 3) seven to twenty days after the second dose of the vaccination (second antibody test).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with the Statistical Package for the Social Sciences, version 26.0 (SPSS, Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. First, we did not calculate the lymphocyte activity of either group, and we could not monitor the whole immune system response. Second, although we established a relatively large effect size and although the difference in antibody titer between the two groups was clear, we may have needed a large sample size to assess adverse reactions. Third, we only included relatively healthy medical workers, not participants with severe complications, and this may have reduced the differences between the prior COVID-19 infection group and the control group. In conclusion, our study showed that the antibody response to the first vaccination in the prior COVID-19 infection group was found to be comparable to that of the second vaccination in the non-COVID-19 infection group. On the other hand, the evaluation of adverse reactions is inadequate, and further large-scale studies are needed.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21259553: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260509: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted descriptive statistical analyses, estimating medians and proportions, using Excel spreadsheet software version 16.0 (Microsoft).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Study limitations include inability to account for the number of participants enrolled in vaccine trials per country, which was not systematically reported for all trials, and inability to account for the impact of manufacturing errors and safety concerns on dosage delivery, which particularly affected AstraZeneca and Janssen. As many lower-income countries continue to experience inequitable shortfalls in COVID-19 vaccine supply amid the ongoing pandemic, efforts must be undertaken to ensure timely access in countries across all income groups, including those hosting clinical trials.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260732: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260123: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study and all experimental procedures were analyzed and approved by ethical committee of School of Medicine of Anhembi Morumbi University (4.637.625 in 08 of April of 2021) and were carried out in accordance with Declaration of Helsinki for ethical principles for medical research involving human subjects.<br>Consent: The written consent inform was obtained from the patient volunteer for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">BEAS-2B and MRC-5 cells were obtained from Rio de Janeiro Cell Bank and co-cultured in DMEM high glucose medium (Sigma Chemical Co., St. Louis, MO, USA) supplemented with 10% fetal calf serum in 500ul of whole blood of Sars-Cov-2 infected male (35-40) years old patient (original Wuhan Sars-Cov-2), presenting an estimated high viral load based on the cycle threshold (CT = 15).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BEAS-2B and MRC-5 cells were obtained from Rio de Janeiro Cell Bank and co-cultured in DMEM high glucose medium (Sigma Chemical Co., St. Louis, MO, USA) supplemented with 10% fetal calf serum in 500ul of whole blood of Sars-Cov-2 infected male (35-40) years old patient (original Wuhan Sars-Cov-2), presenting an estimated high viral load based on the cycle threshold (CT = 15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both BEAS-2B and MRC-5 cells were co-cultured at a concentration of 5×104/mL/well in 48 wells plate, at a humidified atmosphere in a CO2 incubator (5% CO2, 37°C) [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260406: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260464: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260718: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260754: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All analyses were performed with GraphPad Prism 9.1.1 (GraphPad Software, Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has some limitations. The most appropriate VR value to be used as the threshold requires further evaluation. This study only used data up to day 6 of respiratory support. Data were not available after day 7 because a large number of patients were withdrawn from respiratory support at the time. Finally, we cannot rule out the possibility of selection bias because we included only a small number of patients collected at a single institution.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260648: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: All sequences have been validated, and their use is a typical procedure to detect respiratory viruses from the World Health Organization (WHO).</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HRV and IBV detection was performed by RT-PCR final point using specific primers, the retrotranscription step was made using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientifics) and PCR was using GoTaq® DNA polymerase (Promega), the genome of HRV was visualized in agarose – Seakem LE Agarose (LONZA) at 2% applying a voltage of 80 Volts for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientifics</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260782: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also adjusted for several time-varying, self-reported covariates: receiving Supplemental Nutrition Assistance Program (SNAP) benefits in the month prior to the survey, receiving unemployment insurance past 14 days, and employment status at the time of the survey.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nutrition Assistance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As with all observational analyses, our study has clear limitations. First, measurements of both the distress and vaccination rely on self-report, which may be biased. Second, the web-based sample may not be truly representative of the US population and individuals from underrepresented racial and ethnic groups. Third, our analysis was designed to capture only the direct effect of an individual becoming vaccinated on their own mental health. However, vaccination is likely to have myriad positive spillover effects on mental health that are not captured in this study. Mental health may improve as friends and family become vaccinated, as the economy rebounds, as community prevalence of virus falls, and as fewer people suffer major illness or death. The respondents in the UCA study likely benefited from vaccine scale-up beyond their own vaccination status. Additionally, their getting vaccinated likely benefited other peoples’ mental health. As a result, our findings likely substantially underestimate the beneficial effect of vaccination for mental health at the population level. Notwithstanding these limitations, our study has several key strengths. First, to our knowledge, this is the first study to assess the psychological impacts of COVID-19 vaccination. Second, our main findings are robust to time-varying controls, individual and wave fixed effects, and several alternative modelling strategies. Importantly, our analyses were robust to state-by-wave fixed effects, ruling out c...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260316: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The Department of Occupational Medicine collected the HCW samples after informed consent.<br>IRB: Ethics: The study was approved by the ethics committee of Albert-Ludwigs University Freiburg (#20-1271</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2 antibodies: We used the following SARS-CoV-2 immunoglobuline G (IgG) assays to rule out past infection in the no COVID-19 and in the vaccine cohorts: Anti-SARS-CoV-2 ELISA IgG, detecting IgG antibodies against S1 (EUROIMMUN, Lübeck,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA IgG, detecting IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Germany); recomWell SARS-CoV-2 IgG detecting IgG antibodies against the nucleoprotein (N) (Mikrogen, Munich,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG detecting IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Germany); ADVIA Centaur SARS-CoV-2 total antibody (COV2T) assay, detecting total antibodies against S1-RBD (Siemens, Munich, Germany); and the Elecsys Anti-SARS-CoV-2, detecting total antibodies against N (Roche, Mannheim, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 , detecting total antibodies against N ( Roche , Mannheim , Germany)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analysed using IBM SPSS Statistics version 24 software (www.ibm.com/spss/statistics),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism version 9 (www.graphpad.com), and MedCalc version 19 (www.medcalc.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitation for the use of such a biological assay is the functionality of the T-cell response. Even low-dose steroid treatment may interfere with IGRA testing, as has been shown for Quantiferon TB in immunocompetent children (34). We have seen in one of our patients that even short-term steroid treatment may be of relevance. The patient yielded a negative mitogen control and a negative response to SARS-CoV-2 antigen (46 and 15 mIU/ml) three weeks after vector/mRNA heterologous vaccination, but SARS-CoV-2 S1-IgG was detectable. She was on high dose steroids when blood was drawn, but not during vaccination. After stopping steroid treatment, we repeated the assay and detected 985 mIU/ml after antigen stimulation with high positive mitogen control (1880 mIU/ml). Further, the interpretation of grey-zone results is always difficult, so we developed a double cut-off strategy including BLANK results in result interpretation. Diagnostic test accuracy analysis showed best accuracy with similar negative predictive values using our adopted cut-off strategy. In conclusion, the EUROIMMUN IGRA is an easy to perform assay for the detection of specific T-cell response against SARS-CoV-2 spike antigen. The assay is highly specific and sensitive. During a performance evaluation of the assay we were able to show that patients on immunosuppressive regimens may have isolated T-cell or antibody response or in several cases do not respond at all. For clinical practice, we recommend asking for steroi...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260776: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Children (less than 18 years old) and pregnant women (confirmed by a positive beta-HCG test and/or medical records) were excluded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data not available within WC-CEDAR were manually extracted and recorded in REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each metabolite and protein was annotated with pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database(35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A Gaussian Graphical Model (GGM) based network was then constructed using the GeneNet algorithm(39) and drawing an edge for all partial correlations with an FDR smaller than 0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneNet</div><div>suggested: (GeneNet, RRID:SCR_007678)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260618: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The serum samples were collected and followed by protocol SDP-003, Human Biological Specimens Collection, data September<br>IRB: 22, 2017 and the qualifications of Principle Investigator (Robert Pyrtle, M.D.) were reviewed and approved by Diagnostics Investigational Review Board (Cummaquid, Massachusetts, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, horseradish peroxidase (HRP)-tagged anti-human antibodies (Abcam, Cambridge, UK), diluted 1:10,000 in blocking buffer, were added to the wells (100 μL/well), and the plate was incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies ( Abcam , Cambridge , UK) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The electrochemiluminescence immunoassay (ECLIA) (i.e., Roche Elecsys Anti-SARS-CoV-2 S assay) was used for the detection of antibodies against the RBD of S protein; <0.80 U/mL was considered negative and ≥0.80 U/mL was considered positive for anti-SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S protein .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and virus: African green monkey kidney (Vero E6) cells (CRL-1586) were purchased from the American Type Culture Collection (ATCC, Bethesda, MD, USA) and maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco) at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum samples were collected and followed by protocol SDP-003, Human Biological Specimens Collection, data September</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Biological</div><div>suggested: ( Human Biological Data Interchange , RRID:SCR_004591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometric mean titers (GMTs) were calculated with 95% confidence intervals (CIs) using GraphPad Prism version 8 (GraphPad Software, Inc., CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism version 8 (GraphPad Software, Inc., CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260758: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260558: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For this analysis, we used data from two sub-samples of survey respondents: women and people with a cervix aged 25-64 years (eligible for cervical screening) and people aged 60-74 years in England, Wales and Northern Ireland and age 50-74 in Scotland (eligible for CRC screening).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Study limitations and strengths: We recruited a large sample from across the UK and weighted data to be representative of the UK for age, gender, ethnicity and region. The data are cross-sectional, and caution must be exercised when interpreting the results. In addition, participants’ self-reported intentions might not translate into behaviour (30), although we used ‘yes, definitely’ to indicate positive intention which has demonstrated a strong association with screening behaviour (18). Intention to complete CRC screening was higher than population-level uptake, and may also reflect the high number of HealthWise Wales participants in the CRC cohort, who may be more health-motivated than the general population. (31) Sample selection bias may also explain high overall screening intentions, with limited power to detect the effects of factors expected to be associated with screening intentions such as education and ethnicity. Interview participants were sampled based on symptom experience (the primary study outcome), hence some were not eligible for screening and their responses were therefore hypothetical. Implications: The finding that past screening non-attendance was associated with lower future screening intention is not new, but it underlines the continued importance of interventions to reduce COVID and non-COVID screening barriers among non-participants, including women who have not attended cervical screening for COVID-related reasons. During August and September 2020 a ...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN17782018</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260869: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260971: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participants: This project was approved by the USA university Institutional Review Board on March 30, 2020.<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">This sample size was sufficient for evaluating up to 10 predictors in a regression analyses with adequate power.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are limitations in this study that merit discussion. MTurk workers may have characteristics that differ from other samples of individuals. Chandler and Shapiro (2016) reported that MTurk samples can be more representative of the USA population relative to convenience samples but less representative than probability samples used in epidemiological research. However, Chandler and Shapiro (2016) also pointed out that national probability can be biased because they rely on telephone methods that can over sample older and more conservative participants. There are some strengths to MTurk samples. During the COVID-19 lockdown, online data gathering was the only way to gather complex survey data from diverse populations from broad geographic locations. Additionally, we adopted “best practices” by screening for response quality, using attention checks, and making sure that signaling cues were not in the surveys (Ophir, et al., 2019; Cheung et al., 2017). A total of 450 persons completed the Time 1 survey and 151 (34%) completed the Time 2 survey. The 34% completion rate for this study is consistent with other MTurk research. Auer et al., (2021) conducted a study examining retention levels for MTurk workers across a 30-day interval using a 30-minute survey (which is similar in length to the survey used in this study). With $1.00 compensation for completing each survey (which is equal to our payments), they observed a 35% retention rate. We argue that mindfulness may promote less ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.453244: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supplementary data and gene expression datasets were also downloaded from the Journal publisher’s websites, Immgen browsers, and Signaling Pathway Project.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Signaling Pathway Project</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interactions were visualized in the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (30)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene ontology (GO), signaling and transcription factor analysis was done in KEGG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Metascape and TRANSFAC databases, respectively (31–33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453079: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.452858: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: In vivo hamster challenge model of infection: All animal studies were performed at ViroClinics Xplore, Schaijk, The Netherlands and conducted according to European Union Directive 2010/63/EU and the standards of Dutch law for animal experimentation.<br>Euthanasia Agents: On day 4 post-challenge all animals were euthanized by abdominal exsanguination under isoflurane anesthesia (3-5%).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, groups of five specific pathogen free (SPF) male Syrian golden hamsters (Mesocricetus auratus) aged 9 to 10 weeks at the start of the experiment were randomly assigned to experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, groups of five specific pathogen free (SPF) male Syrian golden hamsters (Mesocricetus auratus) aged 9 to 10 weeks at the start of the experiment were randomly assigned to experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">while full-length human IgG1 antibodies designated for in vitro neutralization and animal studies were produced in transiently transfected and/or stable CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Depletion panning with human ACE2- or CR3022-bound spike (where CR3022 represents an anti-SARS-CoV-1 antibody from the literature with cross-reactivity to SARS-CoV-223, 27) and irrelevant non-target proteins were performed to steer towards binders to specific epitopes and increase target specificity by reducing off-target reactivity, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-223</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBS-T, appropriate HRP-conjugated secondary antibody (anti-M13 and goat-anti-human-IgG for detection of phages and full size hIgG1, repsectively) was added and incubated for 60 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK293-EBNA1 cells were transiently transfected with pUPE expression vectors containing recombinant protein encoding, codon-optimized synthetic genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-EBNA1</div><div>suggested: ATCC Cat# CRL-10852, RRID:CVCL_6974)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies, expressed either as human IgG1-Fab and full-length human IgG1, destined for (initial) in vitro binding experiments were produced following transient transfection of HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">while full-length human IgG1 antibodies designated for in vitro neutralization and animal studies were produced in transiently transfected and/or stable CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To induce expression of spike trimers in a cell context, HEK293F cells were transiently transfected using FectoPRO per the manufacturer specification (PolyPlus Transfection, Illkirch, France) with SARS-CoV-2 surface glycoprotein expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the SARS-CoV-2 Spike protein was cloned into the pCAGGS expression vector system and transfected into HEK-293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 monolayers are washed and incubated for 5 or 6 days at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fragments were ligated into the pHENIX-His8-VSV vector and transformed into Escherichia coli TG1 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHENIX-His8-VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the SARS-CoV-2 Spike protein was cloned into the pCAGGS expression vector system and transfected into HEK-293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Library panning: The phage display libraries employed here were previously generated by ImmunoPrecise Antibodies (Naïve Human Library #0899</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Library</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat maps were curated manually in Excel by merging the results from different experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values were calculated in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453127: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The Tulane University Institutional Biosafety Committee approved the procedures for sample handling, inactivation, and removal from BSL3 containment.<br>Field Sample Permit: Preparation and Characteristics of K777: For the studies conducted at TNPRC, K777 ((4-methylpiperazine-1-carboxylic acid[1-(3benzenesulfonyl-1-phenethyl-allylcarbamoyl)-2phenylethyl]amide) hydrochloride) was supplied by Selva Therapeutics as dry powder stored at room temperature under desiccant.<br>Euthanasia Agents: Euthanasia occurred following terminal blood collection in deeply anesthetized animals via intracardiac inoculation with sodium pentobarbital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">K777 Pharmacokinetics in cynomolgus monkey: Two male and two female cynomolgus monkeys (2.3 - 3.9 kg) from the Sierra Biomedical colony received 200 mg/kg K777 daily for 7 days by nasogastric gavage (10 mL/kg) in a pilot study to evaluate the toxicity and pharmacokinetics in non-human primates (SRI Study No. M158-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stock was prepared in Vero E6 cells and sequence confirmed by deep sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study conducted in cynomolgus monkeys was performed at Sierra Biomedical, a division of Charles River Laboratories, Inc. (Sparks, Nevada) according to an IACUC reviewed protocol and standard operating procedures of the laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K777 Treatment in Experimental AGM Model: Wild-caught African green monkeys (Chlorocebus aethiops) were quarantined at the TNPRC and were screened for SIV, STLV 1, SRV, and B virus (Macacine alphaherpesvirus 1) prior to transfer to a Biosafety Level 3 facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TNPRC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Graphical analyses were performed with GraphPad Prism software, version 9 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04843787</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SLV213 Treatment in COVID-19 Patients</td></tr></table>
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.453140: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vectors encoding for all S proteins were transiently transfected into HEK293 Freestyle (HEK293F) cells with polyethylenimine (PEI, linear, 25 kDa, Polysciences, USA) at a ratio of DNA: PEI = 1:2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA sequence corresponding to residues 1-1208 of the S protein was subcloned from the full-length S sequence, appended with the T4 fibritin foldon sequence at the C-terminus, followed by a c-Myc sequence and a hexahistidine (His6) tag, and inserted into the mammalian expression vector pcDNA3.4-TOPO (Invitrogen, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4-TOPO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The buffer viscosity (η) was set to 0.8945 cP at 25 °C based on the theoretical estimate using SEDNTERP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SEDNTERP</div><div>suggested: (Sednterp, RRID:SCR_016253)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Those parameters were applied in ASTRA 6.0 software (Wyatt Technology, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ASTRA</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453054: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Animal experiment and ethics: The alpaca immunization procedures were conducted in conformity with the institutional guidance for the care and use of laboratory animals, and the protocols were approved by the Institutional Committee of Ethics and Research of the Central Laboratory at Xinyang Agricultural and Forestry University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The resulted emulsion was injected by the subcutaneous route at ten sites near the bow lymph node in the neck base of an adult female alpaca (3-years old).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was then blocked by 0.5 %(w/v) BSA in TBS buffer for 30 min at RT and washed three times using TBS before incubated with anti-Myc antibodies at 1:2,000 dilution in TBS-BSA-T buffer (TBS supplemented with 0.5 %(w/v) BSA and 0.05 %(v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For simultaneous binding of DL28 and monoclonal antibodies (REGN10933, CV30, CB6, all in the IgG form) with RBD, the biotinylated RBD was coated as mentioned above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV30</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - Spike (S): The polypeptide containing, from N- to C-terminus, residues Met1 – Gln1208 (without the C-terminal transmembrane helix, Uniprot P0DTC2) of the SARS-CoV-2 S with mutations K986P/V987P, a GSAS linker substituting the furin sites (Arg682- Arg685), a C-terminal T4 fibritin trimerization motif (GYIPEAPRDGQAYVRKDGEWVLLSTFL), a TEV protease cleavage site, a FLAG tag and a polyhistidine tag 5 was encoded in a pCDNA3.1 backbone vector and overexpressed in Expi293 cells by transient transfection using polyethylenimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Retroviral pseudotyped particles were generated by co-transfection of HEK293T cells using polyethylenimine with the expression vectors encoding the various viral envelope glycoproteins, the Murine leukemia virus core/packaging components (MLV Gag-Pol), and a retroviral transfer vector harboring the gene encoding the green fluorescent protein (GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-hACE2 cells (104 cells/well) were seeded into a 48-well plate and infected 24 h later with 100 μL of virus supernatant in a final volume of 150 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - Spike (S): The polypeptide containing, from N- to C-terminus, residues Met1 – Gln1208 (without the C-terminal transmembrane helix, Uniprot P0DTC2) of the SARS-CoV-2 S with mutations K986P/V987P, a GSAS linker substituting the furin sites (Arg682- Arg685), a C-terminal T4 fibritin trimerization motif (GYIPEAPRDGQAYVRKDGEWVLLSTFL), a TEV protease cleavage site, a FLAG tag and a polyhistidine tag 5 was encoded in a pCDNA3.1 backbone vector and overexpressed in Expi293 cells by transient transfection using polyethylenimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - RBD: The polypeptide containing, from N- to C-terminus, the honey bee melittin signal peptide (KFLVNVALVFMVVYISYIYAA), a Gly-Ser linker, residues 330-531 of the SARS-CoV-2 S, a Gly-Thr linker, the 3C protease site (LEVLFQGP), a Gly-Ser linker, the Avi tag (GLNDIFEAQKIEWHE), a Ser-Gly linker, and a deca-His tag was encoded in a pFastBac-backbone vector for overexpression in Trichoplusia ni High Five suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac-backbone</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, cells carrying nanobody-encoding pSb-init plasmids 46 were grown in Terrific Broth (TB, 0.17 M KH2PO4 and 0.72 M K2HPO4, 1.2 %(w/v) tryptone, 2.4 %(w/v) yeast extract, 0.5% (v/v) glycerol) supplemented with 25 mg L-1 chloramphenicol at 37 °C with shaking at 200 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSb-init</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One microgram of the PCR product and 10 μg of the pDX_init vector 46 were digested separately with 50 units of BspQI (Cat. R0712L, New England Biolabs) for 1.5 h at 50 °C before heat inactivation at 80 °C for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDX_init</div><div>suggested: RRID:Addgene_132697)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The particles were eluted, and the phagemid was sub-cloned into pSb_init vector by fragment-exchange (FX) cloning and transformed into E. coli MC1061 cells for periplasmic expression and screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSb_init</div><div>suggested: RRID:Addgene_159422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotypes for the Alpha (B1.1.7) and Beta (B1.351) variants were generated by incorporating the corresponding Spike mutations into the phCMV-SARS- CoV-2 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was built with 2Fo-Fc maps in Coot 51, and refined using Phenix 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structures were visualized using PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay using SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.452903: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453011: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.17.452778: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BLOSUM62 local-global alignment scores (local or global would produce the same score for a pairwise alignment of lengths N vs N) were computed using the pairwiseAlignment function from the R package Biostrings, with high gap penalties (opening and extension of both 100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biostrings</div><div>suggested: (Biostrings, RRID:SCR_016949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gathering human proteome sequence: The human proteome was downloaded in fasta format from UniProt</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphs were exported from iGraph into Cytoscape v3.82 using the R function createNetworkFromIgraph from package RCy3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From cytoscape, all graphs were exported as .graphml files and read into Gephi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gephi</div><div>suggested: (Gephi, RRID:SCR_004293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python code for the IEDB tool to compute the population coverage was downloaded from http://tools.iedb.org/population/download on 24-11-20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There is conflicting evidence surrounding the existence of memory SARS-CoV-2 cross-reactive CD8+ T cells in unexposed individuals15,16,40, and a limitation of our work is that we could not to provide a direct link to pre-existing immunity, because from healthy donors the MIRA dataset only evaluated expanded naïve T cells and did not examine anti-viral efficacy of the responding T cells. Indeed, although we cannot determine the cause or timeframe of this selection of sCoV-2-HCoV peptides in this subset of individuals, the potential implications are interesting. It is plausible that these patients may exhibit more robust protection against SARS-CoV-2 variants, HCoVs or even future emerging coronavirus strains. Future work should explore any immunity benefit of infection-induced cross-reactive T cell responses, and in addition, it will be interesting to examine whether vaccination against SARS-CoV-2 can induce T cell memory that is cross-reactive with SARS-CoV-2 variants and/or wider coronaviruses in such individuals. Furthermore, by our identification of a set of 10 potentially cross-reactive peptides with broad population coverage, it is possible that these peptides could be employed to test which patients exhibit cross-reactive phenotypes e.g., after vaccination with relevant antigens. More broadly, data are beginning to demonstrate distinct vaccine-induced responses linked to differential patient exposure to SARS-CoV-2 3,4. In turn, it is possible that COVID-19 vaccine boost...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453027: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.19.452809: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested negative for mycoplasma.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies used in this study: Rabbit anti-GATA6 (Abcam ab175349), hyperimmune Rabbit serum from intervenous (i.v) SARS-CoV-2 infected Rabbits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GATA6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody used was IRDye® 800CW conjugated Goat anti-Rabbit (Licor).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T (ATCC-CRL-3216), Vero-E6 (ATCC-CRL-1586) and Calu-3 cells (ATCC-HTB-55) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) with 10% heat-inactivated fetal bovine serum (FBS), 10 mM non-essential amino acids (NEAA), 2 mM L-Glutamine, 1 mM Sodium pyruvate and 1% Penicillin/Streptomycin (all from Biological Industries, Israel) at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome-wide CRISPR screens: To generate CRISPR KO libraries, a total of 4*108 Calu-3 cells were transduced with lentivirus of human Brunello Human CRISPR library (Addgene #73179, gift from David Root and John Doench) in the presence of 0.5 mg/ml polybrene (TR-1003, Sigma), at a MOI of 0.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titration: Vero-E6 cells were seeded in 12-well plates (5 × 105 cells/well) and grown overnight in growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of GATA6 expression in different cell lines: Published mRNA-seq data used for A549, Vero-E6 and Calu-3 cells are from Kinori et al. 2016, Finkel et al. 2021a and Finkel et al. 2021b., respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Calu-3 KO cell lines: DNA oligos (Integrated DNA Technologies, Inc.) containing sgRNA sequences (see supplementary Table S1) were annealed and ligated into lentiCRISPRv2 (Addgene, #52961, gift from Feng Zhang).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>lentiCRISPRv2</div><div>suggested: RRID:Addgene_98292)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was packaged by co-transfection of constructs with the 2nd generation packaging plasmids pMD2.G and PsPax using jetPEI (Polyplus-transfection) into 6-well plates with HEK293T cells according to protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For GATA6 complementation experiment, cells were complemented by transfection of 2.5 μg pBabe 3XFLAG-wt GATA6-3XAU1 puro vector (Addgene #72607) using Lipofectamine 3000 (L3000015 ThermoFisher) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBabe 3XFLAG-wt GATA6-3XAU1 puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with 3 μg pBabe 3XFLAG-wt-GATA6-3AU1 puro plasmid (Addgene #76207) using Lipofectamine 3000 (L3000015 ThermoFisher) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBabe 3XFLAG-wt-GATA6-3AU1 puro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours prior to infection with SARS-CoV-2, 1.5*107 Calu-3 library-cells were seeded in 75-cm2 flasks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of CRISPR-Cas9 genetic screen data: MAGeCK v0.5.6 [73] was used to count sgRNA from FASTQ files and to analyze the selection effect of genes based on the change in sgRNA distribution, using the robust rank aggregation (RRA) algorithm with normalization to total reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAGeCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathway and network analysis: Directed scores were used as input for gene set enrichment analysis (GSEA version 4.1) with GO biological process (c5.bp) from MSigDB (version 7.4) [74, 75].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The STRING network was imported into Cytoscape [76].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes were highlighted based on association with selected REACTOME pathways.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REACTOME</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21259725: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study received ethical approval from the institutional review board (SWUEC119/2563F).<br>Consent: Informed consent was obtained from the participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 290 participants were expected; i) 230 patients and pregnant women visiting the hospital for either an emergency medical procedure or an elective unpostponable surgery including vaginal delivery, cesarean section, uterine curettage for miscarriage, and exploratory laparotomy, ii) 60 medical personnel, comprising physicians, nursing staffs, technicians, in the department.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The RT-PCR tests were analyzed by a molecular pathologist (WJ) who was blinded from the rapid test results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In the pandemic, the RT-PCR is suggested with limitations regarding access and duration of the result as previously described. The rapid test could guide the management concerning the prioritization of PPE equipment and facilities, i.e., negative pressure theatre or cohort ward, which shall be limited during the pandemic. However, the rapid antibody test should be interpreted with caution also due to the odds of false-negative results especially during the early clinical course [5, 13]. In our current practice, we perform both rapid antibody test and RT-PCR in symptomatic patients (fever, URI symptoms) at admission for a patient who requires an urgent/emergency procedure including childbirth delivery. The research also studied the seroprevalence of SARS-Cov-2 antibodies among the medical personnel, who were considered healthy and active, thus possess a risk to become a ‘silence spreader’. We included 74.07% of all staff in the department. All frontline people including residents, interns, nursing staff, and technicians participated in the study. While only 10% of consultants took part in the study. The Thai government also considers healthcare workers with URI symptoms as one of the PUI criteria. In the current study cohort, 21.6% (12/60) were at risk for COVID-19 infection. About half of these high risk were symptomatic (6/20) while the others were either indirectly contacting the COVID-19 patient or recently traveling to the high-risk area. Contracting the disease from outs...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260890: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We evaluated the Spike protein against ACE2 protein and four types of antibodies anti-Spike extracted from CoV-AbDab database [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human antibodies were selected based on their preferences for distinct binding locations in Spike: subunits S1, S2, S1-S2, S1-RBD, and S1-notRBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1-notRBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the Symmetric trait substitution model with the Bayesian Stochastic Search Variable Selection approach for rate estimation in BEAST 1.10.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned these sequences to the WH01 genome using MAFFT 7.475 with --auto and --addfragments options and trimmed the 3’ and 5’ untranslated regions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stability analysis was performed using the Stability function from FoldX tool [23]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FoldX</div><div>suggested: (FoldX, RRID:SCR_008522)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualization and structure manipulation was conducted using PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:To overcome the limitation in the number of sequences available for the state, we generated 1,927 novel SARS-CoV-2 genomes sequenced biweekly between March and June 2021, sampled from residents of 91 out of the 92 cities of Rio de Janeiro. These sequences represent ∼50% of the genomes publicly available in GISAID from the state so far, notably reaching a sequencing ratio of ∼1:100 cases reported during April and May 2021. We then analyzed lineage dynamics in Rio de Janeiro as well as the emergence and dispersion of new variants. Three main phases defined the pandemic in the state of Rio de Janeiro, each of them represented by a different lineage. Remarkably, all phases occurred with distinct patterns of transmissibility and mortality. Whereas the daily number of cases increased during the second and third phase, more people died in the first and third ones. We hypothesized that lack of knowledge about the disease and resources to treat patients in early pandemic may explain such severity in the first phase [30–32]. After almost a year of pandemic, a significant amount of information had been already gathered about the virus and the disease, certainly improving patient care. We have observed a switch in the death profiles over the course of pandemic, while deaths were more restricted to old groups and people with comorbidities in the first phase, a substantial increase of young people was reported at the third wave. Prioritizing the vaccination of elderly people might have had...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260926: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Confidence intervals for the changes in prevalence were calculated using a normal approximation to the sampling distribution of a difference in prevalences.[12] Data were analysed using the statistical package R version 4.0.0.[13] We obtained research ethics approval from the South Central-Berkshire B Research Ethics Committee (IRAS ID: 283787), and Medicines and Healthcare products Regulatory Agency approval for use of the LFIA for research purposes only.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">8] Briefly, we included non-overlapping community samples from the adult population 18 years and older, using a self-administered questionnaire and LFIA test at home (Table 1).[6,8] Invitations were sent to named individuals randomly selected from the National Health Service (NHS) patient list which includes anyone registered with a General Practitioner (primary care physician) in England, covering almost the entire population.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sensitivity of finger-prick blood (self-read) for IgG antibodies was 84.4% (70.5, 93.5) in RT-PCR confirmed cases in healthcare workers, and specificity 98.6% (97.1, 99.4) in pre-pandemic sera.[</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has limitations. Participation bias may have been introduced from the lower response from ethnic minority groups and people in more deprived areas. Therefore, it is possible that our study is not fully representative of the population of England. However, we attempted to minimise this by correcting for differential response rates and differences in population characteristics introduced by our sampling strategy. An important limitation was the exclusion of children for regulatory reasons as the LFIA was approved for research use in adults only. Given that the highest antibody prevalence and increases were observed in students and younger adults, not sampling children, in particular those of secondary school-age, means that we were unable to better understand infection risk factors in the youngest age groups. We used at-home self-adminitered LFIAs which despite being a cost-effective solution to conducting large-scale surveillance studies are generally less sensitive than laboratory assays.[9] However, our comprehensive laboratory evaluation and usability studies of the selected LFIA found it’s performance to be acceptable, in terms of sensitivity and specificity in comparision to a “gold standard” ELISA test,[9] and feasible to use at-home by members of the public, in terms of usability of the LFIA kit and achieving a valid test result.[15] In summary, although we observed a significant decline in the SARS-CoV-2 antibody prevalence in the adult population in England ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.22.453287: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following day cells were stimulated in X-VIVO 15 media with 5% male human AB serum containing ~1 nmol of peptide pool corresponding of SARS-CoV-2 Prot S of US-WA (wild-type), Gamma (P.1./B1.1.28) and Delta (B.1.617.2) variants or positive control anti-CD3 mAb CD3-2 from or blank media as negative control.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Stocks of SARS-CoV-2 were generated as a single passage from received stock vial (USA-WA1/2020 and P.1.) or primary culture (B.1.595) on mycoplasma negative Vero cells (ATCC #CCL-81) at a MOI of 0.005 for 48 h.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AZ-E484Q, a B.1.595 virus (GISAID: EPI_ISL_765942) was grown from a nasopharyngeal swab on Calu-3 cells for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stocks of SARS-CoV-2 were generated as a single passage from received stock vial (USA-WA1/2020 and P.1.) or primary culture (B.1.595) on mycoplasma negative Vero cells (ATCC #CCL-81) at a MOI of 0.005 for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CCL-81, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood for peripheral blood mononuclear cells (PBMCs) and plasma was collected in BD Vacutainer with sodium heparin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Vacutainer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Area under the curve (AUC) values were calculated using R version 4.0.3 (R Core Team, 2020) and the DescTools package (Signorelli, 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DescTools</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired using a Cytek Aurora cytometer (Cytek) and analyzed by FlowJo software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: SPSS and Graph Pad Prism were used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The only limitation of ELISpot, as compared to flow cytometry based enumeration, is that total T cell responses are measured without separate quantification of CD4 and CD8 responses. We also analyzed Ag-specific T cell responses to stimulation with Spike protein peptide pools from WA1 versus two variants of concern by ELISpot. Participant PBMC’s were stimulated with 16-mer overlapping peptide pools corresponding to the spike protein of WA1, P.1. (Gamma) and B.1.617.2 (Delta). In accordance with previously published results (Sahin et al., 2020), mRNA vaccines induced a robust T cell response to WA1, an early 2020 virus, which did not differ for Gamma and Delta variants, as evidenced by a 10-fold increase in ELISpots from post-vaccination samples stimulated by S peptide pools compared to unstimulated wells (Figure 4A). Next, we analyzed T cell responses of both groups at different time points. Given that some samples had high responses in the unstimulated wells we subtracted the number of ELISpots from the unstimulated well to calculate the number of Ag-specific ELISpots for each time point. Data from aged mice (Brien et al., 2009; Fulton et al., 2013; Jergović et al., 2019) showed that induction of Ag-specific T cell responses becomes delayed and decreased with age. In our data, there was a slightly lower response in the older cohort at day 7 post first dose with all three variants but it was not statistically significant (Figure 4B). However, after a second (booster) dose bot...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 17, 20 and 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260853: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: After approval from the local ethics committee (no. 20-1065), initially 13 professional singers were included (11 from the Bavarian Radio Chorus,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">185 Hz) for the male and F#4 (fo approx.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The liquid was nebulized using a Lynden Vox e-cigarette (Lynden GmbH, Dürmentingen, Germany) and the amount of gas inhaled was controlled using a ZAN 100 spirometer (ZAN, Inspire Healthcare, Oberthulba, Germany) mounted on the e-cigarette.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Inspire Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This computation of curve smoothing was performed in Matlab (The Mathworks Inc., Natick, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:For most singers, however, the associated limitations concerning inhalation, articulation etc. were so weighty that a singing performance with any of the tested mask models appeared not desirable. A particular problem was the self-auditory perception. In this respect, some masks, especially when surrounding the auricles (Qatar Mask), strongly influenced the perception of the own voice. Therefore, the specific acoustic alteration due to the tested masks should be analyzed in future investigations. There were many limitations associated with the presented investigation. First, it appears important that the analyzed data only present the primary impulse dispersion by singing and refer to artificially introduced aerosols that do not reflect the real number of potentially virus-laden particles. Consequently, an analysis on the absolute aerosol reduction by the tested masks cannot be offered here. Next, only professional singers have been included. However, a potentially different behavior in amateur singers could not be excluded. Further, it could be speculated that on opera stages the exaggerated articulation could lead to different dispersion patterns, as well as the influence of greater movement activities on the masks and the aerosol clouds. Additionally, the data only refers to a part of a classical masterpiece. Different data when singing other styles or other languages cannot be excluded. Especially Musical Theater singing could lead to observable changes due to its practic...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260905: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of E_Sarbecco and RdRp assays was performed through calibration curves using 10-fold dilutions of nCoV-ALL-Control plasmid (Eurofins Genomics, Germany), ranging from 1.94 to 1.94 × 106 and 1.00 to 1.00 × 106 GC per reaction respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nCoV-ALL-Control</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: All data analysis was done with SPSS version 26 (IBM Corporation, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260691: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (reference No. R2-079 and R3-006).<br>Consent: Participants provided informed consent by completing a form on the survey website.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of the 27,036 remaining participants, data from 9,510 (5392 males and 4118 females) who stated they needed regular treatment or hospital visits were analyzed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata (Stata Statistical Software: Release 16; StataCorp LLC, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, this study also had several limitations. First, because we conducted a cross-sectional study, causality could not be determined. However, since it is theoretically unlikely that treatment interruption experienced by an individual will increase the COVID-19 infection rate in a region, we think it is likely that high regional infection rates cause treatment interruption. Second, we did not identify workers’ reasons for discontinuing treatment in this study. As discussed above, there are various possible causes of treatment interruption, which may vary by region. Third, we did not inquire about the diseases being treated. Treatment interruption may vary depending on the presence or absence of symptoms and the potential disadvantages of discontinuing treatment for a particular disease.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260559: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Detailed eligibility criteria, human subjects protection, and written consent have been reported previously17 and are given in the supplementary appendix.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Design and Treatments: As previously described, this randomized placebo controlled study compared bamlanivimab (7000mg) with placebo, administered as a single intravenous infusion over a 1-hour period12,17.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All other site personnel, and study participants, were blinded to treatment assignment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma samples collected at study entry and at days 1, 3 and 5 were used to measure anti-spike receptor binding domain (RBD) neutralizing antibodies (nAbs) in a surrogate viral neutralization test, and anti-nucleocapsid (anti-N) binding antibody levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike receptor binding domain (RBD) neutralizing antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SAS version 9.4 (SAS Institute, Cary, NC) and R version 4.0 (R Foundation for Statistical Computing)18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04501978</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ACTIV-3: Therapeutics for Inpatients With COVID-19</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260714: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data files from 2000 onwards were loaded and processed using Python</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:4.4 Limitations: This study relied strongly on reporting from VAERS. As all studies that utilise passive reporting data, it is limited by the biases inherent in reporting itself. These biases, by definition, are imperfectly understood.[20–22] Underreporting, in which an adverse effect is not reported, is a frequent confounder, as is overreporting, where the same event is reported multiple times, often due to an innocent lack of communication (e.g. the parent of a vaccinated child makes a report, unsure whether the physician will also make a report). To some extent, underreporting is mitigated for the mRNA-based vaccines currently approved. Both mRNA vaccines are administered under Emergency Use Authorizations that mandate reporting to VAERS of any serious adverse effects, whereas such mandatory reporting is typically only applicable for other vaccines if they fall within the scope ratione materiae of the National Childhood Vaccine Injury Act’s mandatory reporting provisions. Since anaphylaxis almost always necessitates treatment, frequently results in hospitalisation and is considered a serious, indeed life-threatening, medical emergency by providers, it is very likely that the rate of underreporting is quite low. Because non-mRNA vaccines, except for the Janssen COVID-19 vaccine, are not held to this standard, it is quite likely that there is a bias from differential underreporting. The likelihood of reporting an anaphylactic or anaphylactoid reaction to VAERS is higher for ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260708: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260863: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was obtained from the respective Medical Faculties’ independent ethics committees (University of Freiburg: 256/20_201553; University of Tübingen: 293/2020BO2; University of Ulm: 152/20).<br>Consent: Written informed consent was obtained from adult participants and from parents or legal guardians on behalf of their children at both sampling time points.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological assays: Antibodies against SARS-CoV-2 in 2236 samples were detected using the following four assays: (1) EuroImmun-Anti-SARS-CoV-2 ELISA IgG and IgA (S1), (2) Siemens Healthineers SARS-CoV-2 IgG (RBD), (3) Roche Elecsys Ig (N) and (4) MULTICOV-AB, a previously published bead-based multiplex immunoassay that simultaneously analyses antibody binding to 23 antigens from SARS-CoV-2 (including VOCs)20,21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EuroImmun-Anti-SARS-CoV-2 ELISA IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA (S1), (2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MULTICOV-AB assay also analyses antibody binding to endemic coronavirus antigens (i.e. HCoV-OC43, - NL63, -HKU1 and -229E)20,21. 385 samples were analyzed with the GenScript SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NL63</div><div>suggested: (Virostat Cat# 3879, RRID:AB_2889994)</div></div><div style="margin-bottom:8px"><div>-HKU1</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of our study include the potential recall-bias inherent to retrospective self- or parent-reporting of symptoms via questionnaires and physician-interviews. Additionally, PCR tests for SARS-CoV-2 during the first wave in Germany were mostly limited to the household index case, meaning it is possible that infected individuals were not identified as such, despite the multi-assay serological approach. However, the in-depth characterization of the humoral response provides valuable data for clinicians, public health officials and the public, at a time when children are increasingly viewed as a potential viral reservoir due to exclusion of pediatric populations from current vaccination strategies. Similarly, while PCR testing was not available for all individuals, the strength of this cohort comes from the comparatively large number of children, inclusion of children and adults from the same household, the inclusion of seronegative household members as well-matched controls, and the prospective longitudinal analysis of the humoral response in children for up to one year post-infection. The seropositive cohort also comprises almost exclusively individuals with mild or asymptomatic infections and so provides real-world data representative for the majority of SARS-CoV-2 infections in the community. In summary, although children mostly show mild or even asymptomatic clinical courses following SARS-CoV-2 infection, they mount a strong and enduring humoral immune response. Th...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260139: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval and patient recruitment: This study had been approved by The First Affiliate Hospital of Guangzhou Medical University Ethics Committee, and the institutional review board of BGI; written informed consents had been obtained from all patients and healthy donor participated in this study.<br>Consent: Ethics approval and patient recruitment: This study had been approved by The First Affiliate Hospital of Guangzhou Medical University Ethics Committee, and the institutional review board of BGI; written informed consents had been obtained from all patients and healthy donor participated in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Based on the knowledge that blood cells are the major contributor of cfDNA in most clinical scenarios (19, 68) and to date there is no clinical/genetic evidence of ovary injuries in COVID-19 patients (in fact, a large proportion of the COVID-19 patients are male in our cohort), we utilized the orientation-aware cfDNA fragmentation pattern around blood cell- and ovary-specific open chromatin regions from all COVID-19 blood samples as positive and negative signals, respectively, to train a classification model for injury assessment of other tissues.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CfDNA sequencing and data processing: We used SOAPnuke (v1.5.0) (66) software to trim sequencing adapters, filter low quality and high ratio Ns in the raw reads with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SOAPnuke</div><div>suggested: (SOAPnuke, RRID:SCR_015025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The preprocessed reads were then aligned to the human reference genome (NCBI build GRCh38) using BWA (67) software with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:On the other hand, there are various limitations in this study. Firstly, the clinical diagnosis for many COVID-19 patients and tissues are not available due to the limited medical resources during the outbreak of the pandemic. Secondly, we could only perform qualitative analyses without comprehensive statistical analyses for tissue injuries. Hence, to provide more meritorious information to the clinic, it is worthwhile to validate the results using larger and more thorough datasets in the following studies. In addition, it would be favorable to explore the feasibility of other analyses, such as nucleosome positioning (14, 36) and promoter coverage patterns (61) , for quantitative measurement of organ injuries in following works. As a summary, through analysis of cfDNA in COVID-19 patients, we report alterations and dynamics of cfDNA characteristics during treatment, as well as organ-specific signals in cfDNA, demonstrating that cell-free DNA could serve as valuable analytes for effective disease monitoring and tissue injury assessment of COVID-19 patients.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 37. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453042: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed written consent to participate in the research project, and the study was approved by the Regional Ethical Board in Ospedale L.<br>IRB: All participants provided informed written consent to participate in the research project, and the study was approved by the Regional Ethical Board in Ospedale L.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Subjects Recruitment: 43 subjects (24 males and 19 females,dataset) of different ages (ranging from 30 to 81 years) undergoing SARS-Cov-2 serological analysis (Centro Polispecialistico Giovanni Paolo I, Viterbo, I) were enrolled in this study from October 2020 to March 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry chromatograms were created for peak alignment, matching and comparison of parent and fragment ions with tentative metabolite identification (within a 2-p.p.m. mass-deviation range between the observed and expected results against an imported KEGG database).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fold change analysis was performed on the entire metabolomics data set using the MetaboAnalyst 5.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaboAnalyst</div><div>suggested: (MetaboAnalyst, RRID:SCR_015539)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to analyze a correlation network of the compounds in shared pathways, MetScape, an app implemented in Java and integrated with Cytoscape (version 3.8.2), was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetScape</div><div>suggested: ( Metscape , RRID:SCR_014687)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453118: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EEA1 rabbit monoclonal antibody (clone C45B10) was from Cell Signaling Technologies (CAT# 3288S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EEA1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were labeled with anti-EEA1 primary antibody and anti-rabbit Alexa Fluor 647 secondary.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 90 sec UV dose was approved by the IBC for removal of inactivated SARS-CoV-2 out of the BSL-3 lab after it was established that the virus particles were capable of specific binding to Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the accumulation of SARS-CoV-2R18 particles in Vero E6 cells was completed using Matlab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453146: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the membranes were incubated in TBST with primary antibodies (GAPDH (Proteintech, 60004-1), RAD21 (Abcam, Ab992, Lot: GR214359-10), CTCF (Millipore, 07-729), SMC3 (Abcam, Ab9263, Lot:GR466-7), Total Histone H3 (Abcam, Ab1791, Lot:GR206754-1), H3K4me3 (Abcam, Ab8580, Lot: GR3264490-1), H3K9me3 (Abcam, Ab8898, Lot: GR164977-4), H3K27ac (Abcam, Ab4729, Lot: GR3357415-1), and H3K27me3 (Cell Signaling Technology, #9733S, Lot19)) at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (Proteintech Cat# 60004-1-Ig, RRID:AB_2107436)</div></div><div style="margin-bottom:8px"><div>RAD21</div><div>suggested: (Abcam Cat# ab992, RRID:AB_2176601)</div></div><div style="margin-bottom:8px"><div>CTCF</div><div>suggested: (Millipore Cat# 07-729, RRID:AB_441965)</div></div><div style="margin-bottom:8px"><div>Lot:GR466-7), Total Histone H3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H3K27ac</div><div>suggested: (Abcam Cat# ab4729, RRID:AB_2118291)</div></div><div style="margin-bottom:8px"><div>H3K27me3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with 1:500 anti-SARS-CoV-2 Spike glycoprotein antibody (Abcam, Catalog#ab272504) diluted in blocking buffer for overnight at 4 degree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike glycoprotein</div><div>suggested: (Abcam Cat# ab272504, RRID:AB_2847845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next morning, the antibody-protein-chromatin complex was retrieved by adding 25μl pre-washed Protein G Dynabeads (Thermo Fisher Scientific, 10004D).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-protein-chromatin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used for ChIP-Seq include RNA Polymerase II (RPB1 N terminus, Cell Signaling Technology, #14958S, Lot4), RAD21 (Abcam, Ab992, Lot: GR214359-10), SMC3 (Abcam, Ab9263, Lot:GR466-7), CTCF (Millipore, 07-729), H3K4me3 (Abcam, Ab8580, Lot: GR3264490-1), H3K9me3 (Abcam, Ab8898, Lot: GR164977-4), H3K27ac (Abcam, Ab4729, Lot: GR3357415-1), H3K27me3 (Cell Signaling Technology, #9733S, Lot19) and HA (Abcam, Ab9110, Lot:GR3231414-3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RPB1 N terminus, Cell Signaling Technology,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SMC3</div><div>suggested: (Abcam Cat# ab9263, RRID:AB_307122)</div></div><div style="margin-bottom:8px"><div>Lot:GR466-7), CTCF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H3K4me3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H3K9me3</div><div>suggested: (Abcam Cat# ab8898, RRID:AB_306848)</div></div><div style="margin-bottom:8px"><div>HA</div><div>suggested: (Abcam Cat# ab9110, RRID:AB_307019)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Human lung adenocarcinoma cells A549 expressing human ACE2 (A549-ACE2, #NR53821) was acquired from BEI Resources (Manassas, VA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were from ATCC and were cultured in DMEM with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to infection, Vero-E6 cells were washed once with PBS and the viral inoculum was added to the flask in the presence of 3 ml of serum-free and antibiotics-free MEM medium supplemented with 1mM HEPES, and incubated for 1 hour at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, ∼5 million SARS-CoV-2 infected A549-ACE2 cells were washed once with PBS to remove debris and dead cells, trypsinized off the culture plates, and were cross-linked using 1% formaldehyde for 10mins at room temperature, quenched with 0.75M Tris-HCl pH 7.5 for 5mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-viral Transduction and CRISPRi: We in-house generated a lentiviral construct expressing dCas9-KRAB-MeCP2 by PCR amplification of the dCas9-KRAB-MeCP2 (contains a domain of MeCP2) from pB-CAGGS-dCas9-KRAB-MeCP2 (Addgene 110824), and then insert it to the pLenti-EF1a-dCas9-VP64-2A-Blast backbone (Addgene 61425) to replace th dCas9-VP64.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pB-CAGGS-dCas9-KRAB-MeCP2</div><div>suggested: RRID:Addgene_110824)</div></div><div style="margin-bottom:8px"><div>pLenti-EF1a-dCas9-VP64-2A-Blast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate lentivirus, 293T cells were transfected with the lentiviral transfer vector DNA, psPAX2 packaging and pMD2.G envelope plasmid DNA at a ratio of 4:3:1, respectively, by lipofectamine 2000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RBP1 ChIP-Seq gene transcription quantification, hg19 RefSeq gene annotation coordinates were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-Seq analysis: RNA-Seq reads were aligned to the hg19 reference human genome or SARS-CoV-2 viral genome (NC_045512.2) with STAR v 2.7.027.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression analyses were performed with EdgeR, and genes with |FC|>2, FDR<0.05 were considered as significantly differential expressed genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pair of reads were mapped to the human reference genome assembly hg19, and multi-mapped pairs, duplicated pairs, and other unvalid 3C pairs were filtered out following the standard procedure of HiC-Pro.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HiC-Pro</div><div>suggested: (HiC-Pro, RRID:SCR_017643)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Compartmental domains are genomic regions with continuous positive or negative compartmental scores (E1), identified by applying HOMER tool (findHiCCompartments.pl) on E1 scores.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOMER</div><div>suggested: (HOMER, RRID:SCR_010881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We considered loops with a DESeq2 FDR <0.1 and a log2FC >0 or <0 as virus-strengthened or weakened chromatin loops.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: qPCR data was analyzed by Prism and presented as mean±SD, which are indicated in figure legends.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses for sequencing data were performed with Python or R scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453162: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: At the end of the study, all mice were sacrificed by cervical dislocation and some vital organs, like kidneys, liver and spleen were collected to examine morphological and histological characteristics and weights of the organs. 2.6.2.<br>IACUC: Animal ethics statement: This study was carried out in strict adherence to the animal laboratory of Nanogen pharmaceutical Company, the National Institute of drug quality control (NIDQC), and the laboratory of Hanoi Medical University (HMU).<br>IRB: The processes were designed according to the guide of ICH/GCP, Drug administration of Vietnam, as well ACTD and approved by Ethics committee of Ministry of Health 2.8.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal vaccination: Balb/c mice of both sexes, 6-10 weeks old were used for immunological studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, the membranes were blocked in 0.5% BSA (Sigma-Aldrich, St. Louis, MO, USA) and incubated with human anti-S1 antibody (Abcam, Cambridge, MA, UK) for 3 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the membranes were incubated with horseradish peroxidase (HRP)-linked rabbit anti human IgG antibody (Abcam, Cambridge, MA, UK) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Balb/c mice, Syrian hamsters, as well non-human primates were immunized intramuscularly with Nanocovax at doses of 25 μg, 50 μg, 75 μg, and 100 μg, their serum samples were collected quantification of spike protein specific IgG antibodies by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upper serum fraction was collected and heat-inactivated at 56°C in 30 minutes before use or kept at −20°C. 2.4.2. Quantification of SARS-CoV-2 spike protein specific IgG antibody by ELISA: The method of quantifying SARS-CoV-2 spike protein-specific IgG antibody was adapted from Tan C. W. et al, [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed 3 times with washing buffer then 100 μL of diluted goat anti-mouse IgG (Fc specific)-Peroxidase antibody (#A0168; Sigma-aldrich) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG ( Fc specific)-Peroxidase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolate was propagated in Vero E6 to prepare virus stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro surrogate virus neutralization assay: The virus neutralization ability of antibodies in sera of Balb/C mice, hamster, and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/C</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pCNeoMEM plasmid containes a G418 resistance gene used as a selection marker, a MoMLV promoter to express the target gene, a human universal chromatin opening element (UCOE), untranslated regions from the Chinese hamster EEF1A1 gene (eEF1A1), and a synthetic matrix attachment sequence (sMAR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCNeoMEM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S, which was completely sequenced by NextGen technology at the Center for Computational and Integrative Biology, Harvard University. 2.1.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCNeoMEM-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The collected data were statistically analyzed using Grapthpad Prism, version 5 (Grapthpad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Grapthpad Prism</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260657: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Indeed, our network-based intervention model comes with caveats. Our focus on interventions to reduce risk of SARS-CoV-2 does not consider risks for other infections like influenza, norovirus, and antibiotic resistant pathogens, particularly if the infection risk factors for these other diseases do not coincide with those associated with SARS-CoV-2. In addition, network-based interventions require changes in staff care and availability, exploration of feasibility will require extending the current framework to reflect constraints in staff expertise, numbers, and supply. Moreover, we have assumed that recovered individuals and vaccinated individuals have protective immunity from onward transmission over the period of the epidemic outbreak (here modeled as 100 days). The duration of effective immunity has been estimated to be at least 6-8 months [35]; however, the rise of variants and heterogeneous variation in immune protection reinforce the need to use PPE in nursing home facilities until levels are substantially reduced (in contrast to some proposals that recovered individuals not use PPE, perhaps because of a concern on levels of PPE availability [34]). Applications of dynamic rewiring informed by immune shielding concepts should be evaluated and adjusted in light of the ongoing spread of variants of concern. In summary, we have developed a network-based approach to cohort both residents and healthcare workers in light of their infection and immune status as a means to redu...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.451321: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The purity of human monocytes was above 95%, as determined by flow cytometric analysis (FACScan; Becton Dickinson) using anti-CD3 (BD Biosciences) and anti-CD16 (Southern Biotech) monoclonal antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD16</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were infected with SARS-CoV-2 at MOI of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the effects of mefloquine on SARS-CoV-2 attachment, monolayers of Calu-3 cells in 96-well plates (2 × 105 cells/well) were infected with MOI of 0.1, for 1h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among the different cell lines available in CMAP, we chose data from A549 cells, which is the one most similar to Calu-3 used in our wet lab experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remdesevir (RDV), was purchased from Selleckhem (https://www.selleckchem.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.selleckchem.com/</div><div>suggested: (Selleck Chemicals LLC, RRID:SCR_003823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kits for ELISA assays were purchased from R&D Bioscience.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R&D Bioscience</div><div>suggested: (UMD Bioprocess Scale-Up Facility, RRID:SCR_012703)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data were initially analysed s in the usegalaxy.org platform and then aligned through clustalW, using the Mega 7.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data is available from GEO (https://www.ncbi.nlm.nih.gov/geo/) (39), with accession number GSE92742.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/geo/</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, to identify pathways targeted by mefloquine, we applied GSEA (40) using KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSEA computes an enrichment score that measures how much a pathway is enriched in differentially expressed genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed gene comprising the SARS-CoV-2 infection expression signature were identified using the R package edgeR (43).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Here we used the CMAP pipeline (37,38), comparing the mefloquine expression signature with the SARS-CoV-2 infection expression signature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CMAP</div><div>suggested: (CMAP, RRID:SCR_009034)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose-response curves used to calculate EC50 and CC50 values were generated by variable slope plot from Prism GraphPad software 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism GraphPad</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.453274: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plaque numbers were scored in at least 3 replicates per dilution by independent readers, who were blinded with respect to the source of the supernatant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Virus: African green monkey kidney cells (Vero, subtype E6) and the human lung epithelial cell line (Calu-3 cells) were cultured in high glucose DMEM and low glucose DMEM medium, both complemented with 10% FBS, 100 U/mL penicillin and 100 µg/mL streptomycin at 37 °C in a humidified atmosphere with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">48-72 h supernatants were collected and the harvested virus was quantified as PFU/mL by titering in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pRSFDuet-1 plasmids (Novagen) encoding SARS-CoV-2 nsp14 or nsp10 engineered with an N-terminal His-SUMO tag were prepared as follows: SARS-CoV-2 RNA isolated from the supernatant of SARS-CoV-2-infected Vero E6 cells was provided by Benjamin R. tenOever48.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSFDuet-1</div><div>suggested: RRID:Addgene_165451)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were digested with BamHI and XhoI and subsequently ligated into BamHI and XhoI-digested pRSFDuet-His6-sumo vector and sequence verified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSFDuet-His6-sumo</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The molecular docking calculations were performed using GOLD 2020.2 software (Cambridge Crystallographic Data Centre, Cambridge, UK)54</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The figures for the docking poses of the largest docking score value was generated with PyMOL Delano Scientific LLC software (Schrödinger, New York, USA)55</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260627: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Samples were immediately stored at 4°C and transported to the lab where processing began immediately (within 6 hours of collection).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thresholding was done using QuantaSoft™ Analysis Pro Software (Bio-Rad, version 1.0.596).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantaSoft™ Analysis Pro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistics were computed using RStudio (version 1.1.1073).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.20.453160: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HLA class I molecules from the cleared lysate were incubated with anti-HLA-A, B, C monoclonal antibody (W6/32) coupled Sepharose-4B resin (GE Healthcare, IL, USA) at room temperature for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HLA-A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sorting and expansion: After two stimulation cycles, an aliquot of each well was stained with custom PE-conjugated MHC tetramer folded with HLA matched SARS-CoV2 peptide, and with APC-Cy7 conjugated anti-CD8 antibody (Biolegend, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After expansion, the purity of antigen specific T cells were determined with anti-CD8 antibody and MGP-65, NSP13-448, NSP13-242, NSP13-134, or NSP13-400 tetramer staining again.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NSP13-134</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the cells were fixed and permeabilized with Intracellular Fixation & Permeabilization Buffer Set (eBioscienceTM, NY, USA), and then stained with APC conjugated anti-CD137, FITC conjugated anti-CD69, PE conjugated anti-IFN-γ, Pacific blue conjugated anti-TNF-α antibody (all purchased from Biolegend, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD137</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD69</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TNF-α</div><div>suggested: (BioLegend Cat# 430901, RRID:AB_2883995)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TAP-deficient T-B cell hybrid cell line T2, melanoma cell line A375 (HLA-A0101/0201), RPMI-7951 (HLA-A0101/0201) and package cell lines Phoenix-GP, 293T were purchased from ATCC (VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Melanoma cell lines Hs-578T (HLA-A0301/2402) and M14 (HLA-A1101/2402) were purchased from NCI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hs-578T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Melanoma cell line Mel624 (HLA-A0201) was the gift from Dr. Steven Rosenberg (NCI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mel624</div><div>suggested: RRID:CVCL_RA32)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MGP-pLVX or NSP13-pLVX lentiviral vector were transfected into package cell line 293T, together with package vectors contain VSVG envelop vector to make lentivirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375, Mel624, RPMI-7951, Hs-578T and M14 cell lines were infected with MGP-pLVX or NSP13-pLVX lentiviral vectors and the stable cell lines were screened with puromycin selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>M14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MGP-65, NSP13-448, NSP13-242, NSP13-134 or NSP13-400 specific T cells were added at effector-to-target (E:T) of 20:1 cell ratio for 4 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MGP-65</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For MGP-65 specific T cell test, A375-MGP and Mel624-MGP cells labeled with 51Cr were used as ‘hot’ targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mel624-MGP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, for NSP13-448 specific T cells, A375-NSP13 and RPMI-7951-NSP13 cells labeled with 51Cr were used as hot targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RPMI-7951-NSP13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-radiolabeled A375 cells pulsed with NSP13-448 peptide or VGLL1 HLA-A0101 peptide (LSELETPGKY) (36) were used as cold targets and control cold targets, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For NSP13-242 specific T cells, A375-NSP13 and Mel624-NSP13 cells labeled with 51Cr were used as hot targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mel624-NSP13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For NSP13-400 specific T cell test, Hs-578T-NSP13 and M14-NSP13 cells labeled with 51Cr were used as hot targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>M14-NSP13</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375-MGP, Mel624-MGP (HLA-A0201+, MGP+), A375-GFP, Mel624-GFP (HLA-A0201+, GFP+), were used to evaluate MGP-65 specific T cell activity; A375-NSP13, RPMI-7951-NSP13 (HLA-A0101+, MGP+), A375-GFP, RPMI-7951-GFP (HLA-A0101+, GFP+), for NSP13-448 specific T cell activity; A375-NSP13, Mel624-NSP13 (HLA-A0201+, NSP13+), A375-GFP, Mel624-GFP, for NSP13-242 specific T cell activity; Hs-578T-NSP13 (HLA-A0301+, HLA-A2402+, NSP13+), Hs-578T-GFP (HLA-A0301+, HLA-A2402+, GFP+), for NSP13-134 specific T cell activity and M14-NSP13 (HLA-A2402+, NSP13+), Hs-578T-NSP13, M14-GFP (HLA-A2402+, GFP+), Hs-578T-GFP, for NSP13-400 specific T cell activity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mel624-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus transduction: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA, CA, USA) with fusion of GFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX</div><div>suggested: RRID:Addgene_101121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MGP-pLVX or NSP13-pLVX lentiviral vector were transfected into package cell line 293T, together with package vectors contain VSVG envelop vector to make lentivirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NSP13-pLVX</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide selection and validation: To analyze the acquired MS/MS spectra, the spectra were searched against the Swiss-Prot protein database (version 2020_05) by using Mascot search engine node (version 2.6) within Proteome Discoverer 2.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mascot</div><div>suggested: (Mascot, RRID:SCR_014322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The False Discovery Rate (FDR) was determined using “Target Decoy PSM Validator” node within Proteome Discoverer (version 2.3) and protein/peptide with an FDR of ≤ 1% being retained for further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was performed using GraphPad Prism version 7.03.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry data were analyzed using FlowJo (version 10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452756: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260561: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Culture: Vero E6 cells were cultured in DMEM supplemented with 2% FBS in a 5% CO2 humidified incubator at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Data analyses were completed using STATA version 13.0 (StataCorp, College Station, Texas, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21259539: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 10–12 UC CORDS was operationalized by UC Health as ‘non-human subjects research’ and analyses are considered institutional review board exempt.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medications used for each patient were determined from the EHR by measurement of all medication active ingredients utilized within 30 days of COVID-19 positive test based on the RxNorm standardized nomenclature for clinical drugs from the National Library of Medicine.17 Given the assumption, in context of COVID-19, of a similar therapeutic class effect of angiotensin converting enzyme-2 inhibitors (ACEIs) and angiotensin receptor blockers (ARBs) usage of these medications was collapsed to the overall category of ‘ACEIs/ARBs’.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RxNorm</div><div>suggested: (RxNorm, RRID:SCR_006645)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were extracted with module pyodbc, version 4.0.30 in Python, version 3.8.3 (Python Software Foundation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses performed in R, version 3.6.3 (R Project for Statistical Computing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Outpatient medications for patients in CORDS may require at least a month for complete capture. Use rates are conservative estimates for the non-hospitalized patients since medications for COVID-19 positive patients prescribed medications outside of UC Health are not present in CORDS. While the study demographics were consistent with California overall, given, that this state has a large minority population this may influence generalizability to the US. Consequently, the percentage of COVID-19 positive cases that were Non-Hispanic White in CORDS (28%) was lower than that observed in US national estimates (56%). Hispanics were 37% of the positive cases in our dataset and 21% in the US. A smaller percentage of COVID-19 positive patients were black (6%) than observed in national estimates (12.2%). Asians were 7% of the COVID-19 positive patients in CORDS compared to 4% in US estimates.25
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260200: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The time series models were a) exponential smoothing state space models (ETS) [20], b) exponential smoothing state space models with screening for Box-Cox transformation, ARMA errors and trend and seasonal components (TBATS) [21] and c) additive models with non-linear trends fitted by seasonal effects (PROPHET) [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PROPHET</div><div>suggested: (Prophet, RRID:SCR_017083)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strength and weaknesses: A strength of our study were the data of four years from nine hospitals representing about half of all inpatient psychiatric admissions in Hesse, Germany. This allowed both to give a representative picture of inpatient psychiatric care in Germany and to show how the forecasting approaches work at different study sites. Furthermore, it was possible to analyse the effect of sudden changes in hospital admissions to the performance of different modelling approaches due to the commencement of the Corona hospital regulation in March 2020. A limitation of our study was the lack of data to differentiate between causes of reduced hospital admissions after the corona regulation came into effect in March 2020. The reduced admissions could have been a result of different supply side and demand side effects, such as avoidance of elective admissions, reduced capacities due to isolation and quarantine requirements and unwillingness of patients to enter hospitals during the Corona crisis. Another limitation of our study was its restriction to one large German provider of inpatient mental health care, which requires a lot of care when translating to different healthcare systems or different clinical settings. C. Comparison to previous research: Previous studies often focused on emergency departments [26] and there were no previous studies that analysed forecasting of psychiatric hospital admissions comparable to our study in scale and scope. Vollmer et al 2021 predict...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260367: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Stata/SE 15.0 (StataCorp LP, College Station, TX, USA) for all analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has limitations. First, measurement bias is present in Sources 1 and 2 as our pertussis case definition only considered positive PCRs. We therefore might have missed cases diagnosed by serology (sometimes prescribed even if not recommended), or based on clinical grounds, especially during the 1st lockdown (from mid-March to May, 2020), when transportation was limited, office-based physicians unreachable, and private laboratories overwhelmed by the implementation of large-scale SARS-CoV-2 testing. Second, we cannot determine whether the decrease of pertussis cases observed here was due to decreased pertussis circulation or reduced testing. However, the similar decrease observed in hospitalized cases in the youngest population does not favor the latter hypothesis, and access retriction to outpatient testing was mostly limited to the first lockdown period. Third, we may have lacked statistical power to detect a significant decrease in the proportion of positive cases, as the post-lockdown period was relatively short compared to the pre-lockdown period (i.e., 9 months vs. 87 months, respectively), and negative PCR tests results were not available from data Source 2. In conclusion, this national-level study shows a strong association between the COVID-19 pandemic and pertussis in France, with an unprecedented drop of pertussis cases. Pertussis should be closely monitored to detect any resurgence in the community when social distancing restrictions will be relaxed, as wel...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04318431</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Prevalence of SARS -Cov2 Carriage in Asymptomatic and Mildly…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260550: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260265: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was performed after obtaining approval from the institutional ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in SPSS version 23 (IBM, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:New vaccines are on the way that can aid in the production of antibodies even against mutants.[9] According to Pal et al. patients with diabetes mellitus have a poor prognosis if they are infected with COVID-19, they also suggested that patients with diabetes mellitus, cardiovascular diseases, and malignancies should be prioritized for vaccination.[10] The limitations of our study include the retrospective design and the small sample size. Nonetheless, this is the first study from eastern India demonstrating the comparative effectiveness of Covaxin™ and Covishield™.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260651: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Decisions as to whether a patient met not did not meet the criteria for the CVW were made against objective parameters by one person clinically qualified person and ratified by another (both acute medicine trained), with both being blind to patient outcomes (including re-presentation, escalation to ITU care and death).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was performed using STATA (SE) version 15 (StataCorp LLC, Texas, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations. First, by comparing outcomes across studies, there is an assumption that patient populations including demography, burden of disease and impact of COVID-19, are similar across published studies. Most studies to date have not presented in depth demography and therefore these direct comparisons should be reviewed with caution. Second, in the current paper, the objective criteria for the CVW were applied using the granular electronic health record at QEHB without the benefit of seeing the patient or considering the time of the initial presentation, and all these factors are important when making the decision to admit or discharge. Third, it is possible that more of the patients who met the CVW criteria might have been discharged were the CVW in place. Fourth, when assessing staffing needs it has been assumed that all patients will require follow up for 14 days, as described in the NHSE SOP. It is highly likely that some would require much less follow up prior to discharge. Fifth, this is not a formal health economic review, which would form part of the evaluation of any new service. The study has significant strengths. Decisions as to whether the patient met the CVW criteria were made independently by two researchers, without knowledge of outcomes, thus reducing bias. All patients were included in the study, reducing the population bias which can hinder consented studies. As data includes all medications and electronic noting, reasons for continued ad...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260611: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260521: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260655: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This study was done in compliance with Act 008430/1993 of the Ministry of Health of the Republic of Colombia, which classified it as minimal-risk research.<br>Consent: All the patients were asked for their consent and were informed about the Colombian data protection law (1581 of 2012).<br>IRB: The institutional review board of the Universidad del Rosario approved the study design. 2.2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For this analysis, 25 random sets were used, and a final optimal number of clusters were obtained based on the average silhouette width.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Patients were systematically evaluated for post-COVID manifestations (see below), including depression and autonomic symptoms by validated scales, as well as for clinical characteristics during the acute COVID-19.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All patients were tested for total anti-SARS-CoV-2 antibodies (see below for details).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies anti-SARS-CoV2: Total IgG, IgA and IgM antibodies to SARS-CoV-2 were evaluated in serum samples through the Elecsys Anti-SARS-CoV-2 electrochemiluminescence immunoassay “ECLIA” (Roche Diagnostics International AG, Rotkreuz, Switzerland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV2: Total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Elecsys anti-SARS-CoV-2 S assay detects antibodies to SARS-CoV-2 Receptor Binding Domain (RBD) in a double-antigen sandwich assay format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Receptor Binding Domain (RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Autonomic symptoms were evaluated by COMPASS 31 [14, 18]. 2.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COMPASS</div><div>suggested: (COMPASS, RRID:SCR_015874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PubMed was systematically searched for published and unpublished studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To summarize the diverse information of frequencies of post-COVID manifestations, a meta-analysis approach was employed using Metafor R package (http://www.jstatsoft.org/v36/i03/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metafor</div><div>suggested: (metaphor, RRID:SCR_003450)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21258787: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the local research ethics committee (Instituto de Educação Superior da Paraíba - IESP, opinion No. 4.777.641, CAAE: 47672821.8.0000.5184) and was registered in the Brazilian Clinical Trial Registration Platform (Number: RBR-107wv6d9).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 7.0 and GPower 3.1.9.7 software programs were used for the statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The major limitations to exercise (hypoxemia and dyspnea) were resolved by implementing oxygen and ventilatory support during low to moderate intensity exercise. It is important to emphasize that patients only performed the exercises in a safe condition (oxygen saturation > 93% and absence of dyspnea). If the safe condition was not reached, patients did not perform the exercise protocol. NIV and oxygen support reduces breathing work and respiratory muscles’ demand during exercise, increasing performance. O’Donell et al.(16) demonstrated that improvement is primarily explained by altered symptoms (reducing dyspnea and leg discomfort) and did not directly correlate with alterations in any of the measured cardiopulmonary physiological variables. Hospital discharge improvement and length of hospital stay reduction was achieved due to the combination of progressive oxygen weaning and the maintenance of the performance of physiological systems. Cardiorespiratory fitness and neuromuscular performance are directly affected by severe COVID-19(5). Exercise training helps keeping the physiological gears running. It prevents cardiac atrophy during the bed rest period(17), improving cardiovascular performance. It also improves strength and neuromuscular efficiency, even at moderate intensity(18), and reduces inflammatory markers(19). In patients who are not able to perform voluntary muscle contraction, neuromuscular electrical stimulation prevents muscle atrophy(20) and acutely mobilizes ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452721: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were performed in accordance with institutional guidelines from the Animal Research and Ethics Board.<br>Euthanasia Agents: Bronchoalveolar lavage, lung, mediastinal lymph node, nasal turbinate and spleen mononuclear cell isolation: Mice were euthanized by exsanguination.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">200 µg of Anti-CD4 (clone GK1.5) and anti-CD8 (clone 2.43) depleting, or an IgG isotype control antibodies (MilliporeSigma, Etobicoke, ON, Canada) were intraperitoneally administered as a single bolus 26-days post-vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>an IgG</div><div>suggested: (Hangzhou HuaAn Biotechnology Cat# HA1006, RRID:AB_2819167)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with primary antibodies (1:1000 Anti-VSV-G (ThermoFisher Scientific Waltham, MA, United States), 1:2000 Anti-NP (ThermoFisher Scientific Waltham, MA, United States) and 1:5000 GAPDH (MilliporeSigma, Etobicoke, ON, Canada) diluted in 5% skim milk, followed by anti-mouse and anti-rabbit IRDye secondary antibodies (LI-COR, Lincoln, NE, United States) diluted in 5 % skim milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, goat anti-mouse-biotin antibodies (Southern Biotech, Birmingham, AL, United States) IgA (1:2000), IgG (1:5000), IgG1 (1:5000), IgG2a (1:5000)) were diluted in reagent diluent and added to all wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-biotin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both trivalent vaccines were further amplified in HEK293 cells and subsequently purified by cesium chloride density gradient ultracentrifugation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transgene protein analysis by Western blot: A549 cells (CCL-185, ATCC, Manassas, VA, United States) were cultured at 37°C in DMEM supplemented with 10% FBS, 1 % HEPES pH 7.3, 1% L-glutamine and 100 U/mL of penicillin–streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Vero E6 culture media was then replaced with 100 µL of the serum-virus mixture and was incubated at 37°C for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Age-matched 6–8-wk-old wild-type female BALB/c, C57BL/6J, or B6.Cg-Tg (K18-ACE2) 2Prlmn/J mice were purchased from either Charles River Laboratories (Saint Constant, QC, Canada) or The Jackson Laboratory (Bar Harbor, ME, United States)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg ( K18-ACE2 ) 2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 strain SB3-TYAGNC was provided by Dr. Arinjay Banerjee, Dr. Karen Mossman, Dr. Samira Mubareka, and Dr. Rob Kozak and isolated as described previously (Banerjee et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SB3-TYAGNC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This PCR product was cloned in pCY1 plasmid which contains the mCMV promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCY1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Age-matched 6–8-wk-old wild-type female BALB/c, C57BL/6J, or B6.Cg-Tg (K18-ACE2) 2Prlmn/J mice were purchased from either Charles River Laboratories (Saint Constant, QC, Canada) or The Jackson Laboratory (Bar Harbor, ME, United States)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stained cells were fixed and permeabilized with BD Cytofix/Cytoperm before incubation in BD Perm/Wash buffer (BD Biosciences, San Jose, CA, United States).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Cytofix/Cytoperm</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo software (version 10.1; Tree Star, Ashland, OR, United States).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tests were performed using GraphPad Prism software (Version 9</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Graphpad Software, La Jolla, CA, United States).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These limitations of i.m. delivery, along with our current findings and those from others (Bricker et al., 2021; Hassan et al., 2020), should further bolster the global effort in developing respiratory mucosal-deliverable next-generation COVID-19 vaccines. In this regard, there have been at least two clinical trials testing either inhaled aerosol ChAdOx1nCov-19 (Singh et al., 2021) or intranasally delivered ChAd-SARS-CoV-2-S developed by scientists at WUSTL (Clinical Trial NCT04751682). Our current study has also provided the novel experimental evidence that both B and T cells are required for optimal protection. Of note, our data suggest that the clinical outcomes (body weight losses and mortality) may not always corroborate with viral burden, depending on both the immune pathway and relative potency of vaccine. We have observed that while Tri:HuAd-vaccinated B cell-deficient hosts well-protected in terms of clinical outcomes suffered impaired lung viral clearance, T cell-deficient hosts suffered both moderately worsened clinical outcomes and lung viral clearance. On the other hand, the robust i.n. Tri:ChAd vaccine strategy protected wildtype, B cell- and T cell-deficient hosts equally well in terms of clinical outcomes, whereas lack of B or T cells led to impaired lung viral clearance. Besides using T cell-depletion approach, the role of vaccine-induced T cell immunity in protection is supported further by our observations from B.1.135-infected K18-hACE2 animals immunized w...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04751682</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Intranasal SARS-CoV-2 Vaccin…</td></tr></table>
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260576: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Inclusion/exclusion criteria: Studies were included in this review if they met the criteria as follows: Inclusion criteria: 1) Adult patients with laboratory-confirmed COVID-19; 2) biomarker reflecting platelet size (i.e., MPV, PDW and/or P-LCR); 3) investigation of an association between a biomarker reflecting platelet size and disease severity and/or mortality in COVID-19; 4) original (experimental) research including randomised controlled trials, case-control studies, cohort studies, cross-sectional, case reports and series of cases.;</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We carried out a systematic search of the literature from Medline, Embase, PubMed, Web of Science, the Cochrane Central Register of Controlled</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the statistical heterogeneity was assessed using RevMan v5.4.1 (2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RevMan</div><div>suggested: (RevMan, RRID:SCR_003581)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For unreported p values, an appropriate t-test was performed using Graphpad v9.1.1 (2021) if raw data was available.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations of the study: Heterogeneity was explored by conducting sensitivity analyses, minimizing the effect of possible confounders. Specifically, the day the blood test was performed and clinical outcome measures. Our data established that these parameters did not influence the results of the meta-analysis for MPV and P-LCR in severe patients, and for all three platelet size biomarkers in non-survivors. A limitation of our study was that most of the included studies were cross-sectional retrospective. Thus, the studies were dependent on the data that was entered into a clinical database and not collected for research from a predesigned protocol. Consequently, some key statistics may not be measured due to unavailable data, and certain variables that have the potential to impact the outcome may not have been recorded at all. For example, only one study excluded patients who had taken platelet medication for >10 days prior to the study [29]. In addition to this, many studies did not describe the full process of the blood collection and analysis as it was conducted by hospital staff prior to the start of the study. This could weaken the conclusions made by the authors. As an example, Wang et al [25] concludes that an MPV-to-lymphocyte ratio of >8.9 was a high risk for COVID-19 severity. However, without a description of the blood test methodology, clinicians cannot determine what laboratory conditions this cut-off would apply to, as different conditions can giv...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.19.452918: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses: Stocks of representative viral strains, including influenza A virus (Udorn, WSN), respiratory syncytial virus (RSV-A2), SARS-CoV-2, and encephalomyocarditis virus (EMCV)) were prepared using standard virology techniques on Vero (SARS-CoV-2 and EMCV), MDCK (influenza A virus) and Hep-2 (RSV) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div><div style="margin-bottom:8px"><div>Hep-2</div><div>suggested: CLS Cat# 300397/p694_Hep-2, RRID:CVCL_1906)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260590: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trained research assistants entered anonymized participant data into a REDCap database (Version 10.9.4; Vanderbilt University, Nashville, Tennessee, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These tools were developed in studies with substantial methodological limitations and incorporate variables not immediately available at the time of a patient’s hospital arrival, so are not useful to guide early isolation, testing and treatment decisions.2 None of these risk prediction tools considered the prevalence of disease in the population. Prevalence can substantially change the approach to testing and cohorting, and this will become increasingly important as prevalence rates drop and selective rather than liberal testing may be more appropriate. United States-based investigators recently reported the development of the CORC score using only clinical variables. The CORC score contains several similar variables to the CCIS. However, the CORC score was derived in a non-consecutive sample of patients which had a much higher incidence of disease than our study cohort and may be vulnerable to selection bias. The CORC score also included race and ethnicity as predictor variables. This inclusion of race and ethnicity variables limits the generalizability of the CORC score beyond the urban American population in which it was developed, as it does not reflect the international diversity of ethnic backgrounds. Moreover, it is unlikely race or ethnicity represents a biologic risk. The association between race and ethnicity and SARS-CoV-2 infection in the CORC score likely reflects other sociodemographic and geographic predictors of the risk of COVID-19 infection in the American p...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04702945</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Canadian COVID-19 Emergency Department Registry</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260543: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For calculation of the index, we included the racial and ethnic categories: Latino/Hispanic, American Indian and Alaska Native, Asian, Black or African American, Native Hawaiian or Pacific Islander, and Non-Hispanic White [49].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Despite the merits of our study, we want to point out the following weaknesses and future research directions: 1) While a major strength of the lexicon-based sentiment classification approach lies in its simplicity, this method does not allow us to identify more complicated language features, such as sentiment shifters (e.g., “I don’t like this car”, is negative, even though the word “like” is not; [15]); 2) Twitter users represent a younger demographic group, whose sentiments and opinions may not reflect those of the entire population. In addition, urban areas tend to be overrepresented in tweet samples [63]. We tried to partially address this issue by including the proportion of the population between 18 and 34 (the main demographic who uses Twitter) but discarded the variable during our modelling process due to unacceptably high correlations with other variables on our model. 3) Our regression modelling approach does not consider the temporal dimension (except for the 1st death variable), despite having a spatiotemporally complete dataset. Therefore, our current and future research efforts focus on the application of spatiotemporally explicit modelling using Bayesian statistics to address the spatial and temporal nature of our dataset [64]. Lastly, due to the real-time availability of data, such as tweets and various metrics on COVID-19, it is feasible to apply our methods and update the results of this study daily. For instance, the space-time scan statistic can be employ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452748: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2/TMPRSS2 cells stably expressing ACE2 and transmembrane serine protease 2 (TMPRSS2) were established and maintained as previously described (51).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cell lines: Codon-optimized full-length S genes of SARS-COV-2 variants (using D614G as the base plasmid) were cloned into pCDNA3.1(+) (GenScript, Piscataway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV gag/pol (pCMVΔR8.2) and Luciferase reporter (pHR’CMV-Luc) plasmids were obtained from the Vaccine Research Center (National Institutes of Health, Bethesda, MD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔR8.2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHR’CMV-Luc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers were calculated using a nonlinear regression curve fit (GraphPad Prism software Inc., La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Computational analysis: The amino acid locations on the RBD that affected nAb potency were modeled with PyMOL molecular graphics system (version 1.7.4; Schrödinger, LLC) using the Protein Data Bank (PDB) entries 6ZOZ for the closed conformation and 7A98 for the open conformation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Finally, the safety and simplicity of pseudovirus neutralization assays offer many advantages for identifying MOCs and screening antibody therapeutics and vaccinee sera, but such assays have limitations. Pseudoviruses do not completely mimic authentic SARS-CoV-2 or virus entry conditions in vivo. In our nAb screens, we found that two antibodies that bind outside of the receptor binding motif could only partially neutralize (< 80%) pseudoviruses bearing WT Spike (data not shown). This inability to achieve complete neutralization by some nAbs has been observed by others using authentic SARS-CoV-2 (54, 68) and may be due to use of engineered target cells that permit efficient virus entry or heterogeneous glycosylation of Spike that affects an antibody epitope. Neutralization assays also cannot measure the potential protective activity afforded by nAb Fc effector functions. To address the limitations of any single assay, several consortia have formed to integrate findings from animal models and in vitro assays involving a variety of formats to inform the development of potent antibody therapeutics and other medical countermeasure that will remain potent against emerging variants.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260642: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260622: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave written informed consent.<br>IRB: The study protocol was approved by the Human Research Ethics Committee of the Faculty of Medicine at Ramathibodi Hospital, Mahidol University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-PF4/polyanionic antibodies were screened by IgG-specific ELISA (Hyphen Biomed Zymutest HIA IgG, Quadratech Diagnostics, UK) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-PF4/polyanionic</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statical analyses were performed on GraphPad Prism 9.1.1 (GraphPad Software, CA, USA) and Stata statistical software version 15.1 (StataCorp, TX, 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Stata statistical</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.17.452787: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The characterization of the protein structural dynamics was done with the following analyses: a) flexibility with the Root Mean Square Fluctuation (RMSF); b) analysis of collective modes of wild-type and mutants (correspondence/correlation calculation); c) conformational sampling using hybrid methods; d) distance analysis between the two residues of the catalytic dyad; e) SASA analysis for different regions; f) analysis of the frequency of occurrence of mutants in the patient data deposited in the GISAID database. 2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GISAID</div><div>suggested: (GISAID, RRID:SCR_018279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type and apo crystal SARS-CoV-2 Mpro structures with 1.91 Å resolution (PDB ID: 7C2Y [DOI: 10.2210/pdb7C2Y/pdb]) were used to generate 48 mutants with single point mutations [17]using PyMOL software [The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The normal modes were calculated using the DIMB (Iterative Mixed-Basis Diagonalization) module [24] implemented in CHARMM software [25, 26] considering all the atoms of the protein and a force field corresponding to the CHARMM36m [27].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHARMM</div><div>suggested: (CHARMM, RRID:SCR_014892)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Heatmap, Violin and Boxplot representations were generated in Python using the Pandas [34, 35], NumPy [36], Matplotlib [37] and Seaborn [38] libraries.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the PISA web server, we calculate the solvation free energy gain upon formation of the interface, interface area and number of potential hydrogen bonds and salt bridge [39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452571: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike phylogenetic analysis: The multiple sequence alignment with NC_045512.2 as reference was performed by the MAFFT v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree reconstruction was performed by the Maximum Likelihood method in the IQ-TREE program (Nguyen et al., 2015), using 1,000 replicates of ultrafast bootstrap (Hoang et al., 2018) and a Shimodaira-Hasegawa-like approximate likelihood ratio test (SH-aLRT) with 1,000 replicates (Guindon et al., 2010), 2,000 iterations and the optimization of the UFBoot trees by NNI on bootstrap alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree visualization was performed by FigTree software (http://tree.bio.ed.ac.uk/software/figtree/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike selection and coevolutionary analyses: The multiple sequence alignment of the 2,901 unique spike sequences and the phylogenetic tree previously built were used as input in the HyPhy program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HyPhy</div><div>suggested: (HyPhy, RRID:SCR_016162)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PDB file 6M0J was selected as the best template (2.45 Å and 194 amino acids) to the modeling using the MODELLER pipeline (Webb and Sali, 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generation of the spike RBD - ACE2 complexes for each different lineage was performed by the PyMOL software using the structural alignment of the RBD models with the 6M0J template, which was the source of the ACE2 structural coordinates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260644: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The composite outcome allowed to estimate the proportion of all children who had SARS-CoV-2 antibodies (i.e., were infected) any time by a specific testing, rather than cross-sectional seroprevalence at a single testing, and was measured for T1, T2 and T3 separately (outcomes T1, T12, and T123).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T12</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Bayesian approach permitted adjusting for the sensitivity and specificity of the SARS-CoV-2 antibody test and the hierarchical structure of cohort (individual, school and district levels).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04448717</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Study of Seroprevalence of SARS-CoV-2 Antibodie…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260762: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260537: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations that are important to consider. Firstly, despite the large number of individuals included, this is a single centre study and may not be generalisable across all UK hospitals given the heterogeneity in practice, building infrastructure, and patient population that exists. Our organisation had a high number of documented hospital-acquired infections in patients between March 2020 and March 2021 (n=795), but was not an outlier with 7 other NHS Trusts with higher numbers (highest n=1,463).[31] Seven of the top 10 busiest NHS Trusts (including our own) were also in the top 10 Trusts with the highest number of hospital-acquired COVID-19 infections in patients, indicating a common theme that may be a driver of nosocomial SARS-CoV-2 infections.[32] The effectiveness of various infection control measures on within-hospital transmissions over time in our setting is also likely to be generalisable to many UK hospitals, as they were based on national guidance applicable to all NHS Trusts. Many institutions will share similar issues regarding outdated infrastructure with 43% of NHS Trusts occupying estates greater than 30 years old.[33] Although we did not have a selective sampling strategy, either for case detection or sequencing of positive cases, it is possible that there was an unobserved sampling bias. For example, as individuals with higher viral loads will be more infectious and their samples more likely to result in successful sequencing, they are...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260628: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study design and study population: A cohort study was carried out within the OpenSAFELY platform, which has been described previously.<br>IRB: The study was approved by the Health Research Authority (REC reference 20/LO/0651) and by the LSHTM Ethics Board (ref 21863).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and Limitations: We identified COVID-19 hospitalisations from a base population covering around 40% of the population of England, giving us high statistical power. We examined a broad range of hospitalisation and mortality outcomes, and were able to describe and adjust for a wide range of personal and clinical characteristics using rich primary care data. However, our study has some limitations. We relied on ICD-10 codes entered as the primary reason for hospitalisation or underlying cause of death to define our cause-specific outcomes, but these fields may not have been used consistently.26 In particular, there might have been a tendency for clinicians aware of a recent COVID-19 hospitalisation to code COVID-19 for a range of clinical complications, masking more specific sequelae. Outcomes were classified in broad categories to obtain an overview of post-COVID-19 disease patterns; more granular disease categories would be of future interest but will require more follow-up to maintain statistical power. Our main comparisons may have been affected by time-related factors. We compared post-COVID patients in 2020 with controls from 2019 and earlier; consultations for non-COVID-19 conditions in 2020 are known to have been subdued in the general population,27 perhaps due to lockdown, or public reluctance to seek care, potentially affecting comparison with earlier years. On the other hand, patients with recent a COVID-19 hospitalisation may assume immunity from reinfectio...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260302: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consent was obtained prior to their enrollment in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260234: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The institutional ethics committee approved the study vide letter no. AIG/IEC-Post BH&R 15/06/2021-07.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The limitation of our survey is we did not capture the data on age and comorbidities of the patients who reported symptoms. However, to our knowledge, this is the first Indian study to report a high incidence of post-COVID-19 symptoms among COVID-19 recovered individuals. Both hospitalized and non-hospitalized patients suffer from post-COVID-19 symptoms. Furthermore, the injudicious use of steroids led to a significant increase in the risk of post-COVID-19 symptoms.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260583: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.19.452910: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">or with 1 μg UBE2O antibody (A301-873A, Bethyl) overnight following with 15 μL prewashed protein A/G beads (1:1 mixture, 1614013 and 1614023, Biorad) incubation for another 1.5 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UBE2O</div><div>suggested: (Thermo Fisher Scientific Cat# A301-873A, RRID:AB_1309799)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used in these experiments included Flag (F1804, Sigma), EGFP (50430-2-AP, Proteintech), NSP3 (ab181602, Abcam), UBE2O (A301-873A, Bethyl), pSerine (gtx26639, GeneTex), pThreonine (9386, Cell Signaling), TAB2 (A302-759A, Bethyl), TAB3 (A302-208A, Bethyl)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A301-873A , Bethyl) , pSerine ( gtx26639 , GeneTex) , pThreonine ( 9386 , Cell Signaling) , TAB2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A302-759A , Bethyl) , TAB3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for the experiment are: CANX (2679, Cell Signaling), TOMM20 (ab56783, Abcam), Flag (F1804 and F7425, Sigma), NSP3 (ab181602, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CANX ( 2679 , Cell Signaling)</div><div>suggested: (Cell Signaling Technology Cat# 2679, RRID:AB_2228381)</div></div><div style="margin-bottom:8px"><div>TOMM20</div><div>suggested: (Abcam Cat# ab56783, RRID:AB_945896)</div></div><div style="margin-bottom:8px"><div>ab56783 , Abcam) , Flag ( F1804</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NSP3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells from ATCC were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Hyclone, SH30033.01) supplemented with 10% Fetal bovine serum (FBS, Hyclone, SV30160.03) and 1×Penicillin/Streptomycin (Hyclone,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UBE2O plasmid was described before [52] and TNIP cDNA was amplified from HeLa cDNA and cloned in to pCS2 vector with Flag tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCS2</div><div>suggested: RRID:Addgene_62214)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw data were first transformed using FAIMS MzXML Generator and then analyzed using MaxQuant version 1.6.17.0 [54]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-Protein Interaction (PPI) network and pathway annotation of interactors was constructed by Cytoscape plugin Reactome FI v7.2.3 [57].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interactors of NSP3 were divided into 3 groups (CoV1, CoV2 and both) and enriched GO terms were shown using clusterProfiler package [58]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Circos plots was performed using circlize package [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Circos</div><div>suggested: (Circos, RRID:SCR_011798)</div></div><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We filtered out the kinases of which matching sites was less than 3 or Z-score is lower than 1 and created Human Kinome Tree illustration using KinMap [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KinMap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The targeting drugs that regulate activity changed kinases were extracted from drugbank (https://go.drugbank.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>drugbank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptome data analysis: Raw reads were aligned to the human genome (hg38) using HISAT2 [62].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we assembled reads to transcripts and quantified the read counts of each genes utilizing StringTie [63].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StringTie</div><div>suggested: (StringTie , RRID:SCR_016323)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We kept genes that CPM is greater than 1 in at least 2 samples and analyzed the differential expression gene using edgeR [64].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Molecular Function (MF) were performed using enrichR in clusterProfiler package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>enrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452709: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 RBD Neutralizing Antibody, Human IgG1 (Cat#SAD-S35, Acro Biosystems, Newark, DE), SARS-CoV-2 (2019-nCoV</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: (Abcam Cat# ab20402, RRID:AB_445563)</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For pseudovirus production, Lenti-X-293T cells were co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lenti-X-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera 28-days post-infection from three (3) different species of non-human primates (NHPs) rhesus macaques (RM), cynomolgus monkeys (CM), African Green Monkeys (AGMs) (N=2 each), challenged with SARS-CoV-2 (SARS-CoV-2 USA_WA1/2020 strain at 4.0 x 106 TCID50/mL through intra-tracheal route) were used in the pseudovirus assay. 2.3. Pseudovirus Based Neutralization Assay: HEK293T-ACE2 cells (NR-52511, BEI Resources, Manasas, VA) were grown in Dulbecco’s Minimal Essential Medium (DMEM, Lonza, Walkersville, MD), supplemented with 10% Fetal Bovine Serum (FBS) according to standard culture conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-ACE2 cells were seeded at ~20,000 cells per well into 96-well plates (100 μL per well) DMEM with 10% FBS without antibiotic the day before the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pNL4-3.Luc.R-E-, NIH AIDS Reagent, Catalog Number: 3418 was licensed/obtained from the New York University School of Medicine. Codon Optimized SARS-CoV-2 Spike gene from isolate 2019-nCoV_HKU-SZ-002a_2020 (GenBank: MN938384) was synthesized at GeneWiz, South Plainfield, NJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike gene was cloned into eukaryotic expression plasmid pcDNA3.1 to generate plasmid, designated as pSRC332.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pSRC332</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For pseudovirus production, Lenti-X-293T cells were co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luc.R-E- and pSRC322 using JetPrime transfection reagent (Polyplus Transfection, New York, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSRC322</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day cells were co-transfected with 3 μg pSRC332 and 12 μg pNL43. Luc. R. E using JetPrime® Transfection Reagent following the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL43</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pNL4-3.Luc.R-E-, NIH AIDS Reagent, Catalog Number: 3418 was licensed/obtained from the New York University School of Medicine. Codon Optimized SARS-CoV-2 Spike gene from isolate 2019-nCoV_HKU-SZ-002a_2020 (GenBank: MN938384) was synthesized at GeneWiz, South Plainfield, NJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luminescence signal was normalized to the virus control after background subtraction and analyzed using PRISM software using four parameter logistic curve fitting to calculate 50% pseudovirus based neutralization index (PBNI50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452733: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).<br>IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">One male and 3 females were assigned to the MV-014-212 and RSV groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For MV-014-212 and MVK-014-212, we used Rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and Goat anti-rabbit HRP-conjugated secondary antibody (Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MVK-014-212</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For rA2-mKate2, the reagents used were Goat anti-RSV primary antibody (Millipore) and Donkey anti-goat HRP-conjugated secondary antibody (Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were stripped with Restore Western Blot Stripping Buffer (ThermoFisher, Carlsbad, CA) and reprobed with goat anti-RSV polyclonal antisera (Sigma-Aldrich, St. Louis, MO) and a monoclonal antibody specific for GAPDH (6C5) protein (ThermoFisher, Carlsbad, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RSV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was washed 4 times with 250 μL PBST and 100 μL of HRP-conjugated goat anti-monkey IgG antibody (PA1-8463, Thermo Fisher, Waltham, MA) diluted in blocking solution was added to each well following the last wash step.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-monkey IgG</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)</div></div><div style="margin-bottom:8px"><div>PA1-8463</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the IgA standard curve anti-human IgA capture antibodies Mab MT57 (MabTech) were absorbed on plates instead of spike antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: (MABTECH Cat# 3860-4-1000, RRID:AB_10734770)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The standard total IgA antibody assayed on each test plate was used to calculate the concentration of IgA antibodies against spike protein in the AGM samples expressed in the arbitrary units ELU/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-specific IgG1 and IgG2a ELISA: Serum samples from mice were collected on Day -21 and on Day 28 post vaccination to quantify the levels of SARS-CoV-2 spike-specific IgG1 and IgG2a antibodies by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-specific IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, 100 μL of HRP-conjugated goat-anti-mouse IgG1 (Thermo Fisher) or HRP-conjugated goat-anti-mouse IgG2a (Thermo Fisher) secondary antibodies diluted 1:32,000 and 1:1000, respectively, were added to each well and the plate was incubated at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers / Probe sequences are shown below: SG-F: CGATCTTGTAGATCTGTTCCTCAAACGAAC SG-R: ATATTGCAGCAGTACGCACACACA FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ TCID50 assay to detect shedding of SARS-CoV-2 in BAL and NS of AGMs after challenge: Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM + 10% FBS + Gentamicin and the cultures were incubated at 37°C, 5.0% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confluent RCB1 cells grown in a clear-bottom black 96-well plate (Grenier) were infected with the serum-virus mixes and centrifuged (spinoculated) at 1,800 x g for 30 minutes at 20 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RCB1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Starting with a dilution of 1/25, serial 2-fold dilutions of heat-inactivated AGM sera were incubated with the pseudotyped viral particles (3 x 105 RLU/well) at 37°C for one hour after which the mixes were used to infect Vero E6 monolayers in white 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male and female K18-hACE2 Tg (strain #034860, B6.Cg-Tg[K18-ACE2]2Prlmn/J) mice were procured from The Jackson Laboratory (Bar Harbor, ME) and were approximately 8-10 weeks old at the time of vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg[K18-ACE2]2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The kRSV-DB1-QUAD plasmid and spike insert were digested with the enzymes AatII and SalI (NEB) and ligated with T4 DNA ligase (NEB) overnight at 16 ℃.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>kRSV-DB1-QUAD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The construction of the plasmid rA2-mkate (a.k.a. kRSV-A2) was described in Rostad 2016.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rA2-mkate</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence traces were assembled using Sequencher software and the assembly was manually confirmed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequencher</div><div>suggested: (Sequencher, RRID:SCR_001528)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting curves of inhibition vs. dilution of the sera were fitted using non-linear regression, option “[inhibitor] vs normalized response-variable slope” in GraphPad Prism (version 9.0.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The use of a semi permissive animal model for the evaluation of the live attenuated vaccine (LAV) candidate MV-014-212 constitutes a limitation of this study, since LAVs rely on replication to elicit a robust immune response. The semi-permissivity of AGMs to RSV and SARS-CoV-2 would result in lower replication of MV-014-212 and a more modest serum neutralizing antibody response. In a more permissive host like humans, MV-014-212 is expected to replicate to higher titers potentially resulting in higher immunogenicity than that observed in AGMs. Remarkably, immunization of AGM with MV-014-212 resulted in both mucosal and systemic antibody responses. There was approximately 100-fold more spike-specific total serum IgG in MV-014-212 vaccinated AGM compared to AGM that received wt RSV A2 or PBS inoculations. Spike-specific IgA was also detected in nasal swabs of MV-014-212 immunized animals. There was approximately an 8-fold increase in IgA concentration 25 days following vaccination with MV-014-212. In an experimental human challenge study, low RSV F-specific mucosal IgA was a better predictor for susceptibility to RSV challenge in seropositive adults than serum IgG and neutralizing antibody levels (Habibi 2015). Indeed, spike RBD-specific dimeric serum IgA was shown to be more potent at neutralizing SARS-CoV-2 than monomeric IgG (Wang 2021). By inference, secretory IgA which exists at mucosal surfaces as dimeric IgA may act as a potent inhibitor of SARS-CoV-2 at the site of infec...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04798001</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Intranasal RSV Vaccine Expre…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.17.452576: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All systems were solvated in TIP3 water molecules in 0.15 M salt concentration using CHARMM-GUI. 2.2 Molecular Dynamics Simulations: All-atom molecular dynamics (MD) simulations were performed with NAMD 2.1440 using the Charmm36m force field41, 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NAMD</div><div>suggested: (NAMD, RRID:SCR_014894)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.17.452804: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each library, 45 OD of induced culture was washed twice with PBS-BSA (0.2 mg/mL), and RBD surface expression was labeled via a C-terminal c-Myc tag with 1:100 diluted FITC-conjugated chicken anti-c-Myc antibody (Immunology Consultants Lab, CMYC-45F) in 3mL PBS-BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day post-transfection, cells were infected with VSV (G*ΔG-luciferase), and after 2 hr, infected cells were washed 5x with DMEM before adding medium supplemented with anti-VSV G antibody (I1-mouse hybridoma supernatant diluted 1:40, from ATCC CRL-2700)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>G*ΔG-luciferase) ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-VSV G</div><div>suggested: (Fitzgerald Industries International Cat# 10R-2673, RRID:AB_11192005)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of S was done with mouse monoclonal ANTI-FLAG M2 antibody (Sigma F3165) and Alexa Fluor 680 AffiniPure</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ANTI-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F3165, RRID:AB_259529)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected using Lipofectamine 2000 (Life Technologies) with a S encoding-plasmid in Opti-MEM transfection medium and incubated for 5 hr at 37°C with 8% CO2 supplemented with DMEM containing 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudovirus entry assays: HEK293T (293T) cells (ATCC CRL-11268) and 293T cells with stable transfection of human ACE242 were cultured in 10% FBS, 1% PenStrep DMEM at 37°C in a humidified 8% CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.4 expression plasmids were transfected into HD 293F cells for protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of R. affinis ACE2-Fc: The R. affinis 787 (GenBank: QMQ39222.1) and R. affinis 9479 (GenBank: QMQ39227.1) ACE2 ectodomains constructs were synthesized by GenScript and placed into a pCMV plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Marginal likelihood ancestral sequence reconstruction was performed with FastML (version 3.11)49 using the amino acid sequence alignment, the maximum likelihood nucleotide tree topology from RAxML, the LG+G substitution matrix, re-optimization of branch lengths, and FastML’s likelihood-based indel reconstruction model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastML</div><div>suggested: (Fastml, RRID:SCR_016092)</div></div><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting CCSs are available on the NCBI Sequence Read Archive, BioSample SAMN18316101.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Sequence Read Archive</div><div>suggested: (NCBI Sequence Read Archive (SRA, RRID:SCR_004891)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast library sorting experiments were conducted on a BD FACSAria II with FACSDiva software (version 8.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 labeling of RBD+ cells was measured on a BD LSRFortessa X50 flow cytometer and data was processed via FlowJo (version 10)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalized cell entry levels of pseudovirus generated on different days (biological replicates) were plotted in Graph Prism as individual points, and average cell entry across biological replicates was calculated as the geometric mean.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Prism</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.17.452554: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal work: Institutional approvals: All animal experiments described in this study were performed in accordance with protocols (number 1930) that were reviewed and approved by the Institutional Animal Care and Use and Committee of Princeton University (#1930) and Boston University (PROTO202000020).<br>Euthanasia Agents: Briefly, mice were anesthetized using isoflurane (2.5%), placed into a body conforming animal mold (BCAM) (InVivo Analytics) and imaged within 5 min of injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Heterozygous K18-hACE2 C57BL/6J mice of both sexes (strain 034860, 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory and maintained at the NEIDL at Boston University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and antibodies: VeroE6 cells and AAV-293 cells (ATCC) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum (Bio-Techne, R&D systems, Minneapolis, MN, USA) and 1% (v/v) Penicillin Streptomycin (Thermo Scientific, Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Penicillin Streptomycin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti-mouse antibodies were used for flow cytometry: from BioLegend (San Diego, CA, USA): CD45-PE-Cy7 clone 30-F11, CD45-PE-Dazzle5 clone 30-F11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45-PE-Dazzle5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti-human antibodies were used for flow cytometry: from BD Biosciences (San Jose, CA, USA): CD45-V500 clone HI30, CD34-FITC clone 581, CD8-FITC clone G42-8, CD11c-allophycocyanin clone B-ly6; from BioLegend: CD56-allophycocyanin-Cy7 clone HCD56, CD33-PerCP-Cy5.5 clone WM53, CD11c-Alexa Fluor 700 clone 3.9, CD123-eFluor450 clone 6H6, CD14-PE-eFluor610 clone 61D3, CD3-FITC clone SK7, CD19-allophycocyanin clone HIB19, HLA-DR-BV510 clone L243, CD3-BV605 clone UCHT1, CD20-BV650 clone 2H7, CD16-BV117 clone B73.1, CD45-BV785 clone H130, CD8-FITC clone RPA-T8, CD33-PE clone WM53, CD14-PerCP-Cy5.5 clone HCD14, CD45RA-PE-Cy7 clone HI100, CD56-allophycocyanin clone QA17A16, CD4-Alexa Fluor 700 clone SK3; from Thermo Scientific: CD14-Alexa 700 clone Tuk4, CD3-PE-Cy5.5 clone 7D6, CD4-PE clone RPA-T4, CD19-PacBlue clone SJ25C1, CD16-PE-TexasRed clone 3G8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (SouthernBiotech Cat# 9590-09, RRID:AB_2796984)</div></div><div style="margin-bottom:8px"><div>CD34-FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8-FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11c-allophycocyanin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD56-allophycocyanin-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD33-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD123-eFluor450</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14-PE-eFluor610</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19-allophycocyanin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HLA-DR-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20-BV650</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16-BV117</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD45-BV785</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD33-PE</div><div>suggested: (SouthernBiotech Cat# 9590-09, RRID:AB_2796984)</div></div><div style="margin-bottom:8px"><div>CD14-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD45RA-PE-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD56-allophycocyanin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-PE-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4-PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19-PacBlue</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies were used for immunochemistry: anti-human CD31 clone JC/70A (Biocare Medical, Pacheco, CA, USA), anti-mouse CD31 clone D8V9E (Cell Signaling Technology, Danvers, MA, USA), ACE2 clone EPR34435 (Abcam, Waltham, MA, USA), polyclonal SFTPC (Seven Hills Bioreagents, Cincinnati, OH, USA), anti-human CD68 clone KP1 (LS Bio, Seattle, WA, USA), anti-human CD61 clone ARC0460 (Thermo Scientific), anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent, Santa Clara, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD31</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse CD31</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD68</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD61</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L) (Vector Laboratories, Burligame, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti-SARS-CoV-2 antibodies were used for immunohistochemistry: rabbit polyclonal anti-SARS-CoV Nucleoprotein (Novus Biological, Littleton, CO, USA), mouse monoclonal anti-SARS-CoV-2 Spike clone 2B3E5 (This antibody was used in this study as clone E7U60, which was the pre-production clone ID of clone 2B3E5; Cell Signaling Technology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV Nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of human CD34+ cells were assessed by flow cytometry using an anti-human CD34-FITC antibody (clone 581, BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD34-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry fluorophore compensation for antibodies was performed using an AbC™ Anti-Mouse Bead Kit (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of peripheral human chimerism in HNFL mice: 2-4×106 PBMCs of human or murine origin were isolated as described above and stained for 1 h at 4°C in the dark with an antibody cocktail targeting human(h)CD45, mouse CD45, hCD3, hCD4, hCD8, hCD16, hCD19, hCD11c, hCD56 and hCD14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hCD16</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hCD14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody staining and flow cytometry analysis of NRG-L splenocytes and fLX: 2-4×106 splenocytes or fetal lung cells of human or murine origins were isolated as described above and stained for 1 h at 4°C in the dark with an antibody cocktail targeting mouse CD45, human(h)CD45, hCD19, hCD3, hCD33, hCD11c, hCD56, hCD68, hCD123, hCD14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hCD68</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hCD123</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking, 25 µL of antibody cocktail targeting hCD3, hCD20, hCD16, hHLA-DR, hCD45, hCD8, hCD4, hCD33, hCD45RA, hCD56, hCD14, mCD45, and containing a LIVE/DEAD viability dye (ThermoFisher Scientific) was added to each sample and incubated in the dark for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hCD20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hHLA-DR, hCD45, hCD8, hCD4, hCD33, hCD45RA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hCD56</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Our P2 working stock of the virus was prepared by infecting Vero E6 cells with the P1 stock, at a multiplicity of infection (MOI) of 0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AAV-293 cells (Agilent) at 50% confluency in 15 cm dishes were transfected via the calcium phosphate method with 22.5 µg XR8 (NGVB, Indianapolis, IN), 7.5 µg pHelper (Agilent), 7.5 µg of pAB269-TBG-FLT3 LG-BGH per plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AAV-293</div><div>suggested: NCBI_Iran Cat# C548, RRID:CVCL_6871)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse models and housing: NOD Rag1-/- IL2Rgnull mice (NOD.Cg-Rag1tm1MomIl2rgtm1Wjl/SzJ, were obtained from the Jackson Laboratory, catalog number 007799).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NOD Rag1-/- IL2Rgnull</div><div>suggested: RRID:BCBC_1261)</div></div><div style="margin-bottom:8px"><div>NOD.Cg-Rag1tm1MomIl2rgtm1Wjl/SzJ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NRG-Flk2-/- (NRGF) mice (NOD.Cg-Rag1tm1Mom Flt3tm1Irl Il2rgtm1Wjl/J) were generated as described previously (Douam et al., 2018) and are available at The Jackson Laboratory (Bar Harbor, ME, USA) (catalog number 033127).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NRG-Flk2-/-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NOD.Cg-Rag1tm1Mom Flt3tm1Irl Il2rgtm1Wjl/J</div><div>suggested: RRID:IMSR_JAX:033127)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE2 C57BL/6J mice of both sexes (strain 034860, 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory and maintained at the NEIDL at Boston University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:MGI:3589388)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of AAV-Flt3LG: The pAB269 AAV backbone containing AAV2 ITRs was kindly provided by Markus Grompe (OHSU, Oregon, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAB269</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FLT3 was PCR amplified from pAL119-FLT3L (Addgene, item #21910), and the TBG was amplified from pX602-AAV-TBG:NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA (Addgene, item #61593).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAL119-FLT3L</div><div>suggested: RRID:Addgene_21910)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo software (TreeStar, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An unstained fLX section was used to create an autofluorescence signature that was subsequently removed from multispectral images using InForm software version 2.4.8 (Akoya Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>InForm</div><div>suggested: (inForm, RRID:SCR_019155)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each sample, comprising 100 μg peptides, was TMT-labeled with TMTPro 16plex reagents (ThermoFisher Scientific: # A44520) as per the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MaxQuant output files designated ‘‘Phospho(STY)sites’’ and ‘‘proteinGroups’’ were filtered to remove entries that were either entirely mouse, or in the case of completely homologous peptides, had annotations of both mouse and human.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw FASTQ files were quality-checked with FastQC v0.11.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were found to be excellent quality and were aligned to the combined human (GRCh38, Ensembl 101) and mouse (GRCm38, Ensembl 101) genomes with STAR v2.7.1a followed by quantification with featureCounts v1.6.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality was checked with MultiQC v1.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DESeq2 result were imported into Ingenuity Pathway Analysis (IPA; Service curated by Qiagen; Access provided through the Boston University Genome Science Institute) (Kramer et al., 2014), and a canonical pathway enrichment analysis was performed using the default settings and the same differential expression thresholds as before (shrunken log2 fold change > 2 or < -2 and FDR-adjusted p-value < 0.01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical tests and graphical depictions of results were performed using GraphPad Prism version 9.0.1 software (GraphPad Software, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data deposition: The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Perez-Riverol et al., 2019) partner repository with the dataset identifier PXD025851.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptomic data generated during this study are available through the National Center for Biotechnology Information Gene Expression Omnibus (GEO) under series accession no. GSE180063.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:To enhance our understanding of the cellular and molecular mechanisms driving protective immune responses in the respiratory tract of asymptomatic and mild COVID-19 patients, investigations need to go beyond human patient studies due to their inherent limitations. Immunodeficient mice engrafted with fLX have been previously reported to be highly permissive to coronavirus infection (Wahl et al., 2021). Such in vivo platforms carry substantial advantages over other in vivo models (including humans) in a way that enables investigations into coronavirus infection within a human lung environment over time and in controlled experimental settings. However, given our common understanding that the quality of immune responses during SARS-CoV-2 infection defines disease outcome, the lack of significant human hematopoietic reconstitution in these models has precluded their use for investigating human immune responses against coronavirus infection. Here, we report that NRG-L mice singly engrafted with fLX are highly susceptible to SARS-CoV-2 infection. Inoculated fLX were prone to extensive inflammation, which associated with severe histopathological manifestations of disease. In sharp contrast, co-engraftment of fLX and human HSC in HNFL mice resulted in protection against SARS-CoV-2 infection, as well as limited inflammation and histopathology. Protection associated with the induction of a superior ISG response in HNFL mice as compared to NRG-L mice, which was dominated by the upregulat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 68, 70, 71, 72 and 73. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260630: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The statistical significance level was set at P ≤ 0.05. 2.2 Ethical approval: The study was approved by the ethical committee of University Hospital Centre Split on June 15, 2020 (500-03/20-01/09; 2181-147-01/06/M.S.-20-12).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in R statistical software version 3.6.2 and RStudio version 1.2.1335.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One of the study restrictions is a somewhat smaller sample size, but the major limitation is the unavailability of appropriate control groups that would allow us to draw stronger conclusions. Control groups of COVID-19-negative individuals with data on ABO blood groups and chronic conditions or the same data for individuals that were infected but survived the disease would have enabled more robust analyses regarding the risk factors for disease severity and death in analyzed individuals. For the same reasons, despite sufficient donors’ sample size, we could not exclude the possibility that the general bias of collecting more samples from universal donors (group 0) and less from AB group affected results to some extent. However, since population differences reflect not only in blood types but also in many other genetic and environmental factors, we believe that the present and future studies of this type conducted in various population samples will contribute to creating a clearer and more complete picture of COVID-19 and ABO groups association.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260563: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The retrospective analysis of the outbreak was approved by the ethics committee of the Medical Faculty of the Heinrich-Heine University Duesseldorf, (study no. 2021-1481).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2-specific antibodies: Samples were tested for anti-SARS-CoV-2 antibodies using two commercially available test systems.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It detects SARS-CoV-2 nucleocapsid-specific (N) IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike specific IgG antibodies, induced by either vaccination or infection were measured using the Euroimmun SARS-CoV-2-QuantiVac-ELISA on the Euroimmun Analyzer I-2P according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After pre-incubation, 100µl of cell suspension containing 7×104/ml Vero cells (ATTC-CCL-81) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When possible, whole-genome sequencing (WGS) of SARS-CoV-2 was performed by the diagnostic laboratory where the initial PCR testing was performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To distinguish antibody responses induced by vaccination from those induced by SARS-CoV-2 infections, the SARS-CoV-2 IgG chemiluminescent microparticle immunoassay (CMIA) from Abbott was performed on an ARCHITECT i2000Abbott.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The lack of longitudinal data as well as a control group of persons without vaccination examined in the same period after infection are important limitations of this study. It is noteworthy that the neutralisation titres were on average significantly lower in unvaccinated convalescents analysed at our lab with the same assay compared to vaccinated and infected individuals (data not shown). Even after complete vaccination, neutralising antibodies are not detectable in all individuals. Especially in elderly and immunosuppressed people, immunity after vaccination is less pronounced. In a previous study, about 30% of those over 80 years of age had no neutralising activity against the prototype virus three weeks after the second dose of an mRNA vaccine (Müller, Andrée et al. 2021). In this study, the antibody response was at the same low level in vaccinated individuals at comparable ages about eight weeks after vaccination. Infection after vaccination, as in this case with the alpha variant of SARS-CoV-2, thus appears to strongly boost immunity. It should be emphasised that vaccinated individuals showed considerable cross-reactivity after infection, which also neutralises the beta variant. The functional immune escape of the beta variant is particularly evident in the loss of neutralisation activity at low antibody levels. It is therefore reasonable to assume that boosting of immunity by an infection may provide additional protection against variants. Although it seems possible th...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260638: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participants: The research protocol for this study was approved by the NYU Langone Institutional Review Board (IRB).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21257742: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">INC function in MS Excel 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MS Excel</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, there are some important limitations that should be considered. First, it is an ecological study, and therefore, while providing useful observational data to help generate hypotheses, it cannot be used to test any hypothesis related to population health. Second, though we chose the most current environmental vulnerability metrics available from EPA EJSCREEN, we cannot be certain that they model current environmental conditions. At the same, much of the impact of air pollution on respiratory health is due to long-term exposure [23-27], not just short-term; therefore, it is still instructive to consider these data even if it is a few years old as of 2021. Third, there are multiple different models for estimating the burden of air pollution; all have their own pros and cons, and all are relatively more unstable at smaller geographic levels (such as sub-county geographies). The environmental vulnerability metrics and visualization scheme presented here were based on those used by a well-established resource to study environmental justice concerns (EJSCREEN). However, we cannot rule out that using different models of air pollution estimates or applying the same models but at a different spatial resolution may yield different results. Finally, due to the lack of outpatient asthma surveillance data at the sub-county level, we used inpatient discharge data to estimate the burden of asthma hospitalization as well as estimated asthma prevalence. These data are subject to vario...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260609: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The present study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (Approval number: R2-079 and R3-006).<br>Consent: Informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata (Stata Statistical Software release 16; StataCorp LLC, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There were several limitations of this study that should be noted. First, the survey was conducted via an Internet panel. Because of the bias of the target population (a population with Internet access), the generalizability of the results is limited. Second, the timing of the survey might have impacted our results. In Japan, vaccination against COVID-19 began on February 17, 2021, for healthcare workers, in April 2021 for people aged ≥65 years, and on June 21, 2021, for people in workplaces. Because the trends in vaccination changed rapidly, careful consideration is needed to determine whether the present findings apply to all periods. Third, the causal relationship between the source of information and willingness to get the vaccine was not clear. But because this was a prospective cohort study, the influence of the temporal relationship between predictors and outcomes is likely to be strong. Finally, there is a common method bias. Further studies using objective records of whether people were actually vaccinated are needed.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260605: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used VGG16, VGG19 [17], ResNet18, ResNet34, ResNet50, RestNet101[16], Inception [18] and EfficientNet [19] that are aligned with the transfer learning method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VGG19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(1) Learning rate scheduling method: We used PyTorch library module optim() that provides several methods to adjust learning rate based on the number of epochs during model training phase [31].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyTorch</div><div>suggested: (PyTorch, RRID:SCR_018536)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260621: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study participants: 323 individuals above the age of 21 years, who were vaccinated in Colombo, Sri Lanka, were included in the study following informed written consent.<br>IRB: Ethics approval was obtained from the Ethics Review Committee of the University of Sri Jayewardenepura.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2 specific antibodies: Seroconversion rates to the BBIBP-CorV vaccine were determined by using the Wantai SARS-CoV-2 Ab ELISA (Beijing Wantai Biological Pharmacy Enterprise, China), which detects IgM, IgG and IgA antibodies to the receptor binding domain (RBD) of the SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All experiments were carried out in duplicate and anti-human IgG monoclonal capture antibodies, was used as a positive control, and media alone as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The percentage calculations for the analysis were conducted in Microsoft Excel and the 95% confidence intervals for each category were calculated using the R software (version 4.0.3) and R-studio (version 1.4.1106).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260491: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: bioMILD, clinicaltrials.gov ID: NCT02247453) collected from July 14, 2018 until February 23, 2019, matched by date of collection, sex, age, smoking habits.<br>IRB: The Institutional Review Board and Ethics Committee of Fondazione IRCCS Istituto Nazionale dei Tumori of Milan approved the study.<br>Consent: All eligible subjects provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the analysis and the graphic design the GraphPad Prism software (version 5.2) was adopted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We acknowledge some limitations in this re-test study related to the limited sample size, the highly specific selection of screening participants (heavy smokers ≥ 30 pack years and ≥55 years old), possibly not representative of the general population, and the intrinsic experimental variability of the immunoenzymatic assays employed in the different laboratories. Moreover, we cannot exclude that other confounding conditions, such as preexisting immunity against other agents, might have contributed to the SARS-CoV-2 positivity in our assays. Nonetheless, cross reactivity towards the most common HCoVs was ruled out. As pointed out in the recent WHO report (www.who.int) and in other commentaries (1,2), studies from different countries suggest that SARS-CoV-2 was growing under the surface for some time before the first diagnosed case in Wuhan. Suggestive evidence from our previous published study (10) and conflicting results from the current retesting exercise, despite adding important signals in this direction, do not allow us to accept or discard this hypothesis. Indeed findings of these studies are only partially confirmed due to the heterogeneity of methods utilized and the risk of non-specific signals in serological assays. Despite that, the report underlines the importance of investigating these potential early events, to solve the still unanswered questions about the origin and timing of the current pandemic and may contribute to a better understanding of the future virus c...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03654105</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Screening and Multiple Intervention on Lung Epidemics</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02247453</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Plasma microRNA Profiling as First Line Screening Test for L…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260213: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved by the UAMS Institutional Review Board and waiver of consent and HIPAA applied.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory Methods: A two-step process was used to evaluate the sera for CoV-2 antibodies, as suggested by Centers for Disease Control (CDC) guidelines[13].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sera were tested for CoV-2 Receptor Binding Domain (RBD) IgG antibodies using the Beckman Coulter (BC) Access SARS-CoV-2 IgG (Brea, CA) in the Clinical Laboratory at the UAMS main campus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2 Receptor Binding Domain (RBD) IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four-Antigen Confirmation Test (FACT): The laboratory-derived assay in this study was designed considering prior ELISAs for CoV-2 antibodies[14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies[14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed three times with PBS-T and incubated with 50 µL of secondary antibody solution anti-human IgG + IgM (Jackson ImmunoResearch) diluted 1:5000 in PBS-T + 1% milk) for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG + IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All clinical and demographic variables were stored in a protected REDCap database[10, 11] and included patient age, gender, race, ethnicity, ZIP Code, and county of residence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using SAS, version 9.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Benefits and limitations of convenience sampling techniques have been discussed elsewhere[20]. It is possible that our sampling method could favor subjects who were more ill (e.g., individuals who were hospitalized) or more willing to leave their homes (e.g., individuals when were evaluated in clinics), etc. Nonetheless, the seroprevalence observed is consistent with both reported infections and data from American Red Cross blood donations in southern US states[21] and the Centers for Disease Control Multi-State Assessment of SARS-CoV-2 Seroprevalence (MASS-C)[22], which increases confidence in our data. The American Red Cross blood study found only 2.9% seroprevalence from August to September in southern states, while the MASS-C data revealed 9.2% seroprevalence in December in Arkansas. It should be noted that these earlier studies had no[17] or low (n=1071 Arkansas samples)[22] representation from Arkansas. Taken together, the data support the conclusion that the while seroprevalence rates demonstrate that more Arkansans have been infected with CoV-2 than previously recognized, the majority of the population in a representative rural southern state was not infected by CoV-2 from March to December of 2020. This, in combination with slow vaccine uptake despite rapid distribution of vaccinations across the State, has left many people vulnerable to CoV-2 infection with variants of concern. In fact, this spring, Arkansas is experiencing an uptick in cases, ranking second in high...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260337: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board of the Franciscus Gasthuis and Vlietland Hospital in Rotterdam approved the study protocol and ethical approval was obtained (IRB protocol number 2020-092).<br>Consent: Written informed consent was obtained from the HCWs during the household visits.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All data were analyzed using Microsoft Excel and R version 3.3.2 (R Foundation for Statistical Computing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several study limitations to consider. First, the primary aim was to measure the protective effects of different types of face masks worn by infected persons to prevent further spread. In retrospect, our approach failed to address this research question due to our sampling setting with poor ventilation resulting in many positive air samples due to circulating virus RNA. Therefore, our findings should not be interpreted as a failure in the protective effects of face masks. Importantly, SARS-CoV-2 was also detected on the masks worn by the infected persons and thus these masks limited the exposition of the virus to the environment. Second, all our observations were carried out prior to the emergence of variants of concern, such as the United Kingdom, South African, and Brazilian P1 SARS-CoV-2 variants in the Netherlands. We cannot exclude that different results would have been obtained due to more transmittable variants. Third, our experimental findings in adequately ventilated ICU rooms of COVID-19 patients with low proportions of positive air samples during AGMP require confirmation in a larger cohort that should also include different oxygen therapy. In conclusion, the presented vacuum cleaner based air sampling followed by RT-qPCR is simple to perform, does not require expensive materials, and is an effective method to detect SARS-CoV-2 in the air. Although airborne transmission of SARS-CoV-2 has not yet been widely accepted, it should be considered as an importan...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260597: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We retrospectively queried our data since April 2021 to identify adult patients (>17 years) who had confirmed (positive RT-PCR or antigen test) or suspected COVID-19 (classic symptoms but negative RT-PCR) and received a high-resolution CT scan to determine the extent of their lung involvement using the CT severity (CORAD) score6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CORAD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the analyses were conducted using SAS 9.4 software (SAS Inc. Cary, NC) at 95% confidence interval level.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations being a retrospective single center study. We did not have patient details other than their basic demographics, COVID-19 RT-PCR status, vaccination status and CT severity score. Patient details such as their oxygen saturations, hospital admission status, co-morbidities and mortality were not available. In conclusion, we present here the real-world findings from an independent radiology practice (a unique and common practice model), in India amid the second COVID-19 wave showing significantly lower CT severity score in fully or partially vaccinated patients compared to unvaccinated patients. We report a higher CT severity score in patients with positive RT-PCR. Complete vaccination in patients could be critical in preventing severe lung disease.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260595: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has several limitations. First, we make many simplifying assumptions in the model. For example, we assume all individuals are grouped into one large community and do not examine the potential impact of geographic heterogeneity. Other studies have shown epidemic dynamics due to differences in geography are important to control for in vaccine (20) and serologic (3) studies. We also assume perfect sensitivity and specificity of virologic tests, as implications of these parameters have been explored in detail previously (21,22). While we incorporate heterogeneity in risk of acquiring infection, we do not model differences in risk of transmitting infection (e.g. due to host factors). Additionally, as described above, the combined effects of immunity from prior infection and vaccination are uncertain; we model two simplified assumptions of this relationship but do not incorporate further complexity such as boosting of immunity from repeated exposure. Second, using serologic tests to identify prior infection is subject to error from imperfect test characteristics and waning of antibodies over time. However, we find only small biases in VE estimates from imperfect sensitivity, and information on past infection can also be obtained through self-report or medical records. Third, as described above, we assume random vaccination and no unmeasured confounding; the strategies discussed here alone do not address most other sources of potential confounding, which are important to ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260410: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260585: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Cohort and samples: A total 414 HCWs of St. Marianna University School of Medicine, Yokohama City Seibu Hospital, Kanagawa, Japan, who gave consent to participating in the study were recruited.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: Two chemiluminescent immunoassays, the Abbott SARS-CoV-2 IgG and SARS-CoV-2 IgG II Quant (Abbott, Illinois, USA), designed to detect serum IgG antibodies targeting the nucleocapsid and the spike proteins of SARS-CoV-2, respectively, were performed in accordance with the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An orthogonal testing algorithm was adopted in order to idealize positive-predictivity and determine, with high specificity, the individuals who were truly sero-positive of SARS-CoV-2 specific antibodies (3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific antibodies (3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this algorithm the individuals who initially tested positive for anti-nucleocapsid antibodies were tested with a second test targeting the SARS-CoV-2 spike antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 spike antigen.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: Two chemiluminescent immunoassays, the Abbott SARS-CoV-2 IgG and SARS-CoV-2 IgG II Quant (Abbott, Illinois, USA), designed to detect serum IgG antibodies targeting the nucleocapsid and the spike proteins of SARS-CoV-2, respectively, were performed in accordance with the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants positive for both SARS-CoV-2 specific antibodies were finally confirmed of COVID-19 serological diagnosis by detecting neutralizing antibodies against SARS-CoV-2 using the Genscript SARS-CoV-2 sVNT (Genscript, Leiden, Netherlands), a competition ELISA-based surrogate virus neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Against expectations, however, having been the sole first-tier diagnostic against this emerging infection, it is now increasingly recognized that NAT-based SARS-CoV-2 pathogen detection faces serious limitations. COVID-19 illness being primarily a lower respiratory tract infection, the probability of pathogen detection from upper respiratory tract specimens decrease rapidly and nearly halves within approximately two weeks from onset (7). Previous reports have suggested that a substantial fraction, as high as up to 54%, of COVID-19 patients may present with undetectable viral loads and show false-negative RT-PCR results (8–10). Our observation recapitulates such findings, by demonstrating the sensitivity of NAT to have remained as low as 61.7%. Missed diagnoses having occurred not only in the pauci-symptomatic and the asymptomatic populations but also in acutely ill cases of high suspicion, indefinite molecular testing results already have left behind a significant burden of those in need of a diagnosis. A well-defined diagnostic complementary to NAT is still in serious need. Since the host immune response lags behind viral invasion, the ability of antibody tests to detect an acute infection in its early phase is usually limited and considered inferior to NAT. However, in the case of COVID-19, NAT performance itself remains suboptimal and thus serological testing may well aid in early-phase case detection (11,12). While the present study targeted pre-exposed HCWs and was desig...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260528: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study received ethical clearance from the ethical committee of Tarbiat Modares University, Tehran, Iran.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The samples were also run at 1% agarose gel for further validation.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To this end, the LAMP products were extracted from agarose gel using the QIAquick Gel Extraction Kit (Qiagen, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LAMP</div><div>suggested: (LAMP, RRID:SCR_001740)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.18.452826: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This animal experiment protocol was approved by the Animal Ethics Committee of the School of Basic Medical Sciences at Fudan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection of adenovirus transduced mice: Six to eight week-old male mice (BALB/c) were transduced intranasally with adenovirus expressing wild-type ACE2, the D355N variant or empty control (5×1010 viral particles per mouse).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were tested routinely and found to be free of mycoplasma contamination.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% paraformaldehyde in PBS, permeablized with 0.2% Triton X-100, and incubated with the rabbit polyclonal antibody against SARS-CoV nucleocapsid protein (Rockland, 200-401-A50, 1 μg/ml) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV nucleocapsid protein ( Rockland , 200-401-A50 , 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes, cells were incubated with the secondary goat anti-rabbit antibody conjugated to Alexa Fluor 488 (Thermo #A11034, 2 μg/ml) for 2 h at room temperature, followed by staining with 4’,6-diamidino-2-phenylindole (DAPI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of FLAG-tagged ACE2 delivered by adenovirus, the sections were incubated in blocking reagent and then with FLAG M2 antibody (1:100 dilution, Sigma-Aldrich #1804) at 4 °C overnight, followed by incubation with HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral antigen detection, the sections were incubated with house-made mouse anti-SARS-CoV-2 nucleocapsid protein serum (1:5000) and HRP465 conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid protein serum</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with homemade mouse anti-SARS-CoV-2 N serum overnight at 4°C, incubated with the secondary goat anti-mouse HRP-conjugated antibody for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cultures and SARS-CoV-2 virus: HEK293T cells (American Tissue Culture Collection, ATCC, Manassas, VA, CRL-3216), Vero E6 (Cell Bank of the Chinese Academy of Sciences, Shanghai, China) and HeLa (ATCC #CCL-2) were maintained in Dulbecco’s modified Eagle medium (DMEM) (Gibco, NY, USA) supplemented with 10% (vol/vol</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene #12259) and psPAX2 (Addgene #12260) and the transfer vector with VigoFect DNA transfection reagent (Vigorous) into HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface ACE2 binding assay: HeLa cells were transduced with lentiviruses expressing the ACE2 from different species for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pShuttle-ACE2 plasmids were then electroporated 440 into BJ5183 AD-1 cells (Agilent), which were pretransformed with pAdEasy-1 to facilitate recombination with the pShuttle-CMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AD-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The transfected HEK293 cells were maintained until the cells exhibited complete cytopathic effect (CPE) and then harvested and freeze-thawed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection of adenovirus transduced mice: Six to eight week-old male mice (BALB/c) were transduced intranasally with adenovirus expressing wild-type ACE2, the D355N variant or empty control (5×1010 viral particles per mouse).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The cDNAs encoding ACE2 orthologs (Table S1) were synthesized by GenScript and cloned into pLVX-IRES-zsGreen1 vectors (Catalog No. 632187, Clontech Laboratories, Inc) with a C-terminal FLAG tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-zsGreen1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene #12259) and psPAX2 (Addgene #12260) and the transfer vector with VigoFect DNA transfection reagent (Vigorous) into HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, SARS-CoV-2 RBD (residues Thr333-Pro527), SARS-CoV RBD (residues Arg306–Leu515), or NL63-CoV RBD (residues Gln481-Ile616) with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac-Dual</div><div>suggested: RRID:Addgene_135584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 or SARS-CoV pseudotyped virus: Pseudoviruses were produced in HEK293T cells by co-transfecting the retroviral vector pTG-MLV-Fluc, pTG-MLV-Gag-pol, and pcDNA3.1 expressing the SARS-CoV spike, SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTG-MLV-Fluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTG-MLV-Gag-pol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and production of recombinant adenovirus expressing ACE2 variants: cDNA of ACE2 variants with a FLAG tag at the C-terminus was cloned into pShuttle.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle</div><div>suggested: RRID:Addgene_16402)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pShuttle-ACE2 plasmids were then electroporated 440 into BJ5183 AD-1 cells (Agilent), which were pretransformed with pAdEasy-1 to facilitate recombination with the pShuttle-CMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pAdEasy-1</div><div>suggested: RRID:Addgene_16400)</div></div><div style="margin-bottom:8px"><div>pShuttle-CMV</div><div>suggested: RRID:Addgene_16403)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed using the ImageJ program (http://rsb.info.nih.gov/ij/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We note that our conclusions are based on experiments performed in cell culture and in an artificial animal model and therefore have certain limitations. It will be important to extend this work to a real-world study, which could bridge the gap between genotype, phenotype and epidemiology. In addition, we only considered the effect of ACE2 SNVs. As the serine protease TMPRSS2 can prime the viral spike for direct fusion with the plasma membrane39, 43, SNPs in TMPRSS2 might also impact SARS-CoV-2 cell entry and be useful target of future studies. Moreover, SNPs in the 5’UTR or other non-coding regions of ACE2 were not included in this study and may also be important in regulating ACE2 transcription or translation, leading to varied ACE2 protein levels in vivo that could affect virus entry and the severity of COVID-19. Due to these limitations, we urge caution not to over interpret the results of this study. Of note, SARS-CoV-2 has evolved rapidly in humans, and a variety of genomic changes, including mutations and deletions in the spike protein, have recently been identified44, 45. Given that genetic variants will continue to arise, it is likely that we will see more genomic changes in the spike protein that might affect the spike interaction with human ACE2. Thus, it will be important to continue testing the interactions of these mutated spike proteins with the ACE2 SNVs. In summary, our study suggest that ACE2 polymorphism could impact human susceptibility to SARS-CoV-2 infec...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260600: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the CIMS (Care Institute of Medical Sciences) hospital ethics committee (CTRI/2020/05/025247).<br>Consent: The need for consent was waived off due to the nature of the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using IBM SPSS version 19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260414: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants signed informed consent at recruitment before SARS-CoV-2 antibody testing as a part of the clinical study on CP approved by the Ethics Committee of the Padova University Hospital (1).<br>IRB: All participants signed informed consent at recruitment before SARS-CoV-2 antibody testing as a part of the clinical study on CP approved by the Ethics Committee of the Padova University Hospital (1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On CP donations an in vitro microneutralization method was used for neutralizing antibodies-NA-assessment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies-NA-assessment</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260346: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The surveys were to be completed and submitted online; consent was obtained from the participants before the start of each survey, which would be administered by a trained medical student helper.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Under this consideration, we deemed random visits of elderly face-to-face to have a high risk of infection.[11] Therefore, our study opted to interview the close relatives of our medical students who live within the same household as a safer and more effective way for medical students and participants to reduce the risk of infection.[11] A total of 59 medical student helpers (Supplementary Data 2) were recruited in September 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was carried out using IBM Statistical Package for Social Sciences (SPSS) Version 26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This may be explained by the fear of COVID-19 infection within the Hong Kong population, prompting citizens to avoid public transport and practice social distancing.[15] Having previously experienced the SARS epidemic of March 2003, many Hong Kong citizens are still fearful of unknown infectious diseases.[16] Given that telemedicine carries no risk of infection compared to traditional face-to-face consultations,[17] it certainly has value under an epidemic or pandemic scenario; however, it has been shown in literature that telemedicine would underperform in hands-on procedures, such as physical examination or postoperative care.[18] Nonetheless, with rapid technological advancements, these limitations may soon be overcome. Hence, it is therefore reasonable to infer that the nature and benefits of telemedicine potentially outweigh its limitations under a severe outbreak scenario, including an epidemic or even pandemic. For both “severe outbreak” and “after pandemic” scenarios, expectation of government subsidies for telemedicine services was the strongest common driver of telemedicine use. It was also the only statistically significant positive independent predictors of considering telemedicine use for after the COVID-19 pandemic ends. For example, the Elderly Health Care Voucher Scheme was launched in Hong Kong in 2009, aiming to provide financial incentives to elderly when seeking medical services in the private sector so as to alleviate stress placed on the public healthcar...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260603: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study approval: All participants provided written informed consent and all protocols were approved by the Cedars-Sinai institutional review board.<br>IRB: Study approval: All participants provided written informed consent and all protocols were approved by the Cedars-Sinai institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coupling efficiency was confirmed by incubation of 625 beads from each coupled region with a phycoerythrin-conjugated anti-6× HisTag antibody (Abcam, Cambridge, UK) at a concentration of 10 μg/mL for 45 min shaking at 900 rpm and room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6× HisTag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, after washing with PBS/0.1% Tween 20 the beads were incubated with R-phycoerythrin-labelled goat anti-human IgG detection antibody (Ab) (5 µg/ml, Dianova, Hamburg, Germany) for 1 h at RT and washed again.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the current study, we included all participants (n=177) who had confirmed evidence of prior SARS-CoV-2 infection based on presence of positive anti-nucleocapsid IgG serology results (Abbott Diagnostics, Abbott Park, Illinois) (19).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Several limitations of our study merit consideration. Our cohort includes HCWs from a single center who volunteered and responded to surveys, potentially limiting generalizability. We have a relatively small number of male subjects (n=63) that may have limited the ability to detect potential additional predicators of post-COVID autoimmunity; thus, further investigations of larger sized samples are needed. Although this was a prospective study, the survey method involved requesting participants to self-report symptoms occurring up to 6 months prior to the blood draw, contributing to potential recall bias. Whether examined subjectively or objectively, symptomatology can vary not only between but also within individuals over time. Similarly, the status of AAB reactivity may change over time and in relation to the timing of initial or repeated exposures. Thus, future longitudinal studies are warranted to understand temporal trends in similarly measured exposure and outcomes. In summary, this comprehensive study of AABs to a wide array of antigens found that male sex carries the risk of diverse autoimmune activation following symptomatic COVID-19 illness, whereas female sex carries risk for a distinct profile of autoimmune activation following asymptomatic SARS-CoV-2 exposure. Importantly, both sets of sex-specific AAB reactivity patterns were found to persist up to 6 months following associated symptomatology. Further understanding the nature of triggered and persistent AAB activ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.19.452771: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Blood was drawn at the NYU Vaccine Center with written consent under IRB approved protocols (IRB 18-02035 and IRB 18-02037).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization titers of sera, monoclonal antibody and soluble ACE2 (sACE2)14 were determined as previously described13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260285: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The UCSF Institutional Review Board (IRB) granted a waiver of consent under IRB protocol #17-24056.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also processed negative control samples (water and HeLa cell RNA) to account for background contamination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Metagenomic analysis of respiratory viruses: Samples were processed through the IDSeq pipeline36,37, which performs reference based alignment at both the nucleotide and amino acid level against sequences in the National Center for Biotechnology Information (NCBI) nucleotide (NT) and non-redundant (NR) databases, respectively, followed by assembly of the reads matching each taxon detected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IDSeq</div><div>suggested: (IDseq, RRID:SCR_019038)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human gene expression quantification: Following demultiplexing, sequencing reads were pseudo-aligned with kallisto39 (v. 0.46.1; including bias correction) to an index consisting of all transcripts associated with human protein coding genes (ENSEMBL v.99), cytosolic and mitochondrial ribosomal RNA sequences, and the sequences of ERCC RNA standards.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENSEMBL</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The design formula for the direct comparison between children and adults with SARS-CoV-2 was ∼log10(rpM) + age cohort, where age cohort was either “children” or “adults”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations that should be kept in mind: 1) a larger sample size would have increased the generalizability of our findings; 2) we could not directly control for timing since onset of infection; 3) proteomic measurements may have provided additional insight but were not possible from the available swab specimens, which were collected into a virus inactivating agent; 4) our findings regarding tissue cellular composition require validation by single-cell sequencing; and lastly, 5) the majority of subjects with COVID-19 had mild disease at the time of sampling and did not require hospitalization. Results may have differed if specimens from a greater proportion of severely ill individuals had been available, however, this likely resulted in a more relevant comparison since few children develop severe disease. Taken together, our findings suggest children elicit a more robust pro-inflammatory and adaptive immune response to SARS-CoV-2 infection in the upper airway compared to adults but an overall comparable type I interferon response. Children, unlike adults, also display decreased proportions of ciliated cells, the primary targets of SARS-CoV-2, upon infection with the virus. These differences in the upper airway immune response and tissue composition may both contribute to the protection of children from severe disease in the lower respiratory tract. Further study is warranted to unravel why children are better protected specifically against SARS-CoV-2, or ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260439: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We designed a thematic framework of seven domains (Table 2) to guide the research, based on existing vaccine readiness assessment tools and gap analyses developed for implementing Ebola virus disease (EVD) vaccines[8, 9] and COVID-19 vaccination guidelines developed by the World Health Organization (WHO).[10] Literature review: We searched Embase, MEDLINE & Global Health databases in early February 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260549: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data extraction: We searched Medline and Embase using relevant Medical Subject Headings (MeSH) termed influenza or influenza virus or flu or Corona virus, COVID-19, Novel Corona Virus, SARA-CoV-2, flu vaccine, and myocardial infarction or acute myocardial infarction or STEMI/ACS or heart attack literature published within the last five years with additional filters of human studies and customized articles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>MeSH</div><div>suggested: (MeSH, RRID:SCR_004750)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260307: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was approved by Yale Human Research Protection Program Institutional Review Board (IRB Protocol ID 2000028924).<br>Consent: Informed consent was obtained from all enrolled vaccinated HCWs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">ELISA, neutralizations, and flow cytometry analyses were blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line was obtained from the ATCC and has been tested negative for contamination with mycoplasma.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Anti-Spike and anti-nucleocapsid antibodies were serially diluted to generate a standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166, 1:5,000) diluted in dilution solution added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: Antibody clones and vendors were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hHLA-DR ( G46-6 )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 300 µl of serial fold virus dilutions were used to infect Vero E6 cells in MEM supplemented NaHCO3, 4% FBS 0.6% Avicel RC-581.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics statement: This study was approved by Yale Human Research Protection Program Institutional Review Board (IRB Protocol ID 2000028924).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Yale Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Institutional Review Board from the Yale University Human Research Protection Program determined that the RT-qPCR testing and sequencing of de-identified remnant COVID-19 clinical samples conducted in this study is not research involving human subjects (IRB Protocol ID: 2000028599).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clinical data were collected using EPIC EHR May 2020 and REDCap 9.3.6 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo software version 10.6 software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All analyses of patient samples were conducted using GraphPad Prism 8.4.3, JMP 15, and R 3.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A potential limitation in our study is that, even with our 7-day stimulation prior to analysis, it remains possible that our T cells assay failed to detect underrepresented T cell clones impacted by variant sequences when sampled in the presence of the majority of conserved peptides. Overall, our data point to a necessity of active monitoring of T cell reactivity in the context of SARS-CoV-2 evolution. The magnitude of the antibody titers in COVID-19 patients following natural infection has been directly correlated with length of infection and severity31. Here, we found that previously infected vaccinated individuals display an increased resilience in antibody responses against both “single” and combination of substitutions in the RBD region, which otherwise severely decreased neutralization activity of uninfected vaccinated individuals. Our observations of the impact of pre-existing immunity in vaccinated individuals on their ability to neutralize variants could be explained by the time window between the initial exposure (infection) and vaccination. Still, our observations provide an important rationale for worldwide efforts in characterizing the contribution of pre-existing SARS-CoV-2 immunity to the outcome of various vaccination strategies. Along with recently introduced serological tests32, such studies could inform evidence-based risk evaluation, patient monitoring, adaptation of containment methods and vaccine development and deployment. Finally, these findings sugges...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260425: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants were asked to provide informed consent and to confirm their eligibility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Demographic variables included in the analysis were age group [18 - 29 years, 30 - 49 years, 50 - 69 years and 70+], gender [Female | Male | Another gender], highest educational attainment [GCSEs/O-levels | A levels/Highers | Degree or higher degree], ethnicity [using UK Government 2011 census groups [15]] employment [Full time | Part time | Home-maker | Retired | Student | Unemployed], annual household income [Less than £15,000 | £15,000 - £24,999 | £25,000 - £39,999 | £40,000 - £59,999 | £60,000 - £99,999 | £100,000+], political views [Conservative/Right” | Floating/Centre | Liberal/Left] and UK postcode area.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Key limitations of this study were that it was non-representative and that the sampling-method was not random; meaning that the study findings are not generalisable either in the UK or elsewhere. We caution in particular that whilst vaccine dis- or mis-information did not appear to be a major influencer of vaccine choice in this UK cohort, this may not be the case in other jurisdictions. The study’s participants were disproportionately likely to be highly educated, white and aged over 50 years. Ethnic minority groups are at greater risk from COVID-19 [24,43] and are also less likely to report that they will accept COVID-19 vaccination [44] but these groups were under-represented among those responding to the survey. Facebook’s advertising policies preclude the targeting of boosted posts to specific ethnic minority groups, and we were therefore unable to influence the degree to which the advert was seen by, or engaged with by members of ethnic minority groups. The study was observational and causal links between the outcomes and statistically associated explanatory variables cannot be assumed. Additionally, covariates which were not included in the study, or any that were misclassified, could have led to residual confounding. As the study relied on self-reported information, there was scope for response bias, although we designed the questions to minimise this wherever possible. Finally, whilst the STM analysis is fully reproducible using statistical software, the assignment o...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260510: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was received by the Ethics Review Committee of Faculty of Medical Sciences, University of Sri Jayewardenepura.<br>Consent: Informed written consent was obtained from patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples from the patient cohort 1 (n=30) was used to determine the IgG and IgA antibody levels at 4 weeks since onset of illness, the ACE2 receptor blocking antibody levels and the antibodies to RBD by the HAT assay for the wild type (WT) and SARS-CoV-2 variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452680: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human intestinal tissue specimen collection: Patients with and without IBD were recruited at outpatient colonoscopy performed for colon cancer screening, surveillance, or IBD activity assessment at NYU Langone Health’s Ambulatory Care Center, New York, under an NYU Grossman School of Medicine Institutional Review Board–approved study (Mucosal Immune Profiling in Patients with Inflammatory Bowel Disease; S12-01137).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were blocked in 5% normal donkey serum (Sigma) in TBS-T at room temperature (RT) for 1 hr, followed by incubation with rabbit anti-ACE2 antibody (1:100, Abcam, ab15348) in the blocking solution at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Abcam Cat# ab15348, RRID:AB_301861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500, Abcam, ab15348) diluted in PBS containing 3% BSA overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used for immunoblotting studies: mouse anti-β-actin (1:5,000, Sigma, AC-15), rabbit anti-ACE2 (1:1,000, Abcam, ab15348), mouse anti-TMPRSS2 (1:1,000, Santa Cruz, sc-515727).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-515727, RRID:AB_2892118)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (mouse anti-rabbit and goat-anti mouse, 211-032-171 and 115-035-174, respectively) were purchased from JacksonImmunoResearch RNA deep sequencing and analysis: Organoid monolayers were cultured in differentiation media for 7 days and then were infected with SARS-CoV-2 at MOI of 4 for 24 hrs or 72 hrs before RNA extraction with 2-3 technical duplicates per line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 211-032-171, RRID:AB_2339149)</div></div><div style="margin-bottom:8px"><div>mouse, 211-032-171</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 211-032-171, RRID:AB_2339149)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A working stock of SARS-CoV-2-mNG was generated by infecting a 90-95% confluent monolayer of Vero E6 cells (ATCC CRL-1586) for 48 hrs at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons were cloned into pCR™2.1-TOPO® (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR™2.1-TOPO®</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The crypts were embedded in 30 μl of Matrigel and cultured with Human IntestiCult™ Organoid Growth Medium (OGM) (Basal Medium and Organoid Supplement, Stemcell Technologies) supplemented with 100 IU Penicillin and 100 μg/ml Streptomycin (Corning) and 125 μg/ml Gentamicin (ThermoFisher), herein referred to as expansion medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For differentiation, the human organoids were cultured with 1:1 mix of Human IntestiCult™ OGM Basal Medium and DMEM/F-12 (ThermoFisher) in the presence of 100 IU Penicillin and 100 μg/ml Streptomycin, 125 μg/ml Gentamicin and 2 mM L-Glutamine (Corning), herein referred to as differentiation medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IntestiCult™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using an EVOS FL Auto Cell Imaging System (ThermoFisher) and then processed and quantified using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upstream regulators analysis was performed by uploading the differentially expressed genes to Ingenuity Pathway Analysis software (Qiagen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical differences were determined as described in figure legend using either R or GraphPad Prism 9 software (La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260291: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Excess clinical specimens were obtained under an institutional review board (IRB) exempt protocol (IRB reference number FWH20200103E).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specimen Acquisition: The BinaxNOW™ COVID-19 Ag Card (Abbott) was used to test basic medical trainees for SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Libraries with QRS > 1.0 were denatured and diluted to a final loading concentration of 10 pM following the Illumina MiSeq System Denature and Dilute Libraries Guide (Document # 15039740 v10), and then sequenced on the MiSeq system at 2 x 151 bp using the MiSeq v3, (600 cycle) kit (Illumina, Cat. MS-102-3003)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Antigen card specimens present a few limitations when compared to NP swabs collected in viral transport media (VTM). First, in the workflow presented here, antigen test swabs are stored in 500 µL of DNA/RNA shield while NP swabs are stored in up to 3 mL of VTM. Multiple RNA extractions can be carried out from VTM specimens after the initial round RT-PCR testing but, antigen swab-derived viral RNA can only be extracted once. Next, variants with novel or interesting mutations can be cultured from VTM; enabling downstream biochemical or viral neutralization assays. In contrast, antigen tests immediately expose the specimen to an extraction buffer which disrupts the viral membrane, releases viral RNA, and enables the presentation of viral nucleocapsid antigens to anti-nucleocapsid antibodies on the LFA positive line. Thus, viruses collected post antigen-test are most likely non-culturable, however we did not evaluate cultivability. Here we only attempted to sequence from the BinaxNOW™ antigen test, but other antigen tests may also yield viable specimens for whole-genome sequencing. This work is a first step for future studies examining the sequencing utility of specimens collected for other antigen or rapid molecular tests.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260481: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260497: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: We obtained research ethics approval from the South Central-Berkshire B Research Ethics Committee (IRAS ID: 283787), and Medicines and Healthcare products Regulatory Agency approval for use of the LFIA for research purposes only.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, in each round of the study we invited a non-overlapping random community sample of adults aged 18 years or over in England, based on the National Health Service general practitioner registrations list.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(11) We estimated clinical sensitivity of the LFIA on finger-prick blood (self-read) for IgG antibodies following natural infection at 84.4% (70.5, 93.5) among RT-PCR confirmed cases in healthcare workers, and specificity 98.6% (97.1, 99.4) in pre-pandemic sera.(10,12) Here we report data on vaccine coverage and results of antibody testing based on complete, validated data from round 6 received on 28 May 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has limitations. While we approached a random sample of the population, it is possible that differential non-response may have resulted in biased estimates of prevalence and vaccine uptake. Nonetheless, we achieved a large sample and relatively high participation (over 25%) amongst those invited to take part and weighted our findings to be representative of the population of England as a whole. Antibodies detected in this study reflected anti-S IgG in response to prior infection and vaccination, but this is only one part of the protective immune response, and therefore we cannot equate presence or absence of antibody with immunity. In addition, although offering distinct advantages in terms of costs, logistics and scale, the LFIA does have limitations. Due to limited sensitivity, it does not detect low levels of antibody which may result in lower antibody prevalence estimates than some other studies (21) and potentially be of clinical significance, for example, as a marker of protection against severe disease and/or hospitalisation; as people read their own test results there will be some classification errors including the missing of faint positive lines in people with low visual acuity. On the other hand, within-study comparisons, for example, by ethnicity or deprivation, should be relatively unaffected by test performance. Nonetheless we adjust our prevalence estimates for the performance of the test, based on previous validation work,(10) as well as presenting t...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260079: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: Use of human samples for this study was approved by the University of Ottawa Ethics Review Board: Certificates H-04-20-5727, H-04-21-6643 and H-07-20-6009.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody responses in pre-pandemic serum samples of all four cohorts were tested for the presence of antibody isotypes (IgA, IgM, IgG, and IgE) and IgG subtypes (IgG1, IgG2, IgG3, and IgG4) using this ELISA binding assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Accordingly, the control calibration antibodies were prepared with appropriate dilutions to generate the calibration curve (anti-COVID Ig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-COVID Ig) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After two hours, plates were washed three times with 200uL PBS-T followed by the addition of secondary-HRP antibodies (1:3000) diluted in dilution buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>secondary-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50uL of the appropriate diluted secondary antibody-HRP was added to each well and the plates were incubated at RT for one hour of shaking (700rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-HRP</div><div>suggested: (Bioworld Technology Cat# MB001H, RRID:AB_2857326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relieff is used to predict classification rank, i.e. within the group significance, for each feature in the training set classification, of serum antibody cross-reactivity to 4 different SARS-CoV-2 antigens (N, RBD, Spike) for IgA, IgM and IgG and separately for antibodies for seasonal viruses (OC43, HKU-1, 229E, NL63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens ( N , RBD , Spike ) for IgA , IgM and IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NL63</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ELISA Antigens and Antibodies: To evaluate the functional antibody responses of sCoV antibodies against different SARS-CoV-2 proteins, SARS-CoV-2 S, RBD, and N proteins were used as coating antigen (see antigen production).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen ( see antigen production) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies: Anti-human IgG-HRP (NRC anti-hIgG#5-HRP</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control antibodies: Anti-SARS-CoV-2 S CR3022 Human IgG1 (Absolute Antibody, Ab01680-10.0), Anti-SARS-CoV-2 S CR3022 Human IgA (Absolute Antibody, Ab01680-16.0), Anti-SARS-CoV-2 S CR3022 Human IgM (Absolute Antibody, Ab01680-15.0), Anti-SARS-CoV-2 S CR3022 Human IgE (Absolute Antibody, Ab01680-14.0), Anti-SARS-CoV-2 S CR3022 Human IgG1 (Absolute Antibody Ab01680-10.0), Anti-SARS-CoV-2 S CR3022 Human IgG2 (Absolute Antibody Ab01680-11.0), Anti-SARS-CoV-2 S CR3022 Human IgG3 (Absolute Antibody Ab01680-12.1), and Anti-SARS-CoV-2 S CR3022 Human Ig4 (Absolute Antibody Ab01680-13.12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: (Abcam Cat# ab273074, RRID:AB_2847846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The concentration of antigen, antibodies, and sample diluents were kept as above, although the volume was reduced to 10uL per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen ,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 229E RBD (P15423) was cloned in pCAGGs plasmid with a hexa-his Tag (C-term) with secretory signal (N-term) and transfected into 293F cells maintained in Freestyle 293 expression media (Thermo Fisher, 12338018) at 37°C, 7% CO2, with shaking (125rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6 – FLAG tag was synthesized by Genscript with codon-optimization for expression in CHO cells.A biotin acceptor peptide sequence (BAP: GLNDIFEAQKIEWHE) was added in-frame at the C-terminus of ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA was cloned into pTT5 and ACE2-BAP cDNA was expressed by transient gene expression in CHO55E1 cells as described above with the addition of 5% (w:w) of pTT5-BirA (E. coli biotin ligase) expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO55E1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 229E RBD (P15423) was cloned in pCAGGs plasmid with a hexa-his Tag (C-term) with secretory signal (N-term) and transfected into 293F cells maintained in Freestyle 293 expression media (Thermo Fisher, 12338018) at 37°C, 7% CO2, with shaking (125rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGs</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike ectodomain (SARS2: MN908947; OC43: AAT84362.1; HKU1: Q0ZME7.1) cDNA constructs with furin site mutated, two stabilizing prefusion proline mutations, the human resistin as trimerization partner and a C-terminal FLAG-(His)6 (SARS2) or FLAG-Twin Strep Tag-(His)6 (OC43 and HKU1) tag were cloned into pTT241 vector and transfected in CHO2353 to generate stable pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT241</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nucleocapsid (SARS2: YP_009724397; OC43: AY391777; HKU1: HM034837) cDNAs with a C-terminal FLAG-Twin Strep Tag-(HisG)6 tag were synthesized by Genscript (Cricetulus griseus codon bias) and cloned in the cDNA into pTT5™ expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA was cloned into pTT5 and ACE2-BAP cDNA was expressed by transient gene expression in CHO55E1 cells as described above with the addition of 5% (w:w) of pTT5-BirA (E. coli biotin ligase) expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div><div style="margin-bottom:8px"><div>pTT5-BirA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing activity was determined by calculating the % inhibition against SARS-CoV-2 S proteins using the following equation:Statistical and Machine learning analyses: Data analysis was conducted using GraphPad Prism v9, R and Matlab 2021a (Matworks Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample clustering was performed using fuzzy c-means (FCM) clustering method (fcm function running under Matlab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.15.452549: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 14, 15, 16, 17 and 18. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260471: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: This study was approved by the ethical committee of Clementino Fraga Filho University Hospital, from Federal University of Rio de Janeiro (<br>Consent: All patients or a member of their families signed the consent form.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients under 18 years old, pregnant women and with cancer were excluded from this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real Time RT-PCR with TaqMan assays: All patient samples were analyzed for SARS-Cov-2 N2 and human RNAseP targets using a commercial One-Step RTqPCR TaqMan kit,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-Cov-2 N2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primer-BLAST search (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) using the sequences of each primer pair and allowing up to 4 mismatches (none in the 3’ s end) in the complete set of the NCBI database (non-redundant sequences) resulted only in SARS-CoV-2 and RNAse P gene related-sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/tools/primer-blast/</div><div>suggested: (Primer-BLAST, RRID:SCR_003095)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Student’s t-test or Mann– Whitney Rank Sum test was used to analyze the statistical significance of the observed differences (according to the parametric or nonparametric distribution of the values, respectively) with SigmaPlot for Windows version 12.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SigmaPlot</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260431: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260544: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Viruses and cells: The use of deidentified positive specimens for the above studies was approved by the University of Washington Institutional Review Board (STUDY00010205).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were permeabilized with 0.1% 100X Triton in 1× PBS for 15 min and then incubated with a primary, cross-reactive rabbit anti-SARS-CoV N monoclonal antibody (Sinobiological, distributed by Thermo Fisher, Cat. #40143-R001 at a dilution of 1:20,000) followed by a peroxidase-labelled goat anti-rabbit antibody (SeraCare, Milford, MA, USA, Cat. #5220-0336 diluted to 1:2,000) and then the peroxidase substrate (SeraCare, Cat. #5510-0030).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (SeraCare KPL Cat# 5220-0336, RRID:AB_2857917)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 or Vero E6-TMPRSS2 cells were seeded in diagonally adjacent wells of 24 well plates (12 wells seeded/plate to minimize cross contamination risk) at 3.5⨯105 cells/well one day prior to infecting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial ten-fold dilutions of clarified viral supernatants were used to inoculate Vero E6 cell monolayers (60,000 cells/well seeded one day prior) in 96□well white polystyrene microplates (Thermo Fisher, Cat. #07-200-628).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each 30 µl PCR reaction contained 5 µl of cDNA, 4.7 µl water, 14.3 µl NoROX (Qiagen, Cat. #204745), 0.7 µl Hi Rox (Qiagen, Cat. #204545), 2.5 µl each of 10 uM Tag-F and E_Sarbecco-R primers, and 0.3 µl of 10 µM E_Sarbecco-P probe.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cat.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentration of the resulting RNA was determined first by NanoDrop spectrophotometer of two high-concentration dilutions (approximately 1 µg/µl and 100 ng/µl) measured in duplicate followed by a dilution in PBS to an approximate concentration of 2×1011 copies/mL, and then by reverse transcription droplet digital PCR (RT-ddPCR) system (Bio-Rad, Hercules, CA, USA) of two low-concentration dilutions (approximately 100 and 10 copies/µl) measured in duplicate with the Mills-sgE primer/probe set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NanoDrop</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are a number of limitations to the work presented here. Most importantly, it is not known whether viral isolation is a perfect laboratory correlate for viral infectivity and transmission in humans, which can vary significantly by time, distance, anatomy or mask wearing, and host immune status. We did not specifically convert CT to viral load given the multiple loci and tests investigated and the presence of mixed genomic and subgenomic transcripts for certain qRT-PCR sets. CT values are strongly assay-and instrument-dependent, and so other labs would need to validate the sensitivity of these primers against independent standard curves in order to calibrate assay performance before putting either the WHO-E CT limit or the Mills-sgE assay into use in their own labs. Finally, this work raises several important questions regarding the basic virology of SARS-CoV-2. The variation in viral titers generated from samples harvested at similar levels of CPE is intriguing, especially as we observed relatively little variation in RNA levels seen in these same samples (Supplemental Table S2). Potential variations in the ratio of infectious virus titers to RNA levels has important implications, as current dogma generally assumes a constant relationship between total RNA and levels of infectious virus in clinical samples. Higher levels of viral RNA correlate with poorer clinical outcomes for instance [38], but in general it has been difficult if not impossible to routinely measure infe...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.04.27.21256156: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.09.21260271: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed the model fitting, model simulations, and visualisation of results using MATLAB 2019b.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As such infections that are confirmed by PRC but where the S-gene is not detected (often termed as ‘S-gene failures’) provide a key indicator for the geographic spread of the Alpha variant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRC</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Accordingly, our study has several limitations. Regarding transmission, our model captures the impact of community prevalence on within-school transmission, but does not capture the impact of within-school transmission on community prevalence. In reality, within-school epidemics may increase community prevalence in extremely local areas (smaller than that of an LTLA), which would then be expected to increase transmission in schools as a damped feed-back loop. Our study assumes homogeneous onwards transmission rates from infected pupils within a given secondary school. In reality, onwards transmission rates are likely heterogeneous between pupils, with transmission rates likely a function of viral load 57 which is heterogeneous both in time and between individuals. Previous studies accounting for this heterogeneity, through the incorporation of within-host viral dynamics 28 obtained similar results to our previous study 27, though the inclusion of heterogeneity may impact the cluster sizes of epidemics in schools 58. Regarding testing, our model assumes that the proportion of pupils taking an LFT test on a given day is equivalent to the local proportion of 10-19 year olds in that school’s LTLA taking an LFT test on a given day, i.e. we assume uptake is homogeneous across schools within a region. In reality, there may be significant heterogeneity between schools even within a local area. Further, we assume that pupils have a given probability of taking an LFT test to satisfy a ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260496: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants or their parent/guardian provided informed consent online via SnapSurvey, and completed a short questionnaire prior to the sampling day.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology was performed on the Abbott Architect using a chemiluminescent microparticle immunoglobulin G (IgG) immunoassay targeting the nucleoprotein (N) (SARS-CoV-2 IgG, Abbott Commerce Chicago, USA) with a seropositivity threshold of 0.8 (henceforth referred to as Abbott N assay).(18) This assay was shown to detect SARS-CoV-2 N-antibodies as early as 7 days post symptom onset and is, therefore, particularly useful for assessing SARS-CoV-2 antibody seroconversion (negative to positive antibodies) between testing rounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology was performed on the Abbott Architect using a chemiluminescent microparticle immunoglobulin G (IgG) immunoassay targeting the nucleoprotein (N) (SARS-CoV-2 IgG, Abbott Commerce Chicago, USA) with a seropositivity threshold of 0.8 (henceforth referred to as Abbott N assay).(18) This assay was shown to detect SARS-CoV-2 N-antibodies as early as 7 days post symptom onset and is, therefore, particularly useful for assessing SARS-CoV-2 antibody seroconversion (negative to positive antibodies) between testing rounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The decision to recommend COVID-19 vaccination for teenagers should consider the added value of vaccinating a group with a high prevalence of natural immunity or, alternatively, whether a single dose, or a lower dose, might be sufficient to confer immunity whilst limiting the risk of potential adverse events, including myocarditis in teenagers and young adults.(37-40) Reassuringly, from 18 June 2020, all school staff are now eligible for vaccination – the School Infection Survey recently reported that 85% of staff had received at least one vaccine dose by May 2021.(23, 41) Limitations: The strength of this surveillance lies in the rapid recruitment and longitudinal assessment of secondary schools as soon as they reopened after national lockdown in September 2020. There are, however, some limitations. We only recruited schools in regions where we had paediatric investigation teams to take blood samples from large numbers of staff and students. Our schools are, therefore, not intended to be representative of all secondary schools in England. We avoided recruiting some secondary school years with end-of-year national examinations to minimise disruption of their education. Additionally, as already discussed, we were unable to assess whether the confirmed infections occurred within or outside the school premises. We are currently conducting a larger national School Infection Survey (SIS) involving 150 schools across England during the 2020/21 academic year.(42)
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260488: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All patients provided written informed consent.<br>IRB: The study was approved by the Health Research Authority, Research Ethics Committee (Reference: 20/WA/0123).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: Serological assessment was performed on the Abbott Architect SARS-CoV-2 IgG Quant II CMIA which reports a quantitative anti-Spike antibody titre.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: Spike protein antibodies (anti-S) were detected using the Abbott Architect SARS-CoV-2 IgG Quant II CMIA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Performance Analysis: The primary outcome of the study was sensitivity and specificity of each LFIA in detecting SARS-CoV-2 IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ability of sera to neutralise SARS-CoV-2 virus was assessed by neutralisation assay on Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were serially diluted in OptiPRO SFM (Life Technologies) and incubated for 1h at room temperature with 100 TCID50/well of SARS-CoV-2/England/IC19/2020 and transferred to 96-well plates preseeded with Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: Serological assessment was performed on the Abbott Architect SARS-CoV-2 IgG Quant II CMIA which reports a quantitative anti-Spike antibody titre.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with MedCalc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphical analyses was performed using GraphPad Prism 9.1.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In terms of study limitations it is important to note that, although the LFIAs were self-tested in the clinic or vaccination centre, participants had access to support from trained healthcare professionals when required. This does not fully replicate the ‘real-world’ application of LFIAs where users will be following a detailed guide in their own homes. Furthermore, the patient cohort includes healthcare workers and as such may demonstrate a greater affinity for self-testing than members of the general population. However, the primary purpose of this study was to evaluate the diagnostics accuracy of the test. The performance of the LFIA evaluated is sufficiently good that it can continue to play a helpful role in the assessment of population antibody responses resulting from widespread infection and high levels vaccination coverage, particularly given the correlation of LFIA results with the functional measure of live virus neutralisation. Over time, antibody titres will begin to wane and ongoing population surveillance may have a helpful role in informing decisions on priority groups and timing of booster vaccines.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452441: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TwinStrep-tagged protein expression and purification: RBDWT, RBDQ498Y and RBDβbaculovirus were used to infect Sf9 cells in a 1:2000 dilution, for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBDQ498Y-ACE2 complex crystallization: Sf9 insect cells were infected with RBDQ498Y and TwinStrep-tagged ACE2 (1:2000) separately for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBDQ498Y-ACE2 complex crystallization: Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were digested from delivery generic vectors using BamHI and NotI restriction enzymes (FastDigest) and cloned in the pAcGP67A transfer vector using Optizyme™ T4 DNA Ligase (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAcGP67A</div><div>suggested: RRID:Addgene_41812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An N-terminal TwinStrep tag and 3C site containing version of ACE2 with no His tag was generated by PCR using ACE2 plasmid DNA as template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:Addgene_164219)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure was solved by molecular replacement using Phaser and previously deposited coordinates for RBDWT-ACE2 complex (PDB accession number 6M0J) as template, and refined using Phenix.refine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final molecule was generated after several cycles of manual building in Coot followed by refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260476: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While our study is the first to examine the effects of stay-at-home orders on rural and urban areas, it has limitations. We focused on stay-at-home orders without considering the heterogeneity of what constituted these orders on the local level and did not separately weigh the impacts of additional measures such as school closures, nonessential business closures, prohibition of large gatherings, and mandatory masking. However, it would be difficult to separate these effects as most restrictions were implemented concurrent with, and worked in tandem to, stay-at-home orders. COVID-19 case data may be biased by differences in testing availability. However, because testing was more limited in rural than urban areas,57 our findings are likely an underestimate of the true difference in infection rates between urban and rural counties. We were not able to examine hospitalization and ICU utilization rates in rural and urban counties as these data are not uniformly available at the county-level. Finally, our study does not take into account potential residual or unmeasured confounders that may explain the difference in infection rates between rural and urban counties outside of stay-at-home order implementation. We accounted for this by using a random intercept in our analysis, but due to the absence of granular data at the county-level, potential confounding would be impossible to eliminate completely. High rates of COVID-19 in rural counties, along with the suppressed effect of stay...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.16.452629: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All SARS-CoV-2 work was carried out under BSL3 conditions in a dedicated facility in QUB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines were routinely tested for mycoplasma contamination and no evidence of contamination was detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stocks were prepared in Vero or VeroE6 cells in DMEM containing 2.5% FCS (v/v) infected at a low MOI (~0.001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Near confluent monolayers of Vero cells in 24 or 6 well plates were infected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Continuous cell line culture: In this study, 3 continuous cell lines were used: Vero wildtype (number), Vero E6, and Vero E6 expressing human ACE2 and TMPRSS2 (VAT) (Rihn et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following PCR, the amplicons from pools A & B were combined, and the resulting pooled amplicons (98 x 450 bp overlapping tiled amplicons, spanning the SARS-CoV-2 genome) were purified using Kapa HyperPure beads (Roche Molecular Systems Inc) and quantified using a Qubit fluorometer and dsDNA HS Assay Kit (Thermo Fisher Inc, Manchester, UK)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Inc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis: The FASTQ files were uploaded into the Galaxy web platform, and we used the public server at usegalaxy.eu to analyse the data (Afgan et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260482: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, our study was not without limitations. A number of patients from the original study who did not cooperate in the second study could change the current result. A small number of cases had full workup of paraclinical data and chest imaging in the electronic system of the hospital from the original study; therefore, finding an association between blood marker and long-COVID symptoms was not possible. Future studies to explore the association between symptom categories and inflammatory markers in the acute phase and long-COVID symptoms could shed new light on the underlying mechanism of the post-acute phase in people suffering from COVID-19.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260394: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional socioecological variables were extracted for each country from the World Bank dataset (https://data.worldbank.org/) including 5-year averages (2015-2019) for per capita GDP (in current USD), percent of the population living in urban areas (hereafter ‘percent urban’), and per-capita health care expenditure (hereafter ‘health spending’).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://data.worldbank.org/</div><div>suggested: (Data World Bank, RRID:SCR_012767)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As with any model at a global scale, there are important limitations. For example, our models cannot capture important regional differences and cannot directly infer individual-level mechanisms. Moreover, our models utilise WHO confirmed case and death data that are likely considerable underestimates of the true scale of this global emergency. Nonetheless, the overall strong relationship between cases and deaths supports the idea that modelling the case data is of utility as COVID-19 deaths are generally better reported than cases [58]. The weak relationship between cases and tests is not surprising as it has been demonstrated that regional differences can vary by country [1]. Moreover, while we assembled a diverse set of predictors, this dataset is not comprehensive. We aimed to maximise the number of countries we included in the analysis without introducing large amounts of missing data. However, the predictive performance of our models was surprisingly high, and few model estimates of cases and deaths not including the observed values for each country (Fig. 4). Countries such as Tanzania, for which our model overpredicted cases and deaths, may warrant increased attention and surveillance. Our study shows that for any global analysis of SARS-CoV-2 dynamics, the patterns of other pathogens can provide important insights. At a broad spatial scale, variations in climate are likely to be less critical than variations in contemporary and historical exposure to a diverse array of...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260442: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Lancet devices (27 ga.) and Whatman 903 protein saver collection cards were sent to volunteers with instructions and consent form approved by the SUNY Polytechnic Institute Institutional Review Board (protocol #IRB-2020-10 and #IRB-2021-2).<br>IRB: Lancet devices (27 ga.) and Whatman 903 protein saver collection cards were sent to volunteers with instructions and consent form approved by the SUNY Polytechnic Institute Institutional Review Board (protocol #IRB-2020-10 and #IRB-2021-2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence intensity of all spots was normalized to the human IgG (Hum IgG) internal control spots on each chip, to account for variability between individual chips and individual experiments, generating a “GC-FP detection ratio” for every protein/antigen included in the GC-FP microchip (12):To determine if GC-FP antibody binding data for 2019 SARS CoV2 vs. B.1.1.7 and B.1.351 variant antigens was consistent with standard methods, an ELISA-based ACE2 competitive binding assay (Ray Biotech) was used, as per the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ciencia image analysis LabView software was used to define a region of interest (ROI) for each individual spot on the GC-FP biosensor chip and the fluorescence intensity of each spot was measured.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LabView</div><div>suggested: (LabView , RRID:SCR_014325)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent binding inhibition was calculated for each sample by the following method:
Data Analysis: GC-FP diagnostic ratio data and percent binding inhibition data for the ACE2 competitive assay were analyzed using GraphPad Prism 8.0 software (ROC analysis, correlation, and statistical analysis).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260417: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics committee of AIG Hospitals & CSIR-CCMB and the informed consent was waived.<br>Consent: The study was approved by the Ethics committee of AIG Hospitals & CSIR-CCMB and the informed consent was waived.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing: Base calling was performed on raw image data using bcl2fastq v2.20.0.422 (Illumina).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FASTQC v0.11.9 (7) was used to assess the quality of reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimmomatic was used to trim poor quality bases and adapter sequences (8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapping of reads to the indexed reference genome NC_045512.2 was done using HISAT2 v2.1.0 (9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coverage across the genome was calculated using samtools depth.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was visualized using the ggplot2 package in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21259962: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260412: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The study was approved by the Committee for Medical Research Ethics Region South East Norway (118684) and by the Norwegian Medicines Agency (20/04950-23) and registered in ClinicalTrials.gov (NCT04321616).<br>IRB: The study was approved by the Committee for Medical Research Ethics Region South East Norway (118684) and by the Norwegian Medicines Agency (20/04950-23) and registered in ClinicalTrials.gov (NCT04321616).<br>Consent: All participants gave informed consent prior to inclusion, either by themselves or a legally authorised representative.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participants: NOR-Solidarity is a multicentre, open label, adaptive randomised clinical trial evaluating the effect of antiviral drugs on hospitalized COVID-19 patients admitted to 23 Norwegian hospitals(12).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma levels of LBP, intestinal fatty acid binding protein (IFABP), CCL25 and regenerating islet-derived protein 3α (REG-3α) were measured in duplicate by enzyme immunoassays (EIA) using commercially available antibodies (R&D Systems, Minneapolis, MN) in a 384 format using a combination of a SELMA (Jena, Germany) pipetting robot and a BioTek (Winooski, VT) dispenser/washer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>binding protein (IFABP)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL25</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control and quantification of pooled libraries were performed using Agilent Bioanalyzer (Agilent Technologies, USA) and Kapa Library Quantification Kit (Kapa Biosystems, London, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence processing and bioinformatics: Paired-end reads containing Illumina Universal Adapters or PhiX were discarded using bbduk version 38.90 (BBTools, https://jgi.doe.gov/data-and-tools/bbtools/) (parameters adaptor filter: k=23 hdist=1 tbo cf=TRUE ftm=5. parameters phix filter: k=31 hdist=1) and the remaining reads were demultiplexed using cutadapt version 3.3(19) (parameters:-e 0.1 --no-indels --overlap 12 --discard-untrimmed --action none).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://jgi.doe.gov/data-and-tools/bbtools/</div><div>suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Taxonomic classification of ASVs was done based on RESCRIPt(23) in QIIME2 using a naïve Bayes classifier trained on the V3-V4 region of a preclustered version (99% sequence similarity) of the Silva database version 138(24)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Silva</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential abundance testing with LEfSe(26) was done on the rarefied dataset, while for differential abundance testing with ALDEx2(27), a prevalence-filtered (25% most prevalent) version of the non-rarefied dataset was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALDEx2</div><div>suggested: (ALDEx2, RRID:SCR_003364)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS release 26.0.0.1 and 27.0.0.0 were used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The present study has some limitations. Due to logistic constraints of launching a randomized trial during the first wave of the pandemic, the gut microbiota samples were only collected at the three-month follow-up. We therefore cannot relate the long-term microbiota alterations to potential microbiota alterations during hospitalization. Also, the analysis of microbiota composition was only performed in one cohort, and without a validation panel these must be considered explorative. Moreover, pulmonary function tests beyond P/F-ratio were only performed at three-month follow-up, eliminating the possibility for baseline comparisons. The study also has obvious strengths, including standardized data capture in a randomized trial with longitudinal biobanking, as well as comprehensive long-term follow-up with blood tests, microbiota sampling and assessment of pulmonary function by DLCO. Also, to our knowledge, our study is the first to link pulmonary function to gut microbiota alterations in COVID-19. In conclusion, the decreased microbial diversity and compositional gut microbiota alterations in patients with persistent respiratory dysfunction, as well as the association of persistently raised LBP levels with these clinical features, point to a potential gut-lung axis in COVID-19. These observations could be related to not only acute respiratory failure during hospitalization, but also to long-term COVID-19 morbidity. Our findings warrant further research on the potential role of...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04321616</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Efficacy of Different Anti-viral Drugs in COVID 19 Infec…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21259739: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260387: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21258827: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">They were uncastrated males – a German Shepherd, a Giant Schnauzer, a Border Collie and a Jagdterrier.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.11.21260318: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Study limitations include the retrospective design, being based on the most recent version of the ‘truth data’ for all the weeks at the time of analysis, instead of the numbers of COVID-19 deaths that were reported at the time the forecasts were submitted. We have shown that there were several states for which there were notable effects of updates in death counts, due to reporting delays, and this adversely affected the accuracy of the forecasts of all the combining methods and models. However, this issue only had a minor effect on the relative performances of the methods, and did not alter our overall conclusions. Our reported findings are limited to U.S. data and the forecasts from the COVID-19 Forecast Hub, and so it is possible that different results may arise when applying the combining methods to forecasts from a different set of models, or using other data, such as forecasts for other locations, or predictions of COVID-19 cases or hospitalisations. These are interesting potential avenues for future research. The forecasts in our dataset were produced weekly for 1 to 4 week ahead horizons, and we acknowledge that conclusions could be different for different time-scales. Our ability to detect statistical differences was limited by the small sample sizes, with only 17 locations in each category, missing data and a relatively short out-of-sample period. This research has important policy implications as forecasts from models have been placed at the forefront of public heal...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260227: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Jude Institutional Review Board approved the study.<br>Consent: Participants provided written informed consent prior to enrollment and then completed regular questionnaires about demographics, medical history, treatment, and symptoms if positively diagnosed by PCR with SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD8 BV711-conjugated (Biolegend, 344734, clone SK1)) and TotalSeq-C antibodies (1 µL anti-human CCR7 (Biolegend 353251), 1 µL anti-human CD45RA (Biolegend 304163)) and 2 µL of TotalSeq-C anti-human Hashtag antibodies 1-10 (Biolegend 394661, 394663, 394665, 394667, 394669, 394671, 394673, 394675, 394677, 394679) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD8 BV711-conjugated ( Biolegend , 344734</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TotalSeq-C</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CCR7</div><div>suggested: (BioLegend Cat# 353251, RRID:AB_2800943)</div></div><div style="margin-bottom:8px"><div>anti-human CD45RA</div><div>suggested: (BioLegend Cat# 304163, RRID:AB_2800764)</div></div><div style="margin-bottom:8px"><div>anti-human Hashtag antibodies 1-10 ( Biolegend 394661 , 394663 , 394665 , 394667 , 394669 , 394671 , 394673 , 394675 , 394677 , 394679</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In each batch, each PBMC sample was uniquely labeled with a DNA-barcoded hashing antibody (TotalSeq-C anti-human Hashtag antibodies 1-10, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Hashtag antibodies 1-10 , Biolegend) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface expression of HLA was confirmed via flow cytometry using antibodies against HLA-A, B, C (PE-conjugated, Biolegend 311406, clone W6/32)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against HLA-A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transduction was confirmed by expression of mCherry, and surface TCR expression was confirmed via flow cytometry using antibodies against mouse TCRβ constant region (PE-conjugated, Biolegend 109208, clone H57-597) and human CD3 (Brilliant Violet 785-conjugated, Biolegend 344842, clone SK7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human CD3</div><div>suggested: (BioLegend Cat# 344842, RRID:AB_2616891)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with 1 µL Ghost Dye Violet 510 Viability Dye (Tonbo Biosciences 13-0870-T100) and a cocktail of surface antibodies: 1 µL each of anti-human CD8 (Brilliant Violet 785-conjugated, Biolegend 344740, clone SK1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD8</div><div>suggested: (BioLegend Cat# 344740, RRID:AB_2566202)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following fixation and permeabilization, cells were washed twice with 1X Perm/Wash buffer and stained with a cocktail of intracellular antibodies: 1.25 µL of anti-human IFNγ (Alexa Fluor 647-conjugated, Biolegend 502516, clone 4S.B3) and 1 µL anti-human CD69 (PerCP-eFluor710-conjugated, eBioscience 46-0699-42, clone FN50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFNγ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD69</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For hCoV and SARS-CoV-2 antibody detection, 384-well microtiter plates were coated overnight at 4 °C, with recombinant proteins diluted in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA plates were washed and incubated for 30 minutes at room temperature with anti-human secondary antibodies diluted in 1% milk in PBS-T: anti-IgG (1:10,000; Invitrogen, A18805).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary</div><div>suggested: (Thermo Fisher Scientific Cat# A18805, RRID:AB_2535582)</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A18805, RRID:AB_2535582)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K562 cells (ATCC CCL-243) were transduced, then antibiotic selected for one week using 2 µg/mL puromycin in Iscove’s Modified Dulbecco’s Medium (IMDM; Gibco) containing 10% FBS and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat 76.7 cells (a gift from Wouter Scheper; variant of TCR-null Jurkat 76.7 cells that expresses human CD8 and an NFAT-GFP reporter) were transduced, then antibiotic selected for 1 week using 1 µg/mL puromycin in RPMI (Gibco) containing 10% FBS and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat 76.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tetramer generation and Jurkat Cell line staining: Biotinylated HLA-B*15-monomers loaded with NQKLIANQF (SARS-CoV-2) and NQKLIANAF (CCCoV) versions of the peptide were tetramerised using TotalSeq-C-0951-PE-Streptavidin (Biolegend 405261) and TotalSeq-C-0956-APC-Streptavidin (Biolegend 405283).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was generated by transfecting 293T packaging cell line (American Type Culture Collection (ATCC) CRL-3216) with the pLVX lentiviral vector containing the HLA-B*15:01 insert, psPAX2 packaging plasmid (Addgene plasmid #12260), and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX</div><div>suggested: RRID:Addgene_101121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sequence was cloned into the pLVX-EF1α-IRES-Puro lentiviral expression vector (Clontech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1α-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was generated by transfecting 293T packaging cell line (ATCC CRL-3216) with the pLVX lentiviral vector containing the TCR-mCherry insert, psPAX2 packaging plasmid (Addgene plasmid #12260), and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study data are collected and managed using REDCap electronic data capture tools hosted at St. Jude (Harris et al. 2009; 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resulting GEX matrices were analysed with the Seurat R package version 3.2.3 (Stuart et al. 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed twice with 1X Perm/Wash buffer and analyzed by flow cytometry on a custom-configured BD Fortessa using FACSDiva software (Becton Dickinson)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:An important limitation of our study is that we could not compare the effect of one vs two doses of mRNA vaccine in individuals with pre-existing immunity. It has been suggested in multiple studies that a second vaccine dose in individuals with pre-existing immunity does not further increase antibody levels from the first dose (Wang et al. 2021; Mazzoni et al. 2021; Krammer et al. 2021; Goel et al. 2021; Ebinger et al. 2021; Camara et al. 2021), but the effect on T cells remains to be studied. We found an increase in the fraction of EMRA T cells in fully vaccinated subjects with pre-existing immunity. Whether or not this increase is associated with more (or less) durable and efficient protection is not clear. Longer term follow-up studies of the durability of memory in vaccine-only, infection-only, and vaccinated after infection groups should closely monitor the phenotype of antigen-specific T cell responses. Precise measurement of epitope-specific T cell and B cell responses is crucial for defining the correlates of SARS-CoV-2 protection, which will inform vaccination strategies to prevent pandemic recurrence as additional SARS-CoV-2 variants emerge. The striking similarity between the phenotypes and constituent repertoires of epitope-specific CD8 T cell responses following infection, vaccination, or infection followed by vaccination, indicate that mRNA vaccines are capable of inducing equivalent memory as an infection episode and further expanding these responses if previou...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362995</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">St. Jude Tracking of Viral and Host Factors Associated With …</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 25, 26 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260386: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All study participants provided written informed consent, and all study procedures were approved by the Mayo Clinic Institutional Review Board.<br>IRB: All study participants provided written informed consent, and all study procedures were approved by the Mayo Clinic Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Assays: The neutralizing antibody response was assessed using a high-throughput, fluorescence/GFP-based pseudovirus/VSV microneutralization assay4, further developed in our laboratory to allow rapid imaging/quantification of cell infection with the ImageXpress® platform/software (Molecular Devices).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageXpress®</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260382: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the Ethics Committee of the national research institute of tuberculosis and lung diseases (approval number: IR.SBMU.NRITLD.REC.1399.037).<br>Consent: Written informed consent was obtained from all participants or their legal guardians.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies which is used for flow cytometry were phycoerythrin (PE)-conjugated anti-human CD4, CD19, CD16/56 antibodies (PharMingen, USA) to staining CD4 T cells, CD19 for B cells, CD16/56 for NK cells, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16/56</div><div>suggested: (Acris Antibodies GmbH Cat# SM2170F, RRID:AB_1005717)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CD8 cells were stained by anti -human CD8 conjugated with allophycocyanin (APC) antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti -human CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>allophycocyanin ( APC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(FITC)-conjugated anti-human antibody (PharMingen, USA) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibody</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was analyzed by flowjo software version 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS Statistics version 21.0 software was used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In summary the current study has limitations due to the variability and diverse future of COVID-19 which unable to generalize the statement. Concerning the complexity of the immune system, prospective multicenter studies with a large sample of patients need to be studied. Besides, analysis of cellular subsets in detail with multi-colored staining of subsets of T cells such as Th9, Th17 and Th22 T cells are necessary to assess the time-based changes in immune response after infection with SARS-Co-V-2 and their prognostic value. In conclusion, our data suggests that the counts of total lymphocyte and their immunophenotyping (consisting of CD4 +, CD8+, CD25+FOXP3+ T cells, and NK cells) may be correlated with the severity of COVID-19 patients. The reduction of these cells may suggests for usage on them as the predictors of the severity of the disease, however, need to be explored in detail in the future.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260361: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the Preferred Reporting in Systematic Reviews and Meta-Analyses (PRISMA) guidelines (17), Medline and Embase databases were searched on 2nd of July 2021 using keywords and MeSH terms (Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>MeSH</div><div>suggested: (MeSH, RRID:SCR_004750)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Studies retrieved from the search were imported into EndNote software and the duplicates removed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To further assess publication bias in the studies pooled for prevalence and the risk of severity and mortality in PLWH-COVID-19, funnel plots and Egger test were computed using ‘metafunnel’ and ‘metabias’ procedures respectively in STATA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has several limitations. Firstly, some of the included studies are case series reporting only the PLWH co-infected with SARS-CoV-2. Such studies were excluded from the prevalence analysis, and this may explain the high heterogeneity in the results. However, the random effect model was used to account for the variations in experimental design. Secondly, most studies did not report the distributions of comorbidities, race, age, CD4 and CD8 counts, duration of HIV infection, ART use among other confounders in the studied groups. Thus, we could not control for these parameters in this study. Also, most studies did not report the clinical outcomes (death and severity) of COVID-19 in both PLWH and patients who are HIV-negative and could not be included in the relative risk computation. However, the Egger’s test and funnel plots show that there is no publication bias in the analysed data. Our findings have several clinical and research implications. First, it further widens the body of evidence by including more recent studies to report that PLWH may be at an increased risk of severe COVID-19 and death and which regions may be mostly at risk. Secondly, we show that the risk of severe COVID-19 and death in PLWH varies between continents and may reflect a complex interplay of concomitant contributory factors which may need to be controlled for to better understand the direct or total effect of HIV infection on COVID-19 outcome. Also, the prevalence of HIV-SARS-CoV-2 coinfec...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260404: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Experiments using mice and samples of healthy human were approved by the Research Ethics Review Committee of the Shanghai Public Health Clinical Center Affiliated to Fudan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse vaccination: Peripheral blood samples were collected from female adult mice and pre-existing S2 binding antibodies were measured using the previously described in-house ELISA method.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2 S1 and S2 specific binding antibodies: In-house enzyme-linked immunosorbent assays (ELISA) were developed to measure SARS-CoV-2 S1 and S2 specific binding antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, 100μl of a HRP labeled goat anti-mouse IgG antibody (Cat# ab6759, Abcam, UK) or goat anti-mouse IgG antibody (Cat# 115-035-003, Jackson Immuno Research, USA) diluted in 1×PBS containing 5% milk were added to each well and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab6759, RRID:AB_955434)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of P144 specific monoclonal antibodies: Monoclonal antibodies against P144 were prepared from one naïve BALB/c mouse and one naïve C57BL/6 mouse respectively using the hybridoma technique.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P144</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the 96-well ELISPOT plates were coated with purified anti-mouse IFN-γ monoclonal antibody overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, detecting antibody and Avidin-HRP were added sequentially.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Avidin-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, freshly isolated splenocytes were mixed and fused with SP2/0 cells at a ratio of 1:10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SP2/0</div><div>suggested: CLS Cat# 400481/p8829_Sp20-Ag14, RRID:CVCL_2199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, Vero cells were added into each well (2×104 cells/well) and the plates were incubated at 37°C in a humidified incubator with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of P144 specific monoclonal antibodies: Monoclonal antibodies against P144 were prepared from one naïve BALB/c mouse and one naïve C57BL/6 mouse respectively using the hybridoma technique.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Selected clones of hybridoma cells were injected intraperitoneally into BALB/c×ICR hybrid mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c×ICR</div><div>suggested: RRID:MGI:5652525)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The codon optimized spike gene was subcloned into a eukaryotic expression vector (pJW4303, kindly gifted by Dr. Shan Lu’s Laboratory at the University of Massachusetts) (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJW4303</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed using the FlowJo software (BD Biosciences, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction and preparation of a candidate DNA vaccine encoding SARS-CoV-2 full length S protein: The full-length s gene sequence of the reference SARS-CoV-2 strain was optimized according to the preference of human codon usage and synthesized by GENEWIZ life science company (Suchow, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were performed using GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260495: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers and probes design: The original sequence of SARS-CoV-2 (NC_045512.2) was taken from NCBI database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260358: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Each blood donor signed an informed consent to be enrolled in the</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of anti-SARS-CoV-2: Qualitative determination of serum total anti-Sars Cov 2 antibodies was performed as described elsewhere [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Sars Cov 2</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-43534, RRID:AB_923442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Positive samples were then tested for the presence of specific IgG antibodies using the anti-SARS-CoV-2 IgG reagent kit (Pencoed Bridgend, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the analysis was performed using the SPSS software package (version 19.0) and Windows Excel®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260393: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data sources: We used data from Maccabi Healthcare Services (MHS) centralized computerized database, which captures all data on members’ healthcare-related interactions (including demographics, inpatient and outpatient visits, diagnoses, procedures etc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Maccabi Healthcare</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260006: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in Stata (StataCorp) versions 15 and 16.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This research study has several notable limitations. Firstly, by design it was anonymous, and so the responses obtained could not be checked against national information systems. Secondly, the survey was retrospective, so attendance at events or recording of symptoms may be subject to recall bias. Finally, we received 3,980 responses to the questionnaire from a potential study population of 25,256, a response rate of 15.8%. While there is evidence of external validity of the responses obtained – in particular, the time course of the development of illness reported matches what actually happened – the low response rates mean that the conclusions require external validation. Such external validation has recently been published, in the form of a genomic analysis of sequences from individuals with SARS-CoV-2 infection[9], which also strongly implicates social mixing outside of university settings as a key risk factor for SARS-CoV-2 infection. Further external validation can be seen through comparison of the cases reported in Cambridge local authority[8], and those by specimen date reported by the University of Cambridge cohort (see supplementary Figure 1). The cases in both figures peak around the same time period (8th – 12th November 2021). This work builds on studies from elsewhere identifying indoor social settings as sites of SARS-CoV-2 transmission[11]. For example, at the start of the pandemic, nightclubs in Seoul reported multiple cases associated with venues of this type[...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260375: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We use the EoN python package to simulate the epidemic.35 Code used for simulations is provided at http://www.github.com/jsheen/NPI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260444: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260263: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent and free choice were complied with, for both RT-PCR and antigen test in the same sample, as well as for this comparative study data collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Samples that displayed an exponential growth curve and a cycle threshold value (Ct) <35 were considered positive, while no Ct value indicated a negative result (non-numeric value).</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test detected S protein in the SARS-CoV-2 structure using dye-labelled/fluorescent-labelled anti-protein S antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-protein S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene E is present in all Sarbecovirus, including SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MedCalc version 14.8.1 software was used for statistics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Although this study provided evidence for using Fluorecare® SARS-CoV-2 Spike Protein Test Kit as antigen detection test, it has several limitations. A limitation could be generated by the lack of information related to the the time elapsed from the infectious contact and the performing of the test. Even the patients were tested immediately after symptoms onset, there could be a variable time between these moments. Another limitation is related to the antigenic test that was performed after unloading the collection buffer in the transport medium, but the inset kit allow the use of diluted sample in VTM. However, the results obtained are consistent in terms of specificity and sensitivity in patients with Ct ORF 25, the overall sensitivity was lower comparing with official data for this test. It could suggest that in cases with low viral load, the test is not sensitive.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260256: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was approved by the local ethical committee.<br>Consent: Written informed consent was obtained from patients or legal guardians before inclusion. 2.2 Inflammatory and procoagulant status: Citrated, EDTA and non-anticoagulated blood samples were drawn on hospital admission and after confirmation of SARS-CoV-2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, the prognostic value of D-dimer has several limitations such as long analysis times, highlighting the need to identify other powerful markers. On the other hand, increased clot stiffness has been observed especially in patients with ARDS or ICU admission, revealing a possible association between these parameters and a worse prognosis of the disease [32]. Nevertheless, the prognostic value of clot stiffness measured by VET techniques has not yet been extensively studied. Our results demonstrate that clot stiffness parameters measured by Quantra® had a high prognostic value according to ROC analysis. In particular, fibrinogen contribution to clot stiffness (FCS) had the highest AUC compared to other parameters strongly associated with worse prognosis such as age or D-dimer. These findings highlight the potential use of this marker as predictor of poor prognosis in COVID-19 patients. One of the limitations of our study is, however, that patients were analyzed only at the time of diagnosis. Previous studies have shown that the predictive value of D-dimer on the risk of death is much higher when measured just before the clinical outcome compared to the time of diagnosis, suggesting the importance of dynamically monitoring D-dimer levels to detect thrombotic complications and thus reduce the mortality rate of patients [20]. The results of our study, which found that FCS has a higher predictive value for an adverse event than D-dimer, indicate that FCS may also be an import...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260467: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional Review Board Approval: This study was reviewed and approved by the Lebanese American University Institutional Review Board (IRB) (LAUMCRH.GG4.29/Jan/2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Minimal sample size calculation: Given an alpha of 5% and 80% power with 9 independent variables in the Cox-proportional hazards model, a minimum of 226 patients would be necessary to fit a parsimonious model adjusting for confounding variables; this minimal sample size was calculated using the G*Power software.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Minimal sample size calculation: Given an alpha of 5% and 80% power with 9 independent variables in the Cox-proportional hazards model, a minimum of 226 patients would be necessary to fit a parsimonious model adjusting for confounding variables; this minimal sample size was calculated using the G*Power software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>G*Power</div><div>suggested: (G*Power, RRID:SCR_013726)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Data analysis was performed using SPSS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Several limitations of this study should be mentioned. Given that this is a retrospective cohort study, association and not causality can be reported between the antithrombotic regimens and outcomes. The sample size was relatively small which makes it difficult to completely adjust for confounding and limits generalizability of the results. Despite efforts to control confounders by using different analytical strategies, some potential biases may have been disregarded, leading to a potential residual confounding. Data are based on the experience of a single center in Lebanon which prevents generalizability of our findings based on a potential selection bias. Furthermore, thrombotic events may have been underreported due to the strict isolation measures for covid-19, which may have led treating physicians to underuse imaging for appropriate diagnosis, generating a possible information bias. Strengths of the study include that it may be one of the first studies to examine the combination of therapies for the management of SARS COV-2 to prevent adverse outcomes. In addition, to adjust the analysis for significant variables a propensity matched multivariable cox regression model was employed. Lastly, hazards models that allow time to event analysis accounting for multiple outcomes were employed.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04505774</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Anti-thrombotics for Adults Hospitalized With COVID-19 (ACTI…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02735707</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomized, Embedded, Multifactorial Adaptive Platform Trial…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04372589</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Antithrombotic Therapy to Ameliorate Complications of COVID-…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260377: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Those who agreed and gave their consent, answered a telephone interview.<br>IRB: Ethics: The study was approved by the Sheba Medical Center IRB committee (approval #8130-21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. First, household studies such as ours may be affected by multiple sources of bias. On the one hand, we may overestimate the SAR if we are more likely to detect household with multiple cases. On the other hand, we might underestimate it if some asymptomatic, or pauci-symptomatic cases are missed by surveillance. Second, we estimated an important reduction of infectivity in vaccinated cases with 2 doses compared to unvaccinated cases as previously shown.10,11 However, this is associated with important uncertainty due to the small number of cases (15 vaccinated index cases, and 19 vaccinated secondary cases). Thus, more data are needed to reduce the size of credible intervals. Third, we assumed an all-or-nothing effect of the vaccine that started seven days after the second dose (or 15 days after the first dose in our sensitivity analysis). In practice, the effect of the vaccine is likely to be progressive, which might push down estimates of efficacy since individuals with early partial protection would be considered as unvaccinated. However, excluding households with the early-vaccinated index cases did not impact our estimates (Supplementary Figure 2). The limited number of households does not make it possible to dissociate early vs full protection conferred by the vaccine nor to investigate the infectivity of children relative to adults/teenagers. To conclude, vaccination with two doses substantially reduces the risk of transmission and the ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21259660: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These data sources provide information not available from standard public health reporting or other common sources, such as: Health Insurance Claims: Based on de-identified medical insurance claims from Change Healthcare and other health system partners, we release indicators on the estimated per-centage of covered outpatient visits and hospitalizations that involved COVID diagnoses or symptoms.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Change Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R and Python package software is public and open-source, at https://github.com/cmu-delphi/covidcast/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, most data sources are provided under the Creative Commons Attribution license, and a small number have additional restrictions imposed by the data source; see https://cmu-delphi.github.io/delphi-epidata/api/covidcast_licensing.html. 1.5 Interactive Visualization: Since April 2020, Delphi has been maintaining and continually improving various online visualization tools for the COVIDcast indicators [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Delphi</div><div>suggested: (DelPhi, RRID:SCR_008669)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.15.452504: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.08.21260081: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.14.21260489: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent is obtained during the baseline serology testing visit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260484: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.6 Ethics statement: All the experimental procedures included in this study was authorized by the Ethical Committee of the University of Santiago of Chile (No. 226/2021) and the Scientific Ethical Committee of the Central Metropolitan Health Service, Ministry of Health, Government of Chile (No. 370/2021), and following the Chilean law in force.<br>Consent: Verbal consent was detailed by the health professional assigned by CESFAM for this purpose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">In order to get the maximum representation of values in the curve, we used for the 10-fold serial dilutions a reference pool made from randomized ten total RNA NPS-extracted samples with a Cq value around 20.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the RT-qPCR reactions were performed on the Agilent AriaMx Real-Time PCR System (Agilent Technologies, Part. No. G8830A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent AriaMx</div><div>suggested: (Agilent AriaMx Real-time PCR System, RRID:SCR_019469)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We determined the slope by linear regression in GraphPad Prism and defined the required levels for PCR efficiency (E) and R-squared (R2) as>95 % and>0.95, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 8 statistical software was used to analyze and plot the data obtained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260426: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study protocol was reviewed and approved by the ethical committee the Hospital District of Helsinki and Uusimaa (HUS) and registered under the Development of seroprevalence in Finland during the new coronavirus (SARS-CoV-2) epidemic – serological population study protocol HUS/1137/2020.<br>Consent: Informed consent was obtained from all study subjects before sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A smaller subset of participants for the NAb titration: For comparison of NAb titers against a wild-type virus and variants of concern (Alpha, Beta and Delta), 80/536 twelve-month sera screened to have NAb positive (titer ≥6 against wild-type virus) were randomly selected as above mentioned.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Further, samples of subjects with ≥30% increase in IgG antibody concentration to both SARS-CoV-2 spike glycoprotein antigens (full-length spike protein (SFL) and receptor binding protein (RBD)) between six and twelve month blood sampling (n=29) were excluded from the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike glycoprotein antigens (full-length spike protein (SFL) and receptor binding protein (RBD)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat Anti-Human IgG detection antibody (Jackson Immuno Research) was added into the wells and incubated for 30 minutes before washing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A sample was considered positive for SARS-CoV-2 IgG antibodies (S-IgG) when SFL and RBD specific antibody concentrations were ≥0.089 and ≥0.13 BAU/ml, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A sample was considered positive for nucleoprotein specific IgG antibodies (N-IgG) when N-IgG concentration was ≥0.58 BAU/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nucleoprotein specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus isolation and propagation was performed in Vero E6 cells (44).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All variant viruses were isolated and propagated (passages 1-2) in VeroE6-TMPRSS2-H10 cells (46) and further propagated in Vero E6 cells (passage 3) for MNT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2-H10</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS v27 and R (v4.0.4) with Rstudio (v1.4.1106).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We recognize certain limitations in our study. Due to high SARS-CoV-2 vaccine coverage in the older age groups (≥60 years of age) at the time of the study, only 11% of the participants of our study were ≥60 years of age, the age group with highest disease incidence and morbidity. Since the median age of study subjects was 50 years, our results may not necessarily apply to all age groups. The number of subjects selected to the NAb titer comparison was limited but the study subjects were matched by disease severity, age and gender and randomly selected from the participants. Previous studies have indicated that the presence of antibodies to SARS-CoV-2 was associated with a significantly reduced risk of SARS-CoV-2 reinfection among health-care workers for up to seven months after infection (21, 42). We observed that S-IgG antibodies and neutralizing antibodies persist at least a year after infection in the vast majority of individuals who have recovered from infection. This strongly suggests that protection against re-infection is long-lived, although antibody-mediated immunity may not persist equally well among elderly subjects. A previous study found that patients older than 60 years had fewer memory B cells secreting total IgG and RBD-specific IgG than patients under 60 years old nine months after infection (8). In this study we observed that IgG concentrations declined from six to twelve months more substantially in subjects ≥60 years compared to younger age groups. Similar ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260385: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval: Ethical approval was obtained from the National Statistician’s Data Ethics Advisory Committee (NSDEC(20)12) Use of reporting guidelines: Our study was conducted following STROBE guidelines for reporting observational studies Role of funding source: The funding source played no role in the interpretation of the results<br>IACUC: Ethics approval: Ethical approval was obtained from the National Statistician’s Data Ethics Advisory Committee (NSDEC(20)12) Use of reporting guidelines: Our study was conducted following STROBE guidelines for reporting observational studies Role of funding source: The funding source played no role in the interpretation of the results</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the survey, SARS-CoV-2 antibody levels are measured using an ELISA detecting anti-trimeric spike IgG using a fluorescence detection mechanism to 26 February 2021, then a CE-marked version of the assay, the Thermo Fisher OmniPATH 384 Combi SARS-CoV-2 IgG ELISA, using the same antigen with a colorimetric detection system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the survey, SARS-CoV-2 antibody levels are measured using an ELISA detecting anti-trimeric spike IgG using a fluorescence detection mechanism to 26 February 2021, then a CE-marked version of the assay, the Thermo Fisher OmniPATH 384 Combi SARS-CoV-2 IgG ELISA, using the same antigen with a colorimetric detection system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher OmniPATH</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The main limitation of our study is that the RDD yielded an estimate of the vaccine effectiveness that is only valid for people aged around 80. It cannot be generalised to other age groups. Another limitation of the method is that people aged 75–79 years old rapidly become vaccinated, leaving a short window where the RDD can be applied. To mitigate the contamination of the control group, we estimated the discontinuity in mortality rates over a short time window (15 days), using dates where the difference in vaccination rates between people aged below and above 80 was the largest. We also estimated the discontinuity in weighted proportion of people who were vaccinated and were likely to have developed antibodies, rather than just focusing on the proportion of people who had received the vaccine. Nonetheless, as a result, our results may underestimate vaccine effectiveness. In addition, our analysis only provides an estimate of vaccine effectiveness for the first dose of COVID-19 vaccines. Another limitation is that our approach does not account for the different antibody responses in people who have previously been infected with COVID-19. Finally, the RDD approach estimates the absolute reduction in probability of COVID-19 mortality due to being vaccinated long enough to develop antibodies. To calculate vaccine effectiveness, we had to estimate the probability of COVID-19 mortality in either the untreated or treated population in order to calculate the proportion by which vacc...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260428: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.1 Ethical Considerations: This study was conducted according to the World Medical Association Declaration of Helsinki and conforms to the ethics recommendations of the Committee on Publication Ethics and the International Committee of Medical Journal Editors.<br>Consent: The study protocol was approved by the Research Advisory Council (Ethics Committee) at KFSHRC (RAC #220 1047), which also waived the requirement for obtaining informed patient consent because the risk to individuals whose data were included in the study was minimal and the study used exclusively retrospective deidentified administrative records.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An electronic case report form was developed using REDCap (a secure and flexible web-based clinical research data capture platform) that had over 500 data items for each patient, including demographic characteristics, potential virus exposure (travel history and human and animal contact), vaccination history, comorbidities, signs and symptoms, laboratory and radiologic reports, cardiac workup, medication, treatment regimen, and patient outcome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Data and Statistical Analyses: All collected data were stored and analyzed using SAS, version 9.4, software and GraphPad, version 9.0 (Prisma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We concluded from our data on the treatment regimens that azithromycin, hydroxychloroquine, and lopinavir/ritonavir were not effective treatment for COVID 19, and this is consistent with previous studies and the solidarity trial [30, 31] There are limitations in the current database and the main limitation is that this retrospective study was conducted during the early COVID-19 pandemic where various effective interventions were not assessed such as dexamethasone, IL6 inhibitors, Jak inhibitors and Remdesvir.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.09.21260259: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260357: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written consent was obtained from the next of kin to perform the autopsies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained and cultivated under standard conditions (15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RT-qPCR was conducted using the QuantStudio 5 Dx real-time PCR Instrument, and the data were analyzed and interpreted using QuantStudio™ design and analysis software (v.1.2x, Thermo Fisher, Carlsbad, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantStudio™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All calculations were performed using the statistics package Sigmaplot 13.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigmaplot</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21258757: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent will be obtained from each patient before enrolment into the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent will then be obtained from the patient’s personal legal representative (or directly from the patient if they recover promptly) at the earliest opportunity. 2.3 Eligibility Criteria: Inclusion criteria will be any male or non-pregnant female who is 18 years or older with either: confirmed (positive result from a validated test) or suspected (has been in contact with a confirmed case of COVID 19 AND have mild to severe COVID 19 symptoms AND radiological evidence of pulmonary infiltrates) case of SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Procedures: The IONIC trial is an interventional, randomised, parallel-group, open-label, Phase IIb trial to assess the efficacy and safety of an oral dose of IMU-838 (22.5 mg twice daily [45 mg/day]) plus Oseltamivir (75mg twice daily [150mg/day]) (IONIC Intervention) in comparison with Oseltamivir alone (75mg twice daily) for 14 days in hospitalised patients with COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Consent will then be obtained from the patient’s personal legal representative (or directly from the patient if they recover promptly) at the earliest opportunity. 2.3 Eligibility Criteria: Inclusion criteria will be any male or non-pregnant female who is 18 years or older with either: confirmed (positive result from a validated test) or suspected (has been in contact with a confirmed case of COVID 19 AND have mild to severe COVID 19 symptoms AND radiological evidence of pulmonary infiltrates) case of SARS-CoV-2.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04516915</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">IMU-838 and Oseltamivir in the Treatment of COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN53038326</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260366: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Deaths where there was still disagreement were then reviewed by a researcher with expertise in suicide research (DG), blind to the date of death.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Suicide is often associated with multiple factors including adversity in early childhood, bullying, personal and parental mental illness, exposure to suicidal behaviour in others and genetic vulnerability[7]/ During this period of lockdown, known factors such as isolation [23], loss of social support, disruptions to care and support and potential exam disruption [3], or direct anxiety regarding viral illness, may become greater; as may limitations in accessing social, mental health, and other services while the NHS and other providers try to adapt to new ways of working. However, it is possible that for some people social distancing may lead to an improvement in their symptoms (e.g. those with school phobias). However, while other reports have raised concerns about those with mental health needs during this pandemic[24], the proportion of children in contact with services was similar amongst children who died in the pre and post lockdown periods (33% vs 36%). Particular concerns have been raised about the impact of school closures and physical distancing measure on children with ASD or ADHD [25]. We found no evidence that their risk increased during the pandemic, although children with these diagnoses comprised around a quarter of all the likely suicide deaths in our detailed nested study of suicides pre vs. post lockdown. Our work adds to existing concerns regarding self-harm and suicide in this group [26]. Limitations: There are several limitations to our analysis. As child...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.12.21260360: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was obtained from the East of England – Cambridge Central Research Ethics Committee (<br>Consent: All participants provided informed consent.<br>IACUC: All procedures were ethically approved by the University of Cambridge Animal Welfare and Ethical Review Body and complied with the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012, under the authority of a UK Home Office Licence.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization was genetic and, where possible, investigators were blinded to the genetic status.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization was genetic and, where possible, investigators were blinded to the genetic status.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Models: Mice: Vhl−/− mice(Haase et al., 2001) were crossed with Cd79a-cre (Mb1-cre)(Hobeika et al., 2006) or Cd19-cre (JAX, stock no. 004126) to delete Vhl in the B cell lineage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vhl−/−</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cd19-cre</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The deletion efficiency for mature B cells was 52% (95% CI 30-75%) in Vhl-/-Cd19-cre mice and 98% (95% CI, 97–99%) in Vhl-/-Mb1-cre mice(Burrows et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vhl-/-Cd19-cre</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vhl-/-Mb1-cre</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These mice, along with C57BL/6J mice (JAX, stock no. 000664) were housed in specific pathogen-free animal facilities (at 20–23 °C, with 40–60% humidity, 12-h light:12-h dark cycle).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were gated in FlowJo v10.2 and number of cells falling within each gate was recorded.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read quality was assessed using FastQC v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Babraham Bioinformatics, UK) and BBSplit (BBMap v.38.67(BBMap -</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed using HISAT2 v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Count matrices were generated using featureCounts (Rsubreads package)(Liao, Smyth and Shi, 2019) and stored as a DGEList object (EdgeR package)(Robinson, McCarthy and Smyth, 2009) for further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Counts were filtered using filterByExpr (EdgeR) with a gene count threshold of 10 CPM and the minimum number of samples set at the size of the smallest disease group.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA)(Subramanian et al., 2005) was used to identify biological pathways enriched in COVID-19 severity groups relative to healthy controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis: Raw reads were filtered for base quality using a median Phred score of ≥32 (http://sourceforge.net/projects/quasr/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://sourceforge.net/projects/quasr/</div><div>suggested: (QUASR, RRID:SCR_006820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences without complete reading frames and non-immunoglobulin sequences were removed and only reads with significant similarity to reference IGHV and J genes from the IMGT database using BLAST were retained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine BCR amplification and sequencing: BCR amplification and sequencing was performed as described in Burrows et al.(Burrows et al., 2020) Data are available at the Sequence Research Archive (SRA) database (BioProject accession nos.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw reads were filtered as Burrows et al.(Burrows et al., 2020) Ig gene sequence annotations were performed in IMGT V-QUEST, where somatic hypermutation repertoire and isotype usage differences were performed by custom scripts in python, and statistics were performed in R using Wilcoxon tests for significance (non-parametric test of differences between distributions).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw imaging data were processed using Imaris.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image analysis was performed in ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260402: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">RADT performance and results interpretation was performed by three independent operators concurrently performing blind testing; operators were asked to score their results as negative (score of 0), weakly detected-1, or strongly detected-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Spearman’s rank coefficient was calculated for operator-ranked results and graphs constructed in Graphpad Prism Version 9.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Though an apparently relatively rare and a minor contributor to overall test performance in this and previous studies, false negative results in low Ct/high viral load samples may be significant in real-world contexts in which missing active infections can lead to preventable transmission events (although the clinical relevance of this remains to be seen, since RADT results correlate better with viral cultivability than PCR results (19-21)) In our opinion, this observation reveals an important limitation to use of RADTs for mass screening activities and also lends strong support to following an algorithm in which symptomatic RADT negative persons are re-tested (by RADT or preferably RT-PCR), as is recommended by the WHO (1). Indeed, previous evaluations of RADT accuracy in asymptomatic groups, such as children (24) and household contacts of known cases (25) have reported low sensitivity of the Panbio™ in these populations, probably due to low viral load (high Ct value). In previous analyses the Panbio™ test LOD has been described as correspondent to a Ct value of between 24 and 29 (10-18). Our LOD results using sample serial dilution were consistent with these published LODs, since we estimate the LOD as between approximate Ct 28 and 32, as there was a weak line detected in a sample with Ct 28 but no line at Ct 32 (Figure 2A). In addition, blinded operator-ranked results of RADT signal intensity were significantly inversely correlated in the nonparametric analysis to sample C...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260459: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.15.452507: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The starting configuration was the same for each independent run, but the random seed for the velocities in each run was randomly assigned, resulting in independent behaviors.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Because the system changed, the force field files had to be regenerated using AmberTools (44) as described previously (2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AmberTools</div><div>suggested: (AmberTools, RRID:SCR_018497)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 18 pulling simulations were performed at three different pulling rates (1 nm/ns, 5 nm/ns and 10 nm/ns) on the four truncated structures using Gromacs 2019.1 (51).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hydrogen bonding interaction bitmap was recreated in python using matplotlib (53) in order to add labels for donor acceptor pairs and calculate the percent occupancy of hydrogen bonds across the simulation (script available in SI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.13.21260273: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real time RTPCR was set using SARS-CoV-2 specific primers for the detection of E gene and RdRP gene as described earlier[21].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A phylogenetic tree was generated using the MEGA software [22] for the aligned sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-