- Aug 2021
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.30.454063: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">No statistical methods were applied to predetermine sample size.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The absence of mycoplasma contamination was confirmed with the use of a PCR Mycoplasma Test Kit (Takara, Shiga, Japan).<br>Authentication: Expression of the mCherry-tagged S proteins was confirmed by immunofluorescence analysis.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents and antibodies: Antibodies to SARS-CoV S protein (#40150-R007), to RFP (#PM005), to VSV G protein (#EB0010), and to VSV M protein (#MABF2347) were obtained from Sino Biological (Beijing, China), Medical & Biological Laboratory (Nagoya, Japan), Kerafast (Boston, MA), and Merck (Darmstadt, Germany), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV S protein ( #40150-R007)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RFP</div><div>suggested: (MBL International Cat# PM005, RRID:AB_591279)</div></div><div style="margin-bottom:8px"><div>VSV G protein ( #EB0010) ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV M protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For generation of VSVΔG-S particles, cells expressing S protein of SARS-CoV or SARS-CoV-2 (either stably or transiently) were exposed to VSVΔG-G at an MOI of 3 FFU per cell for 16 h at 35°C in the presence of antibodies to VSV G in order to neutralize the parental viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of stable cell lines: pCG1-mCherry-SARS-CoV-S or pCG1-mCherry-SARS-CoV-2-S was linearized with PuvI and introduced together with pBABE-puro into HEK293T or VeroE6 cells by transfection for 24 h with the use of PEI MAX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BEAS-2B cells stably expressing human ACE2 were generated by lentivirus-mediated gene transfer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: ATCC Cat# CRL-9609, RRID:CVCL_0168)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were thus transfected with pLVX-ACE2-IRES-BLD (Daly et al., 2020), pCAG-HIVgp, and pCMV-VSVG-RSV-Rev (Miyoshi et al., 1998) for 48 h, after which the culture supernatant was collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, for preparation of VSVΔG-G, BHK21/G43 cells (which stably express VSV G protein) were incubated with mifepristone (10 nM) for 6 h and then infected with VSVΔG at a multiplicity of infection (MOI) of 100,000 FFU per cell for 16 h at 35°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK21/G43</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression vectors for the S protein of SARS-CoV or SARS-CoV-2 (pCG1-SARS-CoV-S and pCG1-SARS-CoV-2-S) (Hoffmann et al., 2020) were kindly provided by S. Pöhlmann.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1-SARS-CoV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequence for mCherry was cleaved out of pFX-Tom20-mCherry (Kashiwagi et al., 2019a) by digestion with BamHI and BglII, and was then subcloned into the BamHI sites of the expression vectors for the S proteins to obtain pCG1-mCherry-SARS-CoV-S and pCG1-mCherry-SARS-CoV-2-S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFX-Tom20-mCherry</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-mCherry-SARS-CoV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-mCherry-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pBABE-puro plasmid encoding a puromycin resistance gene was obtained from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBABE-puro</div><div>suggested: RRID:Addgene_1764)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were thus transfected with pLVX-ACE2-IRES-BLD (Daly et al., 2020), pCAG-HIVgp, and pCMV-VSVG-RSV-Rev (Miyoshi et al., 1998) for 48 h, after which the culture supernatant was collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-ACE2-IRES-BLD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-HIVgp</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV-VSVG-RSV-Rev</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, cells transfected with mCherry-CoV-S or mCherry-CoV-2-S vectors were stained with Hoechst 33342 for 15 min and placed in a stage-top incubation chamber maintained at 37°C on a Nikon Ti2 microscope (Nikon, Tokyo, Japan) equipped with a Zyla5.5 scientific complementary metal oxide semiconductor camera (Oxford Instruments, Belfast, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mCherry-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FFU value of the pseudovirus suspension was determined by counting the number of GFP-positive cells with the use of the “Multi-wavelength cell scoring” module of MetaMorph software (Molecular Devices, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaMorph</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A p value of <0.05 was considered statistically significant, and all statistical analysis was performed with JMP Pro software (version 15.0.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JMP Pro</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.29.454261: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was approved by the Ethical Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China (ITJ-C20200128).<br>Consent: Written informed consent was obtained from all participants enrolled in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His (Millipore, USA), anti-GST (Sigma, USA), and anti-BSA (Sangon Biotech, China) antibodies were used for quality control of the SARS-CoV-2 proteome microarray.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GST</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-BSA ( Sangon Biotech , China )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The arrays were washed with 1× PBST, and the bound antibodies were monitored by incubating with Cy3-conjugated goat anti-human IgG and Alexa Fluor 647-conjugated donkey anti-human IgM (Jackson ImmunoResearch, PA, USA) diluted 1:1,000 in 1× PBST at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Bio-Rad Cat# MCA647F, RRID:AB_808612)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized genes were synthesized and cloned into pET32a or pGEX-4T-1 by Sangon Biotech (Shanghai,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET32a</div><div>suggested: RRID:Addgene_62310)</div></div><div style="margin-bottom:8px"><div>pGEX-4T-1</div><div>suggested: RRID:Addgene_113505)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pheatmap (1.0.12) and ggplot2 (3.3.2) carry out plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Nonetheless, there are some limitations for COVID-ONE humoral immunity. For example, it lacks data for convalescent patients, peptide-level humoral responses to proteins other than S protein, and multicentre samples. In the future, we will assay the dynamic responses of SARS-CoV-2-specific antibodies using ∼500 serum samples from ∼100 COVID-19 convalescent patients. We will also integrate published peptide microarray/phage display-related data[15-17, 30] and attempt to update the database covering the whole SARS-CoV-2 proteome at the peptide or amino acid level. In addition, the SARS-CoV-2 protein microarray has already been promoted by CDI Labs (www.cdi.bio) and ArrayJet (www.arrayjet.co.uk), and we anticipate more diverse data for SARS-CoV-2-specific antibody responses from multicentre samples. We strongly believe that by sharing a large dataset and facilitating data analysis, COVID-19 humoral immune is a valuable resource for COVID-19 research.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261138: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistics were performed using the SciPy-Stats Python library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations to the present study include potential variations in SARS-CoV-2 exposure risk during the time period. Weekly surveillance testing indicated approximately constant prevalence of COVID-19 during the analysis period, but surveillance testing was done with Sofia SARS Antigen Fluorescent Immunoassay which has a known low sensitivity (41%) when used for screening of asymptomatic persons [3]. A variation in exposure risk during the analysis period would alter infection risk as more of the cadet population was vaccinated over time. A second limitation is that the present analysis does not account for potential acquired immunity due to prior COVID-19 infections. Approximately 10-15% of the cadet population had previously tested positive for SARS-CoV-2 infection since May 2020, but since estimates for durable immunity are not available and cadets were vaccinated regardless of prior infection status, we did not account for prior infection in determining infection risk. A third limitation are prominent SARS-CoV-2 strains present during the study period. Based on random sequencing (approximately one-quarter of positive infection samples were sequenced), the B.1.429 strain was predominant (76%) at the beginning of the study period. The B.1.1.7 strain increased in prevalence during the study period. Both of two the breakthrough infections were B.1.1.7 variants. The Pfizer-BioNTech vaccine is effective against all known strains during the study period. The continuously developing...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261272: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261284: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study design and setting: In this retrospective, observational study, that ethically and technically approved by the institutional review board of deanship of scientific research, University of Bisha, the clinical, demographic, and comorbidity data on presentation, treatment, and outcomes of all children aged less than 12 years admitted to King Abdalla Hospital, Bisha, Saudi Arabia, between March 1, 2020, and April 28, 2021, with a laboratory-confirmed SARS-CoV-2 infection, retrieved from the electronic medical record (EMR).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medline, Embase, Web of Science, and ProQuest databases were queried for records published from January 1, 2020, until May 1, 2021, using the combination of the following terms: “COVID-19”, “SARS-CoV-2”, “novel</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>ProQuest</div><div>suggested: (ProQuest, RRID:SCR_006093)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioRxiv, MedRxi, Open Grey, and Open Science Framework (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were considered statistically significant at P < 0.05 using SPSS software (IBM SPSS Statistics for Windows, Version 25.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The meta-analysis was performed using Prometa3 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prometa3</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Although we rigorously analyzed data from many relevant COVID-19 studies, our study suffered some limitations, including heterogeneity across studies included for exploring the association of disease severity with any comorbidity, cardiovascular disease, and female gender but not age and respiratory tract diseases. This heterogeneity is believed to have affected the plausibility of some of our results. This study also focused retrospectively on specific comorbidities only, which entails more extensive prospective studies to establish the causality between severe COVID-19 and other comorbidities such as gastrointestinal, renal, genetic, and neurological diseases.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261232: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: The filter cake was washed with a mixture of diethyl ether and heptane (1:1, 4 x 2 ml) to afford N- [(2S)-1-(((1S)-1-cyano-2-[(3S)-2-oxopyrrolidin-3-yl]ethyl)amino)-4-methyl-1-oxopentan-2-yl]- 4-methoxy-1H-indole-2-carboxamide (2) as a solid.<br>IACUC: The study procedures were conducted with approval by the Institutional Animal Care and Use Committee at Utah State University.<br>IRB: Drug Metabolism Studies and Methods: Research was conducted on human tissue acquired from a third party that has been verified as compliant with Pfizer policies, including Institutional Review Board/Independent Ethics Committee approval.<br>Field Sample Permit: All definitive studies were conducted in accordance with US FDA GLP regulations in an OECD MAD member state.<br>Consent: The protocol was approved by an independent institutional review board and all participants provided informed consent before screening.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Rat intestinal microsomes (pool of 200, male Sprague Dawley,), monkey intestinal microsomes (pool of 6, male Cynomolgus,), human intestinal microsomes (pool of 9, male and female,), and human liver microsomes (HLM) (custom pool of 50 donors, male and female), were purchased from Sekisui XenoTech (Kansas City, KS) or BioIVT (Baltimore, MD)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The design for the single ascending dose portion was investigator- and participant- blinded, sponsor-open, randomized, 4-period cross-over (with Period 3 and 4 being optional) in 2 interleaving cohorts with placebo substitution.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anderson (study 1)) for processing and blinded evaluation by an experienced veterinary pathologist and yielded similar results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Plasma samples were analyzed for PF-07321332 concentrations at Pfizer (Groton, CT) using a validated sensitive and specific LC-MS/MS method in compliance with the Sponsor SOPs.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ki values were fit to the tight binding Morrison equation with fixed parameters for enzyme concentration, substrate concentration and the Km parameter using ActivityBase software (IDBS) indicated below Cellular Antiviral Activity: The ability of compounds to inhibit viral induced cytopathic effect (CPE) against human coronaviruses (SARS-CoV-1, SARS-CoV-2, hCoV-229E, MERS) was assessed by monitoring cell viability using two different assay endpoints in VeroE6, MRC-5 or Vero81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells that are enriched for hACE2 expression were batched innoculated with SARS- CoV-2 (USA_WA1/2020) at a multiplicity of infection (MOI) of 0.002 in a BSL-3 lab (Southern Research Institute)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus titer was then quantified by infecting Vero76 cells in a standard endpoint dilution assay and virus dose that was able to infect 50% of the cell cultures (CCID50 per ml) was calculated (53).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, TK6 cells were incubated with (4 or 24 h) vehicle or PF-07321332 in the presence or absence of metabolic activation (Aroclor 1254- induced rat liver S9/NADPH), harvested, fixed, stained with acridine orange and scored for frequency of micronuclei in mononucleated cells by light microscopy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TK6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, human embryonic kidney (HEK) cells stably expressing the human Kv11.1 (hERG) channel were cultured in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) supplemented with 10% (v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO cells stably expressing the human Nav1.5 sodium channel (Catalogue No. CT6007; Charles River Cleveland, OH, USA) were cultured in Ham’s F12 media supplemented with 10% FBS (10% (v/v) and G418 (0.25 mg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactions were monitored by thin layer chromatography (TLC) performed on Analtech, Inc. silica gel GF 250 μm plates or Merck silica gel plates (60 F254) and were visualized with UV light (254 nm) and/or KMnO4 staining or by UPLC-MS (Waters Acquity, ESCI (ESI +/-, APCI +/-)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ESI +/-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 24 BALB/c mice (Charles River, 8 week old female, n=6 mice/group) were divided into 4 groups: group 1: untreated, infected control; group 2: 300 mg/kg PF-07321332 (6); group 3: 1000 mg/kg PF-07321332 (6), and group 4: untreated, uninfected control (for pharmacokinetic analysis and normal weight).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rat intestinal microsomes (pool of 200, male Sprague Dawley,), monkey intestinal microsomes (pool of 6, male Cynomolgus,), human intestinal microsomes (pool of 9, male and female,), and human liver microsomes (HLM) (custom pool of 50 donors, male and female), were purchased from Sekisui XenoTech (Kansas City, KS) or BioIVT (Baltimore, MD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were directly analyzed for depletion of 6 by LC-MS/MS. Plasma Protein Binding Determination for PF-07321332 (6): On the day of each incubation, fresh blood in K2EDTA was collected from male Wistar- Hannover rats (n=5, pooled), male Cynomolgus monkeys (n=2, pooled), and humans (n=1 male and n=1 female, pooled).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar- Hannover</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chronic Toxicity Studies with PF-07321332 (6): Briefly, groups of male and female Wistar Han rats or Mauritian cynomolgus monkeys were administered vehicle [2% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar Han</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon request and subject to certain criteria, conditions and exceptions, Pfizer will provide access to de-identified participant data from Pfizer-sponsored global interventional clinical studies conducted for medicines, vaccines and medical devices for indications that have been approved in the US and/or the EU or in programs that have been terminated (i.e., development of all indications has been discontinued).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pfizer</div><div>suggested: (Pfizer Inc., RRID:SCR_021375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structures were refined iteratively by manual model building in Coot (47) followed by refinement in BUSTER.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>BUSTER</div><div>suggested: (BUSTER, RRID:SCR_015653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the EC50 and EC90, the CCID50/ml values were normalized to that of no drug control as a percentage of inhibition and plotted against compound concentration in GraphPad Prism software by using four-parameter logistic regression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-acquisition data processing was performed with either Topspin V3.2 or MestReNova V9.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Topspin</div><div>suggested: (TopSpin, RRID:SCR_014227)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jugular vein-cannulated male Wistar-Hannover rats were purchased from Charles River Laboratories, Inc. (Wilmington, MA) or Vital River (Beijing, China) and were typically 7-10 weeks of age at the time of dosing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04756531</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">STUDY OF PF-07321332 IN HEALTHY PARTICIPANTS</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261163: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Therefore, according to Brazilian Ethics regulatory requirements, there is no need for ethical approval by an Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Search included all data on female patients aged 10 to 49 years hospitalized with COVID-19, confirmed with a positive RT-PCR result for SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As study limitations, a comparison with those infected with COVID-19 in the general population could not be made because only hospitalized cases with SARS and deaths are notified, and bias introduced by missing variables cannot be eliminated. In the present study, the death risk of each comorbidity was identified separately for the three groups of women: pregnant, puerperal, and neither pregnant nor puerperal. This enabled the use of ORs included in the risk calculations for the COVID-19 progression at hospital admission. Since puerperal women were at a higher risk for the most severe outcomes (need for ICU, use of invasive ventilatory support, and death), the fact that pregnancy is over must not underestimate the severity risks. Thus, in those cases in which the SARS-CoV-2 infection is acquired at the end of pregnancy, the delivery should be considered only after overcoming the disease. When it is acquired during the puerperal period, health professionals should remain alert to the severity-related risks.It would be ideal if all women were vaccinated to minimize the risks of SARS-CoV-2 infection and if they adhered to protection measures to prevent contamination by the virus. As puerperal turned out to be a higher risk group than pregnant women among those hospitalized due to COVID-19, we need more studies comparing these groups. Furthermore, it should be considered that childbirth might influence the progression of COVID-19.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261261: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched Medline, PubMed, Web of Science, Scopus, ProQuest, CINAHL, and a pre-print service (medRxiv) from inception to July 12, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>ProQuest</div><div>suggested: (ProQuest, RRID:SCR_006093)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Our systematic review is subject to several limitations. Firstly, five out of 12 studies was of poor or moderate quality, while more than the half of studies was published in pre-print services without a peer-review process. Secondly, studies were conducted mainly in the USA and United Kingdom and thus the results could not be generalized. Thirdly, data collection time among studies ranged from December 2020 to May 2021. Availability of COVID-19 vaccines and knowledge regarding these vaccines are increasing significantly on an ongoing basis and people’s attitudes towards COVID-19 vaccination could be changed. Moreover, all studies in our review were cross-sectional and thus causal inferences are impossible. Also, only nine studies investigated predictors of COVID-19 vaccination uptake and five studies investigated reasons for decline of COVID-19 vaccination. Additional research is needed to understand as soon as possible the factors that influence people’s decision to take a COVID-19 vaccine. For instance, no study until now has investigated psychological factors that could affect people’s attitudes towards COVID-19 vaccination uptake. Moreover, we should examine whether additional sociodemographic, infection-related and social media variables are related with COVID-19 vaccination uptake. Conclusions: Several factors affect COVID-19 vaccination uptake, while there are various reasons for decline of vaccination. For instance, males, older and white people take mor...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261233: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These 4204 whole genome sequences were aligned using MAFFT (v.7.480) [47], through multiple sequence alignment method, and manually edited by trimming the 5’ and 3’ untranslated regions and removing any gap only sites and low-quality sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261212: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These sequences were aligned to the reference genome obtained from the literature [73] using Muscle [74] and trimmed using Mega 7 (Molecular Evolutionary Genetics Analysis version: 7) [75].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Muscle</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylodynamics analysis of that cluster was carried out using BEAST version 2 (Bayesian Evolutionary Analysis by sampling trees) [76].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For any two rate curves, hi and hj, we compute the norm ||hi −hj||, where the double bars denote the L2 norm of the difference function, that is,To perform clustering of thirty six curves into smaller groups, we apply the dendrogram function in MATLAB using the “ward” linkage as explained in reference [79].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has some limitations. First, we excluded the last 30-day case counts from our study in order compare the performance of our models in the forecasting phase. Moreover, excluding the last 30 data points allows us to overcome the influence of reporting delays on our analysis. Specifically, we utilize the case counts based on the dates of onset in this study, because delays in case reporting, testing rates and factors related to the surveillance systems can influence our epidemic projections. Secondly, we relied on the daily updates of cases in the official surveillance system of Colombia, which can sometimes underreport the cases. Third, the phenomenological models applied in this study do not explicitly account for behavioral changes, and thus the results such as the predicted decline or stability in the epidemic trajectory should be interpreted with caution. Fourth, some authors [83] shifted the dates of symptom onset backwards to approximate the date of infection when applying the EpiEstim package to estimate the instantaneous reproduction number. However, in this study we stick to the date of symptoms onset for the sake of comparison across methods to estimate the reproduction number. Lastly, the unpredictable social component of the epidemic on ground was also a limiting factor for the study as we did not know the ground truth epidemic pattern when the forecasts were generated. In conclusion, the country observed a surge in case counts as the mobility increased i...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21260421: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study has been approved by the Institutional Review Boards of the participating sites.<br>Consent: Post- enrollment exclusion from the intention-to-treat analysis will be restricted to the withdrawal of consent to use trial data by the patient or surrogate decision-maker (SDM) or wrong randomization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We will report the number of patients who were randomized to each group, received the allocated intervention, and included in the final analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04477668</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet Non-Invasive Ventilation for COVID-19 Patients</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261148: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We downloaded all SARS-CoV-2 sequences from GISAID and pH1N1 influenza sequences from GenBank and align them using MUSCLE v3.8.42528 -- a complete metadata table acknowledging the authors, originating and submitting laboratories of the SARS-CoV-2 sequence data is available in Table S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.1 Phylogenetic analyses: We use BEAST v1.1029 for the Bayesian phylogenetic analysis of the entire dataset using an HKY+G substitution model with a Laplace prior (mean=0 and scale=100) on the coalescent growth rate, a Lognormal prior (mean=1 and stdev=2) on the coalescent population size, and a continuous time Markov chain prior on the evolutionary clock rate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We ensure that the effective sample size for every parameter of interest is >200 using Tracer v1.732.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261160: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of Renmin Hospital of Wuhan University, and the Institutional Review Board of the Institute of Psychology, Chinese Academy of Sciences.<br>Consent: All of the subjects gave informed consent online.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3.2 Preprocessing: All imaging data preprocessing procedures were carried out with Data Processing Assistant for Resting-state fMRI version 4.3 (http://www.restfmri.net), which is based on Statistical Parametric Mapping 12 (http://www.fil.ion.ucl.ac.uk/spm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.restfmri.net</div><div>suggested: (REST: a toolkit for resting-state fMRI, RRID:SCR_009641)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Several limitations should be mentioned. First, the sample size in this study is small because the volunteers were recruited from established cohorts. For the same reason, this study is a quasi-experiment condition and thus we cannot find an appropriate control group to conduct formal statistics to test whether the brain-behavior relationship established in the group with higher stress level (i.e., Hubei Cohort) is statistically stronger than that with lower stress level. An ideal control group could be the individuals who took part in the scanning before the pandemic in the same site as the Hubei Cohort but they or their families were not living in Hubei province half a year before the COVID-19 outbreak in Hubei and thus they were presumed free of the pandemic influence or had lower stress level (there were only 5 cases in the current study). Future studies may use established (e.g., HCP or UK Biobank) or new cohorts with large sample size and diversified sample pool to validate the current findings. Second, this study suggests the role of amygdala connectivity in predicting stress behaviors in a non-clinical population. However, whether the current findings can be generalized to patients with stress-related psychiatric disorders or other vulnerable populations to stress needs to be explored. Furthermore, the physiological mechanism behind this prediction role of amygdala connectivity needs to be explored in future studies by using comprehensive computational model or animal...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261059: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulation, data visualisation and computation were done in a Python environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.08.01.21261101: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for the study was obtained from the University of Cambridge Psychology Research Ethics Committee (Approval number: PRE.2020.040).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.29.21261358: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The present study has some limitations. First, age, gender, and other factors that might affect behavior cannot be controlled because we have no information other than that published and used for analyses, although an earlier study [2] included control of them. Drinking behaviors might be biased according to age and gender. These tendencies might be correlated to COVID-19 infection incidence. If so, drinking itself might not present a risk of infection. Secondly, the original data used for an earlier study [2] might include some information to test the risk of group dining with more than two participants once in the prior two weeks compared with no group dining. Alternatively, it might test the risk of group dining with more than two participants once in the last two weeks compared with group dining with one participant once in the last two weeks. These analyses might contribute to evaluation of the risks posed by the frequency and number of participants aside from those posed by drinking. We have no original data. Therefore, we cannot conduct such a study. Thirdly, variant strain N501Y was prevalent during the study period, especially during the late half of the period. Its prevalence might affect the results of increasing risks of non-drinking.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261162: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from all participating patients and the study was performed with the approval of the TMCH ethical committee (approval number: 2021-021).<br>IACUC: Informed consent was obtained from all participating patients and the study was performed with the approval of the TMCH ethical committee (approval number: 2021-021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) and Reliance One-Step Multiplex Supermix (Bio-Rad Laboratories) were used for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There were some limitations to this study. First, study samples were collected in a local district in Japan in the spring of 2021. Second, differences among variant strains were not analyzed. Third, study samples were collected from the nasopharyngeal tract and saliva samples were not analyzed. Fourth, improvements of DIA specificity were not examined and further investigations are necessary. In conclusion, this study showed that the RapidTesta SARS-CoV-2 with a DIA device had sufficient analytical performance for the detection of SARS-CoV-2 in nasopharyngeal samples. When positive DIA results are recorded without a visually recognizable red line at the positive line location on the test cassette, additional RT-PCR evaluation should be performed.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21260838: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave written informed consent before any trial procedures were performed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: The DOXYCOV trial, was an open-label, randomized, non-inferiority trial, to evaluate the safety and efficacy of Doxycycline therapy versus Cameroon National Standard therapy (Hydroxychloroquine + Azithromycin) in ambulatory patients with mild symptomatic, or asymptomatic COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted using Spss version 23.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spss</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04715295</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Efficacy of Doxycycline and Rivaroxaban in COVID-…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.454232: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.25 × 105 J76 cells were co-incubated with 2.5 × 105 K562 cells transgenic for HLA-A*02:01 in 96 well plates filled with 200 μL of IMDM media 10% FCS (Gibco) containing serial dilutions peptide of interest in three independent replicates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>J76</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Codon-optimized genes encoding the α and β chains of these TCRs (TCR RLQ3 residues 1–204 and 1–244; TCR YLQ7 residues 1–203 and 1–241, respectively) were synthesized (Supplementary Table 11) and cloned into the expression vector pET22b (GenScript).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET22b</div><div>suggested: RRID:Addgene_84863)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The acquired data was processed by FlowJo (version 10.6.2) and Prizm Software for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure determination and refinement: Before structure determination and refinement, all data reductions were performed using the CCP4 software suite (69).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structures were determined by molecular replacement with the program Phaser (70) and refined with Phenix (71).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The models were further refined by manual model building with Coot (72) based on 2Fo – Fc and Fo – Fc maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PyMOL program (https://pymol.org/) was used to prepare figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Representative spike glycoprotein sequences for other coronaviruses, corresponding to an adaptation of a set of spike sequences from the CoV3D database (77), were obtained from NCBI and GISAID, and aligned using MAFFT software (78) to generate a multiple sequence alignment which was used to obtain sequences corresponding to the YLQ and RLQ epitope positions in those viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261300: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation of our infection risk modeling approach is the assumption of a homogeneous concentration of droplet nuclei within the room, with viral emissions being instantaneously and completely mixed. However, a recent comparison of this box-modeling approach with computational fluid dynamics (CFD) simulations for a classroom environment indicates relatively minor errors for natural (6%) and forced mechanical (29%) ventilation scenarios [27]. The uncertainty in the emission rate, based on viral loads that vary several orders of magnitude between individuals and over time [28], is likely much more significant than that caused by incomplete mixing at the small scale of our models. Further improvements to the emission rate distributions are needed that incorporate variation in droplet volume concentrations [28, 29], such that a more complete stochastic emission model can be implemented. An additional limitation is our estimation of vaccination thresholds using singular, setting-specific events, without considering cumulative exposure effects that may result from an infectious person attending class in two successive days, for example. The importance of singular SSEs on SARS-CoV-2 transmission is well established, and such events likely occur during a narrow 1-2 day window of peak infectivity [30]. As such we do not expect cumulative exposures to be a significant factor outside of co-habitation environments, which is why our prison scenario used a 36-hour duration. Our approach ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261021: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: As participants did not provide consent for further contact, it was not possible to ask them to provide feedback on the findings.<br>IRB: Ethics: Overall ethical approval for this project was granted by the Imperial College Research Ethics Committee (ICREC) (Reference 20IC5956).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Summary of key findings: Benefits for quality of care were identified for the six dimensions of quality of care, including safety (reduction of exposure risks for COVID-19 transmission); effectiveness and equity (ensuring access and continuity of care to those who need it, including those who had previously limitations to access face-to-face care); efficiency (remote triage), improved timeliness and patient-centredness (convenience, communication, and patient empowerment). Benefits for healthcare providers included a greater work flexibility and more control over schedule. Benefits for healthcare systems included a transformative effect, hastening the digital transformation (increasing awareness, trust, adoption, skills, and technical capacity) and driving changes in legal and regulatory frameworks. Important challenges have also been noted for six domain of quality of care, including patient-centredness (patients’ preference for face-to-face care, potential negative impact on communication), equity (lack of equipment, internet access and digital skills of some patient groups), safety (clinical uncertainty and potentially inappropriate decision making), timeliness (delays in diagnosis and treatment), effectiveness (unsuitability for certain consultations) and efficiency (overuse and misuse). Challenges specific for healthcare providers included the lack of guidance and support, higher workload, and remuneration issues. From the health systems’ perspective, the long-establishe...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261016: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The descriptions of the places are as follows: We applied statistical transformations to our data and used STATA software 14.0 to analyze the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Additionally, some confounding and other possible limitations might exist during the data exploration. Therefore, the result in this study should be interpreted with caution. Mobility on groceries and pharmacies contributed the highest in the COVID-19 new cases increase. Food warehouses, farmers’ markets, specialty markets, and drugstores were among the essential businesses allowed to be opened during the restrictions. This finding is in line with a previous study in India, where travel for daily needs purposes are related to COVID-19 transmission.[14] A previous study observed that people shifted from restaurants towards groceries and food sellers during the stay-at-home orders [15]. We assumed that markets, mainly traditional markets, were places with frequent visitors in Jakarta as those places supplied daily necessities for the people. However, traditional markets tend to be crowded and unorganized, also challenging for social distancing implementation. Though the government ruled out health protocols in traditional markets, it was not strongly enforced. Around 107 traditional market clusters and 555 cases were reported in Jakarta, only in the first relaxation period. 22 Precisely, traditional markets contributed 4.3% of increased COVID-19 new cases in Jakarta [16]. Places like café, restaurants, shopping malls, recreation areas, and parks in Jakarta were shut down in March-June and subsequently reopened, adjusting around 50% of the total capacity during the first relaxat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261031: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were based on assessment during the index EMS attendance and completed with SAS v9.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: Previous evaluations of triage tool accuracy and prognostic COVID-19 prognostic research in the pre-hospital setting, are limited by only including patients who were subsequently admitted to hospital.22-25 This is the first evaluation to use a large cohort of patients identified from routinely collected EMS records and linked to nationally collected, patient-level, healthcare data to provide robust outcome data for all patients including those not conveyed to hospital. We had low rates of missing data in the variables used in the triage tools assessed (Table 1). We also assessed the performance of triage tools in a cohort of patients with suspected infection which, in the absence of accurate universally available rapid COVID-19 diagnostic tests, reflects the population which EMS staff must clinically triage. Most existing research either aimed to determine if patients with suspected infection have COVID-19, or to risk stratify patients with confirmed infection in a hospital setting.26 Our evaluation of triage tool accuracy is limited to a single ambulance service, albeit one covering a large population across the North of England, so the results may not be generalisable to other healthcare settings. Other ambulance services may serve populations with a different risk-profile, provide different types of EMS response or have different thresholds and guidelines regarding when to convey patients to hospital. The population used is likely to be have simi...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN28342533</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261146: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical tests were two-sided at the 0.05 significance level and analyses were conducted in SAS version 9.4 (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are some limitations in this experiment. First, all experiments were performed in an isolation room that provided consistent ventilation rates for comparison which may not be representative of occupational settings. Further studies with other general air movement patterns are needed. There is a wide variation in workstation configurations. The scenarios used here do not accurately reflect all real-world situations and a larger access opening is likely necessary at salons for performing manicures. The experiments did not consider worker or customer movement and only measured a potential exposure from two direct linear coughs. The OPCs collected data at 6-second intervals, so a travel time associated with the aerosolized particles could not be calculated. The cough simulator did not produce many particles in the larger size ranges. We collected data for 10 minutes after each cough. Since smaller particles remain in the air for longer, the two ACH we used aided in removing the small particles and prevented them from migrating and settling. Finally, masks or other transmission control methods were not considered in this work. Barriers were solely considered to assess this engineering control. Other control methods used in combination with barriers would likely provide additional reductions in exposure. In summary, laboratory simulations demonstrate that barriers can reduce cough particle exposures in locations where workers interact with others and especially for situations...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261237: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Ethics Committees from the Kumamoto General Hospital and NCGM approved this study (Kumamoto General Hospital No. 180, and NCGM-G-004176-00, respectively).<br>Consent: Each participant provided a written informed consent, and this study abided by the Declaration of Helsinki principles.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of anti-SARS-CoV-2 antibody titers: Measurement of 3 anti-SARS-CoV-2 antibody levels (anti-S1-IgG, anti-S1-IgM, and anti-N-IgG) in each participant was performed using the chemiluminescence enzyme immunoassay (CLEIA) platform (HISCL) manufactured by Sysmex Co. (Kobe, Japan) as previously reported24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1-IgG, anti-S1-IgM,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6TMPRSS2 cells were maintained in DMEM supplemented with 10% FCS, 100 µg/ml of penicillin, 100 µg/ml of streptomycin, and 1 mg/mL of G418.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The merTools package (version 0.5.2) in R software was used for prediction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>merTools</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.454085: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: EXPERIMENTAL MODEL AND SUBJECT DETAILS: Ethics Statement: For the use of human specimen, all protocols involving human subjects recruited at Kyoto University were reviewed and approved by the Institutional Review Boards of Kyoto University (approval number G0697).<br>Consent: All human subjects provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Collection of BNT162b2-Vaccinated Sera: Peripheral blood were collected four weeks after the second vaccination of BNT162b2 (Pfizer-BioNTech), and the sera of 18 vaccinees (average age: 40, range: 28-59, 22% male) were isolated from peripheral blood.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To estimate the emerging time of the Lambda variant (C.37 lineage), we collected all Lambda sequences carrying the RSYLTPGD246-253N mutation that were sampled in 2020 (2 sequences) and randomly sampled 100 sequences in 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: HEK293T cells (a human embryonic kidney cell line; ATCC CRL-3216), and HOS cells (a human osteosarcoma cell line; ATCC CRL-1543) were maintained in Dulbecco’s modified Eagle’s medium (high glucose) (Wako, Cat# 044-29765) containing 10% fetal calf serum and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, luciferase-expressing reporter viruses pseudotyped with the SARS-CoV-2 S protein and its derivatives, HEK293T cells (1 × 106 cells) were cotransfected with 1 μg of psPAX2-IN/HiBiT (Ozono et al., 2020), 1 μg of pWPI-Luc2 (Ozono et al., 2020), and 500 ng of plasmids expressing parental S or its derivatives using Lipofectamine 3000 (Thermo Fisher Scientific, Cat# L3000015) or PEI Max (Polysciences, Cat# 24765-1) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the experiment, HOS-ACE2 cells and HOS-ACE2/TMPRSS2 cells (10,000 cells/50 μl) were seeded in 96-well plates and infected with 100 μl of the pseudoviruses prepared at 4 different doses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOS-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HOS-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also added the following 4 SARS-CoV-2 genomes as the outgroup: strain Wuhan-Hu-1 (GISAID ID: EPI_ISL_1532199, isolated on December 26, 2019), EPI_ISL_1093172 (isolated on August 25, 2020), and EPI_ISL_1534645 (isolated on November 30, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids expressing the S proteins of the Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), Lambda (C.37) variants and the point mutants were generated by site-directed overlap extension PCR using pC-SARS2-S D614G (Ozono et al., 2021) as the template and the following primers listed in Table S4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-SARS2-S D614G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting PCR fragment was digested with Acc65I or KpnI and NotI and inserted into the corresponding site of the pCAGGS vector (Niwa et al., 1991).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned entire genome sequences by using the FFT-NS-1 program in MAFFT suite v7.407 (Katoh and Standley, 2013) and deleted gapped regions in the 5’ and 3’ regions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We constructed a phylogenetic tree using IQ-TREE 2 v2.1.3 software (Minh et al., 2020) with 1,000 bootstraps (Figure S1A)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A timetree was summarized using TreeAnnotator software in the BEAST package and visualized by using FigTree v1.4.4 (Figure 1C and Figure S1B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In Figures 2C and 2D, the crystal structure of SARS-CoV-2 S (PDB: 6ZGE) (Wrobel et al., 2020) was used as the template, and 40 homology models of the SARS-CoV-2 S of the Lambda variant were generated using Build Homology Model protocol MODELLER v9.24 (Fiser et al., 2000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequences were determined by DNA sequencing services (Fasmac or Eurofins), and the sequence data were analyzed by Sequencher v5.1 software (Gene Codes Corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequencher</div><div>suggested: (Sequencher, RRID:SCR_001528)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the 80 μl mixture of pseudovirus and sera/antibodies was added into HOS-ACE2/TMPRSS2 cells (10,000 cells/50 μl) in a 96-well white plate and the luminescence was measured as described above (see “Pseudovirus Assay” above). 50% neutralization titer was calculated using Prism 9 (GraphPad Software)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453908: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21260870: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261140: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological Testing: Serum samples were tested for nucleoprotein (N) antibodies as a marker of previous SARS-CoV-2 infection (Anti-SARS-CoV-2 total antibody assay, Roche Diagnostics, Basel, Switzerland) and spike (S) protein antibodies, which could be infection- or vaccine-derived (Elecsys Anti-SARS-CoV-2 S total antibody assay, Roche Diagnostics: positive ≥ 0.8 arbitrary units (au)/mL to assess vaccine response).(9, 10) Assessment of Vaccine Effectiveness: A test negative case-control design was used to estimate odds ratios for testing SARS-CoV-2 positive to in vaccinated compared with unvaccinated people with COVID-19 compatible symptoms who were tested using polymerase chain reaction (PCR), as described previously.(8) Data sources: Outcome assessment: All healthy adults aged ≥50 years in England were eligible for inclusion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 total antibody assay, Roche Diagnostics, Basel, Switzerland) and spike (S) protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using STATA v.14.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:(19, 20) Notwithstanding this, it is important to emphasise that a single dose of either vaccine remains highly effective against severe endpoints, which is the primary aim of the vaccination programme, with 75-85% protection against hospitalisation in the oldest cohorts.(8) As of 28/06/2021, the vaccination programme is estimated to have prevented nearly 8 million infections and 27,000 deaths in England alone.(21, 22) Strengths and Limitations: The strength of this study is the combination of sero-surveillance with real-world national VE data for two different vaccines in different age groups, including older adults who were excluded from initial clinical trials, with variable, real-world dosing intervals. Serological assessments provide an objective measure of vaccine responses which are important for comparing vaccines and schedules, but interpretation of serological data is limited as the way in which it correlates with protection is unknown and the recognition that neutralising activity of antibodies and cellular immunity also play an important role in protection. As with any observational study, there are limitations to VE analysis. There may be confounding factors that could increase the risk of COVID-19 in vaccinated individuals, for example, if vaccinated individuals adopted riskier behaviours after vaccination or unvaccinated individuals isolated themselves to reduce their risk of viral exposures. In addition, VE could be attenuated if there are high levels of prote...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261028: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The N3C Data Enclave is approved under the authority of the NIH Institutional Review Board (IRB, IRB00249128) with Johns Hopkins University School of Medicine as a central IRB for data transfer.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV infection was defined by (1) HIV condition (ICD codes), (2) HIV-related laboratory results (ELISA antibody test or detection of HIV viral load), (3) HIV-related medications (antiretroviral therapy, [ART]) excluding pre-exposure prophylaxis (Supplementary Table S-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antiretroviral therapy ,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">History of HIV infection, SOT, comorbid conditions, demographics (age, sex, race and ethnicity [non-Hispanic Black, non-Hispanic White, Hispanic, others]), smoking history (never vs. ever vs. unknown), and study sites were extracted using custom concept sets developed from International Classification of Diseases (ICD) codes, Current Procedural Terminology (CPT) codes, and other medical codes (Supplementary table S-1 lists concept sets and codes used in definitions).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Despite the largest and the most representative sample to date for a U.S. population 17,18, our study has limitations. First, N3C primarily compiled data from large academic medical centers funded by NCATS. Therefore, it may be less representative of admission practices and disease severity in other settings. There has historically been a low threshold to admit PWH and SOT to these hospital because of their underlying disease. While this might have contributed somewhat to increased likelihood of hospitalization with mild/moderate disease, it would not account for the independent increased odds for ventilation among persons that were hospitalized in these groups. Potential misclassification of key exposures (e.g. HIV status, SOT, or other comorbidities) may occur due to inherent limitations of EMR data. In particular, we were more likely to identify PWH who were successfully engaged in care due to reliance on ICD codes, ART, and laboratory results in the past 2 years to define HIV status. However, HIV or SOT are unlikely to be missed on admission diagnoses due to their clinical importance. Further, these potential misclassifications are likely to be non-differential throughout the cohort and unlikely to change our conclusions. HIV laboratory values (CD4 cell counts and HIV viral load) were not universally available across all study sites and individuals. Differential laboratory assays and protocols across sites added further complexity for data harmonization and validation. Ho...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260837: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study exclusion criteria included lack of willingness or ability to provide informed consent, or lack of an appropriate legal guardian or representative to provide informed consent.<br>IRB: The two study protocols were reviewed and approved by the NHS Health Service Research Ethics Committees (REF: 20/SC/0147 for SAFER and 20/SC/0169 for FASTER).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-human IgG (γ-chain specific, A9544, Sigma-Aldrich) or IgA (α-chain specific, A9669, Sigma-Aldrich) or mouse anti-human IgA1 (Fc-specific, ab99794, Abcam) or IgA2 (Fc-specific, ab99800, Abcam) conjugated to alkaline phosphatase was used as secondary antibody and plates were developed by adding 4-nitrophenyl phosphate in diethanolamine substrate buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-9C4ADD, RRID:AB_10508694)</div></div><div style="margin-bottom:8px"><div>α-chain</div><div>suggested: (Sigma-Aldrich Cat# M8695, RRID:AB_2617179)</div></div><div style="margin-bottom:8px"><div>anti-human IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: (Abcam Cat# ab99800, RRID:AB_10710695)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCWs in a variety of roles were enrolled onto SARS-CoV-2 Acquisition in Frontline Healthcare Workers - Evaluation to inform Response (SAFER) study between 30th March and 9th April 2020 at Royal Liverpool University Hospital (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Frontline Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the patient cohort, adults (aged ≥ 18 years) with signs and symptoms of suspected COVID-19 infection attending RLUH, Aintree University and Whiston Hospital in Merseyside between April 2020 to January 2021 were recruited into Facilitating A SARS Cov-2 Test for Rapid Triage (FASTER), regardless of disease severity, race, ethnicity, gender, pregnancy or nursing status, or the presence of other medical conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTER</div><div>suggested: (FASTER, RRID:SCR_009045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blank corrected samples and standard values were plotted using the 4-Parameter logistic model (Gen5 v3.09, BioTek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S1 and S2 proteins were conjugated with Biotin (EZ Link conjugation kit, Thermofisher), then directly labelled with Streptavidin-BV785 and PE (Biolegend), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermofisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on an Aurora cytometer (Cytek Biosciences) and analysed using Flowjo software v.10 (Treestar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analyses were performed using R software (version 4.0.4) or GraphPad Prism (version 9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical and demographic data were analysed using GraphPad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has limitations. Diagnosis of co-infection was complex amongst patients, as pneumococcus might be carried by the patient before the viral infection or might be picked up later. High use of antibiotics (potentially prescribed at an outpatient visit) and reduced social mixing affected survival, prevalence and transmission dynamics of other respiratory pathogens, such RSV1, 49, and most likely pneumococcal transmission. Hence, we observed decreased prevalence of pneumococcus amongst patients-particularly during periods of national lockdown, which subsequently limited the number of SARS-CoV-2/ pneumococcus co-infected individuals studied here. Thus, despite inclusion of nearly 500 subjects in our study, we were able to evaluate pneumococcal mediated immunomodulatory effects only for a relatively small number of individuals, limiting the ability to do further stratifications. In children, pneumococcal colonisation has been profusely documented. Children however experience an attenuated course of SARS-CoV-2 infection. This emphasises the importance of our findings in adults and indicate the need to conduct future studies aimed at understanding the differential disease course in children, taking this important variable into consideration. In addition, differences in age and underlying disease between the HCW and patient cohorts are some factors that have potentially affected the course and outcome of the disease. Further studies, ideally in the setting of controlled human ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261130: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Information on date of birth and sex (male/female) was retrieved from the Danish Civil Registration System (11).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: The strengths of this study are the high-quality registers and the possibility to use the unique personal identifier to link data on all residents in Denmark. The national testing strategy during the study period, including unlimited access to free-of-charge RT-PCR tests nationwide, led to a high proportion of the population being tested, which enabled us to capture data on both asymptomatic and symptomatic infections. Another strength was the access to national data on all laboratory confirmed RT-PCR SARS-CoV-2 infections. Also, a high sensitivity (97.1%) and specificity (99.98%) was observed for the RT-PCR test (21) ensuring a low risk of misclassification. An effort was made to ensure that all individuals had equal opportunities to receive the COVID-19 vaccines. This was done through an online booking system, special campaigns, offering vaccination in some workplaces, translating the material to other languages than Danish and English and arranging transport for those who were not able to reach the vaccination clinics on their own. This study has also several limitations. Since we were not able to discriminate between asymptomatic and symptomatic infections, it was not possible to assess the severity of a COVID-19 infection after vaccination based on symptoms. We used a positive SARS-CoV-2 test prior to hospitalization and death (i.e. COVID-19 related hospitalization and death) as proxy for the severity of COVID-19, although this definition might...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261122: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study participants: 553 individuals, who received their first dose of the AZD1222/Covishield vaccine between the 15th of February to 4th March 2021, were included in the study following informed written consent (16 to 17 weeks since receiving the first dose).<br>IRB: Ethics approval was obtained from the Ethics Review Committee of University of Sri Jayewardenepura.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Blood samples were obtained from all individuals to determine seropositivity rates at ≥16 weeks since obtaining the first dose of the vaccine, while T cell studies, ACE2 blocking and variant specific antibody responses for SARS-CoV-2 were carried out in only 69 individuals, who were randomly selected from different age categories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2 specific antibodies: The presence of SARS-COV-2 specific antibodies were detected by using the Wantai SARS-CoV-2 Ab ELISA (Beijing Wantai Biological Pharmacy Enterprise, China), which detects IgM, IgG and IgA antibodies to the receptor binding domain (RBD) of the spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to quantify IgG antibodies to the RBD, WANTAI SARS-CoV-2 quantitative IgG ELISA (CAT-WS-1396) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>quantify IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, ELISpot plates (Millipore Corp., Bedford, USA) were coated with anti-human IFNγ antibody overnight (Mabtech, Sweden).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFNγ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All experiments were carried out in duplicate and anti-human IgG monoclonal capture antibodies, was used as a positive control, and media alone as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261105: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. First, our data was limited to a single hospital system within New York City, which may limit generalizability to other geographical regions. Similarly, as the standard of care for hospitalized patients with COVID-19 has evolved after our data was collected, model performance should be validated with newer cohorts. Our models did not use inputs such as imaging and echocardiograms, and their exclusion may have hindered performance. We deliberately limited hyperparameter tuning of models to simulate a scenario where a federated model has to be urgently deployed at resource-constrained hospitals, such as during the COVID-19 pandemic. Allowing further optimization of the MLP structure, and techniques such as transfer learning may improve MLPfederated model performance.20 We examined only two classifiers; other approaches such as random forests or support vector machines may have yielded better results. Lastly, performance with the FL approach was generally statistically inferior to pooled dataset performance, and it remains to be explored if other approaches exist which can help bridge this gap while retaining the privacy advantages of FL. In summary, we demonstrate the utility of FL to improve prediction of key outcomes while maintaining privacy and confidentiality. We hope this will encourage the development of generalizable clinical models which would otherwise be hindered by inability to share patient-level data across institutional boundari...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261066: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient Cohorts, Data Collection and Analysis: This study was approved by the Weill Cornell Medicine Institutional Review Board protocol # 1207012637 entitled Utilizing a Transplant Database for Quality Assessment and Performance Improvement and Clinical Outcomes and protocol # 20-05022154 entitled Impact of COVID-19 Illness on Kidney Transplant Candidates and Recipients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory Evaluation: SARS-CoV-2 Antibody Testing: All patients in the study were initially screened for SARS-CoV-2 antibodies upon admission for kidney transplant in the clinical setting using a clinically validated test targeting the RBD of the S1 spike protein (S-RBD) to detect SARS-CoV-2 antibodies which gives either a positive or negative result.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Testing for the quantitative 10 transplant recipients and 4 dialysis patients testing was performed using the following assays: 1) measurement of IgG Index value and IgM Index value using the SARS-CoV-2 Pylon 3D analyzer (ET Healthcare) as previously described6, 2) SARS-CoV-2 total receptor binding domain (RBD) assay to measure the overall binding between SARS-CoV-2 antibodies and the RBD of the virus S protein, 3) SARS-CoV-2 Antibody Avidity Assay that measures the rate of SARS-CoV-2 specific antibody dissociation from RBD, which is inversely correlated with the antibody avidity, and 4) SARS-CoV-2 Surrogate Neutralizing Antibody Assay (SNAb) which is a competitive binding assay that measures the percentage of RBD-ACE2 binding and inversely correlates with the SNAb binding inhibition (neutralizing activity).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 total receptor binding domain (RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Testing for the quantitative 10 transplant recipients and 4 dialysis patients testing was performed using the following assays: 1) measurement of IgG Index value and IgM Index value using the SARS-CoV-2 Pylon 3D analyzer (ET Healthcare) as previously described6, 2) SARS-CoV-2 total receptor binding domain (RBD) assay to measure the overall binding between SARS-CoV-2 antibodies and the RBD of the virus S protein, 3) SARS-CoV-2 Antibody Avidity Assay that measures the rate of SARS-CoV-2 specific antibody dissociation from RBD, which is inversely correlated with the antibody avidity, and 4) SARS-CoV-2 Surrogate Neutralizing Antibody Assay (SNAb) which is a competitive binding assay that measures the percentage of RBD-ACE2 binding and inversely correlates with the SNAb binding inhibition (neutralizing activity).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ET Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: GraphPad Prism 9 was used to determine median, mean and standard deviation for all data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our data set has several limitations. First, there were only a small number of samples that were available for sequential testing and there was only a short duration of follow-up. In the cohort of patients who underwent quantitative and qualitative testing, all received lymphocyte depleting induction therapy and therefore it is unknown whether results would be similar if patients had another type of induction therapy, nor could we compare whether the attenuated response would also be seen in patients who underwent induction with IL-2 receptor blocking agents. Such data is important as some have suggested using less potent immunosuppression, especially for induction therapy in the COVID era. Finally, dialysis patients are known to have an impaired immune response21 and therefore the study would be strengthened by having a non dialysis cohort to compare our findings as well. It is reassuring, however, that overall our findings mirror that done by other centers in both transplant and non-transplant patients. Overall, this is the first study to describe the changes in humoral immunity in kidney transplant recipients pre and post-transplantation. We have demonstrated that (1) there is significant heterogeneity in the durability of the humoral response to SARS-CoV-2 in the transplant population and (2) transplant patients experience a significantly greater decrease in IgG levels directed against SARS-CoV-2 RBD protein during the first year as compared to wait-listed dialysis patien...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261082: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Subjects: The study design was approved by the Okinawa Institute of Science and Technology, Graduate University (OIST) human subjects ethics committee (applications HSR-2020-024, HSR-2020-028).<br>Consent: All donors provided informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Based on antibody test results, donors were grouped into seronegative young (n=45, 40 % male, 60% female; mean age 38 years, age rage 23-49 years), seronegative elderly (n=41, 17 % male, 83% female; mean age 81 years, age rage 70-93 years), seropositive young (n=19, 63 % male, 37% female; mean age 41 years, age rage 20-50 years), and seropositive elderly (n=11, 45 % male, 55% female; mean age 78 years, age rage 70-91 years).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were resuspended in RPMI1640 (Gibco) medium supplemented with 5% (v/v) human AB-serum (PAN-Biotech; P30-2901), seeded into 96-well, U-bottom culture plates (106 cells per well), and either left unstimulated (cells treated with equimolar amounts of DMSO) or stimulated with 1μg/mL SARS-CoV-2 M peptide pool for 7 h in the presence of 1μg/mL anti-CD40 (5C3; Biolegend; 334302) and 1 μg/mL anti-CD28 antibodies (CD28.2; Biolegend; 302934).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD40</div><div>suggested: (BioLegend Cat# 334302, RRID:AB_1236384)</div></div><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After stimulation, cells were incubated with anti-Fc receptor-blocking antibody (Biolegend; 422301) and NIR-Zomibie (Biolegend; 423106) and stained with anti-CD3 (OKT3; Biolegend; 1:200), anti-CD4 (clone PPA-T4; Biolegend; 1:200), anti-CD8 (SK1; Biolegend; 1:200), anti-CD45RA (HI100; Biolegend; 1:100), and anti-CCR7 (G043H7; Biolegend; 1:100) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Fc receptor-blocking</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: (BioLegend Cat# 317318, RRID:AB_1937212)</div></div><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: (BioLegend Cat# 980902, RRID:AB_2616623)</div></div><div style="margin-bottom:8px"><div>anti-CD45RA</div><div>suggested: (BioLegend Cat# 304106, RRID:AB_314410)</div></div><div style="margin-bottom:8px"><div>anti-CCR7</div><div>suggested: (Fluidigm Cat# 3159003, RRID:AB_2714155)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For intracellular cytokine analysis, cells were subsequently fixed and permeabilized using Foxp3 Staining Buffer Sets (eBioscience; 00-5253-00) and stained with anti-IFN-γ (B27; BD; 1:100), anti-TNF-α (MAb11; Biolegend; 1:20) and anti-IL-2 (MQ1-17H12; Biolegend; 1:20) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Foxp3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: (BD Biosciences Cat# 564039, RRID:AB_2738557)</div></div><div style="margin-bottom:8px"><div>anti-TNF-α</div><div>suggested: (BioLegend Cat# 502913, RRID:AB_315265)</div></div><div style="margin-bottom:8px"><div>anti-IL-2</div><div>suggested: (BioLegend Cat# 500305, RRID:AB_315092)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were analyzed on a Fortessa X-20 (BD), and data were analyzed with FlowJo software version 10.7.1 (FlowJo LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Unpaired t tests or Mann-Whitney U tests were performed using GraphPad Prism 9.1.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21260924: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261074: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In closing, we also mention that our approach is not exempt from limitations that affect TB transmission models. For instance, the outcome of our model depends on a series of epidemiological parameters and initial burden estimates that are subject to strong sources of uncertainty, thus propagating this uncertainty to the results. This means that future improvements in measuring the input data are expected to impact the quantitative outcomes of our mathematical model, the same way as it would affect any other model who leans on them. Moreover, in our work we have only described the disruption caused by the COVID-19 pandemic on the TB care system via a reduction of diagnosis capabilities and treatment availability. Even if these are arguably the primary, and have been the first effects of COVID-19 pandemic on TB transmission dynamics in being characterized, there may be many other effects that are yet hard to parameterize. On the one hand, it is well known that the emerging pandemic has disrupted profoundly the age-structure of social contacts in human populations world-wide through a combination of mobility restrictions, lockdowns, social distancing, and adaptive conducts driven by self-perceived risk, often associated to the stark variations in susceptibility to severe disease and death that have been extensively reported for COVID-19. All these effects combined have arguably re-wired age-dependent contact structures in a way that is not fully understood, and may not be compl...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.454098: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Specimens – nasopharyngeal swabs were collected from suspected cases and contact persons as part of the public health emergency response of the Ministry of Health in the Republic of Guinea. Isolation of RNA from specimens was carried out using a kit for the isolation of nucleic acids “RiboPrep” (“InterLabService”, Russia).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genome was assembled through mapping the filtered reads to the reference genome (Wuhan-Hu-1 (NC_045512.2)) using the BWA software version 07.17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of the nucleotide sequences of both complete genomes and the S gene was carried out using the MAFFT v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparative phylogenetic analysis was conducted using the BioNumerics 7.6 software package (Applied Maths NV, Belgium) and the Maximum Parsimony algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioNumerics</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21260398: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This pilot study was conducted to estimate the sample size needed for future studies due to lack of data and the innovation of the method used.<br>IRB: Ethical considerations: The Ethics and Research Committee of Qazvin University of Medical Sciences approved this study (IR.QUMS.REC.1399.043).<br>Consent: Informed written consent was obtained from all participants following a detailed explanation of the examination and study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This study had a randomized controlled design.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The patients who met the inclusion criteria were selected and divided into two groups included intervention and control groups based on random number blocks designed by Excel software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The collected data were analyzed using the IBM SPSS software version 26 in two unlabeled groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study had several limitations. Because of the nature of rehabilitation and assessment, neither the executors nor the participants could be blinded. Therefore, it is not possible to rule out the placebo effect, observer bias or experimenter bias in the current study. In addition, the subjects were limited to patients aged 18 years and above, the duration of the intervention was only three days, and the number of participants was insufficient in each group. Eventually, we did not measure other variables such as the respiratory rate, pulse rate, lung capacities, and anxiety score. Therefore, future studies should address these limitations.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261119: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial was conducted in accordance with the applicable ethical standards and Good Clinical Practices guidance at seven sites after obtaining ethics committee approval and registration on the clinical trial registry of India (CTRI/2020/09/027903).<br>Consent: All the trial participants had signed the informed consent document.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">05), the female participant having a negative pregnancy test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This was a prospective, open-label, two-arm, randomized, controlled, multi-centric trial for evaluation of efficacy and safety of COVID-19 HIG solution manufactured by Intas Pharmaceuticals Ltd. India.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260998: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We considered three age cohorts: 12-17 years old to match US myocarditis data following mRNA COVID-19 vaccination, and 12-15 and 16-19 years old to align with common age groupings for vaccination policy and an Israeli report of especially high risk in males age 16-19 following mRNA COVID-19 vaccination.1,2,11 Given the demographics of earlier reports of mRNA vaccine-associated myocarditis, our report focuses on young males, but we include data for female cohorts for comparison purposes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Another limitation is the approach taken to account for missed cases of COVID-19. We assumed that infection rates are similar for 12-19-year-olds and the overall population, and that one-third of the extra COVID-19 cases not detected in the database were tested and seen by physicians with similar rates of myocarditis. There is no currently available data to support precise estimates. However, assuming no additional cases of myocarditis from any of the missed COVID-19 cases, rates of myocarditis in 12-17 year old males would still be nearly three times as great from COVID-19 infection than from the vaccine. With intense media and social media focus on COVID-19 vaccine side-effects, it is important to quantify and communicate to the public the risks of COVID-19 infection in young people. The ACIP report projected that mRNA vaccination in 12-17-year-old males would result in 215 fewer hospitalizations and 71 fewer intensive care unit stays. Benefits of the vaccine outweighed the risk of myocarditis from vaccination in all age groups, 12 years-old and up. Our results suggest that the risk of myocarditis from COVID-19 infection itself exceeds the known risk from vaccination by a considerable margin. In light of more infectious variants, the new school year nearing and many colleges now requiring COVID-19 vaccination (either for all students or just those living on campus), these results are especially timely. Whether considering all the risks and benefits of COVID-19 vaccination o...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260606: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.31.21261422: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations of the study: Thus far, to the best of our knowledge, this is one of the largest studies exploring sex-specific differences in CFRs at regional and country level of SSA. Our data was derived from individual-level patient data, which included information on age and sex, for a consecutive duration of 120 days from 20 SSA countries. Due to data unavailability, we were only able to include 20 from the 47 member states comprising the WHO African region. A particular strength of our study included our choice of prior. Our sensitivity analysis indicated that our prior was robust, since the results from all priors considered produced similar results. Among the 20 countries, only four countries had low sample sizes in some age categories, suggesting strong statistical validity and accuracy among the remaining 16 countries. Our study however, goes not without limitations. Our dataset was solely limited to age and sex; other gender-relevant indicators, such as presence of comorbidities, socioeconomic status, and immunological conditions were not available for analysis, preventing us from conducting further analyses on gender-related health inequities. Furthermore, gendered hospital admissions and differential treatment for men and women in clinical settings could act as a confounding source of bias to COVID-19 case and death reporting, impacting our CFR results. Due to lack of data, we could not address this. Moreover, case definition, surveillance capacity (e....
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453518: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: All animal experiments were conducted in an AAALAC International-accredited facility and were approved by the Rocky Mountain Laboratories Institutional Care and Use Committee following the guidelines put forth in the Guide for the Care and Use of Laboratory Animals 8th edition, the Animal Welfare Act, United States Department of Agriculture and the United States Public Health Service Policy on the Humane Care and Use of Laboratory Animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Inoculation experiments: Four to six-week-old female and male Syrian hamsters (ENVIGO) were inoculated (10 animals per virus) intranasally (I.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: At regular intervals mycoplasma testing was performed.<br>Authentication: The airflow was adjusted for each tube length to be 30 cage changes/hour and the flow was validated prior to starting the experiments by timing a smoke plume through the tubes.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary goat anti-hamster IgG Fc (horseradish peroxidase (HRP)-conjugated, Abcam) spike-specific antibodies were used for detection and visualized with KPL TMB 2-component peroxidase substrate kit (SeraCare, 5120-0047).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Secondary goat anti-hamster IgG Fc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-hamster IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus propagation was performed in VeroE6 cells in DMEM supplemented with 2% fetal bovine serum, 1 mM L-glutamine, 50 U/mL penicillin and 50 μg/mL streptomycin (DMEM2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Receptor transfection: BHK cells were seeded in black 96-well plates and transfected the next day with 100 ng plasmid DNA encoding human or hamster ACE2, using polyethylenimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plates pre-coated with poly-L-lysine (Sigma–Aldrich) were seed with 293T cells and transfected the following day with 1,200 ng of empty plasmid and 400 ng of plasmid encoding coronavirus spike or no-spike plasmid control (green fluorescent protein (GFP)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively), were synthesized and cloned into pcDNA3.1+ (GenScript).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1+</div><div>suggested: RRID:Addgene_117272)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK cells previously transfected with ACE2 plasmid of interest were inoculated with equivalent volumes of pseudotype stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:Addgene_164219)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutagenesis to model the residues that differ in the B.1.1.7 RBD and hamster ACE2 was performed in COOT 51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure figure was generated using the Pymol Molecular Graphics System (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amino acid sequence alignments of human ACE2 (BAB40370.1) and hamster ACE2 (XP_005074266.1), and of SARS-CoV-2 RBD from the linage A strain and B.1.1.7 variant, were were generated using Clustal Omega (http://europepmc.org/article/MED/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining reads were mapped to the SARS-CoV-2 2019-nCoV/USA-WA1/2020 (MN985325.1 using Bowtie2 version 2.2.928 with parameters --local --no-mixed-X 1500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR duplicates were removed using picard MarkDuplicates (Broad Institute) and variants were called using GATK HaplotypeCaller version 4.1.2.029 with parameter-ploidy 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.25.453673: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Pseudoviruses were generated by co-transfection of HEK293T cells with plasmids encoding firefly luciferase, a lentiviral packaging plasmid (Addgene cat8455), and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53, or SARS-CoV-2 B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped viruses (PSV) sufficient to generate 100 000 relative light units (RLU) were incubated with serial dilutions of nanobody for 60 min at 37 °C. 15 000 HEK293T-hACE2 cells were then added to each well, and the plates were incubated for 48 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 challenge experiments: K18-hACE2 transgenic mice were purchased from Jackson laboratories and maintained as a hemizygous line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nanobodies were cloned in the pHEN plasmid with a C-terminal sortase motif (LPETG) and a 6xHIS tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning and expression of candidates: Selected nanobody sequences were ordered as eBlocks from Integrated DNA technologies (IDT) with 20 bp overhangs for Gibson assembly into a pHEN6 plasmid digested with PstI and BstEII restriction enzymes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing antibody ID50 titers were calculated in Prism 9 (GraphPad Software) by fitting a four-parameter logistic curve bounded between 0 and 100, and interpolating the concentration/dilution where RLUs were reduced by 50% relative to control wells in the absence of nanobody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence was quantified using a BD FACSCelesta and the FlowJo software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry and HDExaminer analysis files have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository (REF ID:30395289).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S4) was quantified using ImageJ and an E4 homodimer as a reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453327: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: BioIVT sought informed consent from each subject, or the subjects legally authorized representative, and appropriately documented this in writing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentration of antibody binding sites and KD values were determined by Bayesian inference as described previously.18,19 Serum-antibody mediated displacement of ACE2 from S1 by using microfluidic diffusional sizing: Displacement of ACE2 from SARS-CoV-2 S1 was measured on a Fluidity One-W Serum as described previously.19,20 S1 is used to improve S/N as S1 binding induces a larger size change than RBD upon binding to ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453787: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: MS/MS data were processed using PMi-Byonic (Version 3.7) node within Proteome Discover (Thermo Scientific) Data were searched using the Protein Metrics 182 human N-glycan library (included in the Byonic program) as potential glycan modifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PMi-Byonic</div><div>suggested: (PMI-Byonic, RRID:SCR_016735)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was displayed using PyMOL, the only change being that the O-linked glycans were hidden due to low occupancy [3].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.24.453631: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Six hamsters each were challenged with 0.1 ml of 105 TCID50/ml of B.1/Delta/B.1.617.3 virus variants intranasally under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiments: For the virus shedding study, eighteen female, Syrian hamsters of 8-10-week-old age were divided into 3 groups of 6 animals each.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The lesions were graded on a numerical scale from 0 to 4 as no abnormality (0), minimal (1), mild (2), moderate (3) and severe (4) based on the severity of lesions observed by blinded scoring.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 antibody detection: The serum samples collected on day 3, 5, 7 and 14 DPI were tested for IgG antibodies by a hamster anti-SARS-CoV-2 IgG ELISA as described earlier [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolates were propagated and passage twice in VeroCCL81 cells and sequence verified by Next generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroCCL81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The data collected from the study was analysed using Graph pad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261093: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Every PCR test conducted in Qatar, regardless of location (outpatient clinic, drive-thru, or hospital, etc.), is classified on the basis of symptoms and the reason for testing (clinical symptoms, contact tracing, random testing campaigns (surveys), individual requests, routine healthcare testing, pre-travel, and port of entry).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Incidence rates and corresponding 95% CIs were estimated using a Poisson log-likelihood regression model with the STATA 17.042 stptime command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted in STATA/SE version 17.042.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/SE</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21261008: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Authorised representatives of the sponsoring institution as well as representatives from the human research ethics committees, research governance office and regulatory agencies may inspect all documents and records required to be maintained by the CPI in this study.<br>IRB: Authorised representatives of the sponsoring institution as well as representatives from the human research ethics committees, research governance office and regulatory agencies may inspect all documents and records required to be maintained by the CPI in this study.<br>Consent: Local site study documents will be stored for at least 15 years and will not be destroyed without the written consent of the CPI.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Level 4 centres provide local care for low-risk mothers and babies including births from 34 weeks’ gestation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study data will be collected and managed using REDCap electronic data capture tools [12] hosted at The University of Melbourne.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Deidentified individual patient-level data on ≤ 100 fields will be analysed in STATA SE v16 [13].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, there are limitations to the data collection methods, including missing data on planned home births, private hospital births, and COVID-19 infection rates in pregnancy. There are also hospital-specific variations to the many data collection fields, requiring manual recoding and collation before indicators can be generated. There are potential risks related to data security. However, as no personally-identifying information will be collected in this study, there is no possibility of breaches of privacy or confidentiality. The risks to the successful conduct of the study include inadequate health service resources to collect and submit the data or insufficient study resources to clean and analyse data on a continuous basis. We have designed this study to leverage existing routine data reporting tools to minimise the burden on health services. We have also obtained philanthropic and University funding to support the central data management and report generation (see Funding declarations).
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.25.453717: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was approved by the Experimental Animal Ethics Committee in Kyorin<br>Euthanasia Agents: After the mice were euthanized by cervical dislocation, peritoneal exudate cells were harvested by sterile lavage of the peritoneal cavity with ice -cold Dulbecco’s modified Eagle’s medium (DMEM; Nacalai Tesque, Kyoto, Japan).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal care and use: Adult (8–12-week-old) male C57BL/6J mice (Sankyo Labo Service, Tokyo, Japan) were housed at a temperature of 23–25 °C and humidity of 50%–60% with a fixed light/dark cycle (light, 7:00–19:00; dark, 19:00–7:00).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking with 1% bovine serum albumin, the primary antibody against p65 (8242S; Cell Signaling Technology) was applied at a 1:400 dilution for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p65</div><div>suggested: (Cell Signaling Technology Cat# 8242, RRID:AB_10859369)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal care and use: Adult (8–12-week-old) male C57BL/6J mice (Sankyo Labo Service, Tokyo, Japan) were housed at a temperature of 23–25 °C and humidity of 50%–60% with a fixed light/dark cycle (light, 7:00–19:00; dark, 19:00–7:00).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The density of each protein band was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453598: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 8. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261038: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The PDCS was approved by Institutional Review Boards of the University of California, Berkeley, the University of Michigan, Ann Arbor, and the Nicaraguan Ministry of Health.<br>Consent: Participants’ parents or legal guardians provided written informed consent.<br>Field Sample Permit: Laboratory methods: Upon collection, annual blood samples were immediately transported to the Nicaraguan National Virology Laboratory of the Ministry of Health for processing and storage at −80°C.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used SaTScan v9.4.4 to identify hierarchical and the newer Gini clusters of infection risk, disease risk, and case incidence.29,30 Hierarchical clusters identify the most statistically likely clusters and Gini clusters maximize outcome rates</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SaTScan</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As the case-based incidence rate is frequently misinterpreted as a measure of infection and/or disease risk for pathogens of high human concern that cause many subclinical infections (including malaria-causing Plasmodium; Mycobacterium tuberculosis; and many pathogens transmitted by sex, air, vectors, and soil), our findings concerning the limitations of case-based spatial studies likely generalize widely and impact many diseases of global health importance that disproportionately affect neglected populations. Measuring a population’s infection status (not just that of suspected cases) has many benefits, the most obvious being to guide interventions to areas of high transmission. As another example, due to antibody-dependent enhancement, prior infection with DENV or ZIKV can lead to severe and life-threatening dengue upon a subsequent DENV infection under certain circumstances.18,23 Given widespread ZIKV immunity across Latin America and the high prevalence of DENV across the tropics and subtropics, knowing where ZIKV and DENV seroprevalence is high can highlight where episodes of severe dengue are likely to occur and burden medical facilities. For SARS-CoV-2, knowledge of areas with a high proportion of uninfected individuals is critical for public health measures, both to prioritize vaccine rollout, particularly in settings where vaccine availability is severely limited, and to inform the need for other interventions. Others have shown how to combine regional serosurvey dat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261039: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval: Ethics approvals were obtained from the Research Ethics Board of University of British Columbia in British Columbia (H20-02097), the Health Research Ethics Board of University of Manitoba (HS24140 (H2020:352)) and the Health Information Privacy Committee of the Government of Manitoba (No. 2020/2021-32) in Manitoba, the Health Sciences Research Ethics Board of University of Toronto (no. 39253) in Ontario, and the Institutional Review Board of McGill University in Québec (A06-M52-20B).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261040: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from patients and the study was approved by the Institute Ethics Committee.[<br>IRB: Informed consent was obtained from patients and the study was approved by the Institute Ethics Committee.[</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using Stata version 14 (TX, USA) and graphical representation using R version 4.0.2 and RStudio 1.4.1717.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, this study has a few limitations. Firstly, recall bias is inherent to the case-control study design and cannot be completely eliminated. Secondly, difference in the standard of care of COVID-19 treatment practices may exist since CAM cases were treated at other hospitals while controls were mainly treated at our tertiary care center. Thirdly, since it was a retrospective study, the robustness of our findings decreased due to lower sample size available for multivariable modelling in view of missing information particularly for blood glucose, HbA1c and ferritin. Fourth, cases of CAM may occur infrequently beyond 30 days of COVID-19 onset (n=10, 6.6%) and thus controls may remain at-risk of CAM. However, none of the controls have notified the authors of the occurrence of CAM even after study completion. In conclusion, CAM is strongly associated with diabetes, poor glycemic control, and systemic steroid use. Requirement of oxygen therapy and hospitalization for COVID-19 did not affect the risk of CAM. Novel risk factors identified in our study include prolonged use of cloth and surgical masks vis-a-vis N95 masks, and repeated nasopharyngeal swab testing. These are potentially modifiable and merit further prospective research.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261025: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was given på subject patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was carried out offline, independent of clinical analysis results, on TomTec® software by the primary analyst and quality-controlled by a senior echocardiographer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TomTec®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses and graphs utilised GraphPad Prism 5.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04316884</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Mechanisms for Organ Dysfunction in Covid-19</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260972: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search methods: An exhaustive literature review was conducted on major databases: PubMed, WHO COVID-19 Database, Embase, China National Knowledge Infrastructure (CNKI) Database, Google Scholar, manual searches of leading medical journals, and a pre-print server, medRxiv, covering the timeline of January 1st, 2020, to March 16th, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This review has some limitations, such as the small sample sizes analyzed from each country except for China that had 73% (n=423) of the total included cases. The majority of these cases were reported from Wuhan or the Hubei province, where the gross domestic product per capita is less than half of that of Beijing and Shanghai[105]. Therefore, the findings of studies from China may be generalizable to the socioeconomic and health development status of other middle-income countries and not to high-income nations. This review can be improved by sampling larger series and including IPD, if available, to predict the outcome of COVID-19 illness based off epidemiological trends dramatically reducing hospitalization time, given the lack of sufficient healthcare resources in low-middle income countries. Therefore, a selection bias remains when considering LMICs where admitted hospital patients could be in a more critical state reporting a higher mortality rate. Our review on reinfections in COVID-19 also comes at a pertinent time as countries, especially the developing world, suffer a repeated wave of infection[106]. At this time, public health initiatives aimed at removing complacency are the need of hour, and one of the key messages that needs to be given is that reinfection is a reality and vaccines along with social distancing remain the key in fighting the pandemic. A recently published online longitudinal survey [107] in 23 countries of high, middle and low income, across 4 con...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260910: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A discussion of the relative advantages and disadvantages, as well as their respondent demographics, are available from Prolific’s website [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prolific’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Open-ended questions, particularly “highest level of education”, required extensive codification for standardization which was semi-automated in MySQL using Oracle MyQSL Workbench (v8.0 CE) and custom Python 3 scripts (algorithms available on request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were run in IBM SPSS (v27.0) and graphs were created in GraphPad Prism (v6.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were created in Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Other limitations of this study include low variability in responses suggests that the reliability and ecological validity of the self-reported data should be questioned. Furthermore, the heavy skew towards young individuals, and lack of representation of nonbinary genders (who may be at increased risk for adversity during pandemic restrictions), limit the generalisability of our findings across these dimensions. Data regarding self-identified race, culture and ethnicity was not collected, and collecting this information as well as clearer or more standardised measures of socio-economic status and level of education would enhance the quality of the results found here. To improve the validity of future cluster analyses for COVID-related decision making, the model would benefit by keeping variables used for cluster creation and variables used for outcome measures mutually exclusive. In closing, each country has approached the COVID-19 pandemic in different ways, yet we demonstrate here that people have formed internationally coherent clusters in responding to this challenging period. Incorporating group-specific approaches to improve adherence and coping will not only assist in reducing the spread of infection, but also benefit the well-being of citizens while vaccinations are under way. This knowledge should inform way we create, enforce and adapt restrictive regulations for future large-scale crises.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260942: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written consent before being enrolled into the trial.<br>Field Sample Permit: The trials were designed and funded by Nanogen Pharmaceutical Biotechnology JSC and the Ministry of Science and Technology (MOST) of Vietnam.<br>IRB: The trial protocol was approved by the Ethics Committee/Protocol Review Board of the Ministry of Health (Vietnam) and was performed in accordance with the ICH-GCP good clinical practice guidelines, with an ethical policy consistent with the “Declaration of Helsinki” and applicable Vietnamese laws and regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were healthy men and nonpregnant women, 18 to 50 years of age with body-mass index (BMI) of 18 to 27 kg/m2 (table S2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This was a randomized, double-blind, placebo-controlled study (figure 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial staffs responsible for the vaccine preparation and administration, and participants were unaware of vaccine assignment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size of phase 1 was not based on formal statistical power calculation but on the range of 30 – 150 recommended in Article 10 of Appendix 10/2020/TT-BYT by Vietnam Ministry of Health.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immune response analysis: The geometric anti-S IgG antibody and neutralizing ability of SARS-CoV-2 antibody in the sera at the screening stage is considered as baseline values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of these phase 1 and 2 trials are limited ethnic diversity (almost exclusively Vietnamese Kinh people), short follow-up duration, healthy participants only and the lack of convalescent serum data. Without comparison of vaccine responses to convalescent sera from covid-19 patients, it is difficult to compare and contrast the immunogenicity of different vaccines and hence the projected efficacy. This shortcoming will be addressed in phase 3 trial. In conclusion, Nanocovax is highly safe and immunogenic. Dose strength of 25 mcg is selected for phase 3 to evaluate the vaccine efficacy.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04683484</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Clinical Trial to Assess the Safety and Immunogenicity of …</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261007: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patients who were RT-PCR positive for Covid-19 were recruited using a block randomization parallel group protocol [22] for the efficacy and safety of indomethacin after obtaining the Ethics Committee clearance and consent from the patients.<br>Consent: Patients who were RT-PCR positive for Covid-19 were recruited using a block randomization parallel group protocol [22] for the efficacy and safety of indomethacin after obtaining the Ethics Committee clearance and consent from the patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients who were RT-PCR positive for Covid-19 were recruited using a block randomization parallel group protocol [22] for the efficacy and safety of indomethacin after obtaining the Ethics Committee clearance and consent from the patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260992: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A representative of the institution provided consent electronically.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomisation: Schools were randomly assigned 1:1 to either a policy of offering contacts daily testing over 7 days to allow continued school attendance (intervention arm) or to follow usual policy of isolation of contacts for 10 days (control arm).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">During the trial, the trial management team were blinded to the combined data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Based on these assumptions we estimated that 58 participating schools in each arm provides 80% power (two-sided alpha=0.05) to detect a difference in attendance between the study arms.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 PCR was performed using the Thermo Fisher TaqPath COVID-19 kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher TaqPath</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Additionally, at some stages, schools paused the intervention either because of capacity limitation or because public health officials were concerned about the spread of the Delta lineage or rising transmission in the community. No local public health teams reported concern that transmission was observed to increase because of this study. Previous estimates for the performance of antigen LFDs compared to PCR testing have varied markedly.[6, 22] Here we estimate the overall sensitivity of school-based LFD testing in largely asymptomatic individuals as 53%, which falls within the range of previously reported rates. It is worth noting the findings on transmission in this study are in the context of this level of performance. Specificity was 99.93%. As LFD performance varies by viral load[23] this overall performance is subject to change as the population viral load distribution changes. Consistent with previous reports[6] we find that higher viral loads, i.e. lower PCR cycle threshold values, are associated with increased sensitivity, and therefore LFDs are more likely to detect those who are most infectious.[16] The study has several limitations. Schools and colleges, despite provision of dedicated resources, were not always able to participate due to competing pressures, and it is also likely as a result that data capture was imperfect, e.g. it is possible that not all PCR-positive cases were reported to schools, and not all contacts may have been documented for all index case...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN18100261</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260909: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the ethics committee of the University of Occupational and Environmental Health, Japan.<br>Consent: Informed consent was obtained via a form on the survey website.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stata Statistical Software version 16 (StataCorp LLC, TX, USA) was used for all analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations in this study. First, it was not knonw the reasons accounting for sickness presenteeism. Many possible explanations may explain why workers experience sickness presenteeism, including financial hardship preventing medical visits, unstable employment, or unavailability of sick leave entitlement. Second, we did not investigate the types of illnesses and health problems experienced by people with sickness presenteeism. Third, we did not determined the chronological relationship between sickness presenteeism and socioeconomic status and lifestyle. In this study, we found that around 19% of Japanese workers experienced sickness presenteeism during the period of rapidly spreading COVID-19 infection. Those who were socioeconomically disadvantaged, in poor health, or with unfavorable lifestyle habits were more likely to report sickness presenteeism. Accordingly, the issue of sickness presenteeism has been highlighted by COVID-19. The increase in sickness presenteeism may not only worsen the health status of individuals, but also have long-term effects on society, such as reduced productivity and increased social security burden due to employment instability. These findings indicate the need for efforts to decrease sickness presenteeism in workers who need to recuperate at home.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260280: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: In some more recent surveys (i.e. Massachusetts, NY-Central/Upstate and the second Washington survey) and in Michigan respondents answered questions about food security in the past 30 days, which is validated through the USDA module.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NFACT study sites distributed the NFACT surveys (in whole or part) online pursuing one of three sampling strategies: 1) Convenience sampling in partnership with community organizations, stakeholders, social media, and/or news media, which are not representative of a state population (ten sites); 2) Quota sampling using survey panels administered by Qualtrics (Provo, UT), a survey research company, in which the quotas aimed to achieve state representation on some characteristics (e.g. race, ethnicity, income) (eight sites); or 3) Quota or convenience sampling in which certain high-risk populations (e.g. low-income, BIPOC, or Supplemental Nutrition Assistance Program (SNAP) participants) were targeted (six sites).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nutrition Assistance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: In presenting our results, we recognize two key limitations. First, research that requires participants to report eating or food-related behaviors is challenged by both recall and social desirability bias (45). Retrospectively asking participants about food insecurity has been shown to lead to overestimation of pre-COVID prevalence of food insecurity (34), suggesting our study may contain similar overestimations. However, we try to address this potential limitation by reporting percent change between pre and during COVID-19 food security, in addition to absolute prevalence of food insecurity, though if the overall pre-pandemic levels of food insecurity are lower, our absolute food insecurity prevalence is likely underestimated. While there has been some skepticism about the high prevalence of food insecurity reported since the COVID-19 pandemic began, our results confirm this high prevalence while providing a more robust measure to benchmark changes. Second, surveys across all research sites included in this study were administered online, limiting respondents to those with computer skills and internet access. This potentially introduced a barrier for some (though not all) elderly or low-income potential respondents (46, 47), as well as those living in rural areas without reliable internet (48). Our study employed a number of methods to overcome this challenge across different sampling strategies. These strategies included partnering with non-profit and community...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261094: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: E-questionnaire was completed through an online survey module using validated RedCap software (Research Electronic Data Capture) tool16. 330 out of 715 participants who originally enrolled into the Covid-19 add-on study (46%) completed e-questionnaire prior to and during all of the three Covid-19 waves.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">E-questionnaire was completed through an online survey module using validated RedCap software (Research Electronic Data Capture) tool16. 330 out of 715 participants who originally enrolled into the Covid-19 add-on study (46%) completed e-questionnaire prior to and during all of the three Covid-19 waves.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RedCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and visualization were performed in the R (v.4.1.0) environment with rstatix, sjmisc, ggplot2, and pheatmap packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260740: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approval was obtained to take deferred consent from patients (or next of kin/nominated consultee) to retain blood samples, including serum and RNA specimens, as well as clinical data (Research Ethics Committee [REC] references 14/SC/0008 and 19/SC/0116).<br>IRB: Ethical approval was obtained to take deferred consent from patients (or next of kin/nominated consultee) to retain blood samples, including serum and RNA specimens, as well as clinical data (Research Ethics Committee [REC] references 14/SC/0008 and 19/SC/0116).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To facilitate multi-omic comparison, serum samples from BioAID patients were prioritised if whole blood RNA-Sequencing had already been undertaken as part of an earlier study, where samples had been selected from the BioAID database using a random number generator.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">N=24 samples in each of two comparator groups were required to achieve a power of >90% to identify an AUC of at least 0.8, at a significance level of 0.01.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To facilitate multi-omic comparison, serum samples from BioAID patients were prioritised if whole blood RNA-Sequencing had already been undertaken as part of an earlier study, where samples had been selected from the BioAID database using a random number generator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioAID</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">13 Sera from additional BioAID patients were selected randomly from within individual infection groups using a random number generator in Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw data were converted to the mzML open-source format and signals below an absolute intensity threshold of 100 counts were removed using the MSConvert tool in ProteoWizard 17 before data extraction using XCMS,18 outputting a matrix of measurements (peak integrals) organised row-wise into samples and column-wise into LC-MS “features”, each of which is described by its mass:charge (m/z) value and chromatographic retention time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteoWizard</div><div>suggested: (ProteoWizard, RRID:SCR_012056)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study should be viewed in the context of its limitations. Firstly, in order to ensure diagnostic certainty, we only included the extremes of bacterial infection in the form of bacteraemia. Secondly, our cohort did not include fungal and protozoan infections. Thirdly, we only performed internal cross-validation, which will need further confirmation in an external cohort. We plan to address these limitations in future work to assess the performance of ddhC in new patient cohorts, including fungal and non-bacteraemic bacterial infections, as well as other infections seen outside of the UK. Fourthly, our cohort represents patients unwell enough to seek hospital attention – further work will be required to assess the role of ddhC in less unwell patients presenting to primary care and determine whether it is detectable in minimally invasive samples such as urine or saliva. In conclusion, using high-fidelity metabolic profiling of serum from patients attending hospital, we found that the antiviral molecule ddhC is present in human serum during viral infection and represents an accurate biomarker for a wide range of viral infections, including COVID-19. If shown to perform consistently in further validation work, this biomarker will have a crucial role in the diagnostic repertoire for infectious diseases.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261020: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">To increase statistical power, analysis is therefore reported on the full study sample (n=2,027), adjusting for survey round.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: Our study is the first in Wales to examine the challenges faced by people asked to self-isolate. It included responses from a representative sample of contacts of COVID-19 identified through the national TTP database, ensuring that all those in the study had been confirmed and informed to self-isolate. This enabled sampling to ensure that contacts in our study were representative of all contacts successfully reached by TTP in each of the periods of interest for the two survey rounds. However, this also presents the key limitation of the study, as it includes only those who have been successfully reached by a contact tracer and informed to self-isolate. It is likely that those who are not successfully reached may perceive additional challenges to self-isolation that are not be captured in our findings.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260991: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The institutional review committee of Cox’s Bazar Medical College and Hospital checked the design and approved the study.<br>Consent: The participants’ implied consent to participate in the study was based on their verbal acceptance of the survey and their responses to the interviewers’ queries.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Before importing to the Statistical Package for Social Sciences (SPSS) software (version 20.0), all data were entered on a master Microsoft Excel spread sheet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453488: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were transferred to a Hybond ECL membrane (Amersham biosciences) using a semi-dry transfer system (Biorad) and probed with primary antibodies: 1:1000 rabbit anti-ACE2 (Abcam, Ab108209) or 1:10000 mouse anti-tubulin (Sigma, T5168) and secondary antibodies: anti-mouse IgG IRdye 800CW (LI-COR Biosciences) or anti-rabbit IgG IRdye 800CW (LI-COR Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were blocked with 5% FCS in PBS (blocking buffer) for 30 min, and incubated with sheep anti-SARS-CoV-2 nucleocapsid antibody (1:10000) (86) in blocking buffer for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid antibody (1:10000) (86</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Codon-optimised SARS-CoV-1, MERS-CoV, HCoV-229E and HCoV-NL63 Spike genes were synthesised in pcDNA3.1 from GeneArt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and U87MG cells stably expressing ACE2 were generated by transduction with pMIGR1-blast-ACE2 vector and maintained with 10 μg/ml blasticidin selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>U87MG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 and U87MG-ACE2 cells stably expressing NCOA7 or E2crimson were generated by transduction with RRL.sin.cPPT.SFFV/IRES-puro.WPRE-containing vectors expressing NCOA7 or E2crimson and maintained with 2 μg/ml puromycin and 10 μg/ml balsticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U87MG-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2-NCOA7/E2crimson cells stably expressing TMPRSS2 were generated by transduction with RRL.sin.cPPT.SFFV/TMPRSS2(variant1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2-NCOA7/E2crimson</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CRISPR–Cas9-mediated gene disruption, A549-ACE2 cells stably expressing Cas9 were first generated by transduction with the LentiCas9-Blast vector followed by blasticidin selection at 10 μg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped lentiviral vector production and infection: Pseudotyped lentiviral vectors were produced in a 10-cm dish seeded the day before with HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The infectious virus titre was determined by plaque assay in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: NCOA7 variant 6 (NM_001199622.1) (encoding isoform 4 NP_001186551.1) or E2crimson cDNAs were inserted into pRRL.sin.cPPT.SFFV/IRES-puro.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRL.sin.cPPT.SFFV/IRES-puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Codon-optimised SARS-CoV-2 Spike in pcDNA3.1 and ACE2 expression constructs were kindly provided by Dr Nigel Temperton (82).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 cDNA was inserted into pMIGR1-blast using Notl and Xhol to create</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMIGR1-blast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RNA guides were cloned into LentiGuide-Neo vector as described (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LentiGuide-Neo</div><div>suggested: RRID:Addgene_139449)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and U87MG cells stably expressing ACE2 were generated by transduction with pMIGR1-blast-ACE2 vector and maintained with 10 μg/ml blasticidin selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMIGR1-blast-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Spike P.1, B.1.1.1.7, B1.351 were synthesised in pcDNA3.1 from GENEWIZ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed with Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453524: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was reviewed and approved by the CDC’s National Center for Emerging and Zoonotic Infectious Diseases Institutional Review Board and was conducted consistent with applicable federal law and CDC policy under 45 C.F.R. part 46, 21 C.F.R. part 56; 42 U.S.C. §241(d); 5 U.S.C. §552a; 44 U.S.C. §3501 et seq.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There were several limitations in this analysis. First, it is unknown how many dogs enter the United States each year – by land, air, or sea. CDC maintains records of the number of dogs denied entry, their characteristics, and the reason for denial, but the total number of dog importations is unknown. QARS is a passive surveillance system and the number of dogs captured in QARS may not be representative of the true number of dogs entering the United States with falsified, inaccurate, or incomplete rabies vaccination records. Second, the COVID-19 pandemic may have impacted the number and frequency of dog importations in unique ways. As such, the importation data from 2020 may not be representative of dog importation patterns over time. Importation attempts, especially for dogs under four months of age, may be reduced in the future as the demand for new pets decreases and domestic pets become more readily available for adoption or purchase; however, falsified RVCs was a noticeable problem in 2019 prior to the COVID-19 pandemic and the data from 2019 and 2020 could indicate an emerging issue with dog importations. Airline carrier compliance may also improve once more people begin to fly again. The pandemic has had devastating consequences on the airline industry [23], and it is possible some airline carriers sought to offset losses by transporting more animals. Ultimately, measures to stop the transportation of animals that do not meet US entry requirements should be enforced by...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453545: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260813: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All these studies had been approved by the relevant institutional review boards and participants had provided informed consents.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As a genetic epidemiological method, MR study could overcome the limitations of traditional observational studies. In this MR study, we used genetic variants related to HMGCR expression or HMGCR-mediated LDL cholesterol as instruments to proxy the exposure of statins. Both analyses found a suggestive evidence that statins could reduce the risk of COVID-19 hospitalization, rather than COVID-19 susceptibility and very severe outcome. Although strong evidence is lacking, these results provided a causal evidence supporting the finding from the largest cohort study (2), which calls for additional observational studies in different populations, mechanistic studies, and randomized controlled studies to examine its potential effect against COVID-19. Besides, although no association was found between NPC1L1 expression in adipose subcutaneous and COVID-19 outcomes, there was a strong evidence of the association between NPC1L1-mediated LDL cholesterol and COVID-19 susceptibility. The effect of NPC1L1 inhibitor on COVID-19 susceptibility may be worth further studies as well. Study strengths: The main strength of our study is the use of genetic instruments to proxy drug exposure, which could minimize confounding bias and avoid reverse causation. Besides, we used two different kinds of genetic instruments to proxy the studied drug, which contributes to validate the effect estimates from each other. And a number of sensitivity analyses have been performed to test the efficacy of genetic ins...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260952: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: The main limitation of this study is the fact that it is applied only to the sequencing data from a single region, England. This is justified by the fact that sequencing dataset associated to England on the GISAID open-source genome repository is by far the largest compared to other countries/regions. Thus, it is the only dataset that allows for reliable classification of the variants. To validate the results, we have also analysed the data for Wales and Scotland, as presented in the supplementary material. We chose the other two nations of the Great Britain island because they have a very similar epidemiological history compared to England, thus we would expect the same results. As such, by comparing the results we would test the reliability of the ML procedure alone. In fact, the results for Wales and Scotland, while less significant with respect to statistics, show the same patterns we obtained for England.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260755: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by the Ethics Committee of the Capital Region of Denmark and institutionally at each trial site.<br>Consent: Consent procedure: We obtained informed consent from the patients or their legal surrogates according to national regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We excluded patients who used systemic corticosteroids for other indications than COVID-19 in doses higher than 6 mg dexamethasone equivalents or had used systemic corticosteroids for COVID-19 for 5 days or more, those with invasive fungal infection or active tuberculosis, those with known hypersensitivity to dexamethasone and those who were pregnant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial design and oversight: The COVID STEROID 2 trial was an investigator-initiated, international, parallel-grouped, stratified, blinded randomized clinical trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial design and oversight: The COVID STEROID 2 trial was an investigator-initiated, international, parallel-grouped, stratified, blinded randomized clinical trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">14 Statistical analysis: We estimated that 1000 patients were required for the trial to have 85% power to show a relative reduction of 15% in 28-day mortality combined with a 10% reduction in time on life support at a 2-sided alpha-level of 5%, assuming that 30% would die and 10% still be on life support at day 28 in the control group.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: We had limited power to detect differences in some of the outcomes and in the subgroup analyses. Some baseline variables may have differed between the groups, e.g. diabetes, but a pre-defined secondary analysis adjusting for diabetes and other important risk factors supported the primary result. As expected, the distribution of the primary outcome data was not normal, but it was unexpected that day 28 would have 41.4% of the counts. To mitigate this, we used a newly developed statistical test that accounts for excess zeroes and post hoc used bootstrapping to challenge the results further.18 The sample size estimation for the primary outcome was based on expected relative differences in 28-day mortality and time on life support of 15% and 10%, respectively, that may be considered large. Changes in the treatment of COVID-19 during trial (e.g. increased use of IL-6-RAs) may have influenced the results.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04509973</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Higher vs. Lower Doses of Dexamethasone for COVID-19 and Sev…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260913: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260391: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This study will be conducted both online and in person for biospecimen collection.<br>IRB: The study protocol has been reviewed and approved by the Institutional Review Board at the Yale School of Medicine. Study Population: The study inclusion and exclusion criteria are listed in Table 1.<br>Consent: Minors (ages 12-17) are eligible for the study, but will require a parent or guardian to also consent to the study and be present for all study visits.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study participants will include people aged 12 and over who either have been diagnosed with COVID-19, hospitalized due to COVID-19, or who have tested positive for SARS-CoV-2 more than 2 months prior to joining the study (PCR, antigen, or a positive T-test or antibody test at any point), and who have proof of the diagnosis, hospitalization, or positive test; who intend to receive the vaccine for SARS-CoV-2, but who have not yet received any doses of the vaccine; and who self-report that they have persistent moderate-to-severe symptoms or disability (by answering “yes” to the question: In your opinion, do you have symptoms more than 2 months after your initial COVID-19 infection (Long COVID) that interfere with your quality of life or with your ability to do your normal activities?).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID-19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participant Surveys: The study will include 4 surveys to describe participants’ experience with PASC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data for this study will be collected, recorded, and stored using REDCap, a secure web application designed to support data capture for research studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It includes features for HIPAA compliance including real-time data entry validation (e.g. for data types and range checks), a full audit trail, user-based privileges, de-identified data export mechanism to statistical packages (SPSS, SAS, Stata and R), and integration with the institutional Active Directory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04895189</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Yale COVID-19 Recovery Study</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260959: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from each subject and protocols were approved by Institutional Review Boards of Sayan People’s Hospital.<br>IRB: Written informed consent was obtained from each subject and protocols were approved by Institutional Review Boards of Sayan People’s Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plasma proteomics: Ten of the fifty subjects were randomly selected for plasma proteomic analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were coated with either SARS-CoV-2 recombinant antigens or mouse anti-human IgM monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To remove highly abundant interfering proteins in human plasma, a multiple-affinity removal system liquid chromatography (LC) column (High Select™ Top14 Abundant Protein Depletion Mini Spin Columns; Thermo Fisher Technologies, Santa Clara, CA, USA) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Technologies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant mass spectrometry data were analyzed using Maxquant (Version 1.6.17) and the protein search database used was the Homo sapiens FASTA database downloaded from UniprotKB (UP000005640.fasta).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTA</div><div>suggested: (FASTA, RRID:SCR_011819)</div></div><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All UPLC-MS/MS methods used the ACQUITY 2D UPLC system (Waters, Milford, MA, USA) and Q-Exactive Quadrupole-Orbitrap (Thermo Fisher Scientific™, San Jose, USA) and TripleTOF 5600+ (AB SCIEX, MA, USA) with ESI source and mass analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific™</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Open database sources including KEGG and MetaboAnalyst, Human Metabolome Database, were used to identify metabolic pathways.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Orthogonal partial least squares discrimination analysis (OPLS-DA) and partial least squares-discriminate analysis (PLS-DA) was conducted using MetaboAnalyst 5.0 (http://www.metaboanalyst.ca/MetaboAnalyst/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaboAnalyst</div><div>suggested: (MetaboAnalyst, RRID:SCR_015539)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Metscape was used to build the network of metabolites, analyze the correlation of these different metabolites and visualize the networks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metscape</div><div>suggested: ( Metscape , RRID:SCR_014687)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260810: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: RSV subtyping and whole genome sequencing: Samples were sequenced from cases collected for routine diagnostic purposes as part of public health responses, and from on-going research studies approved by the local Human Research Ethics Committees of the Royal Children’s Hospital and Western Sydney Local Health District with approval numbers 37185 and LNR/17/WMEAD/128,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RSV whole genome sequencing (WGS) was conducted using established protocols24 for a subset of samples selected to provide temporal and geographical representation of i) the pre-COVID-19 period, inclusive of July 2017 to March 2020, and ii) the post-COVID-19 period, inclusive of April 2020 to March 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiplexed libraries were then sequenced either on an Illumina iSeq 100 or MiSeq producing at least 200,000 paired end reads (2×150nt) per library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For genome assembly, the sequence reads were QC trimmed using BBDuk v37.9831 before de novo assembly with MEGAHIT v1.1.332 or reference based assembly with IRMA33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBDuk</div><div>suggested: (Bestus Bioinformaticus Duk, RRID:SCR_016969)</div></div><div style="margin-bottom:8px"><div>MEGAHIT</div><div>suggested: (MEGAHIT, RRID:SCR_018551)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To confirm assembly, the trimmed sequence reads were re-mapped onto the draft genome with BBMap v37.98 and visually assessed using the Geneious Prime v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple sequence alignments were performed independently with MAFFT v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">735 and examined using TempEst v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.536 to identify and exclude excessively divergent sequences in a preliminary maximum likelihood (ML) tree generated in FastTree v.2.137.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastTree</div><div>suggested: (FastTree, RRID:SCR_015501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic relationships of the full-length alignments were inferred using the ML method in IQ-TREE v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G gene phylogenies were estimated using RAxML v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260944: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260878: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All procedures were approved by the Institutional Review Board at Delaware State University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Specifically, demographic characteristics included age as a continuous variable, sex (female = 1, male =0), race and ethnicity (i.e.,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using STATA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.30.454511: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.31.21261326: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent to take part in this study.<br>IRB: This study has Research Ethics Committee approval (REC 19/WA/0058 (Wales REC 3 – covering samples processed in Cardiff), 05/WSE03/111 (South East Wales REC – covering samples processed in Cardiff) and 20/NE/0176 (Newcastle North Tyneside REC – covering QMUL samples)).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a series of paired plasma and dried blood spots (n=22 antibody negative and n=25 antibody positive samples) we observed good agreement between paired specimens (r=0.994) and the gradient of the slope was 1.241x.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>n=22</div><div>suggested: (Advanced Targeting Systems Cat# AB-N22, RRID:AB_458735)</div></div><div style="margin-bottom:8px"><div>n=25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The impact of time between last dose of anti-CD20 monoclonal antibody (ocrelizumab and rituximab, excluding ofatumamab given different administration schedule) and first vaccine dose, and odds of seroconversion, was established using univariate logistic regression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This is deserving of further study given potential limitations of power to address this question. Current evidence suggests that heterologous vaccine regimens may elicit stronger antibody and T-cell responses [18,19]. The effect of age on vaccine response in this cohort is in line with data from the general population [15], and may be entirely due to age-related immunosenescence [17], or there may be an additional impact from collider bias related to age, disability progression and DMT choice. This study made use of dried blood spot sampling, reducing the need for potentially vulnerable people to attend healthcare facilities during the pandemic as well as reduced costs for phlebotomist time and equipment. Dried blood spot sampling has been used since the 1960s for neonatal screening for inborn errors of metabolism [20], and has demonstrated utility across a number of medical uses [21]. Their use as a tool for serological screening of IgG levels is particularly well established [22], and the utility has been highlighted during the COVID-19 pandemic [23]. Whilst extensive work was undertaken to develop and validate the assays used in this study, the lack of gold standard for RBD assay development was a potential limitation; since a true negative result was defined based on historical samples. In order to increase the power for this study, samples were analysed in two laboratories and data pooled. The assay used in the UHW laboratory was subject to significant ceiling effects, w...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.31.21261428: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory tests: During the four surveys, we assessed anti-SARS-CoV-2 antibodies using three different assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, to report seroprevalence, we selected enzyme-linked immunosorbent assay (ELISA Coronapass) CoronaPass total antibodies test (Genetico, Moscow, Russia) that detects total antibodies (the cutoff for positivity 1.0) and is based on the recombinant SARS-CoV-2 spike protein receptor binding domain (Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein receptor binding domain</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Another critical limitation of the Internet search term trends lies in the spectrum of symptoms related to the disease of interest. For example, loss of smell is quite a distinct feature of SARS-CoV-2 infection. If the clinical manifestation of the infection caused by the new strains differ, surveillance strategies using search term trends should also change. More than 20,000 excess deaths have already been reported in St. Petersburg during the pandemic year [11]. The results of our seroprevalence study combined with the data on excess mortality give the IFR equal to 0.86% for the entire population, which is in line with other estimates across Europe [7, 24]. The IFR based on serological study results and excess mortality was stable for all four surveys. However, the official COVID-19 death count provided lower IFRs, which were not stable and was even lower during the pandemic waves. Thus, it seems that the number of deaths during the both waves was unprecedented for St. Petersburg to timely provide official data collection and cause of death specifications in mortality records. We continue to monitor the pandemic in St. Petersburg using all available sources and plan to run the following survey to estimate the number of individuals with antibodies to SARS-CoV-2 after the summer wave. In addition, we aim to detect the herd immunity threshold in St. Petersburg if any exists given the Delta VOC basic reproductive number and diminished vaccine effectiveness [12]. Several possibl...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04406038</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Spread of COVID-19 in Saint Petersburg, Russia</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN11060415</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261150: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome sequencing: Sequencing libraries were prepared according to the classic ARTIC protocol described by Quick J. [10,11] or the SARS-CoV2 genome sequencing protocol (1200bp amplicon “midnight” primer set, using Nanopore Rapid kit) described by Freed N. and Silander O. [12,13] with minor modifications (Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quick J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consensus genomes were generated using the poreCov pipeline [15–24] and Nanopolish was used for consensus generation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed with MAFFT v7.471 [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum likelihood (ML) phylogenetic analysis of the 1,796 B.1.1.28 sequences was performed with IQ-TREE version 1.6.12 under the model GTR+F+R3 of nucleotide substitution selected by the built-in ModelFinder option [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were estimated in BEAST v1.10 [35] using the GTR+F+I nucleotide substitution model, the non-parametric Bayesian skyline model as the coalescent tree prior [36], a strict molecular clock model with a uniform substitution rate prior (8-10 ×10−4 substitutions/site/year) and a reversible discrete phylogeographic model (using Uruguayan departments as epidemic locations) [37] with a continuous-time Markov chain (CTMC) rate reference prior [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MCMC chains were run for 100 million generations and convergence (Effective Sample Size > 200) in parameter estimates was assessed using Tracer v1.7 [39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum clade credibility (MCC) tree was summarized with TreeAnnotator v1.10 [40] and visualized using FigTree v1.4.4 [41].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TreeAnnotator</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional visualizations were implemented in the R environment with treeio and ggtree Bioconductor packages [42].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.29.454323: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of Universidade Federal de Ciências da Saúde de Porto Alegre (Protocol n. 3.978.647, CAAE 30714520.0.0000.5345).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic analysis: Raw fastq files were trimmed to remove adapter sequences and low-quality reads using trimmomatic [13] (Parameters: leading:3 trailing:3 slidingwindow:4:25 minlen:36 illuminaclip: TruSeq3-PE.fa:2:30:10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality of the resulting mapped BAM files was checked using Qualimap [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Qualimap</div><div>suggested: (QualiMap, RRID:SCR_001209)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The software iVar (v1.2.2) was used to trim QIASEQ SARS-CoV-2 Primer Panel sequences and along with Samtools (v1.6) mpileup function [16] to variant calling (parameters: -A -d 20000 -Q 0) and consensus sequence generation (parameters: -q 20 -t 0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were carried out using Nextstrain ncov workflow (https://github.com/) (default parameters), which includes alignment, phylogenetic reconstruction, geographic and ancestral trait reconstruction, and inference of transmission events.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/</div><div>suggested: (Laubach Lab GitHub Repository project, RRID:SCR_021464)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nextstrain uses by default the software IQ-Tree and the substitution model GTR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-Tree</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.29.454385: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The number of samples was informed by the required parametric combinations randomised by the surrogate model.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261107: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the ethics committee of the University of Occupational and Environmental Health, Japan (reference No. R2-079 and R3-006).<br>Consent: Participants provided informed consent by completing a form on the survey website.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: Release 16; StataCorp LLC, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations in this study. First, we conducted a survey of full-time workers only; we did not include part-time workers, housewives, the elderly, or people under 15 years of age. Accordingly, the results do not present a complete picture of NPI practices in the community; some reports show different rates of implementation of preventive measures in different age groups (6). Second, given the cross-sectional nature of the study, it is not possible to assign causation. In other words, it is not possible to compare rates of NPI implementation before and after the increase in COVID-19 infection rate in a given region. Therefore, we cannot conclude that the rate of implementation has increased because of the increase in infectious rate. Third, we used a simple question to measure NPI adherence; details about frequency and timing remain unknown. To prevent the spread of COVID-19, performing NPIs is essential, along with organizational efforts such as emergency declarations and lockdowns. In this study of Japanese workers, NPIs were more prevalent in regions with higher incidence rates, suggesting that implementation was affected not only by personal attributes but also by the contextual effects of local infection level. In particular, for areas where the implementation is not widespread and the level of infection is low, we propose that environmental interventions such as campaigns to promote awareness of NPIs may be beneficial.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261086: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Every real time reverse transcription-PCR (RT-qPCR) test conducted in Qatar, regardless of location (outpatient clinic, drive-thru, or hospital, etc.), is classified on the basis of symptoms and the reason for testing (clinical symptoms, contact tracing, random testing campaigns (surveys), individual requests, routine healthcare testing, pre-travel, and port of entry).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted in STATA/SE version 17.047.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/SE</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations. The number of documented mRNA-1273 breakthrough infections was small, thereby limiting the statistical precision of the comparisons involving these infections, leading to estimates with wider 95% confidence intervals, and perhaps making them more prone to bias. The study was implemented on documented infections, but other infections may have occurred and gone undocumented. It is possible that breakthrough infections in those vaccinated or who had a prior infection are less likely to be documented, perhaps because of minimal/mild or no symptoms. However, with the high rate of PCR testing in Qatar, the majority of infections are identified not because of testing symptomatic cases, but because of testing for other reasons, such as random testing campaigns, contact tracing, individual requests, routine healthcare testing, pre-travel, and at ports of entry. The results of our study were also consistent when we included only the randomly diagnosed infections. Imperfect assay sensitivity and specificity of RT-qPCR testing may have affected infection ascertainment, but RT-qPCR testing was performed using a validated commercial platform that has been used globally and has essentially 100% sensitivity and specificity26 (Methods). While it is established that SARS-CoV-2 viral load strongly correlates with culturable virus10 and infectiousness, the exact mathematical relationship linking viral load to infectiousness is not known. Therefore, we generated estima...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21260990: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all volunteers.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The vaccinee cohort (n=20) was randomly selected from a larger cohort (n=180) of vaccinated healthcare personnel of Turku University Hospital [16] approved by the Southwest Finland health district ethical permission ETMK 19/1801/2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Affinipure Goat Anti-Human IgG, IgA or IgM Fcγ Fragment Specific detection antibodies (Jackson Immuno Research) to the wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We measured IgG, IgA, IgM and total Ig antibodies against SARS-CoV-2 S1 and N proteins from sera diluted 1:300.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>total Ig antibodies against SARS-CoV-2 S1 and N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S1 (GenBank ID: MN908947.3) and N (Genbank ID: NC_045512.2) antigens were expressed and purified, and antigen-specific antibody levels were measured with a Victor Nivo device (PerkinElmer) as described previously [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison of FMIA, EIA and MNT assays: We calculated Spearman correlation coefficient (ρ) and the statistical significance of the correlation between FMIA and EIA antibody concentrations and the two laboratories’ NAb titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EIA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the MNT of laboratory #1 was performed using Vero E6 cells and true duplicates of sera diluted serially from 1:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MNT of laboratory #2 used VeroE6-TMPRSS2-H10 cells fixed with 4% formaldehyde and measured CPE after three days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2-H10</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MFI values were converted into FMIA U/ml by interpolation from the 5-PL reference curve with GraphPad Prism v9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We determined the thresholds for positivity by comparing all possible threshold combinations for the three antigens with R (version 3.6.0) and RStudio (version 1.2.1335).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of this study are related to the sample material used in the validation process of FMIA. In essence, the thresholds and DPOs described here were optimised for the detection of previous infections with mild to moderate symptoms. Despite this, the S-IgG levels correlated strongly with NAb titers. Our results also suggest that FMIA is better at recognising samples with NAbs than many commercial assays [12]. Whilst S-IgG FMIA identified all samples with NAbs, it does not necessarily measure antibodies against neutralising epitopes only, as some samples negative in MNT were considered positive for S-IgG. We conclude that FMIA is valuable in pre-screening of serum samples prior to confirmatory MNT. As the anti-SARS-CoV-2 antibody levels have been found to correlate with the disease severity [23–25], we can expect FMIA to perform well in the serological diagnostics of also previous severe infections. Importantly, while the present data show an excellent sensitivity for IgG-FMIA until 150 DPO, its performance after that remains to be investigated. Estimates of the persistence of immunity to COVID-19 appear to depend on the serological assay used [11,26]. We recently reported that six and twelve months after SARS-CoV-2 infection 98% and 97 % of the patients, respectively, still had S-IgG in FMIA [27]. Other recent studies have found that anti-spike IgG antibodies persist in 90% of individuals seven [28] and nine months [29] after a confirmed SARS-CoV-2 infection. We found ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261285: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata 16.0 (StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The main limitation of the study is the comparatively small amount of person-time participants contributed with one dose of vaccine only. This is likely the result of the short (three weeks) recommended interval between BNT162b2 mRNA vaccine doses at the time of the study. This makes the confidence intervals around the estimates of vaccine effectiveness associated with one dose of vaccine very broad. A further limitation was the lack of information available as part of the surveillance data beyond age, sex, and history of past infection of the residents. This prevented us from identifying whether some co-morbidities were associated with severe forms of disease. The study was conducted shortly after BNT162b2 mRNA COVID-19 vaccine campaigns were initiated for LTCF residents in early 2021. As vaccine-related immunity is expected to decline more quickly in the older compared to the younger population,27 these breakthrough events four to six weeks after the second dose of vaccines advocate for the administration of a third dose in the fall prior to an expected increase in SARS-CoV-2 circulation this coming winter in the northern hemisphere. Overall, our findings provide an important contribution to understanding the impact of B.1.351 lineage on the effectiveness of BNT162b2 mRNA COVID-19 vaccine in LTCFs. Vaccine effectiveness against B.1.351 was reduced, and we observed B.1.351 outbreaks with severe forms of disease among fully vaccinated individuals in two LTCFs. Our findings hi...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.30.21261383: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Respondents provided informed consent prior to data collection.<br>IRB: The research protocol was approved by the Yale University Institutional Review Board (IRB protocol number: 2000028232).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Respondents were entered into a random drawing to be one of 20 selected to receive a $500 incentive.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Stata version 16 (StataCorp, College Station, Texas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations to our study include the following. First, our sample sizes from some states (mostly in the Mountain West) were relatively low and with a sampling error of above 5%. Second, the respondents of our survey were those who, last year, had completed our previous survey, indicated a willingness to complete later surveys, and then completed a one-year follow up; therefore, it’s possible that this subsample of respondents who are reliable survey takers may differ from the population in meaningful ways that could bias generalization. The major strengths to our study include a large national sample weighted to representativeness and a strong response rate.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261241: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261221: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations. First, the results of this survey may not be generalizable to other countries, particularly those with higher COVID-19 incidence and greater restrictions on within-country movement. At the time of the survey (November 2020), fewer than 50 cases had been reported in Lao PDR, and health systems were not experiencing the same overwhelming of capacity as in many other countries [45]. Additionally, while initial control measures limited local movement, these restrictions were largely relaxed by May 2020, seven months prior to the survey, with the main intervention remaining being strict border closure. We expect, therefore, that compared to other LMICs, the effects of food security and access to health care found in this study may be smaller than would be seen in other countries. At the same time, however, the effects of the pandemic on food security and income and expenditures may be seen more strongly in Luang Prabang as compared to other provinces within Lao PDR. As the province is home to the UNESCO World Heritage City of Luang Prabang, Luang Prabang province receives a greater proportion of its income from tourism as compared to other provinces [20]. Indeed, our survey found a greater proportion of household reduced expenditures (64%) compared to another, unpublished, survey in a different rural province, where 46% of households reduced expenditures (personal communication). As mentioned, households in the study population had been receiving educat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.30.21261361: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All collected data were anonymized in standardized forms and informed consent was obtained from all individuals or patients’ next-of-kin for severe cases.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Measurements were performed in a blinded fashion in triplicates using the Triturus automated analyser (Grifols, Barcelona, Spain).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bulk/ single cell RNA-seq data analysis and mining: The available single cell RNA-seq object was mined for each one of the datasets (Table 1) using Seurat package v3 (28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">More specifically, reads where EDASeq normalized, filtered using default parameters and then PANDORA algorithm was used to combine results of DESeq (32), DESeq2 (33), limma-voom (34),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, edgeR (35) and ABSSeq (36) methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assessed with the Prism (GraphPad) software with the appropriate test according to the distribution of values and their complexity, as detailed in each figure legend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260973: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: Our study relied on an RD design, which allows for causal effect estimation in observational data under relatively weak assumptions.10 Other policies that use the same threshold may, however, bias the results.11 Sweden had no other relevant policies using a 70-year threshold during the COVID-19 pandemic. The observed discontinuities were also isolated to the expected outcome variables, suggesting causality. The validity of our estimates also depends on appropriate modeling of the age-outcome relationship. We followed the current best practice recommendations, which is to fit simple models (linear or quadratic) within a data-driven bandwidth (age window) around the threshold.21,22 In this modeling framework, the typical concern is that the conclusions may depend heavily on the selected bandwidth.10 The Supplementary material shows that the main results are robust to other reasonable bandwidth choices. A limitation is that RDD can only be used to estimate effects for persons who are exactly 70 years old. The estimates may not generalize to older parts of the targeted age group, and the calculations in Box 1 should, therefore, be interpreted with caution. A key strength of our study was the availability of detailed and complete register data for severe COVID-19 disease, which most likely limited the extent of outcome misclassification, together with repeated assessment of social distancing during the study period. However, participants in the app study...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.29.21261338: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.29.21261156: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of British Columbia Clinical Research Ethics Board provided ethical review and approval for studies from which participants’ specimens were cross-sectionally sampled and tested (H20-02184, H20-02402, H20-01421 and H20-01886).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:An important limitation of SARS-CoV-2 seroprevalence studies in populations with low vaccine coverage is the difference in antibody signals between individuals who have recovered from asymptomatic and symptomatic infection15. The distribution of serological signals between recovered asymptomatic and negative cases are more likely to overlap than when comparing negative to recovered symptomatic, nucleic acid amplification test confirmed cases. Low serological signal should not be a limitation in populations with high vaccine coverage, as SARS-CoV-2 vaccination has been experimentally found to elicit a stronger humoral immune response than natural infection16. In summary, measuring SARS-CoV-2 seropositivity at the population level presents unique challenges, which warrant investigation and consideration of alternative methodologies. We show robust diagnostic accuracy of DBS samples when tested for anti-SARS-CoV-2 IgG using an MSD assay, and model the predictive value of DBS-MSD testing in a theoretical population with fifteen, forty-five and seventy-five percent COVID-19 vaccine coverage11. DBS tests have comparable specificity and lower sensitivity to those conducted on serum, due to low analyte volume and the need for additional sample processing. The PPV of DBS-MSD testing increases in response to high seroprevalence, making it possible to accurately identify individuals who have a humoral immune response. Follow-up, reflex testing may be required to confirm true negatives. ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261228: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics Committee of Faculdade de Medicina de São José do Rio Preto Institutional Review Board (IRB) (protocol number: CAE# 31588920.0.0000.5415)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GeneFinder COVID-19 Plus RealAmp Kit (OSANG Healthcare, KOR) (the manufacturer does not provide sequences of the primers and probe) 34 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneFinder</div><div>suggested: (GENEFINDER, RRID:SCR_009190)</div></div><div style="margin-bottom:8px"><div>OSANG Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome assembling and lineage analyses: The quality of FASTQ sequencing data was checked using FastQC software v0.11.9 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc), and trimming was performed in Geneious Prime v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2021.1 (https://www.geneious.com/), using the plugin BBDuk v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.geneious.com/</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A minimum Phred score of Q30 35 and a minimal read length of 75 base pairs (bp) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phred</div><div>suggested: (Phred, RRID:SCR_001017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nucleotide sequences were aligned using MAFFT multiple sequence alignment software version 7.271 38</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Time-scale phylogenetic trees using the Maximum-likelihood (ML) method were reconstructed in IQ-TREE v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.0.3 39, using the best-fit model of nucleotide substitution, according to Bayesian Information Criterion (BIC), inferred by ModelFinder application 40 .</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelFinder</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To investigate the temporal signal from the ML tree, we regressed root-to-tip genetic distances against sample collection dates using TempEst v 1.5.1 (http://tree.bio.ed.ac.uk) 42</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An ordinary least squares fit was performed using Python 3.8 (https://www.python.org/)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>https://www.python.org/</div><div>suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.29.454333: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent before participation in the study and the study was conducted in accordance with Good Clinical Practice.<br>IRB: The study was performed in compliance with all relevant ethical regulations and the protocol (DRO-1006) for studies with human participants was approved by the Institutional Review Board of the Rockefeller University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 6 times with washing buffer and then incubated with anti-human IgG, IgM or IgA secondary antibody conjugated to horseradish peroxidase (HRP) (Jackson Immuno Research</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were incubated in FACS buffer (1× PBS, 2% FCS, 1 mM EDTA) with the following anti-human antibodies (all at 1:200 dilution): anti-CD20-PECy7 (BD Biosciences, 335793), anti-CD3-APC-eFluro 780 (Invitrogen, 47-0037-41)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (GenWay Biotech Inc. Cat# 18-202-335793-0.1 mg, RRID:AB_1981874)</div></div><div style="margin-bottom:8px"><div>anti-CD20-PECy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluro 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For plasmablast single-cell sorting, in addition to above antibodies, B cells were also stained with anti-CD19-BV605 (Biolegend, 302244), and single CD3-CD8-CD14-CD16-CD19+CD20-Ova-RBD-PE+RBD-AF647+ plasmablasts were sorted as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19-BV605</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies: anti-IgD-BV421 ( Biolegend , 348226</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27-FITC</div><div>suggested: (Millipore Cat# FCMAB191F, RRID:AB_10807274)</div></div><div style="margin-bottom:8px"><div>anti-CD71-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG-PECF594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM-AF700 ( Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec , 130-113-481)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The frequency distributions of human V genes in anti-SARS-CoV-2 antibodies from this study was compared to 131,284,220 IgH and IgL sequences generated by54 and downloaded from cAb-Rep55, a database of human shared BCR clonotypes available at https://cab-rep.c2b2.columbia.edu/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3ΔEnv-nanoluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average of its signal was used for normalization of all the other values on the same plate with Excel software before calculating the area under the curve using Prism V9.1(GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For monoclonal antibodies, the EC50 was determined using four-parameter nonlinear regression (GraphPad Prism V9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: Mammalian expression vector encoding the RBD of SARS-CoV-2 (GenBank MN985325.1; S protein residues 319-539) was previously described50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteins</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single CD3-CD8-CD14-CD16−CD20+Ova−RBD-PE+RBD-AF647+ B cells were sorted into individual wells of 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III and FACSDiva software (Becton Dickinson) for acquisition and FlowJo for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Miltenyi</div><div>suggested: (Miltenyi Biotec, RRID:SCR_008984)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis was performed using MacVector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MacVector</div><div>suggested: (MacVector, RRID:SCR_015700)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261254: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are limitations to this approach; however, our methods are designed to foster dialogue on the ideal methods for transmission and to provide a basis for a joint methods standard for assessing transmission and its reporting A better understanding of transmission dynamics is essential for pandemic planning as with influenza and other respiratory agents. For example, if a substantial proportion of transmission occurs from individuals who at the time have no symptoms, some control measures such as quarantine and contact tracing might have doubtful value, especially if the duration of infectiousness is brief, but infectivity high, a pattern that fits with the infection of the youngest groups of infected people22. The prolonged period of potential infectiousness reported by Murata et al.23 in one of the elderly asymptomatic subjects from the Diamond Princess cruise ship should also be investigated in other settings as it may explain the sudden onset of epidemic foci in nursing homes several days after admission of the last patient to the institution. Again, a single “entry” point test may not be enough. Furthermore, the potential for the elderly to present with more subtle symptoms that may go unrecognized and with a prolonged infectious period is important to understanding and containing outbreaks in care homes.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261084: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">PDSRU Quetta’s Field epidemiologist team recorded detailed epidemiological reports of 600 COVID-19 contacts from during the trace test and quarantine field activities form 1st October till 30th October 2020 in district Quetta, from this data a sample of 300 individuals was selected for this study using Simple random sampling technique.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261227: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260716: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval: The follow-up and analysis work was performed after obtaining due approval of the institution human ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The chi-square test was performed to check out possible associations between the categorical variables like association of male sex, clinical outcome with either of entities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was performed using SPSS trial version 16 for windows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.454072: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PVDF membrane was blocked with 1% (for anti-FLAG antibody) or 3% (for anti-HA antibody) non-fat milk in TBST buffer (Tris-buffered saline containing 0.05% Tween-20) overnight at 4 °C and incubated with anti-FLAG antibody (Sigma, F1804, 1:1000 dilution) or anti-HA antibody (Abcam, ab9110, 1:1000 dilution) for 2 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Abcam Cat# ab9110, RRID:AB_307019)</div></div><div style="margin-bottom:8px"><div>ab9110</div><div>suggested: (Abcam Cat# ab9110, RRID:AB_307019)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For western blot analysis, HEK 293T cells were lysed using RIPA buffer (Beyotime, P0013B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA fragment encoding the biosensor pBRET-1 was synthesized at GENEWIZ (Suzhou, China) and inserted into pcDNA3.1 vector at the site after the FLAG-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid of pBRETmut-1 was constructed by introducing the 3CLpro C145A mutation into pBRET-1 through site-directed mutagenesis using primers C145A-F and C145A-R (Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBRETmut-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBRET-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA fragment encoding the biosensor pBRET-1 was synthesized at GENEWIZ (Suzhou, China) and inserted into pcDNA3.1 vector at the site after the FLAG-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261210: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Validation shows the model underestimated disease burden within the Hispanic community. This is due in part to data limitations surrounding the migrant worker population. As a low estimate, 150,000 migrant farm workers come to North Carolina each growing season, with 94% being native Spanish speakers 47. Nationally, 53% of migrant workers are undocumented which leads to underreporting in census data47 and leads to a misrepresentation of the population within the simulation. The age bracket definitions are also a limitation within the model. For the adult population, we are not able to capture the workplace mobility or community interaction differences. This also limits the assignment of diabetes within the population. The older adult population does not have a workplace peer group, which limits our ability to capture disease spread and the racial/ethnic and comorbidity-based disparities that arise in this population. The variant is modeled by increasing the transmissibility of the disease, rather than introducing a competing strain into the population. This implementation may overestimate the impact of the variant on disease spread. Additionally, there is limited understanding of the variant’s prevalence in the population, as genomic surveillance in North Carolina is limited 48. Finally, we assume masking ends on a particular date whereas in reality, people may continue to wear masks voluntarily and through workplace or school mandates. As a result, our model may...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21261083: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">These were: age group (20 -30, 31-40, 41 – 50, and >50), sex (male or female), nationality (Kuwaiti national and non-Kuwaiti resident), staff group (Administrative or Executive; Nursing or Health-care assistant; Doctor; Specialist Staff; Estates, Porters, or Security; and Pharmacist) and occupation settings (categorized into six groups: 1) office or laboratory, 2) hospital pharmacy, 3) outpatient including radiology, day ward, general practice, or renal dialysis unit, 4) inpatient ward, theatres, emergency department, maternity unit or labor ward, or ambulance, 5) intensive care, and 6) other (e.g., plaster and observational rooms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted in STATA statistical software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has several limitations. First, the study was based on one public secondary hospital and might not be generalizable to HCWs in other public hospitals in Kuwait. However, this hospital is one of the major healthcare facilities in Kuwait and serves over a quarter of the country’s population. Second, the identification of HCWs SARS-CoV-2 PCR-confirmed infections was based on passive reporting to the hospital management due to lack of active laboratory surveillance. However, it was/is required by all HCWs to report PCR-confirmed infections to their upper management within each hospital’s department. Furthermore, underreporting PCR-confirmed infections might underestimate the ‘actual’ number of infections regardless of vaccination status; if this disproportionately impacted those who were unvaccinated compared to those who were vaccinated, this could overestimate vaccine effectiveness. Third, vaccine effectiveness estimates for partial immunity (≥ 14 days after BNT162b2 first dose through receipt of second dose) had wide confidence intervals which likely due to the low number of PCR-confirmed infections reported. In conclusion, vaccine effectiveness of both BNT162b2 and ChAdOx1 COVID-19 vaccines in HCW under ‘real-world’ conditions demonstrated that vaccine is effective in preventing most symptomatic infection across age groups, nationalities, occupation setting, and staff groups. A significant proportion (17.9%) of HCWs were unvaccinated despite the vaccine accessibili...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261133: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The study is affected by several limitations. First, the synthetic population used in the study accounts for the repartition of contacts across workplaces, schools, households, etc., informed by contact surveys. However, numbers of contacts and risk of transmission could vary greatly according to the kind of occupation. The synthetic population accounts for this variability assuming that the average number of contacts from one workplace to another is gamma distributed 12. Still, no data were available to inform the model in this respect. Second, we model vaccination uptake according to age only, when it is determined by several sociodemographic factors. Clusters of vaccine hesitant individuals may play an important role in the dynamics and facilitate the epidemic persistence in the population, as it is described for measles 53. As vaccination coverage increases, heterogeneities in attitude toward vaccination will likely have an increasing impact. Third, the baseline analysis is based on vaccine efficacy parameters for the wild type virus that is best documented. Vaccine protection may be reduced or require more time to establish with VOC infection. For example, vaccine protection was lower for the Delta variant than for the historical variant, especially in those who had received only one dose 54–56. Scenarios with slower rise of vaccine protection - parametrised from 25 - and 30% reduced efficacy against infection were tested in the sensitivity analysis. Simulation shows a m...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21261142: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Antibody Neutralization Assay: All blood collection and processing were performed under the approved protocols (MU Study of Serology for SARS-CoV-2 and MU COVID19 Vaccine study) by the Institutional Review Board of the University of Missouri.<br>IRB: Antibody Neutralization Assay: All blood collection and processing were performed under the approved protocols (MU Study of Serology for SARS-CoV-2 and MU COVID19 Vaccine study) by the Institutional Review Board of the University of Missouri.<br>Consent: Written consent was received from all human subjects prior to being enrolled in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sequences with poor mapping to sequences in the index and a random selection of sequences with good mapping were checked by Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to verify the organism match.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subjects were requested to provide a date of positive PCR test for SARS-CoV-2 and subsequently had laboratory-based serologic tests to confirm the presence of antibody against SARS-CoV-2 S1 RBD protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S1 RBD protein.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody synthesis: Transfections of 10cm dishes of 293FT cells were performed 5 mg each of heavy and light chain vectors and 40 mg polyethyleneimine (PEI)57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 cell lines were generated by transfecting 293FT cells with 500 ng HIV GagPol expression vector, 400 ng of pscALPSpuro-MmACE2 (Mouse) or pscALPSpuro-RnACE2 (Rat), and 100 ng of VSV-G expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary PCR (25 µl) was performed on RBD amplifications using 5 ul of the primary PCR as template with MiSeq nested gene specific primers containing 5’ adapter sequences (Table 1) (0.5 µM each), dNTPs (100 µM each) and Q5 DNA polymerase (New England Biolabs).□Secondary PCR amplification was performed as follows: 95°C(2:00) + [95°C(0:15) + 55°C(0:30) + 72°C(1:00)] x 20 cycles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants present at frequencies of 1% or above were called using the Annotate and Predict Find Variations/SNPs in Geneious and verified by using the V-PIPE SARS-CoV-2 application49.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For sequencing from rRNA templates, dereplicated reads were mapped with Bowtie2 and Minimap2 to a collected reference index of mitochondrial and rRNA related animal sequences from NCBI’s nucleotide and refseq databases (https://www.ncbi.nlm.nih.gov/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/</div><div>suggested: (GENSAT at NCBI - Gene Expression Nervous System Atlas, RRID:SCR_003923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences with poor mapping to sequences in the index and a random selection of sequences with good mapping were checked by Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to verify the organism match.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50 titers were calculated using nonlinear regression (Inhibitor vs normalized response—variable slope) in GraphPad Prism 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.453981: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained, and a baseline health questionnaire was also completed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro characterization of CD38+ICOS+ Cells: Quantification of CD38+ICOS+ CD4 and CD8 T cells by flow cytometry: To quantify CD38+ICOS+ CD4 and CD8 T cells, PBMCs were first resuspended with Human TruStain Fcx (Biolegend) for 10 minutes at room temperature and then stained with the following antibodies in FACS buffer (PBS+ 2% fetal bovine serum): CD8a e450 (Invitrogen 48-0086-42,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD38+ICOS+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional intracellular antibodies were: TNF-a AF488 (Biolegend 502915, 1:100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF488</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of mAb) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass cytometry datasets in this manuscript have been deposited in FlowRepository (http://flowrepository.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowRepository</div><div>suggested: (FLOWRepository, RRID:SCR_013779)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparisons of population frequencies pre- and post-vaccination as well as correlations between post-vaccine cell frequencies and IgG titers were done in GraphPad Prism version 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were analyzed on a Miltenyi MACSQuant16 Analyzer with single-stain control PBMC samples used for compensation conducted in FlowJo v10.6.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) sequencing core at an appropriate target concentration for 10X Genomics library preparation and subsequent sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genomics</div><div>suggested: (UTHSCSA Genomics Core, RRID:SCR_012239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μL of cell culture medium (DMEM supplemented with 2% FBS) was added to each well of a 96-well E-plate using a ViaFlo384 liquid handler (Integra Biosciences) to obtain background reading.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RTCA IC50 values were determined by nonlinear regression analysis using Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-Cell RNA-Seq analysis: Single-cell analysis was performed using Seurat v4.0.0 (14)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34, 35, 36 and 50. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261037: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the University of Cape Town Human Research Ethics Committee (HREC 190/2020 and 209/2020) and the University of the Witwatersrand Human Research Ethics Committee (Medical) (no M210429).<br>Consent: Written informed consent was obtained from all participants.<br>Field Sample Permit: Isolation of peripheral blood mononuclear cells (PBMC): Blood was collected in heparin tubes and processed within 3 hours of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Elecsys anti-SARS-CoV-2 Spike and the Elecys anti-SARS-CoV-2 electrochemiluminescent immunoassays were performed (Roche Diagnostics, GmbH), which enable detection of total antibodies against the SARS-CoV-2 spike (S) receptor binding domain (RBD) and nucleocapsid (N) proteins, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular cytotoxicity (ADCC) assay: The ability of plasma antibodies to cross-link FcγRIIIa (CD16) and spike expressing cells was measured as a proxy for ADCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All stimulations were performed in the presence of Brefeldin A (10 µg/mL, Sigma-Aldrich, St Louis, MO, USA) and co-stimulatory antibodies against CD28 (clone 28.2) and CD49d (clone L25) (1 µg/mL each; BD Biosciences, San Jose, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD28</div><div>suggested: (BD Biosciences Cat# 347690, RRID:AB_647457)</div></div><div style="margin-bottom:8px"><div>CD49d</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 16 hours of stimulation, cells were washed, stained with LIVE/DEAD™ Fixable VIVID Stain (Invitrogen, Carlsbad, CA, USA) and subsequently surface stained with the following antibodies: CD14 Pac Blue (TuK4, Invitrogen Thermofisher Scientific), CD19 Pac Blue (SJ25-C1, Invitrogen Thermofisher Scientific), CD4 PERCP-Cy5.5 (L200, BD Biosciences, San Jose, CA, USA), CD8 BV510 (RPA-8, Biolegend, San Diego, CA, USA), PD-1 BV711 (EH12.2H7, Biolegend, San Diego, CA, USA), CD27 PE-Cy5 (1A4, Beckman Coulter), CD45RA BV570 (HI100, Biolegend, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD19</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-A1A4EC, RRID:AB_10513741)</div></div><div style="margin-bottom:8px"><div>SJ25-C1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BioLegend Cat# 344731, RRID:AB_2564623)</div></div><div style="margin-bottom:8px"><div>PD-1 BV711</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (BioLegend Cat# 304131, RRID:AB_10897946)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antigens: For serology assays, SARS-CoV-2 original and beta variant spike proteins were expressed in Human Embryonic Kidney (HEK) 293F suspension cells by transfecting the cells with the spike plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: SARS-CoV-2 pseudotyped lentiviruses were prepared by co-transfecting the HEK 293T cell line with either the SARS-CoV-2 ancestral variant spike (D614G), the Beta spike (L18F, D80A, D215G, K417N, E484K, N501Y, D614G, A701V, 242-244 del) or the Delta spike (T19R, R158G L452R, T478K, D614G, P681R, D950N, 156-157 del) plasmids in conjunction with a firefly luciferase encoding lentivirus backbone plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat-Lucia™ NFAT-CD16 cells (Invivogen) (2×105 cells/well) were added and incubated for 24 hours at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NFAT-CD16</div><div>suggested: RRID:CVCL_A7ZT)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutations were confirmed visually with bam files using Geneious software (Biomatters Ltd, New Zealand).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR-II flow cytometer and analyzed using FlowJo (v10, FlowJo LLC, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.26.21250865: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Bayesian model was fitted in JAGS version 4.3.0 [37].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JAGS</div><div>suggested: (rjags, RRID:SCR_017573)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A potential limitation of our study – as with most vaccine uptake studies – is that we do not observe the participants’ vaccine decisions. Our outcome measure is their decision to seek out additional vaccination information. An extension of our design that linked information treatments to actual vaccination decisions would be a more powerful design. The experimental results reported in this article provide some guidance for incentive policies. First, we provide evidence that COVID-19 vaccination messaging that highlights financial incentives will likely have a bigger motivational impact on the non-vaccinated than is the case for standard COVID-19 messaging that focuses solely on the health benefits. Second, the non-vaccinated are significantly more likely to be motivated by messaging that highlights cash voucher incentives than they are by lottery incentives. In fact, lottery messaging is no more effective than standard CDC health messaging.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.28.453844: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Obtaining nasal wash/ nasal swab samples: The samples were collected under the Institutional Review Board (IRB) of the Baylor College of Medicine (BCM), Houston, Texas, USA with written informed consent.<br>Consent: Obtaining nasal wash/ nasal swab samples: The samples were collected under the Institutional Review Board (IRB) of the Baylor College of Medicine (BCM), Houston, Texas, USA with written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-RSV IgG antibody (Abcam, Catalog number: ab20745) and rabbit anti-SARS-CoV-2 S1 IgG Antibody (Sino biologicals, Catalog number: 40150R007; BEI Resources, Catalog number: NR10361, 1:2000 dilution of the antiserum).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RSV IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S1 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NR10361</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were washed three times in TBS+0.05 % Tween for 10 min each, incubated with secondary antibodies from Invitrogen, for 1hour at room temperature, washed twice with TBS-T, and stained with 4′,6-diamidino-2-phenylindole (DAPI), washed twice with PBS, and mounted in VECTASHIELD Plus Antifade mounting media (Vector Laboratories, Burlingame, CA, H-1900).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antifade mounting media</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MCP-1, MCP-3, MIG, MIP1a, MIP1b,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Max intensity projections were used for image analysis and processed using ImageJ/Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ/Fiji</div><div>suggested: (BioVoxxel Toolbox, RRID:SCR_015825)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For visualization, RSV/SARS-CoV-2 spots were enhanced by histogram stretching across treatments, post image acquisition in Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tukey’s multiple comparison tests are performed using GraphPad Prism version 7.0 Windows (Graph Pad Software, San Diego, CA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.29.454326: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All samples were shipped to the USDA National Wildlife Research Center (Fort Collins, CO USA) where they were received, logged, and placed in a −80°C ultracold freezer until testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21259040: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.28.21261159: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional Review Board or Ethics Committee approval was obtained for each site prior to enrollment of any study participant.<br>Consent: Safety analyses are presented for ≥16-year-olds without known HIV infection who provided informed consent and received ≥1 BNT162b2 or placebo dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Objectives, Participants, Oversight: This randomized, placebo-controlled, observer-blind phase 1/2/3 study assessed BNT162b2 safety, tolerability, efficacy, and immunogenicity in adolescents and adults (NCT04368728).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Safety data are presented for blinded follow-up and open-label periods.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This report has several limitations. Duration of protection and safety data that could be collected in a blinded, placebo-controlled manner were limited by the ethical and practical need to immunize eligible initial placebo recipients under EUA and according to public health authority recommendations. Data presented here do not address whether vaccination prevents asymptomatic infection, but evaluation of that question is ongoing in this study, and real-world data suggest that BNT162b2 prevents asymptomatic infection.32,33 Preliminary analyses of breakthrough cases have not yet identified a correlate of protection, as vaccine protection rates remain high. This report does not address VE and safety in pregnant women and in children younger than 12 years. Studies evaluating BNT162b2 in these populations are ongoing. The data in this report demonstrate that BNT162b2 prevents COVID-19 effectively for up to 6 months post-dose 2 across diverse populations, despite the emergence of SARS-CoV-2 variants, including the B.1.351 lineage, and the vaccine continues to show a favorable safety profile.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04368728</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Describe the Safety, Tolerability, Immunogenicity, …</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.27.453973: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with 1μg/ml CR3009 SARS-CoV-2 cross-reactive antibody (a kind gift from Dr. Laura McCoy) in permeabilisation buffer for 30 min at room temperature, washed once and incubated with secondary Alexa Fluor 488-Donkey-anti-Human IgG (Jackson Labs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>488-Donkey-anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells were trypsinised, stained with fixable Zombie UV Live/Dead dye (Biolegend) and fixed with 4% PFA before intracellular staining for nucleocapsid protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several computational approaches that have been applied to drug screening that are being applied to COVID-19, each with their own strengths and weaknesses. For example, as the structures of SARS-CoV-2 proteins have been determined, existing databases of small molecules have been leveraged to survey thousands of candidates to bind to these proteins73. Such studies helped identify 3CLpro as a common target, as well as use of drugs such as Lopinavir and Remdesivir25. Another approach is the use of protein-protein interaction networks, which are particularly suited to identifying host-directed therapies74,75. These networks can be analysed for their structure alone and can cover a broad range of potential targets. These have been used to identify, for example, the potential for cancer drug repurposing45,46. However, static-network analyses rely on the assumption that certain features of the network structure can identify the best targets, e.g., proximity to disease-associated nodes, but they cannot predict specific effects. Moreover, they rely on pre-existing network databases, or require additional curation76,77 or machine learning78 for new network types. Mathematical models such as Ordinary Differential Equations can interrogate the dynamics of the disease, but require precise data to fit model parameters, and so can only handle smaller set of variables79,80. By contrast, our approach combines scalable, executable modelling with transparent, biologically plausible ex...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.27.453843: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Next-of-kin provided informed consent for autopsy.<br>IRB: Patient and autopsy data were manually abstracted from the electronic medical record, as approved by the CUIMC Institutional Review Board (IRB-AAS9835).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, CellphoneDB identifies and compares ligand-receptor interaction pairs between cell types and compares the observed interactions to the expected interactions of a null distribution generated from randomly permuted cell labels.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopic imaging and quantitative analysis of histopathologic findings: Four micron thick sections of left and right ventricular FFPE tissue blocks per decedent were cut and labeled using an automated staining platform (Leica Bond 3, Leica Biosystems, Buffalo Grove, IL) with the following monoclonal antibodies against: C4d (Leica Biosystems</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C4d</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, BOND Ready-to-Use Primary Antibody, clone SP91) in order to detect cell damage or, in the case of cardiomyocytes, necrosis; CD61 (Cell Marque, prediluted primary antibody, clone EP65,) to identify platelet-rich microthrombi; and CD31 (Leica Biosystems</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD61</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD31</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">60 To remove homopolymers (A30, T30, G30, and C30) and the template switch oligo sequence (CCCATGTACTCTGCGTTGATACCACTGCTT and its complement AAGCAGTGGTATCAACGCAGA GTACATGGG), reads were trimmed using Cutadapt (v2.8)61 with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining samples were filtered using CellBender v2.0 62 with default settings to remove the ambient RNA byproducts of nuclear isolation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellBender</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathways were considered enriched within a cell type if identified as such by both Reactome and GSEA Msigdb (BH FDR adjusted P- value of < 0.05).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Default parameters were used for the analysis (10% threshold for cells expressing ligands and receptors, p-value = 0.05, 1000 iterations for generation of null distribution, curated interactions list compiled by CellphoneDB from UniProt, Ensembl, PDB, IMEx consortium, and IUPHAR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellphoneDB</div><div>suggested: (CellPhoneDB, RRID:SCR_017054)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using SAS (v9.4, SAS Institute) and R(v3.5.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Patients were hospitalized prior to FDA-approved therapies, and our initial local practice, as of April 15, 2020, was to reserve steroids for only the most critically-ill appearing patients. Therefore, the nearly statistically significant association of steroid use with increased odds of cardiac microthrombi may reflect some confounding by an unmeasured greater severity of illness. During the study period, testing for other respiratory viruses (i.e., influenza or adenovirus) was not routine. Reassuringly, a study of suspected acute myocarditis patients earlier in the pandemic offers evidence that viral co-infection occurs <5% of the time.54 Our observed associations between clinical variables and presence of cardiac microthrombi may be affected by unmeasured residual confounding and missingness, though we were able to adjust for several confounders via CBPS and we employed multiple imputation. The magnitude of the effect estimates may not be generalizable given our single-center study design. While affording previously unattainable resolution of cell type-specific transcription, snRNA-seq analyses have technological limitations which are discussed extensively in the results and on-line methods as they arise. Importantly, SARS-CoV-2 resides in the cytosol, which is removed during sample processing for snRNA-seq. As such, we could not and did not observe SARS-CoV-2 transcripts in our analysis and must rely upon indirect evidence of viral infection of individual cel...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.27.453834: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.27.21261116: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent.<br>IRB: The PIENTER-Corona study was approved by the medical ethical committee MED-U, Nieuwegein, the Netherlands and registered in NTR (https://www.trialregister.nl/trial/8473).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participants: This study was designed as a proof-of-concept, dose-escalation, open-label, randomized-controlled vaccine trial (IDSCOVA) conducted at the Leiden University Medical Center in collaboration with the Centre for Human Drug Research in the Netherlands.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Investigators and participants were not blinded; laboratory personnel was blinded for the study groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants were screened for SARS-CoV-2 infection by serology [SARS-CoV-2 anti-N IgG antibodies (Liaison by Diasorin, Sallugia, Italy) and SARS-CoV-2 PCR of a mid-turbinate/throat swab and excluded when positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sera were tested for the presence of specific IgG antibodies against the nucleoprotein, Spike S1 protein and the receptor binding domain (RBD), located in the S1 subunit using a bead-based multiplex immunoassay (MIA) based on Luminex technology, as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MIA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, we used MIA for detection of anti-nucleocapsid (anti-N) antibodies in parallel to assess any occurrence of SARS-CoV-2 infection following vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid ( anti-N )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using IBM SPSS Statistics for Windows, version 25.0. Armonk, New York: IBM Corp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were made by using GraphPad Prism version 9.0.1 for Windows, GraphPad software, San Diego, California.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has some limitations. Although the concentrations of anti-S1 IgG were higher at each time point, the limited sample size did not allow to demonstrate superiority of intradermal delivery over intramuscular injection. In addition, since we included healthy volunteers aged 18-30 years old, the results on safety and immunogenicity may not apply to the general population. Finally, the longevity of the immune response past day 43 was not assessed, as some participants opted for receiving the regular vaccine through the national COVID-19 vaccination program at day 57. Although the relative importance of neutralization antibodies with regard to protection from COVID-19 has not yet been fully characterized, high levels of neutralising antibodies have been shown in early preclinical Rhesus macaque studies22, in convalescent individuals23,24 and in recently reported vaccine trials.25,26 Additional measurements of neutralising antibodies and T-cell responses will be performed at a later part and will provide more information on the robustness and longevity of the immune response. In conclusion, we show that the ID administration of 10 µg and 20 µg mRNA-1273 vaccine resulted in a robust, homogeneous, immune response with an acceptable safety profile in healthy adults aged 18-30 years. These safety and immunogenicity results support advancement of the investigation of the intradermal route for administration of the fractional doses of the mRNA-1273 vaccine to later-stage clinica...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453874: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All of the simulations were carried out at atomic resolution using GROMACS 2019.4.24 Structures of the E protein pentamer and M protein dimer were obtained from the Feig laboratory’s predicted models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453805: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Public Data: Protein sequence information was downloaded from UniprotKB database [73] https://www.uniprot.org/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 332 humand-SARS-CoV-2 protein-protein interactions from Gordon et al. [5] were downloaded from Biogrid database [74] at https://thebiogrid.org/225737/publication/comparative-host-coronavirus-protein-interaction-networks-reveal-pan-viral-disease-mechanisms.html#!.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biogrid</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Information of CK2 Substrates was downloaded from PhosphoSitePlus at (https://www.phosphosite.org/) [75].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.phosphosite.org/</div><div>suggested: (PhosphoSitePlus: Protein Modification Site, RRID:SCR_001837)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Gene Set Enrichment Analysis we used GSEA version 4.1.0 for windows [79, 80].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional analysis of enriched pathways and reactions was performed using Reactome Pathway Knowledgebase [84] at: https://reactome.org/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reactome Pathway Knowledgebase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GeneCodis 4.0, at https://genecodis.genyo.es/, was used for diseases enrichment analysis [85].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneCodis</div><div>suggested: (GeneCodis, RRID:SCR_006943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BiNGO plugin [86], available from Cytoscape Application Manager, was used to determine and visualize Gene Ontology (GO) categories statistically overrepresented.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BiNGO</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional statistical analysis and graphs were generated and plotted using GraphPad Prism version 5.00 software (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04663737</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluating Safety, Pharmacokinetics and Clinical Benefit of …</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21260967: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Literature search: A literature search was conducted with PubMed, Cochrane, and Google scholars using the following keywords: “COVID-19”, “HIV,” “SARS-CoV-2”, and “AIDS” from January 2020 until August 31st, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were tabulated using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Despite the fact that this review was done following a standardized methodology, it presents with specific limitations. Cohort studies that we reviewed, such as Del Amo et al. and Meyerowitz et al. did not report an HIV viral load which makes it difficult to assess in relation to the other cohorts. Del Amo et al. also did not disclose a CD4+ count. Among the case reports, the HIV viral load and the total number of patients on IMV were not reported by Maomao et al. Lastly, Byrd et al. did not present the total number of patients admitted in the ICU and the number of patients on IMV. We did not run a study assessment because these limitations create barriers which make it hard to assess and compare the studies with one another.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.25.21260925: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: When collection of a venous samples was not possible, we collected a fingertip sample into a BD Microtainer serum microtube with clot activator (reference number: 365964).<br>IACUC: The protocol for the follow-up visits at 6 months was reviewed and approved by the HUS ethical committee and registered under the Development of seroprevalence in Finland during the new coronavirus (SARS-CoV-2) epidemic – serological population study protocol HUS/1137/2020.<br>Consent: Informed consent was obtained from all cases and contacts or their parents or legal guardian before any procedure was performed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At six months, we used BD Vacutainer 5/3.5 ml gel serum tube with clot activator (reference number: 367957) and a smaller tube 5/2 ml (reference number: 368492) for children.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Vacutainer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed statistical analysis using STATA 15.1 (StataCorp LP Lakeway, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study had two main limitations: First, this was not a randomly selected cohort of households as we recruited participants through a voluntary convenience sampling. Second, due to the lag between onset and availability of RT-PCR results, most participants were recruited retrospectively, which prevented us from conducting early household visits to estimate serial intervals for all subjects. Additionally, our estimation of the effective reproductive number was influenced by the limited size of households, with median 3 [IQR:2-4] members. However, this was in line with the demographics of Helsinki, where only 51.5% of households consisted of at least two members including 20.8% of households with 3 or more members.43 Finally, our limited sample size did not allow for comparison of secondary transmission rate depending on age-group of the primary case. Our main strengths were that, unlike most household transmission studies, we measured not only IgG Ab but also NAb to SARS-CoV-2, and that household transmission was assessed over a one month period, providing enough time for the development of antibodies, in case of secondary infection. Finally, only a few participants were lost to follow-up, as 113/129 participated to a convalescent visit at 6 months, allowing us to assess trends in IgG Ab and NAb for 111 study participants out of 129 over a long time period. When living in the same household of an RT-PCR confirmed case, the risk of transmission for other household members is ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261036: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination with VaxZevria® was temporarily halted between 16 and 22 March.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VaxZevria®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed with SAS® 9.4 (SAS Institute Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS®</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and weaknesses of this study: Our study has several strengths. First, it was population-based and all potentially vaccinated age groups were included. This allowed the analysis of rates by age groups. Second, we compared the incidence of the outcomes of interest in vaccinated people with the background incidence, and we also examined a contemporary Covid-19 cohort originated from the same population and in the same dataset. This avoids potential systematic error and confounding caused by heterogeneity between healthcare databases.20 Third, we examined the excess rates of various diagnostic definitions of usual and unusual site venous thromboembolism, with or without thrombocytopenia. This allows the analysis of the rates of specific clinical outcomes, and at the same time it gives an overview of the epidemiology of venous thromboembolism in people with Covid-19 and following vaccination. Fourth, rather than examining the risks associated to a particular vaccine, we included all Covid-19 vaccines in use in our country. The yearly incidence rates of the outcome variables in the reference population and the case-fatality rates were similar to those found in other recent studies.21-24 Our findings should however be interpreted in the context of their limitations. First, we did not review the clinical records and haematological data of patients with venous thromboembolism or thrombocytopenia, and therefore we were not able to evaluate laboratory and clinical data which c...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453840: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All hamster procedures were in accordance with AAALAC procedures and approved by the University pf Pittsburgh IACUC committee (protocol #IS00017405).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Equal numbers of male and female hamsters of 6-8 weeks of age were randomized by animal support staff and housed singly after receipt at the University of Pittsburgh.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Equal numbers of male and female hamsters of 6-8 weeks of age were randomized by animal support staff and housed singly after receipt at the University of Pittsburgh.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A solution of 0.1% immunodiffusion agarose (MP Bio) in 2X Vero E6 growth medium was then added and plaques were developed at 37°C for 72 hours followed by removal of agarose, staining of cells with crystal violet (Fisher Scientific) and counting of plaques.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were evaluated for statistical significance with GraphPad PRISM software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04518410</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ACTIV-2: A Study for Outpatients With COVID-19</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.26.453755: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocols were approved by the institutional ethical committee “Comité d’Ethique en Expérimentation Animale du Commissariat à l’Energie Atomique et aux Energies Alternatives” (CEtEA #44) under statement number A20-011.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and study design: Cynomolgus macaques were randomly assigned in two experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">10 μl of sample were loaded into the capillary and intrinsic fluorescence was measured at a ramp rate of 1°C/min with an excitation power of 30 %.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase (HRP) conjugated goat anti-monkey H+L antibody (Invitrogen #PA1-84631) was then added and incubated for 1h before excess Ab was washed out and HRP substrate added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-monkey H+L</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-84631, RRID:AB_933605)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CD3 (APC-Cy7, SP34-2, BD), CD4 (BV510, L200, BD) and CD8 (PE-Vio770, BW135/80, Miltenyi Biotec) antibodies was used as lineage markers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-Vio770, BW135/80, Miltenyi Biotec</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S RBD domain (residues 319 to 541) was expressed in EXPI293 cells by transient transfection according to the manufacturer’s protocol (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EXPI293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: For the macaques studies, SARS-CoV-2 virus (hCoV-19/France/ lDF0372/2020 strain) was isolated by the National Reference Center for Respiratory Viruses (Institut Pasteur, Paris, France) as previously described (Lescure et al., 2020) and produced by two passages on Vero E6 cells in DMEM (Dulbecco’s Modified Eagles Medium) without FBS, supplemented with 1% P/S (penicillin at 10,000 U ml−1 and streptomycin at 10,000 μg ml−1) and 1 μg ml−1 TPCK-trypsin at 37 °C in a humidified CO2 incubator and titrated on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid (Wuhan Hu-1; GenBank: MN908947.3) with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (Caniels et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T/ACE2 cells kindly provided by Dr. Paul Bieniasz (Schmidt et al., 2020) were seeded at a density of 20,000 cells/well in a 96-well plate coated with 50 μg/mL poly-L-lysine 1 day prior to the start of the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RBD expression, the following reagent was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH: Vector pCAGGS containing the SARS-Related Coronavirus 2, Wuhan-Hu-1 Spike Glycoprotein Receptor Binding Domain (RBD), NR-52309.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid (Wuhan Hu-1; GenBank: MN908947.3) with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (Caniels et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pCR3 SARS-CoV-2-SΔ19 expression plasmid contained the following mutations compared to the WT for the variants of concern: deletion (Δ) of H69, V70 and Y144, N501Y, A570D, D614G, P681H, T716I, S982A and D1118H in B.1.1.7; L18F, D80A, D215G, L242H, R246I, K417N, E484K, N501Y, D614G and A701V in B.1.351; L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y and T1027I in P.1 (Caniels et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody titers are presented as ED50 using the GraphPad Prism software version 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One million of PBMC were cultured in complete medium (RPMI1640 Glutamax+, Gibco; supplemented with 10 % FBS), supplemented with co-stimulatory antibodies (FastImmune CD28/CD49d, Becton Dickinson).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were washed, stained with a viability dye (LIVE/DEAD fixable Blue dead cell stain kit, ThermoFisher), and then fixed and permeabilized with the BD Cytofix/Cytoperm reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with the FlowJo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260567: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations and future research: There are several limitations to this study. First, we only collected two waves of data, restricting our ability to make causal claims. Although it is a cohort study, future scholars may track individuals’ mental health over more waves with shorter intervals. Second, respondents were alumni of one of the most selective consulting firms in the world. Others might thus wish to replicate our findings in different manager populations to ensure generalizability. Third, our survey was voluntary, so the response rate was limited, and it is possible that managers with severe mental illness might not have responded in the first place. The generalizability of our findings might thus be restricted. Fourth, we collected only limited data on the organizations the managers were working in. This implies that future researchers might fruitfully replicate our research while, for example, accounting explicitly for organizations’ specific responses to the pandemic including any organizational support managers might have received. Fifth, this study aims to explore epidemic statistics as predictors of mental health, and as the first study to do so with the aim of helping psychiatric screening, we did not extensively explore the possible mechanisms leading to mental health disorders. Our findings thus call for future research to examine the relationship between epidemic statistics and mental health beyond psychiatric screening purposes.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261076: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Carnegie Mellon University Institutional Review Board, under protocol STUDY2020_00000162.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Facebook uses stratified random sampling within US states to randomly select a sample of its users to see the survey invitation at the top of their News Feed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Several limitations are important to note. First, because the survey uses Facebook active users as its sampling frame and because participation in the survey is strictly voluntary, respondents may not be fully representative of the U.S. population despite incorporation of survey weights, which adjust for non-response and coverage biases based on a limited number of covariates. Comparison to the American Community Survey indicates that our sample over-represents respondents who are college-educated. Research users of the survey microdata can use additional demographic or other survey variables to construct improved post-stratification adjustments to correct this for their purposes. However, any non-response biases not accounted for by Facebook’s non-response weights would be much more difficult to correct. Additionally, many of the outcome measures related to COVID-19 are based on self-reports, which may diverge from more objective measures due to recall bias, social desirability bias, and other sources of survey bias and measurement error. On the other hand, broad comparisons of indicators such as cumulative COVID-19 diagnoses suggest that measurement of key COVID-19 outcomes are relatively robust to response biases that may be present in the sample. Ultimately, the value of such a large-scale survey is not in accuracy afforded by its sample size, since survey biases persist no matter the size of the survey; smaller surveys more carefully constructed to reduce sampling biases...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261042: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 2.1 Recruitment of Participants and Study Cohort: This study was reviewed and approved by the Ethical Review Committee of Dasman Diabetes Institute<br>Consent: Participants were then asked to visit the Dasman Diabetes Institute where they signed up the informed consent form before participating in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">People with autoimmune diseases, those taking immunosuppressants or suffering from arthritis were excluded from participating in this study as well as people with Type 1 Diabetes and pregnant women.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma samples were then aliquoted and stored at −80°C until the assays were performed. 2.3 Measurement of Plasma Levels of SARS-CoV-2-specific IgG: Plasma levels of SARS-CoV-2-specific IgG antibodies were detected using enzyme-linked immunosorbent assay (ELISA) kit (SERION ELISA agile SARS-CoV-2 IgG SERION Diagnostics, Würzburg, Germany), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data for each participant were captured using a RedCap survey that included age, gender, existing diseases (e.g. diabetes and hypertension) as well as height, weight, and history of COVID-19 infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RedCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has a number of limitations. First, the population examined were self-selected mostly by word of mouth and recruitment advertisements. It is likely that the sample is over-representing co-morbid individuals who actively sought to know the antibody protection levels they have after vaccination. Second, the regression analyses adjusted for a number of a priori confounders, however, we cannot rule out potential residual confounding by severity of illness. For example, we could not assess whether patients with severe uncontrolled diabetes or uncontrolled hypertension show lower response to vaccine-induced humoral immunity. Third, the small sample size also limited our ability to examine the effects among different subgroups. The interaction analyses were likely underpowered to detect statistically significant differences between different strata. Fourth, the data presented represent a cross-sectional analysis of the humoral response only, therefore, further studies will be required including the longitudinal analyses of both humoral and cellular responses in the BNT162b2 vaccinees since longer-time follow-ups of both arms of the adaptive immunity can provide more precise information of the putative duration of protective immunity after vaccination. Finally, the studied population in Kuwait is likely to be homogenous and therefore the readers should be cautioned when generalizing the results to other settings and populations. We aim to further perform larger-cohort, mul...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261030: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The public nature of the data and the fact that the dataset that was shared was deidentified obviated the need for informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260954: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, a multivariate receiver operating characteristic (ROC) curve was obtained by varying the confidence level of unequal class models and computing, at each step, sensitivity and specificity.26– 28 Multivariate data processing was performed by in-house Matlab routines (The MathWorks, Inc., Natick, USA, Version 2019b).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The presence of soluble isoprostanoids in both classes of patients confirms that the availability of membrane PUFAs is not a limitation for their enzymatic processing.36 Much remains to be understood regarding the pathogenetic mechanism of COVID-19, however defective innate and specific immune responses are likely to be critical features.37 Schulte-Schrepping et al.38 showed an increase in dysfunctional neutrophils and monocytes in severe COVID-19 patients that seems to be in agreement with our findings. A massive endothelial dysfunction resulting from the cytokine storm and the infiltration of SARS-CoV-2 is a further characteristic of severe COVID-19 that determines the loss of vessel barrier, the promotion of leukocyte infiltration, and the activation of platelet aggregation and coagulation.37,39 Interestingly, in ICU patients we found higher levels of TX-B2, the biological inactive catabolite of TX-A2 (a potent activator of platelet aggregation and thus of coagulation). This is in line with the diffused microthrombosis observed in COVID-19,37,40 and with the lower levels of EETs, which are mainly produced by endothelial epoxygenase and are important mediators of all pro-resolving mechanisms,41 including the lipid mediator class switching.42,43 In conclusion, this study suggests that the more severe disease in ICU patients is accompanied by an inefficient enzymatic synthesis of the anti-inflammatory oxylipins resulting in an ineffective resolution mechanism of inflammation,...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260676: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Providence Veterans Administration Medical Center’s Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Study limitations; our scenario is a hypothetical model, we only have point estimates for the temperatures, ideally we’d have continuous temperature monitoring to better understand the effect of SARS-CoV-2 on temperature over time. Our cohort is also older and mainly male and white (see table 1), we know these demographic variations can affect temperature. Our creation of a hypothetical model prevents us from performing more traditional statistical tests on our results, we created the measures discussed as our best substitute for more traditional sensitivity and specificity analysis. Some of these limitations could be overcome by using continuous temperature monitoring devices. Also, NHs typically do not have a documented baseline temperature defined for their residents. To do so, the EMR will need to be programmed to use existing temperature data that establish and track person-level baseline temperatures; then, it can also be set to alert the clinician to relevant changes from baseline. Resident records did not distinguish whether clinical symptoms triggered the SARS-CoV-2 test. We therefore relied on a conservative definition for “trigger test” that limited our sample size by more than half. Had this information been available, we likely would have had a much larger portion of our sample available for the analysis. A prospective study to test the prediction of the model is needed.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260223: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261065: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethical Committees of the Academic Hospital of Treviso (Italy) and the Hospital of Belluno (Italy), and it was conducted in accordance with the principles of the Helsinki Declaration.<br>Consent: All participants gave their consent to be enrolled in this investigation and to the treatment of their personal data for scientific purposes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Another limitation of the present study is the number of patients. Even if it’s statistically significant, a wider application of the COVID-Q to a larger number of patients may allow to obtain even more precise results and, possibly, to adjust the model we suggested with the present study. It must be observed, also, that being SARS-CoV-2 an RNA virus, it can mutate into diverse variants which may give diverse presentations of COVID-19. Therefore, possible score differences may be encountered by using the questionnaire. At last, the present study has been conducted in a single geographical area, so its application in different areas of other Countries may be useful in order to observe any possible score differences. In conclusion, in this study we developed and proposed a novel questionnaire to assess and scale the COVID-19-associated symptoms. Its application to COVID-19 patients could improve the reliability in collecting clinical data and assessing the severity of symptoms, while its extension to subjects who have not received a COVID-19 diagnosis yet might help to identify those at higher risk of being affected and, therefore, needing a microbiological test.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261041: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260956: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for the HELIUS study was obtained from the Academic Medical Center Ethical Review Board.<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A random sample of persons, stratified by ethnic origin, was taken from the municipality register of Amsterdam and subjects were invited to participate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata 15·1 (StataCorp, College Station, TX, USA) and the msm package17 in R version 3·5·2 (Vienna, Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Nevertheless, there are several limitations. First, our study might be subject to selection bias. Participants in our substudy might have been more concerned about their health compared to non-participants. Second, LTFU differed between ethnic groups, and was higher in participants with lower socio-economic status. We were unable to directly control for differential LTFU, but our sensitivity analysis suggests the impact of LTFU on our results was limited. Third, exposure variables were collected after infection and may have been different at the time of infection, depending on restrictions in place. Fourth, while we included many potential exposures and correlates of infection in our analysis, some might have been missed, such as preventive behaviours (e.g. wearing masks, keeping distance) during activities. In conclusion, ethnic differences in SARS-CoV-2 infection became apparent during the second wave of infection in the Netherlands and incidence was higher in ethnic minority groups compared to those of Dutch origin. Targeted prevention efforts following the first wave might not have been sufficient to prevent these disparities. Focus should be placed on reaching high vaccine coverage in all ethnic groups, alongside improvement of other targeted prevention strategies addressing the needs of individuals within these groups.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260793: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R package nlme, sp, ggplot2, and lattice were used to the trends structure by state analysis. 2.2.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21258785: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Veterans Affairs (VA) Tennessee Valley Healthcare system institutional review board and Research and Development Committees with a waiver of informed consent.<br>Consent: This study was approved by the Veterans Affairs (VA) Tennessee Valley Healthcare system institutional review board and Research and Development Committees with a waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: This domain uses case definitions, concept definitions, data mappings, and other information developed from data sources that are verified, validated, and updated collaboratively across the VHA.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260551: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21261000: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nominated reporting clinicians, facilitated by research midwives and nurses from the UK’s National Institute of Health Research Clinical Research Network, notified all pregnant women admitted to their hospital with confirmed SARS-CoV-2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">In this national observational study, the study sample size was governed by the disease incidence, thus no formal power calculation was carried out.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical methods and analysis: Statistical analyses were performed using STATA version 15 (Statacorp, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>Statacorp</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Whilst it is a limitation that women with mild infection diagnosed and treated in the community will not be included in this study, it is highly likely that all women with severe infection would have been captured. A further limitation of our study is that variant sequencing data were not available for individual women, therefore proxy time periods were utilised instead. However, the Delta VOC is now known to have contributed more than 90% of all sequenced cases since 7th June 2021 so major contamination is unlikely.17 Other time-dependent changes will exist which we cannot account for, for example varying thresholds for admission to hospital or ICU depending on clinician familiarity with managing COVID-19. In the general population, national guidance was updated in January 2021 to inform community management of those with oxygen saturations >92%.18 However, it is unclear that this admission threshold was used extensively in pregnancy and given that the RCOG has never released national admission guidance for pregnant patients, this is unlikely to account for differences observed. Differing thresholds based on bed capacity may have been a contributory factor during the peak of the Alpha VOC when hospital pressures may have restricted admission to the most severe cases. However, this is not supported by our finding of an increased proportion of admissions primarily for COVID-19 in this time compared to the Wildtype period. In addition, current hospital pressures from COVID-19 (...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260773: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We ignore any migration movements, so at any given time the total population is constant and equal to N = S + E + J + I + A + H + Z + R + D.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S + E + J + I + A + H + Z</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to February 12th 2021, 15 mL of clarified supernatant (after 4000 × g centrifugation for 20 min at 4°C), was concentrated using an ultracentrifugal filter device (4000 × g for 35 min at 4°C) (Amicon Ultra-15, 10 kDa MWCO, Millipore-Sigma, St. Louis, MO, U.S.A)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Millipore-Sigma</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our modelling approach has several weaknesses. We did not precisely model the transport and fate of SARS-CoV-2 in municipal sewer systems. The lack of data about flow dynamics and particles binding of SARS-CoV-2 in wastewater hampered a more detailed approach. Hence, we took a simple approach to model the below-ground component and assumed the flow dynamic followed a low-dispersion plug flow model with a plausible fixed decay rate [46] and varied the mean transit time (from shedding to sampling sites) within a range of possible values. As more research focuses on the fate of SARS-CoV-2 in wastewater, the transport module of our model can be enhanced. The comparison with observed seroprevalence level must be done with caution, because we do not model seroreversion (patients who were infected but subsequently test seronegative because of loss of immunity or antibodies falling to undetectable levels). Our model does not model vaccination explicitly. We made this choice to keep the first version of our model relatively simple. However, we believe that we can appropriately approximate the effects of infection-permissive vaccination by reducing the transmission rate and increasing the proportion of asymptomatic infections. As the proportion of vaccinated individuals increases, modelling an explicit vaccination process is necessary. We note that for the Canadian cities studied here, the vaccination coverage was either null or low during the study period. We model SARS-CoV-2 as a sin...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453521: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was performed under American Association for Laboratory Animal Science (IACUC) protocol #20-031 RT-qPCR SARS-CoV-2 Titers: The concentration of virus in nasal washes from study days D1, D3, D5, D7, D9, and D10 was determined by RT-qPCR assay.<br>IRB: The use of human blood was approved by the Ethics Committee of the Hospital District of Helsinki and Uusimaa, Finland (216/13/03/00/2016)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All the strains are owned by and were manufactured along with placebo by IFF (Madison, Wisconsin, USA) Ferret studies: Outbred male ferrets</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Ferrets were randomly assigned to the different experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the ACE2 by immunohistochemistry, Goat Anti-ACE2 antibody (R&D, Cat#: AF933, Lot#: HOK0620051) was used as the primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bifidobacterium animalis subsp. lactis Bl-04, American Type Culture Collection (ATCC) Safe Deposit (SD)5219, DGCC2908, Lacticaseibacillus paracasei subsp. paracasei Lpc-37, SD5275, ATCC PTA-4798, Lacticaseibacillus rhamnosus Lr-32, SD5217, and Ligilactobacillus salivarius Ls-33, SD5208, and for OL-2: Bifidobacterium animalis subsp. lactis Bi-07, SD5220, DGCC 2907, Lactobacillus acidophilus NCFM, SD5221, ATCC 700396, Limosilactobacillus fermentum SBS-1, DGCC1925, Lactococcus lactis subsp. lactis Ll-23, DGCC8656, Streptococcus thermophilus subsp. thermophilus St-21, SD5207.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SD5275</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PBMCs without stimulation were used as a control, dimethyl sulfoxide (DMSO), a carrier for the TLR-ligands, were used as a control for pIC+R848 containing treatments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIC+R848</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cq value in each well was also automatically calculated by the Maestro 1.1 software based on the threshold baseline.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Maestro</div><div>suggested: (Maestro, RRID:SCR_016748)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data generated by the software were exported to a Microsoft Excel (Microsoft Corporation; Redmond, WA) spreadsheet for data processing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slides were viewed and digitized pictures were taken by Olympus VS120 scanner and analyzed by a senior Pathologist using Olyvia 3.2 software (Olympus Corporation, Tokyo, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Olyvia</div><div>suggested: (OlyVIA , RRID:SCR_016167)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were analyzed with CiraSoft software (Quanterix).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CiraSoft</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reads were quality filtered, trimmed and demultiplexed and aligned to the BioSpyder Human Whole Transcriptome v2.0 annotated reference using Salmon (v1.1.0)(Patro et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Salmon</div><div>suggested: (Salmon, RRID:SCR_017036)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was conducted using DESeq2 (v1.26.1)(Love et al., 2014) in R (v 3.6.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis (PCA) was performed to determine overall relatedness of the samples under the various experimental conditions using ggplot2 (v 3.3.3) (Wickham, 2016)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathway analysis was performed using ROntoTools (v 2.14) (Voichita et al., 2019) with a KEGG pathway (Kanehisa, 2019; Kanehisa et al., 2021; Kanehisa and Goto, 2000) considered significantly changed with a false discovery rate perturbation value of > 0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ROntoTools</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453393: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All study procedures and reagents were approved by the Washington University Institutional Review Board (#202011003) and Animal Studies Committee (Assurance #A-3381-01).<br>IACUC: All study procedures and reagents were approved by the Washington University Institutional Review Board (#202011003) and Animal Studies Committee (Assurance #A-3381-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in RStudio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261046: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The samples were processed under an approved HAC by the IRB Committee A (IRB registration # 611298), Augusta University, GA. Based on the IRB approval, the need for consent was waived, all PHI was removed and the data was anonymized before accessing for the study.<br>Consent: The samples were processed under an approved HAC by the IRB Committee A (IRB registration # 611298), Augusta University, GA. Based on the IRB approval, the need for consent was waived, all PHI was removed and the data was anonymized before accessing for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21259587: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The present study was approved by the local Ethics Committee of Vienna (#EK 21-141-0721) and the Federal Office for Safety and Health Care (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After alignment, we retained only reads that mapped in proper pairs using samtools v1.10. a textual pileup of the filtered alignment was obtained using samtools mpileup 1.10 using parameters “-aa -- max-depth 0 --no-BAQ --min-MQ 1” and further summarized using readstomper.pl and R v3.6.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA-MEM (v. 0.7.17)49 was used to map read pairs were to both the human (Hg38) and the SARS-CoV-2 genome (GenBank: MN908947.3, RefSeq: NC_045512.2) with a minimal seed length of 17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.24.21261047: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After the written consent form was given, subjects were designated to either active (proxalutamide) arm or placebo arm.<br>IRB: This RCT has been approved by the national ethics committee (approval numbers 4.173.074 and 4.513.428, for males and females, respectively).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Inclusion criteria included age above 18 years old, absence of contraindication to any of the drugs used in the study, oxygen saturation above 92% and confirmed non-pregnancy in case of females.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Subjects with confirmed COVID-19 through a positive rtPCR-SARS-CoV-2 test for the past seven days were recruited to participate in the present randomized, double-blinded, placebo-controlled clinical trial to test the efficacy of proxalutamide, a second generation NSAA, versus standard of care (SOC) solely.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The XLSTAT version 2020.3.1.1008 (Addinsoft, Inc. New York, NY) was employed for the statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XLSTAT</div><div>suggested: (XLSTAT, RRID:SCR_016299)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Here we present a more thorough biochemical analysis without relevant losses to follow-up and attenuation of these previous limitations. In fact, results have been consistent with the biological hypothesis of anti-androgenic agents mechanism of action, and have demonstrated consistency across genders, age, and baselines characteristics. Proxalutamide therapy was related to improvements in immunologic system, including substantial reduction of neutrophils as early as Day 1, higher increases in total lymphocytes counts, lower N/L ratio, and faster eosinophil increase, as compared to placebo. Strikingly, patients randomized to placebo displayed a progressively increasing N/L ratio, reaching > 3:1 after one week follow up. This demonstrates that proxalutamide may prevent the immunologic progression of COVID-19, since all the changes observed in the proxalutamide group are positive in terms of outcomes. In addition, platelets, allegedly to be directly related with better overall prognosis, raised more rapidly in the proxalutamide group compared to placebo group. Ferritin levels increase considerably during COVID-19, and has been proposed to be an independent predictor of worse COVID-19 related outcomes.28, Ferritin increased less expressively and decreased more quickly among proxalutamide users compared to placebo, providing an additional sign of proxalutamide anti-inflammatory effects. We have found that usCRP levels are statistically lower after seven days of proxalutamide thera...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04853134</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Proxalutamide Treatment for COVID-19 Female Outpatients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04446429</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Anti-Androgen Treatment for COVID-19</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453352: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: BioIVT sought informed consent from each subject, or the subjects legally authorized representative and appropriately documented this in writing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After sample incubation for 2 h at RT, the wells were washed five times with wash buffer and the presence of IgGs directed against above-defined SARS-CoV-2 antigens was detected using an HRP-linked anti-human IgG antibody (Peroxidase AffiniPure Goat Anti-Human IgG, Fcγ Fragment Specific, Jackson, 109-035-098, at 1:4000 dilution in sample buffer) at 20 μL/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equilibrium affinity binding curves of recombinant antibodies against S1 proteins of HCoV-HKU1 and HCoV-NL63: For affinity measurements of anti-human coronavirus spike glycoprotein HKU1 (40021-MM07-100, Sino Biological) to HCoV-HKU1 S1 protein, the antibody was reconstituted according to the manufacturer’s instructions and diluted into PBS, containing 0.05% Tween 20 and 5% human serum albumin (HSA), to achieve a two-fold concentration series ranging from 60 pM to 1 μM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human coronavirus spike glycoprotein HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cross-reactivity measurements, anti-SARS-CoV-2 neutralizing antibody (SAD-S35, Acro Biosystems) was reconstituted according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The binding affinities and concentrations of antigen-specific antibodies in serum samples were determined by monitoring the fraction of labeled antigen that diffused into the distal chamber of the microfluidic device.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As serum samples were derived from convalescent patients, potentially containing different classes of antibodies with variable numbers of binding sites (IgG = 2, IgM = 10), antibody concentration is expressed in terms of binding sites, rather than molecules.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG = 2 , IgM = 10) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD and HCoV-NL63-RBD competition assay: 10 nM Alexa Fluor 647 labeled HCoV-NL63 RBD in PBS containing 0.05% Tween 20 was combined with serum sample corresponding to a final anti-NL63 RBD antibody concentration of 20 nM (based on previous MAAP of each serum sample).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NL63 RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-COVID sera were seropositive for the following coronaviruses: serum 1 (HCoV-229E, HCoV-NL63), serum 2 (HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1) and serum 3 (HCoV-229E).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For profiling of serum against SARS-CoV-2 S1, SARS-CoV-2 S2, HCoV-NL63 S1 and HCoV-HKU1 S1, the buffer additionally contained 5% human serum albumin (HSA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63 S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">alignment: Sequence alignment of coronavirus full length spikes was performed using the Clustal Omega Sequence Alignment Tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The p(EC50) values for all samples and antigens were visualized using the ggplot2 package in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260875: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We conclude by noting a number of weaknesses in this study. The data are provisional, and depend on correct identification of race/ethnicity on death certificates. Racial/ethnic classification at death may differ from self-reported classifications in the American Community Survey. This is particularly problematic for AIAN, Arias et al (2016). Education may be incorrectly recorded, although the BA/non-BA distinction on death certificates is likely more accurate than that for high-school completion, Rostron et al (2010). Our results compare 2020 with 2019, and may not apply in other settings. We are not estimating parameters, but documenting a puzzle using notionally (if provisional) complete counts of deaths, so that, apart from the population estimates that are denominators in Figure 3 (but not in Figures 4 or 5, which depends on death counts only), they are not subject to standard errors or, more precisely, have standard errors of zero in the appropriate finite population calculation.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260852: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol complied with the tenets of the Helsinki Declaration and was approved by the Institutional Review Board (approval number: 18/21 03, Comité de Protection des Personnes Ouest IV Nantes) and registered on clinicaltrial.gov as NCT04757883.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then rinsed and incubated at room temperature with the relevant fluorescent antibodies for 30 minutes: CD3 (UHCT1), CD8 (SK1), CXCR3 (1C6), CXCR5 (RF8B2), CCR6 (11A9), CD25 (2A3), from BD Biosciences; CD4 (SK3), CD69 (FN50), CD137 (4B4-1), from Biolegend; and a Fixable Viability Dye (eBiosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>UHCT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BD Biosciences Cat# 346048, RRID:AB_400455)</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD25</div><div>suggested: (BD Biosciences Cat# 558063, RRID:AB_2275535)</div></div><div style="margin-bottom:8px"><div>CD69</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD137</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-nucleocapsid IgG antibodies: The Abbott anti-N IgG assay is an automated chemiluminescence microparticle immunoassay (CMIA) conducted and interpreted according to manufacturer guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-nucleocapsid IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then rinsed and incubated at room temperature with the relevant fluorescent antibodies for 30 minutes: CD3 (UHCT1), CD8 (SK1), CXCR3 (1C6), CXCR5 (RF8B2), CCR6 (11A9), CD25 (2A3), from BD Biosciences; CD4 (SK3), CD69 (FN50), CD137 (4B4-1), from Biolegend; and a Fixable Viability Dye (eBiosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All the analyses were carried out using GraphPad Prism v8.0 (San Diego, California USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04757883</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Immunological Follow-up After SARS CoV2 Vaccination in Kidne…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21260970: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data sources and selection: We conducted a comprehensive systematic literature search by employing the 6 electronic literature databases MEDLINE [</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15], PUBMED [17], SCOPUS [65]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PUBMED</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260710: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Prior to the distribution, students were made clear about the objectives of this study and inform consent form.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260777: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the first recovery, 200 µl of each sample was inoculated to Vero E6 cells (CRL1586(tm), ATCC) in 6-well plates at a confluence of ∼90%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers and probe specificity was tested by BLAST analysis (NCBI) to prevent known nonspecific binding targets that could be obtained in a human specimen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics are a paired student’s t-test run on Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
- Jul 2021
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453472: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were approved by the Institutional Animal Care and Use Committee at KDCA (No. KDCA-IACUC-21-026). 2.6.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiments: 8-week-old female human ACE2 transgenic mice, tg(K18-ACE2)2Prlmn, were purchased from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pre-incubated mixture of variant and CT-P59 was inoculated to VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture inoculated ACE2-HEK293T cells, and incubated for 72 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal experiments: 8-week-old female human ACE2 transgenic mice, tg(K18-ACE2)2Prlmn, were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>tg(K18-ACE2)2Prlmn</div><div>suggested: RRID:IMSR_JAX:035247)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the neutralization of CT-P59 against each variant was determined as the half-maximal inhibitory concentration (IC50) using GraphPad Prism6 software. 2.4. Pseudovirus</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism6</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453470: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.22.453309: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The experiments with C57BL/6 and IFNAR-/-mice were performed with permission of the Ankara University Ethical Committee for Animal Experiments (06 May 2020, 20120-8-66) in the high containment animal facility (ABSL3+), conducted according to the national regulations on the operation and procedure of animal experiments’ ethics committees (regulation no. 26220, 9 September 2006).<br>IRB: The experiments with C57BL/6 and IFNAR-/-mice were performed with permission of the Ankara University Ethical Committee for Animal Experiments (06 May 2020, 20120-8-66) in the high containment animal facility (ABSL3+), conducted according to the national regulations on the operation and procedure of animal experiments’ ethics committees (regulation no. 26220, 9 September 2006).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 28 IFNAR-/- mice (8-12 weeks) were randomly divided into 6 groups for prophylaxis and contact experiments as well as controls Individuals in the prophylaxis group received intranasal rGRFT and inoculated with SARS-CoV-2 Ank1 after 4 hours.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The suspension was sonicated at 30% power for 10 cycles of 15s on/45s off.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the membrane was incubated in 5% milk in TBS-T containing 1:10000 primary anti-his mouse antibody at 4°C, overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody solution containing 1:3000 horseradish peroxidase (HRP) conjugated goat anti-mouse secondary antibody (Abcam ab6789-1 MG) in PBS-T was added to each well and incubated for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The x6-His peptide present in the recombinant protein was targeted as the control, detected using mouse anti-His antibodies, anti-mouse-IgG-HRP and conjugate and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 150 µL of the mixture was then inoculated on Vero E6 Cells grown in a 96-well flat-bottomed tissue culture plate with highest concentration (6 µM) of rGRFT without the virus was involved as toxicity, serum-free DMEM as cell and 75 µL 100 TCID50 virus as virus controls in each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The experiments with C57BL/6 and IFNAR-/-mice were performed with permission of the Ankara University Ethical Committee for Animal Experiments (06 May 2020, 20120-8-66) in the high containment animal facility (ABSL3+), conducted according to the national regulations on the operation and procedure of animal experiments’ ethics committees (regulation no. 26220, 9 September 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 28 IFNAR-/- mice (8-12 weeks) were randomly divided into 6 groups for prophylaxis and contact experiments as well as controls Individuals in the prophylaxis group received intranasal rGRFT and inoculated with SARS-CoV-2 Ank1 after 4 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFNAR-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">grft gene was cloned into the pet22b vector without a pelb leader sequence, using Gibson assembly.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pet22b</div><div>suggested: RRID:Addgene_84863)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were generated via GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453505: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design: We have used public scRNAseq datasets to compare the level of expression of SARS-CoV-2 entry receptors in male and female lung alveolar epithelial cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole cell extracts were incubated with either STAT1, STAT2, or control rabbit IgG antibody and protein G beads (Invitrogen, 10003D) overnight at 4 °C while rotating.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAT2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterward, membranes were probed with antibodies against STAT1, STAT2, IRF9, and rabbit IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IRF9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then incubated with primary antibodies overnight, followed by incubation with the fluorochrome-conjugated secondary anti-mouse or anti-rabbit IgG (H+L) for 1 hour at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were incubated with Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Co-immunoprecipitation (co-IP): Calu3 cells were incubated with either IFN-α and IFN-β, or IFN-λ for 3 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lipofectamine 3000 was used to co-transfect transfer plasmids and packaging vectors in 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell RNA sequencing datasets: Three publicly available scRNA-seq datasets were obtained as follows: 1) processed data including count and metadata tables of healthy lung tissue was downloaded from Figshare (https://doi.org/10.6084/m9.figshare.11981034.v1); 2) h5 files of normal lungs were extracted from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE122960; and 3) processed data including count and metadata tables of human lung tissue was acquired from GSE130148.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Accession numbers for all ENCODE datasets used can be found in Encode Data Sets Table (Supplementary Table 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENCODE</div><div>suggested: (Encode, RRID:SCR_015482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Predicted enhancer regions of TMPRSS2 were identified using the GeneHancer tool within Track Data Hubs of UCSC genome browser (85, 86).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneHancer</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>UCSC genome browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis: Gene set enrichment analyses (GSEA) were performed according to the instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analyses</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene sets of Hallmark Collection, Canonical Pathway (including KEGG Pathway, Biocarta Pathway, Reactome Pathway and PID Pathway), and GO Biological Process were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>GO Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis used R and GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260928: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: This prospective observational study was conducted at the Geneva University Hospitals (HUG), Switzerland according to the principles of Good Clinical Practice and was approved by the Geneva Cantonal Ethics Commission (2021-00430).<br>Consent: Informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of our study include the small sample size and the short follow-up after vaccination. We also were not able to correlate T cell findings with clinical protection as the study was not designed to measure efficacy, which is pivotal in the identification of vaccine-responders and the indication for a potential third vaccine dose. Strengths of our study is the prospective design and the ability to evaluate two patient populations under anti-CD20 therapy who have different underlying conditions that do both not greatly affect other axes of immune responses, such as in poly-immunosuppressed patients, or those suffering from lymphoma or leukemia. In summary, our study suggests that patients with anti-CD20 treatment are able to mount potent T-cell responses to mRNA COVID-19 vaccines similar to immunocompetent controls. Although patients treated with anti-CD20 treatment have decreased humoral responses to mRNA COVID-19 vaccines, elicited T-cell memory response could reduce complications of SARS-CoV-2 infection in this vulnerable population.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 15. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.23.21261013: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study is prone to the limitations pertaining to modeling exercises. First, VE for children have not been estimated for the vaccines in use in China; therefore, we have assumed the same VE as in adults based on immunogenicity studies 51. Given such a lack of field evidence, we have conducted a sensitivity analysis where a lower vaccine efficacy is assumed for children. The overall conclusions of the study do not change. Still, further data on age-specific vaccine efficacy could help refine the obtained estimates. Second, we assumed that immunity induced either from infection or vaccination lasts more than the time horizon considered in the simulations (i.e., 1 year). There are both evidence from laboratory studies and the field suggesting that the protection lasts several months 52-54. Despite these preliminary pieces of evidence, the duration of the immunity remains a research area of paramount importance and intrinsically linked to viral evolution. It is also possible that waning immunity will continue to provide protection against severe disease but only partial against infection or transmission, which affects the herd immunity threshold. Overall, the duration and quality of immunity will determine the periodicity of COVID-19 outbreaks globally 55,56. Third, in the baseline scenario, we referred to an inactivated SARS-CoV-2 vaccine (BBIBP-CorV) taken to be 73.5% efficacious against infection 17. However, several other vaccines (including CoronaVac, WBIP-CorV, Ad5 nCoV,...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260872: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">11 It was adapted to report on COVID symptoms in March 2020, among adults aged 18 years or older, covering about 2100 randomly selected respondents weekly, drawn from nearly 4000 political</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Moreover, our methods are reproducible over time and avoid the limitations of model-based estimates. Nonetheless, we faced some limitations. The use of excess mortality has limitations as some causes, notably road traffic accidents and other injuries, might have fallen, particularly during COVID lockdowns. However, these injuries constitute less than 10% of all deaths from 2004-14.4,21 There might also be an excess of some deaths from neglected health service, and there are reports, for example, that maternal mortality has risen during the pandemic months.22 However, changes in causes of death aside from COVID are likely small compared to the sharp increases in COVID deaths, particularly during the second viral wave. The delays in death registration or a backlog of deaths reported suddenly might create an artifact of excess deaths. However, in the case of Andhra Pradesh, 98% of deaths registered in May 2021 took place within the previous 30 days, not earlier time periods. Survey data might represent over-reporting, as the questions asked about deaths beyond the households. However, since the introduction was focused on flu-like symptoms in the respondent’s family or daily contacts, the extent of such over-reporting is likely small. Moreover, we corrected for over-reporting, albeit imperfectly, by subtracting reported rates in non-pandemic weeks and tested this assumption in sensitivity analyses, which suggested that a lowest value of 2.3 million COVID deaths over the study ye...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260964: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: These studies were conducted at a single phase 1 unit in China from July 2020 to February 2021 (registered at ClinicalTrials.gov under registration number NCT04479631 and NCT04479644).<br>IACUC: The study protocol, amendments, and informed-consent forms were reviewed and approved by Ethical Review Committee at the site.<br>Consent: Participants provided written informed consent before any study-related procedures were performed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were healthy male or female adults aged 18 to 49 years, had a body weight ≤100 kg and a body mass index of 18-24 kg/m2, and were in good health determined by no clinically significant findings from medical history, physical examination including vital signs, electrocardiogram (ECG), and clinical laboratory assessments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participants: BRII-196-001 and BRII-198-001 are two first-in-human phase 1, randomized, single-blind, placebo-controlled, single ascending dose escalation studies in which BRII-196 and BRII-198 were evaluated respectively among healthy adults.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: BRII-196 or BRII-198 serum concentrations were measured using validated enzyme linked immunosorbent assays (ELISA) with the lower limit of quantitation (LLOQ) at 150 ng/mL.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples for anti-drug antibody (ADA) assays were collected at the following time points: pre-dose on day 1 and at days 15, 31, and 181.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-drug</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PK parameters were estimated by non-compartmental analyses using WinNonlin module in the Phoenix Platform (version 8.3.1.5014, Certara Inc., Princeton, NJ 08540).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phoenix Platform</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04479631</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Pharmacokinetics Study of Human Mo…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04479644</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Pharmacokinetics Study of Human Mo…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260854: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removing outliers based on a root-to-tip regression analysis in TempEst v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.5.311, a maximum likelihood (ML) tree was generated for the final dataset (n=3,971) in IQ-TREE v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260760: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approval was obtained from Sheba Medical Center and informed consent was obtained from all patients.<br>Field Sample Permit: Sample collection methodology: Between July and September 2020, we collected 361 samples from a total of 96 confirmed COVID-19 outpatients: 137 ONP swabs, 137 saline MW samples, 59 distilled water wash, 12 commercial MW solution containing alcohol and 16 commercial MW solution without alcohol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study population: The study population included adult men and non-pregnant women (>18 years old), with molecular confirmation of COVID-19 by RT-PCR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.18.21260711: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260921: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: This study was approved by the Stanford University Institutional Review Board (IRB-60171 and IRB-57519).<br>Consent: Healthcare worker participants provided informed consent to donate blood samples via venipuncture after second dose of vaccination with BNT162b2. IGRA and IgG ELISA were ordered in immunocompromised patients by their providers as part of clinical testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: GraphPad Prism version 9.0 (GraphPad Software, San Diego, California, USA) software was used to visualize data and Mann-Whitney U test was performed to compare cellular and humoral response in immunocompetent and immunocompromised patients.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistics: GraphPad Prism</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260624: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 5 Recruiting Centers and Ethics Committee Approval IDs: The project protocol involved the rapid recruitment of patient-participants and no additional project-related procedures (we primarily used material from clinically indicated venipunctures) and afforded anonymity, owing to the minimal dataset collected.<br>Consent: Differences in recruitment and consent procedures among the centers arose because some centers integrated the project into larger COVID-19 biobanking efforts, whereas other centers did not, and because there were differences in how local ethics committees provided guidance on the handling of anonymization or deidentification of data as well as consent procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Analysis of the Y-chromosome haplotypes: First, we produced high quality Y-chromosome genotypes by manually calling and visually inspecting Y-chromosome SNPs in the male fraction of the cohorts only.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sub-analyses in age groups of 20-40, 41-60, 61-80 and > 80 years were carried out, with the highest sample numbers and statistical power in the age groups of 41-60 and 61-80 years, such that only these are reported (Supplementary Table 1e).</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood types A and AB were also analyzed combined as “A and AB”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Association analysis of the 17q21.31 inversion: 17q21.31 inversion genotypes were imputed using IMPUTE v2.3.245, 46 from quality controlled SNP data (first and second analysis) based on experimentally-validated inversion genotypes from 109 individuals from the 1000 Genomes Project or from P-values (COVID-19 HGI A2/B2 release 5 data) using Fast and accurate P-value Imputation for genome-wide association study (FAPI) (Supplementary Methods).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1000 Genomes Project</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">22 Candidate coding genes were selected based on their inclusion in the GWAS credible sets and/or if any of the variants had been identified as lead eQTL or sQTL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sQTL</div><div>suggested: (SQTL, RRID:SCR_000827)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analysis was carried out using hurdle modeling, implemented in the R package MAST.52 Finally, to check the effect of the 17q21.31 inversion on monocytes stimulated by infection-like conditions we also performed a differential expression analysis in the RNA-seq data from Quach et al.53 by imputing the inversion genotypes with IMPUTE v2.3.225 and quantifying gene and transcript expression differences with Kallisto v0.46.020 and QTLtools v1.154.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMPUTE</div><div>suggested: (IMPUTE, RRID:SCR_009245)</div></div><div style="margin-bottom:8px"><div>Kallisto</div><div>suggested: (kallisto, RRID:SCR_016582)</div></div><div style="margin-bottom:8px"><div>QTLtools</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260721: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A structured questionnaire was prepared in a Google Form and a link was generated, shared with all authors and other volunteers who were instructed properly as to how well they can use this form to recruit data with adequate consent from the participants.<br>IRB: Ethical considerations: This study was conducted in accordance with the institutional Research Ethics and the declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Management and Analysis: All submitted data were automatically stored in a dynamic Microsoft excel sheet which was made available offline after completion of data collection for primary data processing including data duplication-checking, data cleaning, data coding, etc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After accomplishment of data cleaning and coding, the final dataset having data of 402 respondents was entered into Statistical Package for the Social Science (SPSS) version 26.0 for further data processing and doing all statistical analysis which included descriptive statistics, Mann-Whitney U test, Kruskal Wallis H test, Multiple logistic regression, Spearman rank-order correlation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations, Strength, and Recommendation: Our study had several limitations. First, our study sample could not reflect all populations throughout the country. Second, our study could not include participants of all ages. Third, the study sample size was comparatively small. Fourth, our study followed a web-based cross-sectional study that excluded underprivileged people especially those who were not accessible to internet-based facilities. Five, we had to conduct comparatively less sensitive statistical analysis as our data were not normally distributed. As to the strength of our study, to the best of our knowledge, this is the first study that attempted to find out possible reasons why people are deflected from maintaining preventive measures. Future investigations should follow both community-based and web-based cross-sectional studies, collecting data from all sectors, all divisions, attempting to find out the most probable reasons behind failure to maintain all preventive measures for covid-19 prevention in a more structured way.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260842: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: All analyses were performed in STATA 16·0 (StataCorp, 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Some other limitations need to be discussed. The results presented here represent exploratory analyses of ecological nature and they carry the risk of ecological fallacy and unmeasured, unaccounted confounding. Nevertheless, the patterns observed are compatible and extend the results of large-scale population cohort analyses from countries like Israel and UK that demonstrated large clinical benefits from rapid massive deployment of vaccination in whole countries (4–6). One particular source of unaccounted confounding is the extent to which COVID-19 deaths in nursing home residents may have decreased over time, due to non-vaccine-related reasons, e.g. better protection of nursing homes after the first wave in 2020 and a reduction due to harvesting effects of the population pool of frail nursing home residents who would be highly likely to succumb upon infection. A previous analysis comparing the first versus the second wave (until mid-January 2021) found a large decrease in the proportion of COVID-19 represented by nursing home residents in several high-income countries (9). Available data from several European countries and Canada suggest a further decline in the share of deaths represented by nursing home residents during 2021 (Appendix 1). Universal vaccination is easier to achieve in nursing homes than among the community-dwelling elderly. Nevertheless, deaths seem to have declined equally steeply also among community-dwelling elderly (Appendix 1). Other potential sources ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260794: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board (IRB) at Mount Sinai Hospital (IRB</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical tests were performed in GraphPad Prism, were 2-tailed, and significance level was set at p-values < 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260845: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed written consent.<br>IRB: Approval for the study design and sample collection was obtained within the framework of study “Establishment and validation of epitope-specific SARS-CoV-2 blood-based testing methods” (EPI-SARS) by the ethics committee of the Technical University of Munich (reference number 182/20) and the Institutional Ethics Committee of the University Medicine Mannheim (reference number 2020-556N).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, cells were stained with EMA solution (1:1000) for live/dead discrimination and subsequently with surface antibodies: CD19-ECD (1:100), CD8-PE (1:200), CD3-BV421 (1:100) and murine TCR β-chain-APC/Fire750 (1:100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD19-ECD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8-PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HLA type for asymptomatic seropositive and seronegative donors was determined via surface antibody staining using commercially available antibodies targeting HLA-A*02-FITC (1:200,), HLA-A*03-APC (1:200), HLA-B*07-PE (1:100), HLA-B*08-APCVio770 (1:200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-A*03-APC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HLA-B*07-PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HLA-B*08-APCVio770</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 RFP+ cells were then retrovirally transduced with plasmids encoding HLA-A*01:01 or HLA-A*03:01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2 RFP+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the production of retroviral particles, RD114 cells were transfected with pMP71 expression vector (containing the HLA heavy chain construct, gag/pol and amphotropic envelope) by calcium phosphate precipitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RD114</div><div>suggested: ATCC Cat# PTA-4440, RRID:CVCL_1J88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1*105 A549 ACE2 RFP+ cells were then transduced via spinoculation on virus-coated plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the Incucyte killing assay, 5*103 A549-ACE2+ RFP+ HLA-A*01 or A549-ACE2+ RFP+ HLA-A*03 cells were seeded 24 h prior infection with SARS-CoV-2 GFP virus (MOI 5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-A*03</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the production of retroviral particles, RD114 cells were transfected with pMP71 expression vector (containing the HLA heavy chain construct, gag/pol and amphotropic envelope) by calcium phosphate precipitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMP71</div><div>suggested: RRID:Addgene_141355)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After import of sequence raw data in the uType software, the sequences were analyzed for HLA type creation by aligning to recent IMGT HLA allele</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>uType</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation of our study is the use of an in vitro expansion step prior T cell analyses, which may bias the relative abundance of clonotypes and may favor outgrowing of some clones at the expense of others. However, this approach of peptide stimulation offered the possibility of exploiting signatures of recent activation to discriminate epitope-specific and functional TCRs66. Indeed, we identified signatures of T cell function and recent activation correlating with TCR functionality, which allowed a broad in silico investigation of the functional landscape of entire TCR repertoires, otherwise unfeasible by conventional experimental validation. Remarkably, we predicted highly functional TCRs for each of the eleven immunodominant SARS-CoV-2 epitopes analyzed, despite a certain degree of functional heterogeneity. Together with the observed polyclonality, our data indicate that functional and diverse CD8+ T cell immunity should normally establish in non-severe SARS-CoV-2 infections. Polyclonality and high functionality are hallmarks of a protective TCR repertoire67, thus strongly supporting a similar role also in the context of SARS-CoV-2 infections. Nevertheless, the extension of TCR repertoire analyses to settings of severe infections remains a fundamental next step to assign CD8+ T cell responses a role as correlates of protection. Overall, our data provide first evidence that SARS-CoV-2-specific CD8+ T cells persists up to 12 months after infection and are composed of a poly...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260833: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of our study include the relatively low number of B.1.351 cases, owing to its low prevalence in Israel, and also the fact that the sequencing was not done on a sample selected randomly from the total population of SARS-Cov2 positive cases in Israel. In particular, samples were selected for sequencing based on a variety of concerns, but partly to check on the variants among cases occurring after vaccination and partly to follow-up on those coming into contact with persons found to have the B.1.351 variant. Thus, the database has over-representation of vaccinated cases, and also over-representation of the B.1.351 variant among cases in Israel. In order to test the robustness of our results, we used two different statistical methods, unconditional logistic regression and conditional logistic regression with matching to estimate the OR. Both analyses revealed no statistically significant difference, and indicated that any reduction in the vaccine efficacy against B.1.351 relative to B.1.1.7 is at the most marginal with an OR not exceeding 2.5. In addition, we have shown in computer simulations that this type of selection should not introduce bias into the estimation of the odds ratio of a vaccinated case having the B.1.351 variant (see Supplemental Information for details). The criterion for validly using such a database for estimating the OR is that the selection of vaccinated cases or B.1.351 cases should be independent of each other; when selecting a vaccinated cas...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.15.21260589: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and data sharing: We used Python v3.7 in Jupyter Notebooks with pandas, seaborn, and matplotlib libraries to analyse the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations to our study. The 23 PFDs included may not represent all preventable deaths caused by COVID-19 and several jurisdictions did not publish any PFDs relating to COVID-19, with no PFDs reported in the North East, East Midlands, South West or Wales. The underreporting of PFDs limits the capacity for actions to be taken to prevent future deaths. However, it is likely that the number of PFDs relating to COVID-19 will increase in the coming months and years owing to the backlog of inquests as well as the time it takes for inquests to conclude and PFDs to be written and uploaded to the Judiciary website. For example, healthcare professionals in England and Wales called for the deaths of their colleagues to be reported to the coroner and for PFDs to be issued15,16. However, we did not identify any PFDs that reported deaths of healthcare professionals. There are also no clear guidelines for when deaths should be reported to the coroner and when PFDs should be issued after inquests, nor any auditing or quality control of these processes. In the meantime, we encourage coroners across England and Wales to continue writing PFDs when they believe deaths could have been prevented so lessons can be learnt from the COVID-19 pandemic. We are also limited by the information reported by coroners in PFDs and we identified missing data in the reports. In 52% of PFDs the age of the deceased was not reported and 26% did not report the date of death. We did not assess comp...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260795: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations and Strengths: The study employs a novel sampling method with a soft ask and low response rate, the effect of which has not yet been fully studied. Survey weights adjust for non-response and coverage bias (i.e., matching the sample to gender, age, and geographic profile of the US). However, a comparison with the American Community Survey20 shows our sample is more educated with higher vaccine uptake than general population, indicating that vaccine hesitancy is underestimated in this sample. Importantly, these characteristics have been consistent over time. CTIS results follow similar patterns observed by others,8 and have been helpful for tracking trends, understanding associations and informing policies21,22. Demographic questions were asked at the end of the survey and had high unit non-response (e.g., 12% for age), which was treated as a category in analysis. Additionally, we assume the survey was completed in good faith. However, a review of fill-in responses for self-described gender suggest a small percentage of participants used that category to make political statements (e.g., trans-phobic comments). A sensitivity analysis eliminating respondents with self-described gender produced very similar results, though the increase in hesitancy for those age ≥75 years was attenuated (data not shown). A strength of our novel sampling method is that it yielded a large sample with diverse characteristics that enabled detailed subgroup analyses that identified new find...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260929: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform the study at hand, a COVID-19 literature web-scraping tool was applied to allow combined search through common databases such as Pubmed, Embase and Web of Science using predefined syntaxes for identifying relevant literature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pubmed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One limitation of this paper is that while most studies focused entirely on the SSA region, some studies, while focusing on SSA, observed additional LMICs besides LMICs in SSA. This paper aimed to specifically extract the findings from the SSA region. Nevertheless, this factor could have potentially led to minor interpretation biases.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260823: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approval from Institutional Review Boards (IRB): The study is approved by the Institutional Ethics Committee of ICMR-National Institute for Research in Reproductive Health (#55/2020), BYL Nair Hospital, Mumbai, India (# 63/2020); and all the 18 participating study sites under Medical Education and Drugs Department of Government of Maharashtra.<br>Consent: The Institutional Ethics Committees granted a waiver of consent as the data is collected from the medical case records.<br>Field Sample Permit: Data collected from different study sites will be kept separately and only specific individuals within a research team will be able to access and edit the data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The PregCovid registry is a prospective, hospital-based study designed to capture hospital data of pregnant and post-partum women with COVID-19 and their newborns.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data pooling and statistical analysis will be carried out using MS Excel and SPSS version 26 (SPSS South Asia Pvt. Ltd., Bangalore, India).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260767: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Children were considered to have SARS-CoV-2 if they had a documented positive test by polymerase chain reaction (PCR), antigen (Ag), or antibody (Ab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen (Ag),</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has important limitations to consider. As data are aggregated from many health systems using four different CDMs that vary in granularity, some sites may have systematic missingness of certain variables. Additionally, some respiratory data (oxygen flow, FiO2, and specific ventilator settings) are not fully available. The exact timing of laboratory specimens is inconsistently provided by sites. As such, labs were standardized to a calendar day. Furthermore, with high rates of asymptomatic-to-minimally-symptomatic pediatrics infections and increasing adoption of universal SARS-CoV-2 testing policies for pediatric hospital admissions, we cannot definitively attribute reasons for hospital admissions (SARS-CoV-2 versus another unrelated cause). This may limit interpretation of variables associated with higher clinical severity. Additionally, given the low number of severe pediatric cases, interpretation of incidence over time is challenging. Lastly, although ICD-10 coding for MIS-C has likely improved with time and increased awareness of the condition, many cases of MIS-C (especially in the earlier months of the study period) were likely not identified as such, limiting interpretation of MIS-C subgroup analysis. In summary, this study reports the characteristics and outcomes of the largest U.S. cohort of children with SARS-CoV-2 infection to date. The N3C database provides a geographically and demographically diverse, granular view of pediatric SARS-CoV-2 infections and...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.23.453571: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRC5 cells (ATCC CCL-171™, Manassas, VA, USA) in confluent culture in 96-well microtiter plates were infected with 200 μL per well of virus/antibody mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC5</div><div>suggested: ATCC Cat# CCL-171, RRID:CVCL_0440)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentration-effect curves were generated and IC50 values were calculated using a GraphPad Prism software (Version 9.1.0 for Windows, GraphPad Software, San Diego, California USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260963: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the National Research Ethics Commission – CONEP (approval number 4.100.115, on June 20th, 2020) and was registered at the Brazilian Registry of Clinical Trials – ReBEC (RBR-5vpyh4, on June 6th, 2020).<br>Consent: The informed consent form (ICF) was applied to all patients or their legal guardians for patients unable due to their medical condition.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization and procedures: Enrolled patients were sequentially subjected to block randomization to receive 300 mg of secukinumab subcutaneously at day-0 plus standard of care (SoC)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The minimum sample size to achieve 80% power to detect an increase of 5.5 days in the VFD-28 was 25 patients per group.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were collected using the Research Electronic Data Capture (REDCap) database (https://www.project-redcap.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study had some limitations. It was open-label with a small sample size. The sample size was calculated based on the risk of intubation and death observed at the beginning of the epidemic in Brazil. When inclusions started in September 2020, all patients were already taking corticosteroids because of its benefits in oxygen-dependent COVID-19 patients (36). Possibly, this issue improved the challenge to show the significant effects of an anti-inflammatory intervention on top of steroid use. In fact, smaller studies with another anti-cytokine therapy (anti-IL-6R) have also reported no improvement in COVID-19 patients, while two larger trials clearly showed a benefit (37). Furthermore, the optimal dose, route of administration, and timing of secukinumab to ensure therapeutic tissue concentrations in COVID-19 are unknown. The dose regimen chosen in this study was the maximum weekly dose, currently approved for other indications. In conclusion, secukinumab exhibited a satisfactory safety profile in severe COVID-19 patients. Although the blockade of anti-IL-17A with secukinumab appears not to show a clear benefit, compared to the standard of care, in the context of COVID-19 pulmonary failure, there was a significant reduction of pulmonary thromboembolism. Larger clinical trials of secukinumab in COVID-19 may be warranted.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.22.21260416: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">When fitting the Cox models, we included all individuals who died during the analysis period and a weighted random sample of those who did not, with a sampling rate of 1% for those of white British ethnicity and 10% for adults from ethnic minority groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Covariates: Our analysis included key sociodemographic data including measures of deprivation, household composition, occupation and key worker status, educational attainment and exposure to others, defined within Supplementary eTable 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, there were limitations. Most notably, this analysis is generalisable to the 52.4% of the English population with coded BMI data within their health care records in the 10 years preceding the pandemic. In England, height and weight are collected as part of routine care by trained staff using medical grade equipment. Nevertheless, family practice incentivisation schemes and differential take-up rates to population level vascular screening programmes means that data is not missing at random [20]. Previous analysis has shown that women, those who attend their family doctor more often, who come from more deprived areas, who have a high or low BMI and have a greater number of comorbidities are more likely to have a coded BMI value [20]. Nevertheless, it has been demonstrated that missing data within clinical records can provide unbiased estimates of adjusted exposure-outcome associations under a wide range of missing data assumptions [25]. In addition, primary care data in England provide some of the most detailed electronic health-care records internationally and are routinely used to identify individuals at risk of chronic and infectious diseases, including COVID-19 mortality [19, 26], giving this study real world utility. This study utilized data from the 2011 Census, therefore any sociodemographic changes within the last decade will not be reflected in the analysis. Although we adjusted for factors related to the risk of SARS-CoV-2 exposure, including household composi...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260961: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Nasopharyngeal swab specimens were collected as part of the routine SARS-CoV-2 surveillance conducted by the Mount Sinai Pathogen Surveillance program (IRB approved, HS#13-00981).<br>IRB: Briefly, 30 participants enrolled in the PARIS (Protection Associated with Rapid Immunity to SARS-CoV-2) study (reviewed and approved by the Mount Sinai Hospital Institutional Review Board; IRB-20-03374) were invited to provide additional serum samples after receiving their second mRNA vaccine dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2-hour incubation, plates were washed three times with PBS-T and 50 μl/well of the pre-diluted secondary antibody anti-human IgG (Fab-specific) horseradish peroxidase antibody (produced in goat; Sigma, A0293</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# A0293, RRID:AB_257875)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking solution was removed and 100 μl/well of mAb 1C7 (anti-SARS nucleoprotein antibody produced in house) diluted in PBS 1% milk (American Bio) at a 1:4000 dilution were added for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody was removed and plates were washed with 200 μl/well of PBS twice, followed by addition of 100 μl/well of goat anti-mouse IgG-HRP (Rockland Immunochemicals) diluted in PBS 1% milk (American Bio) 1:3000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specimens were selected for viral culture on Vero-E6 cells based on the complete viral genome sequence information.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">39 Viruses were grown in Vero.E6 cells for 4-6 days; the supernatant was clarified by centrifugation at 4,000 g for 5 minutes and aliquots were frozen at -80°C for long term use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero.E6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were seeded in 96-well high binding cell culture plates (Thermo Fisher) at a density of 20,000 cells/well in complete Dulbecco’s Modified Eagle Medium (cDMEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogeny of SARS-CoV-2 lineages: The phylogenetic relationships of the SARS-CoV-2 isolates from the Pathogen Surveillance Program of the Mount Sinai Health System are depicted in a New York focused background from GISAID.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pathogen Surveillance Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Area under the curve (AUC) values were calculated and plotted using GraphPad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A non linear regression curve fit analysis, using Prism 9 software (GraphPad), was performed to calculate the inhibitory dilution 50% (ID50), using top and bottom constraints of 100% and 0% respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260904: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The institutional ethics committee approved the proposal of this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was done using IBM SPSS 21.0 software and Microsoft Office Excel 2007.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Microsoft Office Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The limitations of this study are small sample size and retrospective observational study design. Randomized controlled studies with larger sample sizes are required to determine whether MUST can effectively assess nutritional risk in COVID-19 patients.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.22.453029: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human subjects and patient characteristics: Following written informed consent, adult patients with symptomatic, RT-qPCR confirmed SARS-CoV-2 infection were recruited in the Canton of Zurich, Switzerland, between April 2 and September 24, 2020.<br>IRB: The study was approved by the Cantonal Ethics Committee of Zurich (BASEC 2016-01440).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Downstream analysis was conducted in R version 4.1.0 with package Seurat version 4.0.3 (PMID: 34062119).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TCR profiling on filtered contig annotations was done using R package scRepertoire version 1.1.46, which assigns TCR nucleotide and amino acid sequences together with clonal frequency counts and a clonotype classification to each cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scRepertoire</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260803: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, certain patient groups receiving immunosuppressive therapies appear to develop insufficient humoral and cellular responses 18,23-25, but limited data about the underlying limitations is available. Protection through immunization is achieved by an orchestrated immune response between different cellular subsets of innate (APCs) and adaptive immunity, such as B and T cells. Anti-B cell therapies like anti-CD20 antibodies (rituximab, obinutuzumab and ocrelizumab) and BTK inhibitors are associated with poor humoral SARS-CoV-2 vaccination responses, in patients with AIIRD 17-20, multiple sclerosis 26 and CLL 27. Since B cell depletion enhances the risks for poor Covid-19 outcomes 3, but also can reduce anti-SARS-CoV-2 vaccine responses, it is of utmost importance to delineate the level of B cell repopulation necessary to achieve anti-vaccine responses and get insights into the complex relationship between antigen-specific B and T cells. Therefore, our study aimed to investigate humoral and cellular responses in RTX treated patients versus controls. Consistent with previous data 17-19,22, serologic IgG conversion with formation of neutralizing antibodies was significantly lower and delayed in both, RA and even more pronounced in the RTX cohort compared to HC. This finding was closely linked to the availability of peripheral B cells, activated CD4/8 T cells as well as circulating TFH-like cells. Ongoing antigen exposure through mRNA vaccines seems to permit prolonged GC matu...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 18 and 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260791: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260822: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study design, sample collection, and storage: All studies were approved by the Institutional Review Board of Stanford University (IRB-3780), and the studies complied with the relevant ethical regulations.<br>IRB: Study design, sample collection, and storage: All studies were approved by the Institutional Review Board of Stanford University (IRB-3780), and the studies complied with the relevant ethical regulations.<br>Consent: All participants provided written informed consent before participating in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B cell samples without antigen enrichment were stained with CD19, IgD, CD27, CD38 TotalSeq-C antibodies (all Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD19</div><div>suggested: (Agilent Cat# TC67401, RRID:AB_579635)</div></div><div style="margin-bottom:8px"><div>IgD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD38 TotalSeq-C</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antigen-sorted B cell samples, cells were stained with the following fluorescently labeled antibodies according to standard protocols: CD19, CD20, CD38 (all BD Biosciences), CD3, CD27, IgM, IgD, (all BioLegend), IgA (Miltenyi Biotec)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD38</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM , IgD</div><div>suggested: (MyBioSource Cat# MBS531438, RRID:AB_10577295)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, samples were labeled with TotalSeq-C hashtag 1-9 antibodies (Biolegend) for demultiplexing individual samples in downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1-9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated antibodies goat anti-human IgG (Bethyl Laboratories) or HRP-conjugated goat anti-human IgA (Bethyl Laboratories) were applied for 1h at RT, and plates were developed with TMB substrate (Thermo Fisher Scientific), and stopped with 2N sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Secondary HRP-conjugated antibodies goat anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti X 293T cells (Takara Bio) were cultured in DMEM (ATCC, 30-2002) with 10% heat-inactivated FBS (Corning) and 100 U/ml of penicillin–streptomycin (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lenti X 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, LentiX 293T cells were seeded in 10cm plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was titrated on HeLa-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 hours, cells were transfected using Fugene transfection reagent (Promega) with pHAGE-CMV-Luc2-IRES-ZsGreen-W, lentiviral helper plasmids (HDM-Hgpm2, HDM-tat1b, pRC-CMV-Rev1b), and wildtype or variant SARS-CoV-2 spike plasmids (parent plasmids publicly available from Jesse Bloom lab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-CMV-Luc2-IRES-ZsGreen-W</div><div>suggested: RRID:Addgene_164432)</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo Version 10.7.1 (BD Biosciences) and R version 3.6.1 was used for flow cytometry data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics and software: GraphPad Prism version 8.4.1 and R version 3.6.1 were used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphical illustrations were created with BioRender.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.16.21260675: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We solve Eq.(8), (9) and (10) using matlab inner-embedded function dde23 with particular sets of model parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 13, 5, 6 and 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260373: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The initiative was formally reviewed by institutional authorities at Unity Health Toronto and deemed to neither require Research Ethics Board approval nor written informed consent from participants.<br>Consent: The initiative was formally reviewed by institutional authorities at Unity Health Toronto and deemed to neither require Research Ethics Board approval nor written informed consent from participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and Limitations: Our study had several key strengths and limitations. Our study included a large sample of respondents from multiple clinics across both urban and suburban communities. Patients were randomly sampled using birth month. Survey questions were relevant to COVID-19 and informed by primary care leaders and patients. However, our findings are open to selection bias because of the response rate, mode of delivery, and the survey being offered primarily in English; however, demographics of our sample confirm that we reached a diverse group of patients. We found substantial differences in utilization and perspectives of virtual care by sociodemographic characteristics, but these may be an underestimate of true differences. Our survey reports on experience during the early phase of the pandemic and patients’ comfort and preferences may have evolved since. Finally, although our sample was taken from 13 primary care practices, these were all academic practices in the Greater Toronto Area where physicians were paid by capitation which may limit the generalizability of the findings.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260690: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This observational cross-sectional study was conducted from March to May 2021 at a teaching institute affiliated with a tertiary care hospital in Lahore Pakistan, after obtaining approval from the Institution’s ethical review board.<br>Consent: Informed electronic consent was the first part of the questionnaire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size was calculated by using the Raosoft sample size calculator by keeping a 5% margin of error, 95% confidence interval, and 1050 as the population size with 50% response distribution.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed via SPSS (Statistical Package for the Social Science) software version 26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This research warrants enhancements and does not come without its limitations. The study is cross-sectional which hinders disentangling causality of whether the sleep disturbance is due to the COVID-19 pandemic directly or were there confounding factors that contributed to sleep disturbances as well. Though causality can not be determined, the study still, however, suggests that the pandemic might have an effect on sleep disturbance and the mental health of undergraduate medical and dental students. Even though the sample size is adequate, the results should be generalized for the entire population of undergraduate medical and dental students of Pakistan with caution.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.17.21260662: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the institutional review board of the University of Tlemcen [14/2021 EDCTU].<br>Consent: All participants provided informed consent prior to their participation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">It involved adult (aged 18 years and older) males and females of all regions, who were permanently residing inside the country during the study period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size and sampling technique: The sample size (N=385) was calculated using the single proportion sample size calculation formula, to detect an unknown vaccine acceptance rate (P=50%) with 95% confidence interval (95%CI), 80% statistical power and 5% margin error, among the total Algerian population.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed by means of IBM’s SPSS for Windows, Version 25.0 (SPSS Inc., Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medline was searched through PubMed database using the following search terms: COVID-19, SARS-CoV-2, hesitancy, acceptance, vaccine, and vaccination, to retrieve related studies published from the database inception to May 16th, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260770: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: These data are validated and analysed by Public Health England to check completeness, query any anomalous results, and are used to describe epidemiological trends, as well as being used directly locally by the NHS for performance management.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results have been reported using the STROBE (20) and RECORD (21) guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RECORD</div><div>suggested: (RECORD, RRID:SCR_009097)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: It is important to acknowledge the limitations of the data presented, many of which arise from opportunistically using routinely collected data rather than that obtained from a specific study design. The SIRS electronic system is well-established and captures data on the entire child population in Scotland. However, the aggregate surveillance data derived from the system that we could access lacked detailed information on several potentially important factors, not least of which was ethnicity, which is known to affect both immunisation uptake and attitudes towards immunisation. (23) In the 2011 Scottish Census, 92% of the population of Scotland identified themselves as White Scottish/British, and only 4% as non-white, whereas in England, 81% described themselves as White British and 14% non-white. (24) It may not be appropriate to extrapolate these data to countries with a significantly different ethnic make-up and it is plausible that some of the difference seen between the Scottish and English data could be due to these factors. In using the mean percentage of the entire year 2019 as our baseline comparator, we potentially run the risk of confusing normal seasonal variation in immunisation uptake with the impact of lockdown measures. Ideally, direct weekly or monthly comparisons would be made between 2019 and 2020, however quarterly trends published for previous years including 2019 do not show major difference in uptake throughout the year and in...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.19.21260661: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: The University of California San Diego Institutional Review Board approved the study, and women provided oral and written informed consent prior to use of their breast milk samples in the analyses described above.<br>Consent: Study Approval: The University of California San Diego Institutional Review Board approved the study, and women provided oral and written informed consent prior to use of their breast milk samples in the analyses described above.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Collection: Breast milk samples and clinical information were obtained from women participating in the Mommy’s Milk Human Milk Biorepository at the University of California, San Diego.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus Panel 2 multiplex electrochemiluminescence (ECLIA) serology kits were purchased from Meso Scale Discovery (Rockville, MD) to measure Immunoglobulin A and G (IgA and IgG) antibodies against four antigens related to SARS-CoV-2 in whole breast milk samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated with 150 µL of 1x detection antibody solution containing SULFO-TAG anti-human IgA or IgG prepared with Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical variables were associated with SARS-CoV-2-specific IgA antibodies using multivariable linear mixed effects regression (LMER) to model antibody responses to each individual SARS-CoV-2 protein or fragment with random intercepts at the subject level to adjust for repeated measures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein microarray analysis of breast milk samples: The first generation multi-coronavirus protein microarray, produced by Antigen Discovery, Inc. (ADI, Irvine, CA, USA), included 935 full-length coronavirus proteins, overlapping 100, 50 and 30 aa protein fragments and overlapping 13-20 aa peptides from SARS-CoV-2 (WA-1), SARS-CoV, MERS-CoV, HCoV-NL63 and HCoV-OC43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 and SARS-CoV S proteins were made in Sf9 insect cells and the SARS-CoV-2 RBD, made in HEK-293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization was performed using the circlize, ComplexHeatmap and ggplot2 packages in R (23, 24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study had several limitations as well as strengths. The collection of breast milk samples were not directly observed and samples were collected with nonstandard sampling time points. Therefore, the breast milk samples collected at the onset of symptoms may not reflect duration of exposure to SARS-CoV-2, which may be attributed for the differences observed in IgA kinetics. We also relied on the maternal report of SARS-CoV-2 test results, symptoms and treatments received, however, all participants completed a semi-structured interview guided by trained study staff who prompted for specifics with the aid of a calendar. Another limitation in our study was lack of reactivity to the S1 protein and its fragments produced in vitro using an E. coli based reaction mixture. This was likely due to the lack of eukaryotic post-translational modifications, including N-linked glycosylation which is abundant in S1. We compensated for this by including purified S protein and RBD in the array and by assaying purified S, RBD and the NTD of S by electro-chemiluminescent immunoassay (ECLIA). The added value of this study comes from the longitudinal assessment of milk antibody levels and the breadth of antigens covered by the protein microarray and ECLIA platforms, coupled with COVID-19 patient cases with unique profiles.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260840: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260889: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260892: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.453232: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: The gene sequences encoding the SARS-CoV-2 (NC_045512.2) nucleocapsid protein N-terminal domain (N-NTD; residues 44–180) and the N-NTD containing the C-terminal SR-rich motif (N-NTD-SR; residues 44–212) were codon-optimized, synthesized, and subcloned into pET28a by GenScript (Piscataway, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a</div><div>suggested: RRID:Addgene_114156)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pET28a-N-NTD and pET28a-N-NTD-SR were transformed into Escherichia coli BL21 (DE3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a-N-NTD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET28a-N-NTD-SR</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Kd values were calculated from the fitting process by nonlinear least-squares optimization using Levenberg–Marquardt interactions in the software OriginPro 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OriginPro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tool g_cluster of GROMACS package (40) was used to perform a cluster analysis in the 2.0 μs MD trajectories of the N-NTD:DNA complexes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural representations of the constructed models were displayed using PyMOL (42).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The working concentration of the fluorescent dye DAPI (BioRad, #135-1303, stock in Milli-Q water) was 0.25 μg/mL and the emission recorded using a LED light fluorescent cube (excitation centered at 357/44 and emission at 447/60 nm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRad</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All quantification and image processing steps were performed in Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with GraphPad Prism (version 8.1.1; GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with GraphPad Prism (version 8.1.1; GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 48, 50, 51 and 47. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.22.453345: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene expression level quantification: TPM (Transcripts Per Million) was used to represent ADAR1 and MDA5 (IFIH1 gene) expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cleaned reads were mapped to the reference sequence using BWA (36) aln (bwa aln -t 20) and mem (bwa mem -M -t 20 -k 50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we inspected all editing positions using samtools for editing level quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were mapped to the human reference genome GRCh38 using Hisat2 (Version 2.0.4) (38) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hisat2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, StringTie (Version v1.3.0) (39) was used to calculate the TPM values with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StringTie</div><div>suggested: (StringTie , RRID:SCR_016323)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the effects of RNA editing on spike protein, spike-ACE2, and spike-mAbs stability, all recoding sites in spike protein were used as the input mutation list, and impacts of single mutations on protein or protein complex stability were calculated by MAESTRO (40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAESTRO</div><div>suggested: (Maestro, RRID:SCR_016748)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure visualization and variant annotation were performed with PyMOL (http://www.pymol.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Motif logos were plotted with WebLogo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.452479: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.07.21.453304: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Use of such donor tissue for research was approved by the ethical committee of the Medical faculty of the University Duisburg-Essen (ID: 19-8717-BO).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were excised from the insert and cut into 4 pieces that were incubated overnight at 4°C with specific antibodies at the following dilutions: rabbit anti-SARS-CoV-2 N antibody (JUC3,1:500, (46)), mouse anti-MUC5AC antibody (1:200; Thermo Fisher Scientific), mouse anti-acetylated α-tubulin (1/100; Sigma Aldrich) or goat anti-FOXJ1 antibody (1:200; R&D, Minneapolis, MN, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MUC5AC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FOXJ1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, membranes were incubated with corresponding secondary antibodies: donkey anti-rabbit, donkey anti-mouse or donkey anti-goat Alexa-fluor antibodies (all diluted 1:200, Thermo Fisher Scientific) and 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma-Aldrich) in the dark for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# 18-8816-33, RRID:AB_469529)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Thermo Fisher Scientific Cat# 18-8814-33, RRID:AB_469527)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells (master stock MM-3 from dept of Medical Microbiology collection, characterized by full genome sequencing) were maintained in Dulbecco’s modified Eagle’s medium with 4.5 g/l glucose with L-Glutamin (DMEM; Lonza), supplemented with 8% fetal calf serum (FBS; CapriCorn Scientific) and 100 U/ml of penicillin/streptomycin (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, there are also some limitations in this study, like the sources of cells. PBEC were derived from tumor-free resected bronchial tissue from (ex-)smoking non-COPD patients with lung cancer, and PTEC were from lung donors without lung disease, which may have affected the comparison between PBEC and PTEC. In summary, we show that culture time of airway epithelial cells at the air-liquid interface is a determinant of their susceptibility to SARS-CoV-2 infection, which can only be partly explained by differentiation status based on the amount of ciliated and goblet cells. Differences in expression of entry-associated factors, like ACE2 or TMPRSS2 do not explain the increased susceptibility of airway epithelial cell cultures upon prolonged culture. Our observation that IL-13 treatment causes a limited increase in SARS-CoV-2 infection may be relevant for understanding the impact of type 2 allergic inflammation on SARS-CoV-2 susceptibility. Decreased infection following prolonged inhibition of Notch signaling by DAPT highlights the importance of the presence of both ciliated and goblet cells and warrants further investigation. Ultimately, cellular maturation/differentiation seems intertwined with virus load and spread of the infection over the culture. The proposed cell culture set-up provides a robust tool to test antiviral compounds and acquire additional insight into infection biology of SARS-CoV-2.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 34. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.20.21260849: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: ETHICS STATEMENT: This study was approved by the Ethics committee of Davita in Portugal in compliance with the Declaration of Helsinki, and follows international and national guidelines for health data protection.<br>Consent: All participants provided informed consent to take part in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">An age-matched control cohort without kidney disease comprised 143 individuals randomly selected from a larger cohort of 1245 Health care workers and 146 nursing home residents (8).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ANTIBODY MEASUREMENTS: The ELISA assay used to quantify IgG, IgM and IgA anti-full-length SARSCoV2 spike was adapted from (9) and semi-automized in a 384-well format, according to a protocol to be detailed elsewhere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-full-length</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies against SARS-Cov-2 N antigen were measured by an electrochemiluminescence immunoassay (ECLIA), from Roche Diagnostics (Elecsys® Anti-SARS-CoV-2) and total IgG, IgM and IgA at t2 were quantified using three immunoturbidimetric methods (PEG enhanced) from Siemens Healthineers, using Siemens Atellica CH Analyzer, following manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-Cov-2 N antigen</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-Cov-2 N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>total IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ANTIBODY MEASUREMENTS: The ELISA assay used to quantify IgG, IgM and IgA anti-full-length SARSCoV2 spike was adapted from (9) and semi-automized in a 384-well format, according to a protocol to be detailed elsewhere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ANTIBODY</div><div>suggested: (Antibodypedia, RRID:SCR_012782)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260756: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This has been implemented in Excel, as it is a convenient tool for most occupational health departments and requires no further installation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.07.21.21260906: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The app and CSS were approved in the UK by KCL’s ethics committee (REMAS no. 18210, review reference LRS-19/20–18210).<br>Consent: All app users provided informed consent for use of their data for COVID-19 research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five folds were used on the training set, composed of 80% of the initial dataset randomly selected, to train the models in different subsamples of the population.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-