Reviewer #2 (Public review):

This manuscript describes a detailed model of bats flying together through a fixed geometry. The model considers elements that are faithful to both bat biosonar production and reception and the acoustics governing how sound moves in the air and interacts with obstacles. The model also incorporates behavioral patterns observed in bats, like one-dimensional feature following and temporal integration of cognitive maps. From a simulation study of the model and comparison of the results with the literature, the authors gain insight into how often bats may experience destructive interference of their acoustic signals and those of their peers, and how much such interference may actually negatively affect the groups' ability to navigate effectively. The authors use generalized linear models to test the significance of the effects they observe.

In terms of its strengths, the work relies on a thoughtful and detailed model that faithfully incorporates salient features, such as acoustic elements like the filter for a biological receiver and temporal aggregation as a kind of memory in the system. At the same time, the authors' abstract features are complicating without being expected to give additional insights, as can be seen in the choice of a two-dimensional rather than three-dimensional system. I thought that the level of abstraction in the model was perfect, enough to demonstrate their results without needless details. The results are compelling and interesting, and the authors do a great job discussing them in the context of the biological literature.

The most notable weakness I found in this work was that some aspects of the model were not entirely clear to me. For example, the directionality of the bat's sonar call in relation to its velocity. Are these the same? If so, what is the difference between phi_target and phi_tx in the model equations? What is a bat's response to colliding with a conspecific (rather than a wall)? From the statistical side, it was not clear if replicate simulations were performed. If they were, which I believe is the right way due to stochasticity in the model, how many replicates were used, and are the standard errors referred to throughout the paper between individuals in the same simulation or between independent simulations, or both?

Overall, I found these weaknesses to be superficial and easily remedied by the authors. The authors presented well-reasoned arguments that were supported by their results, and which were used to demonstrate how call interference impacts the collective's roost exit as measured by several variables. As the authors highlight, I think this work is valuable to individuals interested in bat biology and behavior, as well as to applications in engineered multi-agent systems like robotic swarms.

Reviewer #3 (Public review):

Summary:

The authors describe a model to mimic bat echolocation behavior and flight under high-density conditions and conclude that the problem of acoustic jamming is less severe than previously thought, conflating the success of their simulations (as described in the manuscript) with hard evidence for what real bats are actually doing. The authors base their model on two species of bats that fly at "high densities" (defined by the authors as colony sizes from tens to tens of thousands of individuals and densities of up to 33.3 bats/m2), Pipistrellus kuhli and Rhinopoma microphyllum. This work fits into the broader discussion of bat sensorimotor strategies during collective flight, and simulations are important to try to understand bat behavior, especially given a lack of empirical data. However, I have major concerns about the assumptions of the parameters used for the simulation, which significantly impact both the results of the simulation and the conclusions that can be made from the data. These details are elaborated upon below, along with key recommendations the authors should consider to guide the refinement of the model.

Strengths:

This paper carries out a simulation of bat behavior in dense swarms as a way to explain how jamming does not pose a problem in dense groups. Simulations are important when we lack empirical data. The simulation aims to model two different species with different echolocation signals, which is very important when trying to model echolocation behavior. The analyses are fairly systematic in testing all ranges of parameters used and discussing the differential results.

Weaknesses:

The justification for how the different foraging phase call types were chosen for different object detection distances in the simulation is unclear. Do these distances match those recorded from empirical studies, and if so, are they identical for both species used in the simulation? What reasoning do the authors have for a bat using the same call characteristics to detect a cave wall as they would for detecting a small insect? Additionally, details on the signal creation are also absent, but based on the sample spectrogram in Figure 2A, it appears that the authors used a synthetic linear FM chirp characterized by the call parameters. This simplification of the echolocation signals for these species is not representative of the true emitted signals, which are nonlinear FM for not only the species used within this simulation--PK (Schnitzler et al., 1987; Kalko and Schnitzler 1993 and RM (Schmidt and Joermann 1986)-but also for many other bat species that form large aggregations and undergo dense emergence. Furthermore, echolocation calls of bats emitted during dense emergence flights (see Gillam et al 2010) can be very much different from those emitted during foraging calls, so limiting the simulation to foraging calls may not be valid. Why did the authors not use actual waveforms of calls produced by these species during dense emergence to use biologically relevant signals in their simulation?

The two species modeled have different calls. In particular, the bandwidth varies by a factor of 10, meaning the species' sonars will have different spatial resolutions. Range resolution is about 10x better for PK compared to RM, but the authors appear to use the same thresholds for "correct detection" for both, which doesn't seem appropriate. Also, the authors did not mention incorporating/correcting for/exploiting Doppler, which leads me to assume they did not model it.

The success of the simulation may very well be due to variation in the calls of the bats, which ironically enough demonstrates the importance of a jamming avoidance response in dense flight. This explains why the performance of the simulation falls when bats are not able to distinguish their own echoes from other signals. For example, in Figure C2, there are calls that are labeled as conspecific calls and have markedly shorter durations and wider bandwidths than others. These three phases for call types used by the authors may be responsible for some (or most) of the performance of the model since the correlation between different call types is unlikely to exceed the detection threshold. But it turns out this variation in and of itself is what a jamming avoidance response may consist of. So, in essence, the authors are incorporating a jamming avoidance response into their simulation.

The authors claim that integration over multiple pings (though I was not able to determine the specifics of this integration algorithm) reduces the masking problem. Indeed, it should: if you have two chances at detection, you've effectively increased your SNR by 3dB.

They also claim - although it is almost an afterthought - that integration dramatically reduces the degradation caused by false echoes. This also makes sense: from one ping to the next, the bat's own echo delays will correlate extremely well with the bat's flight path. Echo delays due to conspecifics will jump around kind of randomly. However, the main concern is regarding the time interval and number of pings of the integration, especially in the context of the bat's flight speed. The authors say that a 1s integration interval (5-10 pings) dramatically reduces jamming probability and echo confusion. This number of pings isn't very high, and it occurs over a time interval during which the bat has moved 5-10m. This distance is large compared to the 0.4m distance-to-obstacle that triggers an evasive maneuver from the bat, so integration should produce a latency in navigation that significantly hinders the ability to avoid obstacles. Can the authors provide statistics that describe this latency, and discussion about why it doesn't seem to be a problem?

The authors are using a 2D simulation, but this very much simplifies the challenge of a 3D navigation task, and there is an explanation as to why this is appropriate. Bat densities and bat behavior are discussed per unit area when realistically it should be per unit volume. In fact, the authors reference studies to justify the densities used in the simulation, but these studies were done in a 3D world. If the authors have justification for why it is realistic to model a 3D world in a 2D simulation, I encourage them to provide references justifying this approach.

The focus on "masking" (which appears to be just in-band noise), especially relative to the problem of misassigned echoes, is concerning. If the bat calls are all the same waveform (downsweep linear FM of some duration, I assume - it's not clear from the text), false echoes would be a major problem. Masking, as the authors define it, just reduces SNR. This reduction is something like sqrt(N), where N is the number of conspecifics whose echoes are audible to the bat, so this allows the detection threshold to be set lower, increasing the probability that a bat's echo will exceed a detection threshold. False echoes present a very different problem. They do not reduce SNR per se, but rather they cause spurious threshold excursions (N of them!) that the bat cannot help but interpret as obstacle detection. I would argue that in dense groups the mis-assignment problem is much more important than the SNR problem.

The criteria set for flight behavior (lines 393-406) are not justified with any empirical evidence of the flight behavior of wild bats in collective flight. How did the authors determine the avoidance distances? Also, what is the justification for the time limit of 15 seconds to emerge from the opening? Instead of an exit probability, why not instead use a time criterion, similar to "How long does it take X% of bats to exit?" What is the empirical justification for the 1-10 calls used for integration? The "average exit time for 40 bats" is also confusing and not well explained. Was this determined empirically? From the simulation? If the latter, what are the conditions? Does it include masking, no masking, or which species?

Reviewer #1 (Public review):

Summary:

The authors revisit the specific domains/signals required for the redirection of an inner nuclear membrane protein, emerin, to the secretory pathway. They find that epitope tagging influences protein fate, serving as a cautionary tale for how different visualisation methods are used. Multiple tags and lines of evidence are used, providing solid evidence for the altered fate of different constructs.

Strengths:

This is a thorough dissection of domains and properties that confer INM retention vs secretion to the PM/lysosome, and will serve the community well as a caution regarding the placement of tags and how this influences protein fate.

Weaknesses:

Biogenesis pathways are not explored experimentally: it would be interesting to know if the lysosomal pool arrives there via the secretory pathway (eg by engineering a glycosylation site into the lumenal domain) or by autophagy, where failed insertion products may accumulate in the cytoplasm and be degraded directly from cytoplasmic inclusions.

It would be helpful if the topology of constructs could be directly demonstrated by pulse-labelling and protease protection. It's possible that there are mixed pools of both topologies that might complicate interpretation.

Reviewer #2 (Public review):

In this manuscript, Mella et al. investigate the effect of GFP tagging on the localization and stability of the nuclear-localized tail-anchored (TA) protein Emerin. A previous study from this group showed that C-terminally GFP-tagged Emerin protein traffics to the plasma membrane and reaches lysosomes for degradation. It is suggested that the C-terminal tagging of tail-anchored proteins shifts their insertion from the post-translational TRC/GET pathway to the co-translational SRP-mediated pathway. The authors of this paper found that C-terminal GFP tagging causes Emerin to localize to the plasma membrane and eventually reach lysosomes. They investigated the mechanism by which Emerin-GFP moves to the secretory pathway. By manipulating the cytosolic domain and the hydrophobicity of the transmembrane domain (TMD), the authors identify that an ER retention sequence and strong TMD hydrophobicity contribute to Emerin trafficking to the secretory pathway. Overall, the data are solid, and the knowledge will be useful to the field. However, the authors do not fully answer the question of why C-terminally GFP-tagged Emerin moves to the secretory pathway. Importantly, the authors did not consider the possible roles of GFP in the ER lumen influencing Emerin trafficking to the secretory pathway.

Reviewer #1 (Public review):

Summary:

García-Vázquez et al. identify GTSE1 as a novel target of the cyclin D1-CDK4/6 kinases. The authors show that GTSE1 is phosphorylated at four distinct serine residues and that this phosphorylation stabilizes GTSE1 protein levels to promote proliferation. This regulatory link appears to be particularly important in pathological conditions such as cancer, where cyclin D levels are elevated.

Strengths:

The authors support their findings with several previously published results, including databases. In addition, the authors perform a wide range of experiments to support their findings.

Impact:

The authors reveal a mechanism by which elevated levels of cyclin D1-CDK4 can stabilize GTSE1 throughout the cell cycle via phosphorylation. This provides insight into the role of cyclin D1-CDK4 in regulating the cell cycle and promoting cancer growth.

Comments on revisions:

The authors have addressed all my concerns, and I would like to thank them for their efforts on this great study.

Reviewer #2 (Public review):

Summary:

The manuscript by García-Vázquez et al identifies the G2 and S phases expressed protein 1(GTSE1) as a substrate of the CycD-CDK4/6 complex. CycD-CDK4/6 is a key regulator of the G1/S cell cycle restriction point, which commits cells to enter a new cell cycle. This kinase is also an important therapeutic cancer target by approved drugs including Palbocyclib. Identification of substrates of CycD-CDK4/6 can therefore provide insights into cell cycle regulation and the mechanism of action of cancer therapeutics. A previous study identified GTSE1 as a target of CycB-Cdk1 but this appears to be the first study to address the phosphorylation of the protein by Cdk4/6.

The authors identified GTSE1 by mining an existing proteomic dataset that are elevated in AMBRA1 knockout cells. The AMBRA1 complex normally targets D cyclins for degradation. From this list they then identified proteins that contain a CDK4/6 consensus phosphorylation site and were responsive to treatment with Palbocyclib.

The authors show CycD-CDK4/6 overexpression induces a shift in GTSE1 on phostag gels that can be reversed by Palbocyclib. In vitro kinase assays also showed phosphorylation by CDK4. The phosphorylation sites were then identified by mutagenizing the predicted sites and phostag gets to see which eliminated the shift.

The authors go on to show that phosphorylation of GTSE1 affects the steady state level of the protein. Moreover, they show that expression and phosphorylation of GTSE1 confer growth advantage on tumor cells and correlate with poor prognosis in patients.

Strengths:

The biochemical and mutagenesis evidence presented convincingly show that the GTSE1 protein is indeed a target of the CycD-CDK4 kinase. The follow-up experiments begin to show that the phosphorylation state of the protein affect function and have an impact on patient outcome.

Weaknesses:

It is not clear at which stage in the cell cycle GTSE1 is being phosphorylated and how this is affecting the cell cycle. Considering that the protein is also phosphorylated during mitosis by CycB-Cdk1, it is unclear which phosphorylation events may be regulating the protein.

Additional comments for the revised manuscript

The authors have made many modifications to the manuscript in response to the reviewer comments, including the addition of new data that have clarified some of the conclusions. Some of the questions regarding the phase of the cell cycle affected have been addressed with flow cytometry.

There is one issue raised in the first review that can be better addressed. As the authors mentioned in their rebuttal letter, all the reviewers and editor concluded from the original manuscript that GTSE1 was being proposed as a physiological target of CycD-Cdk4 even in non-transformed cells. The authors believe that GTSE1 is likely only a target in cancerous cells that overexpress CycD and have made alterations in the abstract and main text making this point more clear.

Some additional evidence that GTSE1 phosphorylation is occurring in CycD overexpressing tumor cells would strengthen this argument beyond the overexpression experiments presented in the manuscript. For example, in Supplemental Fig 4A of the revised manuscript, bubble plots from CPTAC data is used to show that total protein levels of GTSE1 correlate with proteins associated with proliferation and metastasis. Do levels of GTSE1 correlate with CycD in this data set?

Reviewer #3 (Public review):

Summary:

This paper identifies GTSE1 as a substrate of cyclin D1-CDK4/6 complexes when cyclin D1 is significantly over-expressed (as is common in cancers) rather than its endogenous level. GTSE is stabilized by phosphorylation and GTSE1 correlates with cancer prognosis, probably through an effect on cell proliferation.

Strengths:

There are few bonafide cyclin D1-Cdk4/6 substrates identified to be important in vivo so GTSE1 represents a potentially important finding for the field. Currently, the only cyclin D1 substrates involved in proliferation are the Rb family proteins.

Weaknesses:

GTSE1 is not a 'normal' target of cyclin D1-Cdk4/6, but rather only a target in a pathological situation.

Reviewer #1 (Public review):

Summary:

In this paper, the authors have leveraged Single-cell RNA sequencing of the various stages of evolution of lung adenocarcinoma to identify the population of macrophages that contribute to tumor progression. They show that S100a4+ alveolar macrophages, active in fatty acid metabolic activity, such as palmitic acid metabolism, seem to drive atypical adenomatous hyperplasia (AAH) stage. These macrophages also seem to induce angiogenesis promoting tumor growth. Similar types of macrophage infiltration were demonstrated in the progression of the human lung adenocarcinomas.

Comments on revised version:

The authors have satisfactorily addressed my main concerns.

The only weakness is that infusion of S100a4+ macrophages seem not to affect tumor growth when introduced to the intratracheal route. This negative result somewhat diminishes the significance of the study.

Overall, the revised manuscript is significantly improved.

Reviewer #2 (Public review):

Summary:

The work aims to further understand the role of macrophages in lung precancer/lung cancer evolution

Strengths:

(1) The use of single-cell RNA seq to provide comprehensive characterisation.

(2) Characterisation of cross-talk between macrophages and the lung precancerous cells.

(3) Functional validation of the effects of S100a4+ cells on lung precancerous cells using in vitro assays.

(4) Validation in human tissue samples of lung precancer / invasive lesions.

Weaknesses identified previously:

(1) The authors need to provide clarification of several points in the text.

(2) The authors need to carefully assess their assumptions regarding the role of macrophages in angiogenesis in precancerous lesions.

(3) The authors should discuss more broadly the current state of anti-macrophage therapies in the clinic.

Comments on revised version:

The authors have adequately addressed all of my comments.

Reviewer #1 (Public review):

Summary:

The study combines predictions from MD simulations with sophisticated experimental approaches including native mass spectrometry (nMS), cryo-EM, and thermal protein stability assays to investigate the molecular determinants of cardiolipin (CDL) binding and binding-induced protein stability/function of an engineered model protein (ROCKET), as well as of the native E. coli intramembrane rhomboid protease, GlpG.

Strengths:

State-of-the-art approaches and sharply focused experimental investigation lend credence to the conclusions drawn. Stable CDL binding is accommodated by a largely degenerate protein fold that combines interactions from distant basic residues with greater intercalation of the lipid within the protein structure. Surprisingly, there appears to be no direct correlation between binding affinity/occupancy and protein stability.

Overall, using both model and native protein systems, this study convincingly underscores the molecular and structural requirements for CDL binding and binding-induced membrane protein stability. This work provides much-needed insight into the poorly understood nature of protein-CDL interactions.

Reviewer #3 (Public review):

Summary:

The relationships of proteins and lipids: it's complicated. This paper illustrates how cardiolipins can stabilize membrane protein subunits - and not surprisingly, positively charged residues play an important role here. But more and stronger binding of such structural lipids does not necessarily translate to stabilization of oligomeric states, since many proteins have alternative binding sites for lipids which may be intra- rather than intermolecular. Mutations which abolish primary binding sites can cause redistribution to (weaker) secondary sites which nevertheless stabilize interactions between subunits. This may be at first sight counterintuitive but actually matches expectations from structural data and MD modelling. An analogous cardiolipin binding site between subunits is found in E.coli tetrameric GlpG, with cardiolipin (thermally) stabilizing the protein against aggregation.

Strengths:

The use of the artificial scaffold allows testing of hypothesis about the different roles of cardiolipin binding. It reveals effects which are at first sight counterintuitive and are explained by the existence of a weaker, secondary binding site which unlike the primary one allows easy lipid-mediated interaction between two subunits of the protein. Introducing different mutations either changes the balance between primary and secondary binding sites or introduced a kink in a helix - thus affecting subunit interactions which are experimentally verified by native mass spectrometry.

[Editors' note: The reviewers agreed that the authors addressed all reviewer comments adequately and rigorously.]

In Ihrem Global Energy Review 2025 steht die EAA einen re Commissionen zuwachs im Verbrauch und Produktion von Elektrozytet fest. Dieser Zufachs geht allerdings nur in ganz kleinen Teilen auf den Ersatzforsilerenergien zurück und ist im Wesentlichen durch zunehmenden Energieverbrauch bedingt, z.B. durch Datencenter. Durch diesen Zuwachs steigt der Verbrauch, steigt der Bedarf an bestimmten Mitte um Mineralien ebenfalls sprunghaft an. Der Chef der Ehea geht davon aus, dass um 20-30 Gruppen verknab werden wird. Der Kommentar der Tat weiß deshalb darauf hin, dass die Dekabonisierung durch den Umstieg auf erneuerbare Energien ohne Reduzierung des Verbrauchs nicht gelingen wird. https://taz.de/Die-Tuecken-der-Energiewende/!6074719/

Reviewer #1 (Public review):

Summary:

Fernandez et al. investigate the influence of maternal behavior on bat pup vocal development in Saccopteryx bilineata, a species known to exhibit vocal production learning. The authors performed detailed longitudinal observations of wild mother-pup interactions to ask whether non-vocal maternal displays during juvenile vocal practice, or 'babbling', affect vocal production. Specifically, the study examines the durations of pup babbling events and the developmental babbling phase, in relation to female display rates, as well as pup age and the number of nearby singing adult males. Furthermore, the authors examine pup vocal repertoire size and maturation in relation to maternal display rates encountered during babbling. Statistical models identify female display behavior as a predictor of i) babbling bout duration, ii) the length of the babbling phase, iii) song composition and iv) syllable maturation. Notably, these outcomes were not influenced by the number of nearby adult males (the pups' source of song models) and were largely independent of general maturation (pup age). These findings highlight the impact of non-vocal aspects of social interactions in guiding mammalian vocal development.

Strengths:

Historically, work on developmental vocal learning has focused on how juvenile vocalizations are influenced by the sounds produced by nearby adults (often males). In contrast, this study takes the novel approach of examining juvenile vocal ontogeny in relation to non-vocal maternal behavior, in one of the few mammals known to exhibit vocal production learning. The authors collected an impressive dataset from multiple wild bat colonies in two Central American countries. This includes longitudinal acoustic recordings and behavioral monitoring of individual mother-pup pairs, across development.

The identified relationships between maternal behavior and bat pup vocalizations have intriguing implications for understanding the mechanisms that enable vocal production learning in mammals, including human speech acquisition. As such, these findings are likely be relevant to a broad audience interested in the evolution and development of social behavior as well as sensory-motor learning.

Weaknesses:

The authors qualitatively describe specific patterns of female displays during pup babbling, however, subsequent quantitative analyses are based on aggregate measures of female behavior that pool across display types. Consequently, it remains unclear how certain maternal behaviors might differentially influence pup vocalizations (e.g. through specific feedback contingencies or more general modulation of pup behavioral states).

Comments on revisions:

(1) More detailed analyses of female behavior may be beyond the scope of this study, given the nature of the dataset/recordings. I look forward to the authors' future work on this aspect.

By addressing the important distinction between display number vs. display rate, the authors have provided more direct support for the claim that babbling behavior is related to female displays.

(2) The additional information regarding exposure to adult male song is appreciated.

(3) Added discussion of pup sex differences provides useful context and intriguing speculation about the role of female pup babbling.

(4) The authors' additions have significantly improved the clarity of their acoustic terminology and syllable analyses.

Reviewer #1 (Public review):

Du et al. address the cell cycle-dependent clearance of misfolded protein aggregates mediated by the endoplasmic reticulum (ER) associated Hsp70 chaperone family and ER reorganisation. The observations are interesting and impactful to the field.

Strength:

The manuscript addresses the connection between the clearance of misfolded protein aggregates and the cell cycle using a proteostasis reporter targeted to ER in multiple cell lines. Through imaging and some biochemical assays, they establish the role of BiP, an Hsp70 family chaperone, and Cdk1 inactivation in aggregate clearance upon mitotic exit. Furthermore, the authors present an initial analysis of the role of ER reorganisation in this clearance. These are important correlations and could have implications for ageing-associated pathologies. Overall, the results are convincing and impactful to the field.

Weakness:

The manuscript still lacks a mechanistic understanding of aggregate clearance. Even though the authors have provided the role of different cellular components, such as BiP, Cdk1 and ATL2/3 through specific inhibitors, at least an outline establishing the sequence of events leading to clearance is missing. Moreover, the authors show that the levels of ER-FlucDM-eGFP do not change significantly throughout the cell cycle, indicating that protein degradation is not in play. Therefore, addressing/elaborating on the mechanism of disassembly can add value to the work. Also, the physiological relevance of aggregate clearance upon mitotic exit has not been tested, nor have the cellular targets of this mode of clearance been identified or discussed.

Reviewer #2 (Public review):

This paper describes an interesting observation that ER-targeted misfolded proteins are trapped within vesicles inside nucleus to facilitate quality control during cell division. This work supports the concept that transient sequestration of misfolded proteins is a fundamental mechanism of protein quality control. The authors satisfactorily addressed several points asked in the review of first submission. The manuscript is improved but still unable to fully address the mechanisms.

Strengths:

The observations in this manuscript are very interesting and open up many questions on proteostasis biology.

Weaknesses:

Despite inclusions of several protein-level experiments, the manuscript remained a microscopy-driven work and missed the opportunity to work out the mechanisms behind the observations.

Reviewer #3 (Public review):

This paper describes a new mechanism for the clearance of protein aggregates associated to endoplasmic reticulum re-organization that occurs during mitosis.

Experimental data showing clearance of protein aggregates during mitosis is solid, statistically significant, and very interesting. The authors made several new experiments included in the revised version to address the concerns raised by reviewers. A new proteomic analysis, co-localization of the aggregates with the ER membrane Sec61beta protein, expression of the aggregate-prone protein in the nucleus does not result in accumulation of aggregates, detection of protein aggregates in the insoluble faction after cell disruption and mostly importantly knockdown of ATL proteins involved in the organization of ER shape and structure impaired the clearance mechanism. This last observation addresses one of the weakest points of the original version which was the lack of experimental correlation between ER structure capability to re-shape and the clearance mechanism.

In conclusion, this new mechanism of protein aggregate clearance from the ER was not completely understood in this work but the manuscript presented, particularly in the revised version, an ensemble of solid observations and mechanistic information to scaffold future studies that clarify more details of this mechanism. As stated by the authors: "How protein aggregates are targeted and assembled into the intranuclear membranous structure waits for future investigation". This new mechanism of aggregate clearance from the ER is not expected to be fully understood in a single work but this paper may constitute one step to better comprehend the cell capability to resolve protein aggregates in different cell compartments.

Reviewer #1 (Public review):

Summary:

The authors investigate the neuroprotective effect of reserpine in a retinitis pigmentosa (P23H-1) model, characterized by a mutation in the rhodopsin gene. Their results reveal that female rats show better preservation of both rod and cone photoreceptors following reserpine treatment compared to males.

Strengths:

This study effectively highlights the neuroprotective potential of reserpine and underscores the value of drug repositioning as a strategy for accelerating the development of effective treatments. The findings are significant for their clinical implications, particularly in demonstrating sex-specific differences in therapeutic response.

Weaknesses:

The main limitation is the lack of precise identification of the specific pathway through which reserpine prevents photoreceptor death.

Comments on revisions:

Thank you for your thorough revisions. I appreciate the effort you have put into addressing all the concerns I previously raised. Upon reviewing your responses and the updated manuscript, I find that you have adequately clarified the issues and incorporated the necessary modifications. Your revisions have strengthened the paper, and I have no further concerns at this stage.

Reviewer #3 (Public review):

Summary:

Golamalamdari, van Schaik, Wang, Kumar Zhang, Zhang and colleagues study interactions between the speckle, nucleolus and lamina in multiple cell types (K562, H1, HCT116 and HFF). Their datasets define how interactions between the genome and the different nuclear landmarks relate to each other and change across cell types. They also identify how these relationships change in K562 cells in which LBR and LMNA are knocked out.

Strengths:

Overall, there are a number of datasets that are provided, and several "integrative" analyses performed. This is a major strength of the paper, and I imagine the datasets will be of use to the community to further probed and the relationships elucidated here further studied. An especially interesting result was that specific genomic regions (relative to their association with the speckle, lamina, and other molecular characteristics) segregate relative to the equatorial plane of the cell.

Weaknesses:

The experiments are primarily descriptive, and the cause-and-effect relationships are limited (though the authors do study the role of LMNA/LBR knockdown with their technologies).

Comments on revisions:

I have no additional comments. I appreciate the authors responding to my previous comments. I anticipate the datasets and concepts raised will be helpful to many investigators in the field.

Reviewer #1 (Public review):

Gray and colleagues describe the identification of Integrator complex subunit 12 (INTS12) as a contributor to HIV latency in two different cell lines and in cells isolated from the blood of people living with HIV. The authors employed a high-throughput CRISPR screening strategy to knock down genes and assess their relevance in maintaining HIV latency. They had used a similar approach in two previous studies, finding genes required for latency reactivation or genes preventing it and whose knockdown could enhance the latency-reactivating effect of the NFκB activator AZD5582. This work builds on the latter approach by testing the ability of gene knockdowns to complement the latency-reactivating effects of AZD5582 in combination with the BET inhibitor I-BET151. This drug combination was selected because it has been previously shown to display synergistic effects on latency reactivation.

The finding that INTS12 may play a role in HIV latency is novel, and the effect of its knock down in inducing HIV transcription in primary cells, albeit in only a subset of donors, is intriguing.

In this revised version, the authors have included new data and clarifications which help strengthen their conclusions.

Reviewer #2 (Public review):

Summary:

Identifying an important role for Integrator complex in repressing HIV transcription and suggesting that by targeting subunits of this complex specifically, INTS12, reversal of latency with and without latency reversal agents can be enhanced.

Strengths:

The strengths of the paper include the general strategy for screening targets that may activate HIV latency and the rigor of exploring the mechanism of INTS12 repression of HIV transcriptional elongation.

Weaknesses:

Minor point-there was an opportunity to examine a larger panel of latency reversal agents that reactivate by different mechanisms to determine whether INTS12 and transcriptional elongation are limiting for a broad spectrum of latency reversal agents.

Comments on revisions:

I feel the authors have adequately addressed the original questions and concerns.

Reviewer #3 (Public review):

Summary:

Transcriptionally silent HIV-1 genomes integrated in the host`s genome represent the main obstacle for an HIV-1 cure. Therefore, agents aimed at promoting HIV transcription, the so-called latency reactivating agents (LRAs) might represent useful tools to render these hidden proviruses visible to the immune system. The authors successfully identified, through multiple techniques, INTS12, a component of the Integrator complex involved in 3' processing of small nuclear RNAs U1 and U2, as a factor promoting HIV-1 latency and hindering elongation of the HIV RNA transcripts. This factor hinders the activity of a previously identified combination of LRAs, one of which, AZD5582, has been validated in the macaque model for HIV persistence during therapy (https://pubmed.ncbi.nlm.nih.gov/37783968/). The other compound, I-BET151, is known to synergize with AZD5582, and is a inhibitor of BET, factors counteracting elongation of RNA transcripts.<br /> Therefore, INTS12 maight represent a target for future LRAs-

Strengths:

Findings were confirmed through multiple screens and multiple techniques. The authors successfully mapped the identified HIV silencing factor at the HIV promoter, Silencing of INTS12 increases the activity of small-molecule HIV latency-reversing agents such as the histone deacetylase inhibitor vorinostat. Knockdown of INTS12 does not induce toxic effects in the cells, thus rendering it a candidate a drug discovery campaign aimed at finding new agents for an HIV/AIDS cure.

Weaknesses:

A caveat is that the impact of INTS12 in diverse T cell functions or other in vivo functions is not yet known, but the authors acknowledge this in the revised discussion.

Reviewer #1 (Public review):

Summary:

The study identifies two types of activation: one that is cue-triggered and non-specific to motion directions, and another that is specific to the exposed motion directions but occurs in a reversed manner. The finding that activity in the medial temporal lobe (MTL) preceded that in the visual cortex suggests that the visual cortex may serve as a platform for the manifestation of replay events, which potentially enhance visual sequence learning.

Evaluations:

Identifying the two types of activation after exposure to a sequence of motion directions is very interesting. The experimental design, procedures and analyses are solid. The findings are interesting and novel.

In the original submission, it was not immediately clear to me why the second type of activation was suggested to occur spontaneously. The procedural differences in the analyses that distinguished between the two types of activation need to be a little better clarified. However, this concern has been satisfactorily addressed in the revision.

Reviewer #2 (Public review):

This paper shows and analyzes an interesting phenomenon. It shows that when people are exposed to sequences of moving dots (That is moving dots in one direction, followed by another direction etc.), that showing either the starting movement direction, or ending movement direction causes a coarse-grained brain response that is similar to that elicited by the complete sequence of 4 directions. However, they show by decoding the sensor responses that this brain activity actually does not carry information about the actual sequence and the motion directions, at least not on the time scale of the initial sequence. They also show a reverse reply on a highly-compressed time scale, which is elicited during the period of elevated activity, and activated by the first and last elements of the sequence, but not others. Additionally, these replays seem to occur during periods of cortical ripples, similar to what is found in animal studies.

These results are intriguing. They are based on MEG recordings in humans, and finding such replays in humans is novel. Also, this is based on what seems to be sophisticated statistical analysis. The statistical methodology seems valid, but due to its complexity it is not easy to understand. The methods especially those described in figures 3 and 4 should be explained better.

Reviewer #1 (Public review):

Overall I found the approach taken by the authors to be clear and convincing. It is striking that the conclusions are similar to those obtained in a recent study using a different computational approach (finite state controllers), and lends confidence to the conclusions about the existence of an optimal memory duration. There are a few questions that could be expanded on in future studies:

(1) Spatial encoding requirements

The manuscript contrasts the approach taken here (reinforcement learning in a gridworld) with strategies that involve a "spatial map" such as infotaxis. However, the gridworld navigation algorithm has an implicit allocentric representation, since movement can be in one of four allocentric directions (up, down, left, right), and wind direction is defined in these coordinates. Future studies might ask if an agent can learn the strategy without a known wind direction if it can only go left/right/forward/back/turn (in egocentric coordinates). In discussing possible algorithms, and the features of this one, it might be helpful to distinguish (1) those that rely only on egocentric computations (run and tumble), (2) those that rely on a single direction cue such as wind direction, (3) those that rely on allocentric representations of direction, and (4) those that rely on a full spatial map of the environment.

(2) Recovery strategy on losing the plume

The authors explore several recovery strategies upon losing the plume, including backtracking, circling, and learned strategies, finding that a learned strategy is optimal. As insects show a variety of recovery strategies that can depend on the model of locomotion, it would be interesting in the future to explore under which conditions various recovery strategies are optimal and whether they can predict the strategies of real animals in different environments.

(3) Is there a minimal representation of odor for efficient navigation?

The authors suggest that the number of olfactory states could potentially be reduced to reduce computational cost. They show that reducing the number of olfactory states to 1 dramatically reduces performance. In the future it would be interesting to identify optimal internal representations of odor for navigation and to compare these to those found in real olfactory systems. Does the optimal number of odor and void states depend on the spatial structure of the turbulence as explored in Figure 5?

Reviewer #2 (Public review):

Summary:

The authors investigate the problem of olfactory search in turbulent environments using artificial agents trained using tabular Q-learning, a simple and interpretable reinforcement learning (RL) algorithm. The agents are trained solely on odor stimuli, without access to spatial information or prior knowledge about the odor plume's shape. This approach makes the emergent control strategy more biologically plausible for animals navigating exclusively using olfactory signals. The learned strategies show parallels to observed animal behaviors, such as upwind surging and crosswind casting. The approach generalizes well to different environments and effectively handles the intermittency of turbulent odors.

Strengths:

* The use of numerical simulations to generate realistic turbulent fluid dynamics sets this paper apart from studies that rely on idealized or static plumes.<br /> * A key innovation is the introduction of a small set of interpretable olfactory states based on moving averages of odor intensity and sparsity, coupled with an adaptive temporal memory.<br /> * The paper provides a thorough analysis of different recovery strategies when an agent loses the odor trail, offering insights into the trade-offs between various approaches.<br /> * The authors provide a comprehensive performance analysis of their algorithm across a range of environments and recovery strategies, demonstrating the versatility of the approach.<br /> * Finally, the authors list an interesting set of real-world experiments based on their findings, that might invite interest from experimentalists across multiple species.

Weaknesses:

* Using tabular Q-learning is both a strength and a limitation. It's simple and interpretable, making it easier to analyze the learned strategies, but the discrete action space seems somewhat unnatural. In real-world biological systems, actions (like movement) are continuous rather than discrete. Additionally, the ground-frame actions may not map naturally to how animals navigate odor plumes (e.g. insects often navigate based on their own egocentric frame).

Reviewer #1 (Public review):

Summary:

In this elegant and thorough study, Sánchez-León et al. investigate the effects of tDCS on the firing of single cerebellar neurons in awake and anesthetized mice. They find heterogeneous responses depending on the orientation of the recorded Purkinje cell.

Strengths:

The paper is important in that it may well explain part of the controversial and ambiguous outcomes of various clinical trials. It is a well-written paper on a deeply analyzed dataset.

Weaknesses:

The sample size could be increased for some of the experiments.

Comments on revised version: They have not been able to increase the size of some of the critical experiments, but they have done additional statistics, which make me feel confident that the main conclusions are correct.

Reviewer #2 (Public review):

Summary:

In this study by Sánchez-León and colleagues, the authors attempted to determine the influence of neuronal orientation on the efficacy of cerebellar tDCS in modulating neural activity. To do this, the authors made recordings from Purkinje cells, the primary output neurons of the cerebellar cortex, and determined the inter-dependency between the orientation of these cells and the changes in their firing rate during cerebellar tDCS application.

Strengths:

(1) A major strength is the in vivo nature of this study. Being able to simultaneously record neural activity and apply exogenous electrical current to the brain during both an anesthetized state and during wakefulness in these animals provides important insight into physiological underpinnings of tDCS.<br /> (2) The authors provide evidence that tDCS can modulate neural activity in multiple cell types. For example, there is a similar pattern of modulation in Purkinje cells and non-Purkinje cells (excitatory and inhibitory interneurons). Together, these data provide wholistic insight into how tDCS can affect activity across different populations of cells, which is important implications for basic neuroscience, but also clinical populations where there may be non-uniform or staged effects of neurological disease on these various cell types.<br /> (3) There is systematic investigation into the effects of tDCS on neural activity across multiple regions of the cerebellum. The authors demonstrate that the pattern of modulation is dependent on the target region. These findings have important implications for determining the expected neuromodulatory effects of tDCS when applying this technique over different target regions non-invasively in animals and humans.<br /> (4) The authors provide a thorough background, rationale, and interpretation regarding the expected and observed influence of neuronal orientation on excitability modulation by electrical stimulation.

Reviewer #3 (Public review):

Summary:

In this study, Sanchez-Leon et al. combined extracellular recordings of Purkinje cell activity in awake and anesthesized mice with juxtacellular recordings and Purkinje cell staining to link Purkinje cell orientation to their stimulation response. The authors find a relationship between neuron orientation and firing rate, dependent on stimulation type (anodal/cathodal). They also show effects of stimulation intensity and rebound effects.

Strengths:

Overall, the work is methodologically sound and the manuscript well written. The authors have taken great care to explain their rationale and methodological choices.

Weaknesses:

My only reservation is the lack of reporting of the precise test statistics, p-values and multiple comparison corrections. The work would benefit from adding this and other information.

Reviewer #1 (Public review):

This study provides significant insights into the dynamics of attentional re-orienting within visual working memory, demonstrating how expected and unexpected memory tests influence attention focus and re-focus. The evidence supporting these conclusions is convincing, with the use of appropriate and validated methodologies, including behavioral measures, EEG, and eye tracking, that are in line with current state-of-the-art practices. This work will be of particular interest to cognitive neuroscientists studying attention and memory processes.

Thank you for the detailed revisions. I am pleased to see that the manuscript now effectively addresses every point I raised. The clarification between microsaccades and saccades greatly enhances transparency regarding the eye movement data. The inclusion of time-frequency plots and topographic maps for the working-memory test phase further improves the comprehensiveness of the alpha lateralization results, despite the relative lack of alpha effects at that stage. Moreover, the implementation of the Fractional Area Latency analysis successfully rules out amplitude-related confounds in the saccade bias latency measurements. Finally, the clear reporting of the statistical analyses for significant saccade bias further strengthens the reliability of the findings.

Overall, I appreciate the thorough and thoughtful response, and I believe that all my concerns have been successfully addressed.

Reviewer #2 (Public review):

Summary:

This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during expected test suggests a memory verification process, whereas the prolonged spatial bias during unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

Strengths:

The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

Weaknesses:

The authors addressed the identified weaknesses in a thorough revision during the review process.

Reviewer #3 (Public review):

Summary:

Wang and van Ede investigate whether and how attention re-orients within visual working memory following expected and unexpected centrally presented memory tests. Using a combination of spatial modulations in neural activity (EEG-alpha lateralization) and gaze bias quantified as time courses of microsaccade rate, the authors examined how retro cues with varying levels of reliability influence attentional deployment and subsequent memory performance. The conclusion is that attentional re-orienting occurs within visual working memory, even when tested centrally, with distinct patterns following expected and unexpected tests. The findings provide new value for the field and are likely of broad interest and impact, by highlighting working memory as an action-bound process (in)dependent on (an ambiguous) past.

Strengths:

The study uniquely integrates behavioral data (accuracy and reaction time), EEG-alpha activity, and gaze tracking to provide a comprehensive analysis of attentional re-orienting within visual working memory. As typical for this research group, the validity of the findings follows from the task design that effectively manipulates the reliability of retro cues and isolates attentional processes related to memory tests. The use of well-established markers for spatial attention (i.e. alpha lateralization) and more recently entangled dependent variable (gaze bias) is commendable. Utilizing these dependent metrics, the concise report presents a thorough analysis of the scaling effects of cue reliability on attentional deployment, both at the behavioral and neural levels. The clear demonstration of prolonged attentional deployment following unexpected memory tests is particularly noteworthy, although there are no significant time clusters per definition as time isn't a factor in a statistical sense, the jackknife approach is convincing. Overall, the evidence is compelling, allowing the conclusion of a second stage of internal attentional deployment following both expected and unexpected memory tests, highlighting the importance of memory verification and re-orienting processes.

Weaknesses:

I want to stress upfront that these are not specific to the presented work and do not affect my recommendation to offer the report to the public in its present form.

The sample size is consistent with previous studies, a larger sample could enhance the generalizability and robustness of the findings. The authors acknowledge high noise levels in EEG-alpha activity, which may affect the reliability of this marker. This is a general issue in non-invasive electrophysiology that cannot be handled by the authors but an interested reader should be aware of it. Effectively, the sensitivity of the gaze analysis appears "better" in part due to the better SNR. The latter also sets the boundaries for single trial analyses as the authors correctly mention. In terms of generalizability, I am convinced that the main outcome will likely generalize to different samples and stimulus types. Yet, as typical for the field, future research could explore different contexts and task demands to validate and extend the findings. The authors provide here how and why (including sharing of data and code).

Comments on revisions:

Really nice work, Thank you!

Reviewer #1 (Public review):

The manuscript by Li et al., investigates metabolism independent role of nuclear IDH1 in chromatin state reprogramming during erythropoiesis. The authors describe accumulation and redistribution of histone H3K79me3, and downregulation of SIRT1, as a cause for dyserythropoiesis observed due to IDH1 deficiency. The authors studied the consequences of IDH1 knockdown, and targeted knockout of nuclear IDH1, in normal human erythroid cells derived from hematopoietic stem and progenitor cells and HUDEP2 cells respectively. They further correlate some of the observations such as nuclear localization of IDH1 and aberrant localization of histone modifications in MDS and AML patient samples harboring IDH1 mutations. These observations are overall intriguing from a mechanistic perspective and hold therapeutic significance. The authors have addressed the previous concerns sufficiently in the revised manuscript.

Reviewer #2 (Public review):

Li, Zhang, Wu, and colleagues investigated the non-canonical localization of IDH1 in the cell nucleus and its unconventional functions, expanding our understanding of the roles of metabolic enzymes such as IDH1. To study its nuclear function, they generated a HUDEP2 cell line with a specific deletion of nuclear IDH1. They found that the loss of nuclear IDH1 led to abnormalities in nuclear morphology and chromatin organization, particularly in H3K79me3. By integrating ChIP-seq, ATAC-seq, and RNA-seq analyses, they identified SIRT1 as a key regulatory factor mediating IDH1's role in nuclear morphology regulation during the terminal stages of erythroid differentiation.

Notably, abnormalities in H3K79me3 were also observed in AML/MDS patients harboring IDH1 mutations, offering new perspectives for disease diagnosis and treatment. To robustly determine the nuclear distribution of IDH1 in erythroid cells, the authors employed multiple approaches, including immunofluorescence and nucleus-cytoplasm fractionation. The development of a HUDEP2 cell line lacking nuclear IDH1 was pivotal for studying its non-canonical nuclear functions.

Experimental results, including euchromatin/heterochromatin observations, histone modification analyses, ChIP-seq, and ATAC-seq, indicated that the deletion of IDH1 disrupts the chromatin landscape. While the authors have identified SIRT1 as a key gene affected by the deficiency of IDH1, the mechanisms underlying IDH1's nuclear function are worth further exploration in future studies.

Overall, this study advances our understanding of the non-canonical localization of metabolic enzymes and their nuclear functions, shedding new light on their roles in cellular regulation.

Reviewer #3 (Public review):

Li, Zhang, Wu and colleagues describe a new role for nuclear IDH1 in erythroid differentiation. IDH1 depletion results in a terminal erythroid differentiation defect with polychromatic and orthochromatic erythroblasts showing abnormal nuclei, nuclear condensation defects and an increased proportion of euchromatin, as well as enucleation defects. Using ChIP-seq for the histone modifications H3K79me3, H3K27me2 and H3K9me3, as well as ATAC-seq and RNA-seq in primary CD34-derived erythroblasts, the authors elucidate SIRT1 as a key dysregulated gene that is upregulated upon IDH1 knockdown. They furthermore show that chemical inhibition of SIRT1 partially rescues the abnormal nuclear morphology and enucleation defect during IDH1-deficient erythroid differentiation. The phenotype of delayed erythroid maturation and enucleation upon IDH1 shRNA-mediated knockdown was described in the group's previous co-authored study (PMID: 33535038). The authors describe this new role of IDH1 as non-canonical, but more experiments will be needed to determine whether this function of IDH1 in chromatin organization is secondary to its enzymatic-metabolic role. On the other hand, while the dependency of IDH1 mutant cells on NAD+ as well as a cell survival benefit upon SIRT1 inhibition has already been shown (see, e.g, PMID: 26678339, PMID: 32710757), previous studies focused on cancer cell lines and did not look at a developmental differentiation process, which makes this study interesting.

The authors had initially hypothesized that IDH1 has a role in the nucleus independent of its enzymatic function, which is interesting but was not supported by the presented experiments. In the revised manuscript, the authors decided to just focus on the nuclear role of IDH1. To this end, they present a system in HUDEP-2 cells harboring a CRISPR/Cas9-mediated IDH1 knockout and overexpression of an IDH1 construct containing a nuclear export signal. While they only use this system in some of their experiments, they mostly use a global IDH1 shRNA knockdown approach is employed, which will affect both forms of IDH1, cytoplasmic and nuclear. Future work using their system that specifically depletes nuclear IDH1 could further delineate changes of the chromatin landscape upon loss of nuclear IDH1 and also address how loss of nuclear IDH1 affects the part of the TCA cycle that has recently been shown to be present in the nucleus (PMID: 36044572).

https://www.nytimes.com/2025/03/24/climate/extreme-heat-emissions-energy-trends.html

Reviewer #1 (Public review):

The manuscript investigates the role of the membrane-deforming cytoskeletal regulator protein Abba in cortical development and its potential implications for microcephaly. It is a valuable contribution to the understanding of Abba's role in cortical development. The strengths and weaknesses identified in the manuscript are outlined below:

Clinical Relevance:

The authors identified a patient with microcephaly and intellectual disability patient harboring a mutation in the Abba variant (R671W), adding a clinically relevant dimension to the study.

Mechanistic Insights:

The study offers valuable mechanistic insights into the development of microcephaly by elucidating the role of Abba in radial glial cell proliferation, radial fiber organization, and the migration of neuronal progenitors. The identification of Abba's involvement in the cleavage furrow during cell division, along with its interaction with Nedd9 and positive influence on RhoA activity, adds depth to our understanding of the molecular processes governing cortical development.

In Vivo Validation:

The overexpression of mutant Abba protein (R671W), which results in phenotypic similarities to Abba knockdown effects, supports the significance of Abba in cortical development.

Weaknesses:

The findings in the study suggest that heterozygous expression of the R671W variant may exert a dominant-negative effect on ABBA's role, disrupting normal brain development and leading to microcephaly and cognitive delay. However, evidence also points to a possible gain-of-function effect, as the mutation does not decrease RhoA activity or PH3 expression in vivo. Additionally, the impact of ABBA depletion on cell fate is not fully addressed. While abnormal progenitor accumulation in the ventricular and subventricular zones is observed, the transition of progenitors to neuroblasts and their ability to support neuroblast migration remains unclear. Impaired cleavage furrow ingression and disrupted Nedd9 and RhoA signaling could lead to structural abnormalities in radial glial progenitors, affecting their scaffold function and neuroblast progression. The manuscript lacks an exploration of the loss or decrease in interaction between Abba and NEDD9 in the case of the pathogenic patient-derived mutation in Abba. Furthermore, addressing the changes in localization and ineraction in for NEDD9 following over-expression of the mutant are important to further mehcanistically characterizxe this interaction in future studies. These gaps suggest the need for further exploration of ABBA's role in progenitor cell fate and neuroblast migration to clarify its mechanistic contributions to cortical development.

Reviewer #2 (Public review):

Summary:

Carabalona and colleagues investigated the role of the membrane-deforming cytoskeletal regulator protein Abba (MTSS1L/MTSS2) in cortical development to better understand the mechanisms of abnormal neural stem cell mitosis. The authors used short hairpin RNA targeting Abba20 with a fluorescent reporter coupled with in utero electroporation of E14 mice to show changes to neural progenitors. They performed flow cytometry for in-depth cell cycle analysis of Abba-shRNA impact to neural progenitors and determined an accumulation in S phase. Using culture rat glioma cells and live imaging from cortical organotypic slides from mice in utero electroporated with Abba-shRNA, the authors found Abba played a prominent role in cytokinesis. They then used a yeast-two-hybrid screen to identify three high confidence interactors: Beta-Trcp2, Nedd9, and Otx2. They used immunoprecipitation experiments from E18 cortical tissue coupled with C6 cells to show Abba requirement for Nedd9 localization to the cleavage furrow/cytokinetic bridge. The authors performed an shRNA knockdown of Nedd9 by in utero electroporation of E14 mice and observed similar results as with the Abba-shRNA. They tested a human variant of Abba using in utero electroporation of cDNA and found disorganized radial glial fibers and misplaced, multipolar neurons, but lacked the impact of cell division seen in the shRNA-Abba model.

Strengths:

Fundamental question in biology about the mechanics of neural stem cell division.<br /> Directly connecting effects in Abba protein to downstream regulation of RhoA via Nedd9.<br /> Incorporation of human mutation in ABBA gene.<br /> Use of novel technologies in neurodevelopment and imaging.

Weaknesses:

Unexplored components of the pathway (such as what neurogenic populations are impacted by Abba mutation) and unleveraged aspects of their data (such as the live imaging) limit the scope of their findings and left significant questions about the effect of ABBA on radial glia development.

(1) Claim of disorganized radial glial fibers lacks quantifications.<br /> -On page 11, the authors claim that knockdown of Abba lead to changes in radial glial morphology observed with vimentin staining. Here they claim misoriented apical processes, detached end feet, and decreased number of RGP cells in the VZ. However, they no not provide quantification of process orientation to better support their first claim. Measurements of radial glia fiber morphology (directionality, length) and of angle of division would be metrics that can be applied to data. Some of these analysis could be done in their time-lapse microscopy images, such as to quantify the number of cell division during their period of analysis (though that is short-15 hours).

(2) Unclear where effect is:<br /> -in RG or neuroblasts? Is it in cell cleavage that results in accumulation of cells at VZ (as sometimes indicated by their data like in Fig 2A or 4D)? Interrogation of cell death (such as by cleaved caspase 3) would also help. Given their time lapse, can they identify what is happening to the RG fiber? The authors describe a change in "migration" but do not show evidence for this for either progenitor or neuroblast populations. Given they have nice time-lapse imaging data, could they visualize progenitor versus young neuron migration? Analysis of neuroblasts (such as with doublecortin expression in the tissue) would also help understand any issues in migration (of neurons v stem cells).<br /> -at cleaveage furrow? In abscission? There is high resolution data that highlights the cleavage furrow as the location of interest (fig 3A), however there is also data (fig 3B) to suggest Abba is expressed elsewhere as well and there is an overall soma decrease. More detail of the localization of Abba during the division process would be helpful-for example, could cleavage furrow proteins, such as Aurora B, co-localization (and potentially co-IP) help delineate subpopulations of Abba protein? Furthermore, the FRET imaging is unique way to connect their mutation with function-could they measure/quantify differences at furrow compared to rest of soma to further corroborate that Abba-associated RhoA effect was furrow-enriched?<br /> -The data highlights nicely that a furrow doesn't clearly form when ABBA expression and subsequent RhoA activity are decreased (in Fig 3 or 5A). Does this lead to cells that can't divide because of poor abscission, especially since "rounding" still occurs? Or abnormal progenitors (with loss of fiber or inability to support neuroblast migration)? Or abnormal progression of progenitors to neuroblasts?

(3) Limited to a singular time point of mouse cortical development<br /> On page 13, the authors outline the results of their Y2H screen with the identification of three high confidence interactors. Notably, they used a E10.5-E12.5 mouse brain embryo library rather than one that includes E14, the age of their in utero electroporation mice. Many of the authors' claims focus on in utero electroporation of shRNA-Abba of E14 mice that are then evaluated at E16-18. Justification for the focus on this age range should be included to support that their findings can then be applied to all of mouse corticogenesis.

(4) Detail of the effect of the human variant of the ABBA mutation in mouse is lacking.<br /> Their identification of the R671W mutation is interesting and the IUE model warrants more characterization, as they did with their original KD experiments.<br /> -Could they show that Abba protein levels are decreased (in either cell lines or electroporated tissue)?<br /> -While time-lapse morphology might not have been performed, more analysis on cell division phenotype (such as plane of division and radial glia morphology) would be helpful.

The resubmission has addressed many of the questions raised.

I have a few comments that should be addressed:

(1) The authors maintain a deficit in "migration of immature neurons" which remains unsubstantiated. In their resonse, they state: "we believe that the data showing the accumulation of migrating electroporated cells in the ventricular (V) and subventricular (SV) zones provide compelling evidence of abnormal migration in ABBA-shRNA electroporated cells. "<br /> -Firstly, they do not demonstrate that it's immature neurons, not RGs, that are affected. Secondly, accumulation of cells at the V-SVZ could be due to soley the inability for the RGC to undergo mitosis, therefore remaining stuck"<br /> The commentary of migration, especially of neurons, should be modified.

Reviewer #1 (Public review):

Summary:

This work by the Meng lab investigates the role of the proteins MARK2 and CAMSAP2 in the Golgi reorientation during cell polarisation and migration. They identified that both proteins interact together and that MARK2 phosphorylates CAMSAP2 on the residue S835. They show that the phosphorylation affects the localisation of CAMSAP2 at the Golgi apparatus and in turn influences the Golgi structure itself. Using the TurboID experimental approach, the author identified the USO1 protein as a protein that binds differentially to CAMSAP2 when it is itself phosphorylated at residue 835. Dissecting the molecular mechanisms controlling Golgi polarisation during cell migration is a highly complex but fundamental issue in cell biology and the author may have identified one important key step in this process.

Comments on latest version:

I thank the authors for the numerous revisions they have made to this manuscript, which have strengthened its clarity and overall quality. However, I must reiterate my initial concerns from the first review regarding the rigor of the data analysis, as certain methodological choices may lead to potential overinterpretation of the results.<br /> For instance, the low number of cells analyzed in the new Figure 1B (N = 3; 0 h: n = 28; 0.5 h: n = 23; 2 h: n = 20) indicates that fewer than 10 fixed cells have been quantified per replicate. Given the variability of the CAMSAP2 signal observed in Supplementary Figure 2, this sample size does not appear optimal for accurately capturing the complexity of CAMSAP2 localization within the cell population. Additionally, the Pearson's coefficients calculated between CAMSAP2 and GM130 in Figure 1B (approximately 0.4) do not align with those in Figure 3C, where the control condition shows values above 0.6. This discrepancy highlights the high variability of CAMSAP2 Golgi localization in the HT1080 cell population, which may not be adequately represented by the quantification of such a limited number of cells. If the population distribution were narrow, averaging only a few cells might be sufficient to achieve high statistical power; however, this does not appear to be the case, and a larger sample size is necessary.

Furthermore, to ensure a more robust analysis, SuperPlots displaying each biological replicate should be provided for all quantifications, and statistical analysis should be conducted using a t-test or ANOVA on the means of the three independent experiments rather than on the total number of cells, as the latter approach may influence statistical significance (for reference: jcb.202001064). This recommendation is relevant for Figures 1E, 3B, 3C, 4E, 4F, 6F, Sup1D, Sup3D, Sup3E, Sup3I, and Sup3G and should be implemented whenever possible.

For instance, in the new Figure 6F, the statistical difference (1 star) between Pearson's coefficients for HT1080 and siUSO1-2 conditions, both approaching 90, raises questions about whether this difference is truly substantial enough to support the claim that USO1 knockdown negatively impacts CAMSAP2 localization.

Publishing in journals such as eLife requires high standards in data analysis to ensure rigorous and reproducible scientific conclusions. In its present form, this manuscript does not yet meet those standards.

Additional comments:

Supplementary figure 2<br /> A) The video microscopy conditions are not described in the Materials and Methods section. It is unclear what type of microscope was used-was it a bright-field or confocal microscope? The images contain a significant amount of out-of-focus signal, making it difficult to accurately assess the extent of Golgi apparatus dispersion as described by the authors. If a confocal microscope was used, a Z-stack projection would be beneficial for quantifying this process.

Reviewer #2 (Public review):

Summary:

The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors show that depletion of MARK2 alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation.

Impact:

The Golgi apparatus is a key organelle in cell migration- post translationally modifying and sorting cargo for directed trafficking, acting as a signalling hub, whilst functioning as a nucleation site for microtubules. These functions are essential to establish cell polarity during migration, highlighting the importance of understanding how cells reorient their Golgi in response to different environmental cues.

The study will be of interest to fundamental biologists investigating Golgi function, and positioning, particularly in the context of different cell migration settings. It may also interest scientists investigating the loss of polarity in cancer or the maintenance of epithelial tissue architecture. I am a cell biologist with expertise in cell trafficking, cytoskeleton, and cell migration- during processes spanning development, homeostasis and cancer.

Comments on latest version:

Labelling of graphs - many of the graphs are comparing HT1080 cells with two conditions: parental and KO i.e. Figure 2F, H, I. The labels the authors use are "HT1080 and CAMSAP2 KO". This is confusing and should be changed to "parental and CAMSAP2 KO", the cell type HT1080 could be listed in the figure legend or on the graph below the conditions. (Similar to the labelling in Figure 3 H, I where they use "control and siRNA").

The method section needs improvement - particularly around analysis methods, and statistical details for experiments. I recommend a supplementary table outlining exactly where the data is from (pooled, biological/technical repeats, n definitions, tests of normality etc).

Reviewer #1 (Public review):

Summary

In this manuscript, De La Forest Divonne et al. build a repertory of hemocytes from adult Pacific oysters combining scRNAseq data with cytologic and biochemical analyses. Three categories of hemocytes were described previously in this species (i.e. blast, hyalinocyte and granulocytes). Based on scRNAseq data, the authors identified 7 hemocyte clusters presenting distinct transcriptional signatures. Using Kegg pathway enrichment and RBGOA, the authors determined the main molecular features of the clusters. In parallel, using cytologic markers, the authors classified 7 populations of hemocytes (i.e. ML, H, BBL, ABL, SGC, BGC, and VC) presenting distinct sizes, nucleus sizes, acidophilic/basophilic, presence of pseudopods, cytoplasm/nucleus ratio and presence of granules. Then, the authors compared the phenotypic features with potential transcriptional signatures seen in the scRNAseq. The hemocytes were separated in a density gradient to enrich for specific subpopulations. The cell composition of each cell fraction was determined using cytologic markers and the cell fractions were analysed by quantitative PCR targeting major cluster markers (two per cluster). With this approach, the authors could assign cluster 7 to VC, cluster 2 to H, and cluster 3 to SGC. The other clusters did not show a clear association with this experimental approach. Using phagocytic assays, ROS, and copper monitoring, the authors showed that ML and SGC are phagocytic, ML produces ROS, and SGC and BGC accumulate copper. Then with the density gradient/qPCR approach, the authors identified the populations expressing anti-microbial peptides (ABL, BBL, and H). At last, the authors used Monocle to predict differentiation trajectories for each subgroup of hemocytes using cluster 4 as the progenitor subpopulation.

The manuscript provides a comprehensive characterisation of the diversity of circulating immune cells found in Pacific oysters.

Strengths

The combination of scRNAseq, cytologic markers and gradient based hemocyte sorting offers an integrative view of the immune cell diversity.<br /> Hemocytes represent a very plastic cell population that has key roles in homeostatic and challenged conditions. Grasping the molecular features of these cells at the single-cell level will help understand their biology.<br /> This type of study may help elucidate the diversification of immune cells in comparative studies and evolutionary immunology.

Weaknesses

Several figures show inconsistency leading to erroneous conclusions and some conclusions are poorly supported. Moreover, the manuscript remains highly descriptive with limited comparison with the available literature.

Reviewer #2 (Public review):

Summary:

This work provides a comprehensive understanding of cellular immunity in bivalves. To precisely describe the hemocytes of the oyster C. gigas, the authors morphologically characterized seven distinct cell groups, which they then correlated with single-cell RNA sequencing analysis, also resulting in seven transcriptional profiles. They employed multiple strategies to establish relationships between each morphotype and the scRNAseq profile. The authors correlated the presence of marker genes from each cluster identified in scRNAseq with hemolymph fractions enriched for different hemocyte morphotypes. This approach allowed them to correlate three of the seven cell types, namely hyalinocytes (H), small granule cells (SGC), and vesicular cells (VC). A macrophage-like (ML) cell type was correlated through the expression of macrophage-specific genes and its capacity to produce reactive oxygen species. Three other cell types correspond to blast-like cells, including an immature blast cell type from which distinct hematopoietic lineages originate to give rise to H, SGC, VC, and ML cells. Additionally, ML cells and SGCs demonstrated phagocytic properties, with SGCs also involved in metal homeostasis. On the other hand, H cells, non-granular cells, and blast cells expressed antimicrobial peptides. This study thus provides a complete landscape of oyster hemocytes with functional validation linked to immune activities. This resource will be valuable for studying the impact of bacterial or viral infections in oysters.

The main strength of this study lies in its comprehensive and integrative approach, combining single-cell RNA sequencing, cytological analysis, cell fractionation and functional assays to provide a robust characterization of hemocyte populations in Crassostrea gigas.

(1) The innovative use of marker genes, quantifying their expression within specific cell fractions, allows for precise annotation of different cellular clusters, bridging the gap between morphological observations and transcriptional profiles.

(2)The study provides detailed insights into the immune functions of different hemocyte types, including the identification of professional phagocytes, ROS-producing cells, and cells expressing antimicrobial peptides.

(3) The identification and analysis of transcription factors specific to different hemocyte types and lineages offer crucial insights into cell fate determination and differentiation processes in oyster immune cells.

(4) The authors significantly advance the understanding of oyster immune cell diversity by identifying and characterizing seven distinct hemocyte transcriptomic clusters and morphotypes.

These strengths collectively make this study a significant contribution to the field of invertebrate immunology, providing a comprehensive framework for understanding oyster hemocyte diversity and function.

Conclusion:

The authors largely achieved their primary objective of providing a comprehensive characterization of oyster immune cells. They successfully integrated multiple approaches to identify and describe distinct hemocyte types. The correlation of these cell types with specific immune functions represents a significant advancement in understanding oyster immunity. The authors are aware of the limitations of their study, particularly with regards to the pseudotime analysis, which provides a conceptual framework for understanding lineage relationships but requires further experimental validation to confirm its findings.

This study is likely to have a significant impact on the field of invertebrate immunology, particularly in bivalve research. It provides a new standard for comprehensive immune cell characterization in invertebrates. The identification of specific markers for different hemocyte types will facilitate future research on oyster immunity. The proposed model of hemocyte lineages, while requiring further validation, offers a framework for studying hematopoiesis in bivalves.

Reviewer #3 (Public review):

The paper addresses pivotal questions concerning the multifaceted functions of oyster hemocytes by integrating single-cell RNA sequencing (scRNA-seq) data with analyses of cell morphology, transcriptional profiles, and immune functions. In addition to investigating granulocyte cells, the study delves into the potential roles of blast and hyalinocyte cells. A key discovery highlighted in this research is the identification of cell types engaged in antimicrobial activities, encompassing processes such as phagocytosis, intracellular copper accumulation, oxidative bursts, and antimicrobial peptide synthesis.

A particularly intriguing aspect of the study lies in the exploration of hemocyte lineages, warranting further investigation, such as employing scRNA-seq on embryos at various developmental stages.

Reviewer #1 (Public review):

Summary:

There has been intense controversy over the generality of Hamilton's inclusive fitness rule for how evolution works on social behaviors. All generally agree that relatedness can be a game changer, for example allowing for otherwise unselectable altruistic behaviors when c < rb, where c is the fitness cost to the altruism, b is the fitness benefit to another, and r their relatedness. Many complications have been successfully incorporated into the theory, including different reproductive values and viscous population structures.

The controversy has centered on another dimension; Hamilton's original model was for additive fitness, but how does his result hold when fitnesses are non-additive? One approach has been not to worry about a general result but just find results for particular cases. A consistent finding is that the results depend on the frequency of the social allele - non-additivity causes frequency dependence that was absent in Hamilton's approach. Two other approaches derive from Queller via the Price equation. Queller 1 is to find forms like Hamilton's rule, but with additional terms that deal with non-additive interaction, each with an r-like population structure variable multiplied by a b-like fitness effect (Queller 1985). Queller 2 redefines the fitness effects c and b as partial regressions of the actor's and recipient's genes on fitness. This leaves Hamilton's rule intact, just with new definitions of c and b that depend on frequency.

Queller 2 is the version that has been most adopted by the inclusive fitness community along with assertions that Hamilton's rule in completely general. In this paper, van Veelen argues that Queller 1 is the correct approach. He derives a general form that Queller only hinted at. He does so within a more rigorous framework that puts both Price's equation and Hamilton's rule on firmer statistical ground. Within that framework, the Queller 2 approach is seen to be a statistical misspecification - it employs a model without interaction in cases that actually do have interaction. If we accept that this is a fatal flaw, the original version of Hamilton's rule is limited to linear fitness models, which might not be common.

Strengths:

While the approach is not entirely new, this paper provides a more rigorous approach and a more general result. It shows that both Queller 1 and Queller 2 are identities and give accurate results, because both are derived from the Price equation, which is an identity. So why prefer Queller 1? It identifies the misspecification issue with the Queller 2 approach and points out its consequences. For example, it will not give the minimum squared differences between the model and data. It does not separate the behavioral effects of the individuals from the population state (b and c become dependent on r and the population frequency).

The paper also shows how the same problems can apply to non-social traits. Epistasis is the non-additivity of effects of two genes within the individual. (So one wonders why have we not had a similarly fierce controversy over how we should treat epistasis?)

The paper is clearly written. Though somewhat repetitive, particularly in the long supplement, most of that repetition has the purpose of underscoring how the same points apply equally to a variety of different models.<br /> Finally, this may be a big step towards reconciliation in the inclusive fitness wars. Van Veelen has been one of the harshest critics of inclusive fitness, and now he is proposing a version of it.

Weaknesses:

van Veelen argues that the field essentially abandoned the Queller 1 approach after its publication. I think this is putting it too strongly - there have been a number of theoretical studies that incorporate extra terms with higher-order relatednesses. It is probably accurate to say that there has been relative neglect. But perhaps this is partly due to a perception that this approach is difficult to apply.

The model in this paper is quite elegant and helps clarify conceptual issues, but I wonder how practical it will turn out to be. In terms of modeling complicated cases, I suspect most practitioners will continue doing what they have been doing, for example using population genetics or adaptive dynamics, without worrying about neatly separating out a series of terms multiplying fitness coefficients and population structure coefficients.

For empirical studies, it is going to be hard to even try to estimate all those additional parameters. In reality, even the standard Hamilton's rule is rarely tested by trying to estimate all its parameters. Instead, it is commonly tested more indirectly, for example by comparative tests of the importance of relatedness. That of course would not distinguish between additive and non-additive models that both depend on relatedness, but it does test the core idea of kin selection. It will be interesting to see if van Veelen's approach stimulates new ways of exploring the real world.

Reviewer #2 (Public review):

Summary:

This manuscript reconsiders the "general form" of Hamilton's rule, in which "benefit" and "cost" are defined as regression coefficients. It points out that there is no reason to insist on Hamilton's rule of the form -c+br>0, and that, in fact, arbitrarily many terms (i.e. higher-order regression coefficients) can be added to Hamilton's rule to reflect nonlinear interactions. Furthermore, it argues that insisting on a rule of the form -c+br>0 can result in conditions that are true but meaningless and that statistical considerations should be employed to determine which form of Hamilton's rule is meaningful for a given dataset or model.

Strengths:

The point is an important one. While it is not entirely novel-the idea of adding extra terms to Hamilton's rule has arisen sporadically (Queller 1985, 2011; Fletcher & Zwick 2006; van Veelen et al. 2017)--it is very useful to have a systematic treatment of this point. I think the manuscript can make an important contribution by helping to clarify a number of debates in the literature. I particularly appreciate the heterozygote advantage example in the SI.

Weaknesses:

Although the mathematical analysis is rigorously done and I largely agree with the conclusions, I feel there are some issues regarding terminology, some regarding the state of the field, and the practice of statistics that need to be clarified if the manuscript is truly to resolve the outstanding issues of the field. Otherwise, I worry that it will in some ways add to the confusion.

(1) The "generalized" Price equation: I agree that the equations labeled (PE.C) and (GPE.C) are different in a subtle yet meaningful way. But I do not see any way in which (GPE.C) is more general than (PE.C). That is, I cannot envision any circumstance in which (GPE.C) applies but (PE.C) does not. A term other than "generalized" should be used.

(2) Regression vs covariance forms of the Price equation

I think the author uses "generalized" in reference to what Price called the "regression form" of his equation. But to almost everyone in the field, the "Price Equation" refers to the covariance form. For this reason, it is very confusing when the manuscript refers to the regression form as simply "the Price Equation".

As an example, in the box on p. 15, the manuscript states "The Price equation can be generalized, in the sense that one can write a variety of Price-like equations for a variety of possible true models, that may have generated the data." But it is not the Price equation (covariance form) that is being generalized here. It is only the regression that Price used that is being generalized.

To be consistent with the field, I suggest the term "Price Equation" be used only to refer to the covariance form unless it is otherwise specified as in "regression form of the Price equation".

(3) Sample covariance: The author refers to the covariance in the Price equation as "sample covariance". This is not correct, since sample covariance has a denominator of N-1 rather than N (Bessel's correction). The correct term, when summing over an entire population, is "population covariance". Price (1972) was clear about this: "In this paper we will be concerned with population functions and make no use of sample functions". This point is elaborated on by Frank (2012), in the subsection "Interpretation of Covariance".

Of course, the difference is negligible when the population is large. However, the author applies the covariance formula to populations as small as N=2, for which the correction factor is significant.

The author objects to using the term "population covariance" (SI, pp. 8-9) on the grounds that it might be misleading if the covariance, regression coefficients, etc. are used for inference because in this case, what is being inferred is not a population statistic but an underlying relationship. However, I am not convinced that statistical inference is or should be the primary use of the Price equation (see next point). At any rate, avoiding potential confusion is not a sufficient reason to use incorrect terminology.

Relatedly, I suggest avoiding using E for the second term in the Price equation, since (as the ms points out), it is not the expectation of any random variable. It is a population mean. There is no reason not to use something like Avg or bar notation to indicate population mean. Price (1972) uses "ave" for average.

I should add, however, that the distinction between population statistics vs sample statistics goes away for regression coefficients (e.g. b, c, and r in Hamilton's rule) since in this case, Bessel's correction cancels out.

(4) Descriptive vs. inferential statistics

When discussing the statistical quantities in the Price Equation, the author appears to treat them all as inferential statistics. That is, he takes the position that the population data are all generated by some probabilistic model and that the goal of computing the statistical quantities in the Price Equation is to correctly infer this model.

It is worth pointing out that those who argue in favor of the Price Equation do not see it this way: "it is a mistake to assume that it must be the evolutionary theorist, writing out covariances, who is performing the equivalent of a statistical analysis." (Gardner, West, and Wild, 2011); "Neither data nor inferences are considered here" (Rousset 2015). From what I can tell, to the supporters of the Price equation and the regression form of Hamilton's rule, the statistical quantities involved are either population-level *descriptive* statistics (in an empirical context), or else are statistics of random variables (in a stochastic modeling context).

In short, the manuscript seems to argue that Price equation users are performing statistical inference incorrectly, whereas the users insist that they are not doing statistical inference at all.

The problem (and here I think the author would agree with me) arises when users of the Price equation go on to make predictive or causal claims that would require the kind of statistical analysis they claim not to be doing. Claims of the form "Hamilton's rule predicts.." or use of terms like "benefit" and "cost" suggest that one has inferred a predictive or causal relationship in the given data, while somehow bypassing the entire theory of statistical inference.

There is also a third way to use the Price equation which is entirely unobjectionable: as a way to express the relationship between individual-level fitness and population-level gene frequency change in a form that is convenient for further algebraic manipulation. I suspect that this is actually the most common use of the Price equation in practice.

For a paper that aims to clarify these thorny concepts in the literature, I think it is worth pointing out these different interpretations of statistical quantities in the Price equation (descriptive statistics vs inferential statistics vs algebraic manipulation). One can then critique the conclusions that are inappropriately drawn from the Price equation, which would require rigorous statistical inference to draw. Without these clarifications, supporters of the Price equation will again argue that this manuscript has misunderstood the purpose of the equation and that they never claimed to do inference in the first place.

(5) "True" models

Even if one accepts that the statistical quantities in the Price equation are inferential in nature, the author appears to go a step further by asserting that, even in empirical populations, there is a specific "true" model which it is our goal to infer. This assumption manifests at many points in the SI when the author refers to the "true model" or "true, underlying population structure" in the context of an empirical population.

I do not think it is necessary or appropriate, in empirical contexts, to posit the existence of a Platonic "true" model that is generating the data. Real populations are not governed by mathematical models. Moreover, the goal of statistical inference is not to determine the "true model" for given data but to say whether a given statistical model is justified based on this data. Fitting a linear model, for example, does not rule out the possibility there may be higher-order interactions - it just means we do not have a statistical basis to infer these higher-order interactions from the data (say, because their p-scores are insignificant), and so we leave them out.

What we can say is that if we apply the statistical model to data generated by a probabilistic model, and if these models match, then as the number of observations grows to infinity, the estimators in the statistical model converge to the parameters of the data-generating one. But this is a mathematical statement, not a statement about real-world populations.

A resolution I suggest to points 3, 4, and 5 above is:<br /> *A priori, the statistical quantities in the Price Equation are descriptive statistics, pertaining only to the specific population data given.<br /> *If one wishes to impute any predictive power, generalizability, or causal meaning to these statistics, all the standard considerations of inferential statistics apply. In particular, one must choose a statistical model that is justified based on the given data. In this case, one is not guaranteed to obtain the standard (linear) Hamilton's rule and may obtain any of an infinite family of rules.<br /> *If one uses a model that is not justified based on the given data, the results will still be correct for the given population data but will lack any meaning or generalizability beyond that.<br /> *In particular, if one considers data generated by a probabilistic model, and applies a statistical model that does not match the data-generating one, the results will be misleading, and will not generalize beyond the randomly generated realization one uses.

Of course, the author may propose a different resolution to points 3-5, but they should be resolved somehow. Otherwise, the terminology in the manuscript will be incorrect and the ms will not resolve confusion in the field.

Reviewer #3 (Public review):

There is an interesting mathematical connection - an "isomorphism"-between Price's equation and least-squares linear regression. Some people have misinterpreted this connection as meaning that there is a generality-limiting assumption of linearity within Price's equation, and hence that Hamilton's rule-which is derived from Price's equation-provides only an approximation of the action of natural selection. This is in contrast to the majority view that Hamilton's rule is a fully general and exact result.

To briefly give some mathematical details: Price's equation defines the action of natural selection in relation to a trait of interest as the covariance between fitness w and the genetic breeding value g for the trait, i.e. cov(w,g); this is a fully general result that applies exactly to any arbitrary set of (g,w) data; without any loss of generality this covariance can be expressed as the product of genetic variance var(g) and a coefficient b(w,g), the coefficient simply being defined as b(w,g) = cov(w,g)/var(g) for all var(g) > 0; it happens that if one fits a straight line to the same (g,w) data by means of least-squares regression then the slope of that line is equal to b(w,g).

All of this has already been discussed, repeatedly, in the literature.

Now turn to the present paper: the first sentence of the Abstract says "The generality of Hamilton's rule is much debated", and then the next sentence says "In this paper, I show that this debate can be resolved by constructing a general version of Hamilton's rule". But immediately it's clear that this isn't really resolving the debate, what this paper is actually doing is asserting the correctness of the minority view (i.e. that Hamilton's rule as it currently stands is not a general result) and then attempting to build a more general form of Hamilton's rule upon that shaky foundation. Predictably, the paper erroneously interprets the standard formulation of Hamilton's rule as a linear approximation and develops non-linear extensions to improve the goodness of fit for a result that is already exactly correct.

This is not a convincing contribution. It will not change minds or improve understanding of the topic.

Nor is it particularly novel. Smith et al (2010, "A generalisation of Hamilton's rule for the evolution of microbial cooperation" Science 328, 1700-1703) similarly interpreted Hamilton's rule as a linear model and provided a corresponding polynomial expansion - usefully fitting the model to microbial data so as to learn something about the costs and benefits of cooperation in an empirical setting. it's odd that this paper isn't cited here.

Reviewer #2 (Public review):

In my previous review, I considered the contributions of the authors to be substantial because they have nearly doubled the number of genome sequences for chitons, and their newly sequenced genomes apparently are very well annotated. I would even extend these strengths now that I have had a chance to better review recent literature on marine animal genomes. Their contribution has helped make the chitons one of the best available marine taxa for comparative genomic studies. However, I still am unconvinced by the authors' claims to have demonstrated an unusually high rate of large-scale genome rearrangements across chitons. Their best argument seems to be comparisons drawn within a couple of similarly ancient bivalve lineages that were used to identify the conserved genomic regions in the first place, specifically the 20 molluscan linkage groups (MLGs). Perhaps it is safest to conclude that these MLGs are mostly conserved in conchiferans. Their main comparison with other molluscan classes is presented in tables 4 and 5 in the supplement, where they report a somewhat higher mean translocation rate for chitons (45.48) than for bivalves (41.10) or gastropods (41.87) but does this justify the implications of the title or the claims made in the Summary? I am not sure, partly because these summary tables are not made in a way that separates the gastropod or bivalve species listed into subtaxa separated by LCAs with estimated age, so the mean value across each class is not especially helpful. I still feel that the authors were not convincing in their arguments that chiton chromosomes have been subject to an unexpected history of rearrangement when contrasting quite ancient chitons lineages. This does not include impressive rearrangements documented for the likely geologically recent rearrangements seen within the genus, Acanthochitona, and separately within the subfamily Acanthopleurinae. These are quite impressive events that occurred recently within lineages of shallow-water chiton taxa, not deep still waters.

By the authors' estimates, some sequenced chiton genomes represent lineages that share a last common ancestor (LCA) as much as over 300 million years before present. This is like comparing a frog genome with a human genome. I suspect that the authors would agree that the pace of chiton genome rearrangements is not nearly as great as that observed for younger taxa such as mammals or particular insect orders known to have a history of genome shuffling. For example, according to Damas et al. (2022; https://www.pnas.org/doi/full/10.1073/pnas.2209139119) for comparisons within mammals, "94 inversions, 16 fissions, and 14 fusions that occurred over 53 My differentiated the therian from the descendent eutherian ancestor."

It is more interesting to me how the chiton genome rearrangements compare with other molluscan classes or for comparisons of other marine taxa genomes that share a similarly ancient LCA, but this is difficult to dig out of the authors' presentation. As far as I am aware, there are relatively few such comparisons of genome rearrangements available for marine animals. Attempting to do my own search for any comparison I could make, I noticed in that in a recent compilation of "high quality"* genomes (Martínez-Redondo 2024; https://doi.org/10.1093/gbe/evae235), this included genomes for 84 (mostly insect) arthropods, 67 vertebrates, 31 mollusks, 15 annelids, 12 nematodes, and 6 cnidarians, but the numbers drop off to 1-4 for many phyla, e.g., echinoderms. If there are really so few marine taxa available for comparison to the last 300 My of chiton genome rearrangements and fusions, then I would like to see a better presentation of the contrasts of the 20 molluscan linkage groups (MLGs) across molluscan classes. I found it very difficult to evaluate beyond the assertion that these are relatively conserved in two bivalve taxa. I remain unconvinced whether the amount of genome rearrangement observed by the authors for chitons is either especially rapid or slow. Certainly the genome browsers I have seen do not make it easy to compare, for example, marine gastropod or bivalve genomes (e.g., https://www.ncbi.nlm.nih.gov/cgv/9606 or https://genome.ucsc.edu/cgi-bin/hgGateway).

An unrelated topic that I also brought up in my earlier review is the ancestral reconstruction of molluscan chromosome numbers. The authors' explanation does nothing to justify how they ended up with an optimization of 20 for the ancestor of Mollusca. The outgroups included two annelids, Owenia [12 chromosomes] and Paraescarpia [14], plus the very distant chordate, Branchiostoma [19] (but the tunicate, Oikopleura has 6). Do the authors not understand that outgroups are critical for the optimization of character states at an ancestral node, with the most proximal outgroups being most important? How did they end up with an ancestral reconstruction of the chiton LCA with 16 chromosomes when there is no chiton with more than 13? Given the number of chromosomes in annelids, which is clearly the most proximal outgroups included with chromosome numbers available, it is more parsimonious to postulate that there was an increase in chromosome number for the conchiferan lineage. Related, they should have rooted that tree figure (Fig. 2) with the deuterostome, Branchiostoma, not a monophyletic grouping of all outgroups.

A recent study by Lewin et al. (2024; https://doi.org/10.1093/molbev/msae172) comparing annelid genomic rearrangements suggests to me that annelids probably have a more striking history of rearrangements than for chitons, but I found it difficult to evaluate. I do tend to agree with the overall conclusion of Lewin et al: "All animals with bilateral symmetry inherited a genome structure from their last common ancestor that has been highly conserved in some taxa but seemingly unconstrained in others." That is also my impression so far but the authors have done little to summarize what is known. One study that implies that at least deuterostomes have conserved elements of an ancestral chromosomal arrangement is provided by Lin et al. (2024; https://doi.org/10.1371/journal.pbio.3002661), who sequenced two genomes representing crown group hemichordates (LCA about 504 My).

Even if my general impression is wrong that the history of chiton genome rearrangement is not especially remarkable, or at least we still do not have a great idea of how rapid it is, I still think the authors could have done a better job of demonstrating their claims. This is important if they are going to make big claims about the pace of chiton chromosomal rearrangements. There is very little discussion of other similarly ancient marine animal taxa. I do not especially have a problem with excluding better known terrestrial mammalian or insect genomes as perhaps not a very relevant contrast, but am I supposed to be impressed with the comparisons made with bivalves and gastropods in Tables 4 and 5 of the Supplement? Where do the authors present a detailed comparison of how these estimates compare to conchiferans? Is this amount of genome rearrangement observed for chitons surprising for an extant taxon that has diversified for over 300 My? This is claimed in the title and summary of the manuscript as the take-home for the contribution, but I am left with the impression that there is too little attempt to justify that the pace across Polyplacophora (Neoloricata) is in any way remarkable. Apparently, there are few other lineages of marine taxa within which there are sequenced and well annotated genomes that can be compared, and this confounds the extent of conclusions that can be made.

* "high quality" genomes defined as follows by Martínez-Redondo (2024): "...we lowered the threshold used to consider a data set as high quality to 70% C + F (complete plus fragmented) BUSCO score (Manni et al. 2021), as the original 85% threshold was too restrictive when prioritizing a wide taxonomic sampling and the inclusion of biologically interesting species that are not widely studied."

Reviewer #1 (Public review):

Summary:

The study investigates protein-protein interactions (PPIs) within the nuage, a germline-specific organelle essential for piRNA biogenesis in Drosophila melanogaster, using AlphaFold2 to predict interactions among 20 nuage-localizing proteins. The authors identify five novel interaction candidates and experimentally validate three of them, including Spindle-E and Squash, through co-immunoprecipitation assays. They confirm the functional significance of these interactions by disrupting salt bridges at the Spn-E_Squ interface. The study further expands its scope to analyze approximately 430 oogenesis-related proteins, validating three additional interaction pairs. A comprehensive screen of around 12,000 Drosophila proteins for interactions with the key piRNA pathway player, Piwi, identifies 164 potential binding partners. Overall, the research demonstrates that in silico approaches using AlphaFold2 can link bioinformatics predictions with experimental validation, streamlining the identification of novel protein interactions and reducing the reliance on extensive experimental efforts.

Reviewer #2 (Public review):

Summary:

In this paper, the authors use AlphaFold2 to identify potential binding partners of nuage localizing proteins.

Strengths:

The main strength of the paper is that the authors experimentally verify a subset of the predicted interactions.

Many studies have been performed to predict protein-protein interactions in various subsets of proteins. The interesting story here is that the authors (i) focus on an organelle that contains quite some intrinsically disordered proteins and (ii) experimentally verify some (but not all) predictions.

Weaknesses:

Identification of pairwise interactions is only a first step towards understanding complex interactions. It is pretty clear from the predictions that some (but certainly not all) of the pairs could be used to build larger complexes. This is Done only for some cases and could be extended to the entire network.

Reviewer #1 (Public review):

Summary:

This manuscript investigates the role of the neck linker in coordinating the stepping cycles of the two heads of a kinesin-1 motor. Previous studies in the field showed that kinesin walks by alternating stepping of its heads, referred to as hand-over-hand. In this stepping mechanism, the front head of a kinesin dimer must remain bound until the rear head dissociates from the microtubule, moves forward, and rebinds to the tubulin on the plus-end side of the front head. There is a large body of work done to address this question. These studies all point to the central role of the 14 amino acid extension, a neck-linker, which connects the two heads to a common stalk, in coordination of kinesin motility. In a two-head-bound state, the motor domains (heads) are oriented parallel to the microtubule, but the neck linkers are orienting toward each other, thereby, breaking the symmetry in a homodimeric motor. In addition, the neck linkers are quite short, almost stretching to their near contour length to accommodate the microtubule binding of both heads. Previous studies pointed out that either the opposing orientation or the intramolecular tension of the neck linkers coordinate the stepping cycle.

However, we still do not know which step(s) in the chemo-mechanical cycle is controlled by the neck-linker to keep the two heads out of phase. The front head gating model postulates that ATP binding to the front head is gated until the rear head detaches from the microtubule. The rear head gating model proposes that the neck linker accelerates the detachment of the rear head from the microtubule. In this study, the authors use pre-steady state kinetics and smFRET to address this question. They measured ATP binding and microtubule detachment kinetics of kinesin's catalytic domain with neck linker constraints 1) imposed by disulfide crosslinking of the neck linker in monomeric kinesin in backward (rear head-like) and forward (front head-like) orientations, and 2) using the E236A-WT heterodimer to create a two-head microtubule-bound state with the mutant and WT heads occupying the rear and front positions respectively. They found that neck-linker conformation of the rear head reduces the ATP dissociation rate but has little effect on microtubule affinity. In comparison, the neck-linker conformation of the front head does not change ATP binding to the front head, but it reduces ATP-induced detachment of the front head, suggesting that a step after ATP binding (i.e. ATP hydrolysis or Pi release) is gated in the front head.

Significance:

I believe that this work will make an important contribution to the large body of literature focused on the mechanism of kinesin, which serves as an excellent model system to understand the kinetics and mechanics of a molecular motor. The mechanism proposed by the authors modifies the front-head gating model and is in agreement with recent structural work done on a kinesin dimer bound to a microtubule. Overall, the work is well performed, and the conclusions are well supported by the experimental data.

Reviewer #2 (Public review):

Summary:

In this study, the authors investigate the molecular mechanism behind kinesin-1's coordinated movement along microtubules, with a focus on how ATP binding, hydrolysis, and microtubule attachment/detachment are regulated in the leading and trailing heads. Using pre-steady state kinetics and single-molecule assays, they show that the neck linker's conformation modulates nucleotide affinity and detachment rates in each head differently, establishing an asynchronous chemo-mechanical cycle that prevents simultaneous detachment. Supported by cryo-EM structural data, their findings suggest that strain-induced conformational changes in the nucleotide-binding pockets are crucial for kinesin's hand-over-hand movement, presenting a detailed kinetic model of its stepping mechanism. The manuscript is well-crafted, technically rigorous, and should be of significant interest to cell biology and cytoskeletal motor researchers.

Significance:

All conclusions are well-supported by the provided data. The findings address a critical gap in our understanding of how kinesin's two motor domains coordinate their movements, offering insights into the molecular basis of its stepping mechanism. This work should be of significant interest to the cytoskeletal research community.

Comments on latest version:

The authors have satisfactorily addressed my comments, although I recommend the addition of the following reference:

Lu Rao, Jan O. Wirth, Jessica Matthias, and Arne Gennerich. 2025. A Two-Heads-Bound State Drives KIF1A Superprocessivity. bioRxiv 2025.01.14.632505

This paper provides conclusive evidence that kinesin-1 predominantly adopts a one-head-bound state at limiting ATP concentrations and remains in this state for a significant portion of its enzymatic cycle even at saturating ATP. This limits its processivity compared to KIF1A, which predominantly adopts a two-heads-bound state under saturating ATP conditions. These findings directly support the authors' conclusion that trailing head dissociation is favored over leading head detachment.

Reviewer #3 (Public review):

Kinesin-1 is a dimeric motor protein that transports cargo along microtubules. Its movement relies on the ability of its two catalytic motor domains (heads) to couple microtubule interactions with directional conformational changes and ATP turnover in a coordinated, alternating manner. The kinetics of these processes in each head are tightly regulated (gated) to ensure that at least one motor domain remains bound to the microtubule at all times, preventing detachment.

Niitani et al. investigated the gating mechanism by focusing on the role of the neck linker, a flexible region extending from the motor domain's C-terminus that undergoes conformational changes during stepping. They examined how the neck linker differentially regulates the microtubule affinity and ATP turnover of the front and rear heads. To do this, they designed cross-linkable monomeric motor domains mimicking the conformations of the front and rear heads and employed a combination of pre-steady-state and single-molecule analyses to measure ATP-binding and microtubule-detachment kinetics. Additionally, they studied a kinesin heterodimer with a locked rear head conformation to distinguish the kinetic properties of the front and rear heads within an active dimer.

ATP binding rates were measured using stopped-flow experiments with mant-ATP and nucleotide-free kinesin-microtubule complexes. The results showed that crosslinking the neck linker in the forward-pointing conformation (mimicking the rear head) reduced the ATP dissociation rate, while crosslinking it in the rear-pointing conformation (mimicking the front head) had no significant effect on ATP binding kinetics. ATP dissociation from the rear head was further examined using a kinesin mutant (E236A) that stabilizes the ATP-bound state by significantly slowing ATP hydrolysis.

To assess how neck-linker orientation affects microtubule attachment, the authors monitored turbidity changes after rapidly mixing nucleotide-free, crosslinked kinesin-microtubule complexes with ATP in a stopped-flow apparatus. Their findings demonstrated that the forward-oriented neck linker in the rear head promotes microtubule detachment, whereas the backward-oriented neck linker in the front head reduces detachment rates.

These results indicate that neck-linker conformation governs gating of microtubule affinity and nucleotide binding. Moreover, they show that even partial docking of the neck linker onto the head is sufficient to partially open the gating mechanism. To further investigate the role of neck linker tension, the authors created kinesin dimers with neck linker insertions of varying lengths. Microtubule detachment kinetics and ATPase activity assays revealed that ATP turnover in the rear head is significantly affected by the degree of forward tension applied to its neck linker.

Overall, Niitani et al. build upon previous kinesin gating models by introducing a neck-linker tension-based ATP binding affinity mechanism. Their findings provide a mechanistic basis for recent cryo-EM observations for kinesin-1 and kinesin-3 (KIF14) and distinguish the specific roles of neck linker tension in the front and rear heads in regulating ATP binding, hydrolysis, and microtubule detachment. This study is biochemically rigorous and makes an important contribution, though direct structural validation (e.g., cryo-EM snapshots of crosslinked or mutant kinesins bound to microtubules) would further strengthen their conclusions and clarify the asymmetry in ATP affinity between the front and rear heads.

Reviewer #1 (Public review):

Summary:

Cell metabolism exhibits a well-known behavior in fast-growing cells, which employ seemingly wasteful fermentation to generate energy even in the presence of sufficient environmental oxygen. This phenomenon is known as Overflow Metabolism or the Warburg effect in cancer. It is present in a wide range of organisms, from bacteria and fungi to mammalian cells.

In this work, starting with a metabolic network for Escherichia coli based on sets of carbon sources, and using a corresponding coarse-grained model, the author applies some well-based approximations from the literature and algebraic manipulations. These are used to successfully explain the origins of Overflow Metabolism, both qualitatively and quantitatively, by comparing the results with E. coli experimental data.

By modeling the proteome energy efficiencies for respiration and fermentation, the study shows that these parameters are dependent on the carbon source quality constants K_i (p.115 and 116). It is demonstrated that as the environment becomes richer, the optimal solution for proteome energy efficiency shifts from respiration to fermentation. This shift occurs at a critical parameter value K_A(C).<br /> This counterintuitive result qualitatively explains Overflow Metabolism.

Quantitative agreement is achieved through the analysis of the heterogeneity of the metabolic status within a cell population. By introducing heterogeneity, the critical growth rate is assumed to follow a Gaussian distribution over the cell population, resulting in accordance with experimental data for E. coli. Overflow metabolism is explained by considering optimal protein allocation and cell heterogeneity.

The obtained model is extensively tested through perturbations: 1) Introduction of overexpression of useless proteins; 2) Studying energy dissipation; 3) Analysis of the impact of translation inhibition with different sub-lethal doses of chloramphenicol on Escherichia coli; 4) Alteration of nutrient categories of carbon sources using pyruvate. All model perturbations results are corroborated by E. coli experimental results.

Strengths:

In this work, the author effectively uses modeling techniques typical of Physics to address complex problems in Biology, demonstrating the potential of interdisciplinary approaches to yield novel insights. The use of Escherichia coli as a model organism ensures that the assumptions and approximations are well-supported in existing literature. The model is convincingly constructed and aligns well with experimental data, lending credibility to the findings. In this version, the extension of results from bacteria to yeast and cancer is substantiated by a literature base, suggesting that these findings may have broad implications for understanding diverse biological systems.

Weaknesses:

The author explores the generalization of their results from bacteria to cancer cells and yeast, adapting the metabolic network and coarse-grained model accordingly. In the previous version this generalization was not completely supported by references and data from the literature. This drawback, however, has been treated in this current version, where the authors discuss in much more detail and give references supporting this generalization.

Comments on revisions:

I have no specific comments for the authors. My previous comments were all addressed, discussed and explained.

Reviewer #1 (Public review):

Summary:

This paper presents a method for reconstructing videos from mouse visual cortex neuronal activity using a state-of-the-art dynamic neural encoding model. The authors achieve high-quality reconstructions of 10-second movies at 30 Hz from two-photon calcium imaging data, reporting a 2-fold increase in pixel-by-pixel correlation compared to previous methods. They identify key factors for successful reconstruction including the number of recorded neurons and model ensembling techniques.

Strengths:

(1) A comprehensive technical approach combining state-of-the-art neural encoding models with gradient-based optimization for video reconstruction.

(2) Thorough evaluation of reconstruction quality across different spatial and temporal frequencies using both natural videos and synthetic stimuli.

(3) Detailed analysis of factors affecting reconstruction quality, including population size and model ensembling effects.

(4) Clear methodology presentation with well-documented algorithms and reproducible code.

(5) Potential applications for investigating visual processing phenomena like predictive coding and perceptual learning.

Weaknesses:

The main metric of success (pixel correlation) may not be the most meaningful measure of reconstruction quality:

High correlation may not capture perceptually relevant features.

Different stimuli producing similar neural responses could have low pixel correlations The paper doesn't fully justify why high pixel correlation is a valuable goal

Comparison to previous work (Yoshida et al.) has methodological concerns: Direct comparison of correlation values across different datasets may be misleading; Large differences in the number of recorded neurons (10x more in the current study); Different stimulus types (dynamic vs static) make comparison difficult; No implementation of previous methods on the current dataset or vice versa.

Limited exploration of how the reconstruction method could provide insights into neural coding principles beyond demonstrating technical capability.

The claim that "stimulus reconstruction promises a more generalizable approach" (line 180) is not well supported with concrete examples or evidence.

The paper would benefit from addressing how the method handles cases where different stimuli produce similar neural responses, particularly for high-speed moving stimuli where phase differences might be lost in calcium imaging temporal resolution.

Reviewer #2 (Public review):

This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

(1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

(2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

(3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

(4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

(5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

(6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

(7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

Reviewer #3 (Public review):

Summary:

This paper presents a method for reconstructing input videos shown to a mouse from the simultaneously recorded visual cortex activity (two-photon calcium imaging data). The publicly available experimental dataset is taken from a recent brain-encoding challenge, and the (publicly available) neural network model that serves to reconstruct the videos is the winning model from that challenge (by distinct authors). The present study applies gradient-based input optimization by backpropagating the brain-encoding error through this selected model (a method that has been proposed in the past, with other datasets). The main contribution of the paper is, therefore, the choice of applying this existing method to this specific dataset with this specific neural network model. The quantitative results appear to go beyond previous attempts at video input reconstruction (although measured with distinct datasets). The conclusions have potential practical interest for the field of brain decoding, and theoretical interest for possible future uses in functional brain exploration.

Strengths:

The authors use a validated optimization method on a recent large-scale dataset, with a state-of-the-art brain encoding model. The use of an ensemble of 7 distinct model instances (trained on distinct subsets of the dataset, with distinct random initializations) significantly improves the reconstructions. The exploration of the relation between reconstruction quality and the number of recorded neurons will be useful to those planning future experiments.

Weaknesses:

The main contribution is methodological, and the methodology combines pre-existing components without any new original components. The movie reconstructions include a learned "transparency mask" to concentrate on the most informative area of the frame; it is not clear how this choice impacts the comparison with prior experiments. Did they all employ this same strategy? If not, shouldn't the quantitative results also be reported without masking, for a fair comparison?

Reviewer #1 (Public review):

Summary:

This study is built on the emerging knowledge of trained immunity, where innate immune cells exhibit enhanced inflammatory responses upon being challenged by a prior insult. Trained immunity is now a very fast-evolving field and has been explored in diverse disease conditions and immune cell types. Earhart and the team approached the topic from a novel angle and were the first to explore a potential link to the complement system.

The study focused on the central complement protein C3 and investigated how its signalling may modulate immune training in alveolar macrophages. The authors first performed in vivo experiments in C57BL mouse models to observe the presence of enhanced inflammation and C3a in BAL fluid following immune training. These changes were then compared with those from C3-deficient mice, which confirmed the involvement of C3a. This trained immunity was further validated in ex vivo experiments using primary alveolar macrophage, which was blunted in C3-deficiency, and, intriguingly, rescued by adding exogenous C3 protein, but not C3a. The genetic-based findings were supported by pharmacological experiments using the C3aR antagonist SB290157. Mechanistically, transcriptomic analyses suggested the involvement of metabolism-linked, particularly glycolytic, genes, which was in agreement with an upregulation of glycolytic flux in WT but not C3-deficient macrophages.

Collectively, these data suggest that C3, possibly through engaging with C3aR, contributes to trained immunity in alveolar macrophages.

Strengths:

The conclusions reached were well supported by in vivo and ex vivo experiments, encompassing both genetic-knockout animal models and pharmacological tools.

The transcriptomic and cell metabolism studies provided valuable mechanistic insights.

Weaknesses:

For the in vivo experiments, the histopathological and other inflammatory markers (Figure 1) were not directly linked to alveolar macrophages by experimental evidence. Other innate immune cells (eg. dendritic cells, neutrophils) and endothelial cells could also be involved in immune training and contribute to the pathological outcomes. These cells were not examined or mentioned in the study.

For the ex vivo experiments assessing immune training in alveolar macrophages, only the release of selected inflammatory factors were measured. Macrophage activities constitute multiple aspects (e.g. phagocytosis, ROS production, microbe killing), which should also be considered to better depict the effect of trained immunity.

The proposed mechanism of C3 getting cleaved intracellularly and then binding to lysosomal C3aR needs to be further supported by experimental evidence.

There was an absence of any validation in human-based models.

Reviewer #2 (Public review):

Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

(1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

(2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

(3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

(4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

(5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

(6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

Reviewer #1 (Public review):

Summary:

The authors aimed to characterize neurocomputational signals underlying interpersonal guilt and responsibility. Across two studies, one behavioral and one fMRI, participants made risky economic decisions for themselves or for themselves and a partner; they also experienced a condition in which the partners made decisions for themselves and the participant. The authors also assessed momentary happiness intermittently between choices in the task. Briefly, results demonstrated that participants' self-reported happiness decreased after disadvantageous outcomes for themselves and when both they and their partner were affected; this effect was exacerbated when participants were responsible for their partner's low outcome, rather than the opposite, reflecting experienced guilt. Consistent with previous work, BOLD signals in the insula correlated with experienced guilt, and insula-right IFG connectivity was enhanced when participants made risky choices for themselves and safe choices for themselves and a partner.

Strengths:

This study implements an interesting approach to investigating guilt and responsibility; the paradigm in particular is well-suited to approach this question, offering participants the chance to make risky v. safe choices that affect both themselves and others. I appreciate the assessment of happiness as a metric for assessing guilt across the different task/outcome conditions, as well as the implementation of both computational models and fMRI.

Weaknesses:

In spite of the overall strengths of the study, I think there are a few areas in which the paper fell a bit short and could be improved.

(1) While the framing and goal of this study was to investigate guilt and felt responsibility, the task implemented - a risky choice task with social conditions - has been conducted in similar ways in past research that were not addressed here. The novelty of this study would appear to be the additional happiness assessments, but it would be helpful to consider the changes noted in risk-taking behavior in the context of additional studies that have investigated changes in risky economic choice in social contexts (e.g., Arioli et al., 2023 Cerebral Cortex; Fareri et al., 2022 Scientific Reports).

(2) The authors note they assessed changes in risk preferences between social and solo conditions in two ways - by calculating a 'risk premium' and then by estimating rho from an expected utility model. I am curious why the authors took both approaches (this did not seem clearly justified, though I apologize if I missed it). Relatedly, in the expected utility approach, the authors report that since 'the number of these types of trials varied across participants', they 'only obtained reliable estimates for [gain and loss] trials in some participants' - in study 1, 22 participants had unreliable estimates and in study 2, 28 participants had unreliable estimates. Because of this, and because the task itself only had 20 gains, 20 losses, and 20 mixed gambles per condition, I wonder if the authors can comment on how interpretable these findings are in the Discussion. Other work investigating loss aversion has implemented larger numbers of trials to mitigate the potential for unreliable estimates (e.g., Sokol-Hessner et al., 2009).

(3) One thing seemingly not addressed in the Discussion is the fact that the behavioral effect did not replicate significantly in study 2.

(4) Regarding the computational models, the authors suggest that the Reponsibility and Responsibility Redux models provided the best fit, but they are claiming this based on separate metrics (e.g., in study 1, the redux model had the lowest AIC, but the responsibility only model had the highest R^2; additionally, the basic model had the lowest BIC). I am wondering if the authors considered conducting a direct model comparison to statistically compare model fits.

(5) In the reporting of imaging results, the authors report in a univariate analysis that a small cluster in the left anterior insula showed a stronger response to low outcomes for the partner as a result of participant choice rather than from partner choice. It then seems as though the authors performed small volume correction on this cluster to see whether it survived. If that is accurate, then I would suggest that this result be removed because it is not recommended to perform SVC where the volume is defined based on a result from the same whole-brain analysis (i.e., it should be done a priori).

Reviewer #2 (Public review):

Summary

This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

Strengths

This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

Weaknesses

As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

Reviewer #2 (Public review):

Summary:

This study investigates the effect of a fed vs hungry state on food decision-making.

70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

Findings:

Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

Strengths:

The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

Weaknesses:

My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

Reviewer #3 (Public review):

Summary:

This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

Strengths:

This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

In summary, the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

Weaknesses:

Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) consuming a drink versus nothing, or (c) both.

Reviewer #1 (Public review):

Summary:

In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift-diffusion model, they further find that the best-fitting model has different attentional discounts on the taste and health attributes and that the attentional discount on the health information was larger for the hungry participants.

Strengths:

The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 9 different variants of the DDM, including recent models like the mtDDM and maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

Weaknesses:

First, in examining some of the model fits in the supplements, e.g. Figures S9, S10, S12, S13, it looks like the "taste weight" parameter is being constrained below 1. Theoretically, I understand why the authors imposed this constraint, but it might be unfairly penalizing these models. In theory, the taste weight could go above 1 if participants had a negative weight on health. This might occur if there is a negative correlation between attractiveness and health and the taste ratings do not completely account for attractiveness. I would recommend eliminating this constraint on the taste weight.

Second, I'm not sure about the mediation model. Why should hunger change the dwell time on the chosen item? Shouldn't this model instead focus on the dwell time on the tasty option?

Third, while I do appreciate the within-participant design, it does raise a small concern about potential demand effects. I think the authors' results would be more compelling if they replicated when only analyzing the first session from each participant. Along similar lines, it would be useful to know whether there was any effect of order.

Fourth, the authors report that tasty choices are faster. Is this a systematic effect, or simply due to the fact that tasty options were generally more attractive? To put this in the context of the DDM, was there a constant in the drift rate, and did this constant favor the tasty option?

Fifth, I wonder about the mtDDM. What are the units on the "starting time" parameters? Seconds? These seem like minuscule effects. Do they align with the eye-tracking data? In other words, which attributes did participants look at first? Was there a correlation between the first fixations and the relative starting times? If not, does that cast doubt on the mtDDM fits? Did the authors do any parameter recovery exercises on the mtDDM?

Reviewer #1 (Public review):

Summary:

Mancl et al. present cryo-EM structures of the Insulin Degrading Enzyme (IDE) dimer and characterize its conformational dynamics by integrating structures with SEC-SAXS, enzymatic activity assays, and all-atom molecular dynamics (MD) simulations. They present five cryo-EM structures of the IDE dimer at 3.0-4.1 Å resolution, obtained with one of its substrates, insulin, added to IDE in a 1:2 ratio. The study identified R668 as a key residue mediating the open-close transition of IDE, a finding supported by simulations and experimental data. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface.

Strengths:

The study by Mancl et al. uses a combination of experimental (cryoEM, SEC-SAXS, enzymatic assays) and computational (MD simulations, multibody analysis, 3DVA) techniques to provide a comprehensive characterization of IDE dynamics. The identification of R668 as a key residue mediating the open-to-close transition of IDE is a novel finding, supported by both simulations and experimental data presented in the manuscript. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface. The study identifies the structural basis and key residues for IDE dynamics that were not revealed by static structures.

Weaknesses:

Based on MD simulations and enzymatic assays of IDE, the authors claim that the R668A mutation in IDE affects the conformational dynamics governing the open-closed transition, which leads to altered substrate binding and catalysis. The functional importance of R668 would be substantiated by enzymatic assays that included some of the other known substrates of IDE than insulin such as amylin and glucagon.

It is unclear to what extent the force field (FF) employed in the MD simulations favors secondary structures and if the lack of any observed structural changes within the IDE domains in the simulations - which is taken to suggest that the domains behave as rigid bodies - stems from bias by the FF.

Reviewer #2 (Public review):

Summary:

The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

Reviewer #1 (Public review):

This work employs both in vitro and in vivo/transplant methods to investigate the contribution of BDNF/TrkB signaling to enhancing differentiation and dentin-repair capabilities of dental pulp stem cells in the context of exposure to a variety of inflammatory cytokines. A particular emphasis of the approach is the employment of dental pulp stem cells in which BDNF expression has been enhanced using CRISPR technology. Transplantation of such cells is said to improve dentin regeneration in a mouse model of tooth decay.

The study provides several interesting findings, including demonstrating that exposure to several cytokines/inflammatory agents increases the quantity of (activated) phospho-Trk B in dental pulp stem cells.

However, a variety of technical issues weaken support for the major conclusions offered by the authors. These technical issues include the following:

(1) It remains unclear exactly how the cytokines tested affect BDNF/TrkB signaling. For example, in Figure 1C, TNF-alpha increases TrkB and phospho-TrkB immunoreactivity to the same degree, suggesting that the cytokine promotes TrkB abundance without stimulating pathways that activate TrkB, whereas in Figure 2D, TNF-alpha has little effect on the abundance of TrkB, while increasing phospho-TrkB, suggesting that it affects TrkB activation and not TrkB abundance.

(2) I find the histological images in Figure 3 to be difficult to interpret. I would have imagined that DAPI nuclear stains would reveal the odontoblast layer, but this is not apparent. An adjacent section labeled with conventional histological stains would be helpful here. Others have described Stro-1 as a stem cell marker that is expressed on a minority of cells associated with vasculature in the dental pulp, but in the images in Figure 3, Stro-l label is essentially co-distributed with DAPI, in both control and injured teeth, indicating that it is expressed in nearly all cells. Although the authors state that the Stro-1-positive cells are associated with vasculature, but I see no evidence that is true.

(3) The data presented convincingly demonstrate that they have elevated BDNF expression in their dental pulp stem cells using a CRISPR-based approach I have a number of questions about these findings. Firstly, nowhere in the paper do they describe the nature of the CRISPR plasmid they are transiently transfecting. Some published methods delete segments of the BDNF 3'-UTR while others use an inactivated Cas9 to position an active transactivator to sequences in the BDNF promoter. If it is the latter approach, transient transfection will yield transient increases in BDNF expression. Also, as BDNF employs multiple promoters, it would be helpful to know which promoter sequence is targeted, and finally, knowing the identity of the guide RNAs would allow assessment for the potential of off-target effects I am guessing that the investigators employ a commercially obtained system from Santa Cruz, but nowhere is this mentioned. Please provide this information.

(4) Another question left unresolved is whether their approach elevated BDNF, proBDNF, or both. Their 28 kDa western blot band apparently represents proBDNF exclusively, with no mature BDNF apparent, yet only mature BDNF effectively activates TrkB receptors. On the other hand, proBDNF preferentially activates p75NTR receptors. The present paper never mentions p75NTR, which is a significant omission, since other investigators have demonstrated that p75NTR controls odontoblast differentiation.

(5) In any case, no evidence is presented to support the conclusion that the artificially elevated BDNF expression has any effect on the capability of the dental pulp stem cells to promote dentin regeneration. The results shown in Figures 4 and 5 compare dentin regeneration with BDNF-over-expressing stem cells with results lacking any stem cell transplantation. A suitable control is required to allow any conclusion about the benefit of over-expressing BDNF.

(6) Whether increased BDNF expression is beneficial or not, the evidence that the BDNF-overexpressing dental pulp stem cells promote dentin regeneration is somewhat weak. The data presented indicate that the cells increase dentin density by only 6%. The text and figure legend disagree on whether the p-value for this effect is 0.05 or 0.01. In either case, nowhere is the value of N for this statistic mentioned, leaving uncertainty about whether the effect is real.

(7) The final set of experiments applies transcriptomic analysis to address the mechanisms mediating function differences in dental pulp stem cell behavior. Unfortunately, while the Abstract indicates " we conducted transcriptomic profiling of TNFα-treated DPSCs, both with and without TrkB antagonist CTX-B" that does not describe the experiment described, which compared the transcriptome of control cells with cells simultaneously exposed to TNF-alpha and CTX-B. Since CTX-B blocks the functional response of cells to TNF-alpha, I don't understand how any useful interpretation can be attached to the data without controls for the effect of TNF alone and CTX-B alone.

Reviewer #2 (Public review):

Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

Strengths:<br /> The potential application to dentin regeneration is interesting.

Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

(1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

(2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

(3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

(4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

(5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

Reviewer #3 (Public review):

In general, although the authors interpret their results as pointing towards a possible role of BDNF in dentin regeneration, the results are over-interpreted due to the lack of proper controls and focus on TrkB expression, but not its isoforms in inflammatory processes. Surprisingly, the authors do not study the possible role of p75 in this process, which could be one of the mechanisms intervening under inflammatory conditions.

(1) The authors claim that there are two Trk receptors for BDNF, TrkA and TrkB. To date, I am unaware of any evidence that BDNF binds to TrkA to activate it. It is true that two receptors have been described in the literature, TrkB and p75 or NGFR, but the latter is not TrkA despite its name and capacity to bind NGF along with other neurotrophins. It is crucial for the authors to provide a reference stating that TrkA is a receptor for BDNF or, alternatively, to correct this paragraph.

(2) The authors discuss BDNF/TrkB in inflammation. Is there any possibility of p75 involvement in this process?

(3) The authors present immunofluorescence (IF) images against TrkB and pTrkB in the first figure. While they mention in the materials and methods section that these antibodies were generated for this study, there is no proof of their specificity. It should be noted that most commercial antibodies labeled as anti-TrkB recognize the extracellular domain of all TrkB isoforms. There are indications in the literature that pathological and excitotoxic conditions change the expression levels of TrkB-Fl and TrkB-T1. Therefore, it is necessary to demonstrate which isoform of TrkB the authors are showing as increased under their conditions. Similarly, it is essential to prove that the new anti-p-TrkB antibody is specific to this Trk receptor and, unlike other commercial antibodies, does not act as an anti-phospho-pan-Trk antibody.

(4) I believe this initial conclusion could be significantly strengthened, without opening up other interpretations of the results, by demonstrating the specificity of the antibodies via Western blot (WB), both in the presence and absence of BDNF and other neurotrophins, NGF, and NT-3. Additionally, using WB could help reinforce the quantification of fluorescence intensity presented by the authors in Figure 1. It's worth noting that the authors fixed the cells with 4% PFA for 2 hours, which can significantly increase cellular autofluorescence due to the extended fixation time, favoring PFA autofluorescence. They have not performed negative controls without primary antibodies to determine the level of autofluorescence and nonspecific background. Nor have they indicated optimizing the concentration of primary antibodies to find the optimal point where the signal is strong without a significant increase in background. The authors also do not mention using reference markers to normalize specific fluorescence or indicating that they normalized fluorescence intensity against a standard control, which can indeed be done using specific signal quantification techniques in immunocytochemistry with a slide graded in black-and-white intensity controls. From my experience, I recommend caution with interpretations from fluorescence quantification assays without considering the aforementioned controls.

(5) In Figure 2, the authors determine the expression levels of TrkA and TrkB using qPCR. Although they specify the primers used for GAPDH as a control in materials and methods, they do not indicate which primers they used to detect TrkA and TrkB transcripts, which is essential for determining which isoform of these receptors they are detecting under different stimulations. Similarly, I recommend following the MIQE guidelines (Minimum Information for Publication of Quantitative Real-Time PCR experiments), so they should indicate the amplification efficiency of their primers, the use of negative and positive controls to validate both the primer concentration used, and the reaction, the use of several stable reference genes, not just one.

(6) Moreover, the authors claim they are using the same amounts of cDNA for qPCRs since they have quantified the amounts using a Nanodrop. Given that dNTPs are used during cDNA synthesis, and high levels remain after cDNA synthesis from mRNA, it is not possible to accurately measure cDNA levels without first cleaning it from the residual dNTPs. Therefore, I recommend that the authors clarify this point to determine how they actually performed the qPCRs. I also recommend using two other reference genes like 18S and TATA Binding Protein alongside GAPDH, calculating the geometric mean of the three to correctly apply the 2^-ΔΔCt formula.

(7) Similarly, given that the newly generated antibodies have not been validated, I recommend introducing appropriate controls for the validation of in-cell Western assays.

(8) The authors' conclusion that TrkB levels are minimal (Figure 2E) raises questions about what they are actually detecting in the previous experiments might not be the TrkB-Fl form. Therefore, it is essential to demonstrate beyond any doubt that both the antibodies used to detect TrkB and the primers used for qPCR are correct, and in the latter case, specify at which cycle (Ct) the basal detection of TrkB transcripts occurs. Treatment with TNF-alpha for 14 days could lead to increased cell proliferation or differentiation, potentially increasing overall TrkB transcript levels due to the number of cells in culture, not necessarily an increase in TrkB transcripts per cell.

(9) Overall, there are reasonable doubts about whether the authors are actually detecting TrkB in the first three images, as well as the phosphorylation levels and localization of this receptor in the cells. For example, in Figure 3 A to J, it is not clear where TrkB is expressed, necessitating better resolution images and a magnified image to show in which cellular structure TrkB is expressed.

(10) In Figure 4, the authors indicate they have generated cells overexpressing BDNF after recombination using CRISPR technology. However, the WB they show in Figure 4B, performed under denaturing conditions, displays a band at approximately 28kDa. This WB is absolutely incorrect with all published data on BDNF detection via this technique. I believe the authors should demonstrate BDNF presence by showing a WB with appropriate controls and BDNF appearing at 14kDa to assume they are indeed detecting BDNF and that the cells are producing and secreting it. What antibodies have been used by the authors to detect BDNF? Have the authors validated it? There are some studies reporting the lack of specificity of certain commercial BDNF antibodies, therefore it is necessary to show that the authors are convincingly detecting BDNF.

(11) While the RNA sequencing data indicate changes in gene expression in cells treated with TNFalpha+CTX-B compared to control, the authors do not show a direct relationship between these genetic modifications with the rest of their manuscript's argument. I believe the results from these RNA sequencing assays should be put into the context of BDNF and TrkB, indicating which genes in this signaling pathway are or are not regulated, and their importance in this context.

Reviewer #1 (Public review):

Summary:

In this study, authors utilized in situ cryo-electron tomography (cryo-ET) to uncover the native thylakoid architecture of spinach chloroplasts and mapped the molecular organization of these thylakoids with single-molecule resolution. The obtained images show the detailed ultrastructural features of grana membranes and highlight interactions between thylakoids and plastoglobules. Interestingly, despite the distinct three-dimensional architecture of vascular plant thylakoids, their molecular organization closely resembles that of green algae. The pronounced lateral segregation of PSII and PSI was observed at the interface between appressed and non-appressed thylakoid regions, without evidence of a specialized grana margin zone where these complexes might intermix. Furthermore, unlike isolated thylakoid membranes, photosystem II (PSII) did not form a semi-crystalline array and distributed uniformly within the membrane plane and across stacked grana membranes in intact chloroplasts. Based on the above observations, the authors propose a simplified two-domain model for the molecular organization of thylakoid membranes that can apply to both green algae and vascular plants. This study suggests that the general understanding of the functional separation of thylakoid membranes in vascular plants should be reconsidered.

Strengths:

By employing and refining AI-driven computational tools for the automated segmentation of membranes and identification of membrane proteins, this study successfully quantifies the spatial organization of photosynthetic complexes both within individual thylakoid membranes and across neighboring stacked membranes.

Weaknesses:

This study's weakness is that it requires the use of chloroplasts isolated from leaves and the need to freeze them on a grid for observation, so it is unclear to what extent the observations reflect physiological conditions. In particular, the mode of existence of the thylakoid membrane complexes seems to be strongly influenced by the physicochemical environment surrounding the membranes, as indicated by the different distribution of PSII between intact chloroplasts and those with ruptured envelope membranes.

Reviewer #2 (Public review):

Summary:

For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

Strengths:

By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

Reviewer #1 (Public review):

Summary:

This paper proposes a new set of local synaptic plasticity rules that differs from classic rules in two regards: First, working under the assumption that signals coming into synapses change smoothly over time and thus have temporal correlations such that immediate activity is positively correlated with subsequent activity, it proposes both fast plasticity that immediately corrects errors as well as slower plasticity. Second, it derives these rules from optimal, Bayesian control theory principles that, even without the fast component of plasticity, are shown to provide more accurate performance than classic, non-Bayesian plasticity rules. As a proof of principle, it applies these to a simple cerebellar learning example that demonstrates how the proposed rules lead to learning performance that exceeds that achieved with classic cerebellar learning rules. The work also provides a potential normative explanation for post-climbing fiber spike pauses in Purkinje cell firing and proposes testable predictions for cerebellar experiments. Overall, I found the idea to be compelling and potentially broadly applicable across many systems. Further, I thought the work was a rare, very beautiful display of the application of optimal control theory to fundamental problems in neuroscience. My comments are all relatively minor and more expressions of interest than criticism.

Comments:

(1) The algorithm assumes, reasonably, that inputs are relatively smooth. However, I was wondering if this could make additional experimental predictions for the system being exceptionally noisy or otherwise behaving in signature ways if one were able to train a real biological network to match a rapidly changing or non-smooth function that does not align with the underlying assumptions of the model.

(2) The algorithm assumes that one can, to a good approximation, replace individual input rates by their across-synapse average. How sensitive is the learning to this assumption, as one might imagine scenarios where a neuron is sensitive to different inputs for different tasks or contexts so that a grand average might not be correct? Or, the functional number of inputs driving the output might be relatively low or otherwise highly fluctuating and less easily averaged over.

(3) On the cerebellar example, it is nice that the Bayesian example provides a narrower PF-CF interval for plasticity than the classical rules, but the window is not nearly as narrow as the Suvrathan et al. 2016 paper cited by the authors. Maybe this is something special about that system having well-defined, delayed feedback, but (optional) further comments or insights would be welcome if available.

(4) In the discussion, I appreciated the comparison with the Deneve work which has fast and slow feedback components. I was curious whether, although non-local, there were also conceptual similarities with FORCE learning in which there is also an immediate correction of activity through fast changing of synaptic weights, which then aids the slow long-term learning of synaptic weights.

Reviewer #2 (Public review):

Summary:

Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

Strengths:

Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

Weaknesses:

The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

Reviewer #1 (Public review):

The ventral nerve cord (VNC) of organisms like Drosophila is an invaluable model for studying neural development and organisation in more complex organisms. Its well-defined structure allows researchers to investigate how neurons develop, differentiate, and organise into functional circuits. As a critical central nervous system component, the VNC plays a key role in controlling motor functions, reflexes, and sensory integration.

Particularly relevant to this work, the VNC provides a unique opportunity to explore neuronal hemilineages - groups of neurons that share molecular, genetic, and functional identities. Understanding these hemilineages is crucial for elucidating how neurons cooperate to form specialized circuits, essential for comprehending normal brain function and dysfunction.

A significant challenge in the field has been the lack of developmentally stable, hemilineage-specific driver lines that enable precise tracking and measurement of individual VNC hemilineages. The authors address this need by generating and validating a comprehensive, lineage-specific split-GAL4 driver library.

Strengths and weaknesses

The authors select new marker genes for hemilineages from previously published single-cell data of the VNC. They generate and validate specific and temporally stable lines for almost all the hemilineages in the VNC. They successfully achieved their aims, and their results support their conclusions. This will be a valuable resource for investigating neural circuit formation and function.

Reviewer #2 (Public review):

It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

Reviewer #3 (Public review):

Summary:

Soffers et al. developed a comprehensive genetic toolkit that enables researchers to access neuronal hemilineages during developmental and adult time points using scRNA-seq analysis to guide gene cassette exchange-based or CRISPR-based tool building. Currently, research groups studying neural circuit development are challenged with tying together findings in the development and mature circuit function of hemilineage-related neurons. Here, authors leverage publicly available scRNA-seq datasets to inform the development of a split-Gal4 library that targets 32 of 34 hemilineages in development and adult stages. The authors demonstrated that the split-Gal4 library, or genetic toolkit, can be used to assess the functional roles, neurotransmitter identity, and morphological changes in targeted cells. The tools presented in this study should prove to be incredibly useful to Drosophila neurobiologists seeking to link neural developmental changes to circuit assembly and mature circuit function. Additionally, some hemilineages have more than one split-Gal4 combination that will be advantageous for studies seeking to disrupt associated upstream genes.

Strengths:

Informing genetic tool development with publicly available scRNA-seq datasets is a powerful approach to creating specific driver lines. Additionally, this approach can be easily replicated by other researchers looking to generate similar driver lines for more specific subpopulations of cells, as mentioned in the Discussion.

The unification of optogenetic stimulation data of 8B neurons and connectomic analysis of the Giant-Fiber-induced take-off circuit was an excellent example of the utility of this study. The link between hemilineage-specific functional assays and circuit assembly has been limited by insufficient genetic tools. The tools and data present in this study will help better understand how collections of hemilineages develop in a genetically constrained manner to form circuits amongst each other selectively.

Weaknesses:

Although cell position, morphology (to some extent), and gene expression are good markers to track cell identity across developmental time, there are genetic tools available that could have been used to permanently label cells that expressed genes of interest from birth, ensuring that the same cells are being tracked in fixed tissue images.

Although gene activation is a good proxy for assaying neurochemical features, relying on whether neurochemical pathway genes are activated in a cell to determine its phenotype can be misleading given that the Trojan-Gal4 system commandeers the endogenous transcriptional regulation of a gene but not its post-transcriptional regulation. Therefore, neurochemical identity is best identified via protein detection. (strong language used in this section of the paper).

The authors mainly rely on the intersectional expression of transcription factors to generate split-Gal4 lines and target hemilineages specifically. However, the Introduction (Lines 97-99) makes a notable point about how driver lines in the past, which have also predominantly relied on the regulatory sequences of transcription factors, lack the temporal stability to investigate hemilineages across time. This point seems to directly conflict with the argument made in the Results (Lines 126-127) that states that most transcription factors are stably expressed in hemilineage neurons that express them. It is generally known that transcription factors can be expressed stably or transiently depending on the context. It is unclear how using the genes of transcription factors in this study circumvents the issue of creating temporally stable driver lines.

Reviewer #1 (Public review):

Summary:

The authors introduce ImPaqT, a modular toolkit for zebrafish transgenesis, utilizing the Golden Gate cloning approach with the rare-cutting enzyme PaqCI. The toolkit is designed to streamline the construction of transgenes with broad applications, particularly for immunological studies. By providing a versatile platform, the study aims to address limitations in generating plasmids for zebrafish transgenesis.

Strengths:

The ImPaqT toolkit offers a modular method for constructing transgenes tailored to specific research needs. By employing Golden Gate cloning, the system simplifies the assembly process, allowing seamless integration of multiple genetic elements while maintaining scalability for complex designs. The toolkit's utility is evident from its inclusion of a diverse range of promoters, genetic tools, and fluorescent markers, which cater to both immunological and general zebrafish research needs. Furthermore, the modular design ensures expandability, enabling researchers to customize constructs for diverse experimental designs. The validation provided in the manuscript is solid, demonstrating the successful generation of several functional transgenic lines. These examples highlight the toolkit's efficacy, particularly for immune-focused applications.

Weaknesses:

While the toolkit's technical capabilities are well-demonstrated, there are several areas where additional validation and examples could enhance its impact. One limitation is the lack of data showing whether the toolkit can be directly used for rapid cloning and testing of enhancers or promoters, particularly cloning them directly from PCR using PaqCI overhangs without needing an entry vector. Similarly, the feasibility of cloning genes directly from PCR products into the system is not demonstrated, which would significantly increase the utility for researchers working with genomic elements.

The authors discuss potential applications such as using the toolkit for tissue-specific knockout applications by assembling CRISPR/Cas9 gRNA constructs. However, they do not demonstrate the cloning of short fragments, such as gRNA sequences downstream of a U6 promoter, which would be an important proof-of-concept to validate these applications. Furthermore, while the manuscript focuses on macrophage-specific promoters, the widely used mpeg1.1 promoter is not included or tested, which limits the toolkit's appeal for researchers studying macrophages and microglia.

Another potential limitation is the handling of sequences containing PaqCI recognition sites. Although the authors discuss domestication to remove these sites, a demonstration of cloning strategies for such cases or alternative methods to address these challenges would provide practical guidance for users.

Reviewer #2 (Public review):

Summary:

Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

Strengths:

The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

Weaknesses:

(1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

(2) There is no statement for the upper limitation of the expandability.

(3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

Reviewer #1 (Public review):

Summary:

Optogenetic tools enable very precise spatiotemporal control of the signaling pathway. The authors developed an optimized light-regulated PKC epsilon, Opto-PKCepsilon using AlphaFold for rational design. Interactome and phosphoproteome studies of light-activated Opto-PKCepsilon confirmed a high similarity of interaction partners to PMA-stimulated wild-type PKCepsilon and high specificity for PKCepsilon substrates. Light-dependent recruitment of Opto-PKCepsilon to the plasma membrane revealed the specific phosphorylation of the insulin receptor at Thr 1160 and recruitment to mitochondria the phosphorylation of the complex I subunit NDUFS4 correlating with reduced spare respiratory capacity, respectively. The interactome and phosphoproteome studies confirm the functionality of Opto-PKCepsilon.

Strengths:

AlphaFold simulations enable the design of an optimized Opto-PKCepsilon with respect to dark-light activity. Opto-PKCepsilon is a versatile tool to study the function of PKCepsilon in a precisely controlled manner.

Weaknesses:

Light-controlled PCKepsilon was recently reported by Gada et al. (2022). Ong et al. developed an optimized Opto-PKCepsilon and presented in their manuscript the potential of this tool for controlling signaling pathways. However, some data have to be improved and appropriate controls are still missing for some experiments.

Major comments:

(1) The group of proteins detected as phosphorylated PKC substrates (phospho-Ser PKC substrate antibody) induced by Opto-PKCepsilon varies significantly between Figure 1 C and Figure 2 C. Have the authors any explanation for this? Do both figures show similar areas of the membrane? The size marker indicates that this is not the case.

(2) The ratio of endogenous and exogeneous PCKepsilon is quite different in the experiments shown in Figure 1 C and Figure 2 C. What is the reason for this effect?

(3) In addition to the overall phosphorylation of PKC substrates, the PKCepsilon mutants should be tested for phosphorylation of a known PKCepsilon substrate. The phosphorylation of the insulin receptor at Thr 1160 by Opto-PKCepsilon (see Figure 6) is very convincing and would provide clearer results for comparing the mutants.

(4) The quality of the fluorescence images shown in Figure 5 is poor and should be improved. In addition, a MitoTracker dye for mitochondria labeling should be included to confirm the mitochondrial localization of Opto-PKCepsilon.

(5) Figure S6 shows a light experiment in the absence of insulin, as stated in the headline of the figure legend and in the main text. Does this mean that Figure 6B shows an experiment in which the cells were exposed to light in the presence of insulin? If so, this should be mentioned in the legend of the figure and in the main text. What influence does insulin have on IR phosphorylation at Thr 1160?

(6) The signal of NDUSF4 phosphorylation induced by Opto-PKCepsilon is weak in the experiment shown in Figure 7E. What about the effect of shorter and longer exposure times? How many times was this experiment repeated?

Reviewer #2 (Public review):

Summary:

The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

Strengths:

(1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

(2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

(3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

Weaknesses:

(1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

(2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

(3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

Reviewer #1 (Public review):

Summary:

The authors present results and analysis of an experiment studying the genetic architecture of phenology in two geographically and genetically distinct populations of switchgrass when grown in 8 common gardens spanning a wide range of latitudes. They focused primarily on two measures of phenology - the green-up date in the spring, and the date of flowering. They observed generally positive correlations of flowering date across the latitudinal gradient, but negative correlations between northern and southern (i.e. Texas) green-up dates. They use GWAS and multivariate meta-analysis methods to identify and study candidate genetic loci controlling these traits and how their effect sizes vary across these gardens. They conclude that much of the genetic architecture is garden-specific, but find some evidence for photoperiod and rainfall effects on the locus effect sizes.

Strengths:

The strengths of the study are in the large scale and quality of the field trials, the observation of negative correlations among genotypes across the latitudinal gradient, and the importance of the central questions: Can we predict how genetic architecture will change when populations are moved to new environments? Can we breed for more/less sensitivity to environmental cues?

Weaknesses:

I have tried hard to understand the concept of the GxWeather analysis presented here, but still do not see how it tests for interactions between weather and genetic effects on phenology. I may just not understand it correctly, but if so, then I think more clarity in the logical model would help - maybe a figure explaining how this approach can detect genotype-weather interactions. Also, since this is a proposal for a new approach to detecting gene-environment effects, simulations would be useful to show power and false positive rates, or other ways of validating the results. The QTL validation provided is not very convincing because the same trials and the same ways of calculating weather values are used again, so it's not really independent validation, plus the QTL intervals are so large overlap between QTL and GWAS is not very strong evidence.

The term "GxWeather" is never directly defined, but based on its pairing with "GxE" on page 5, I assumed it means an interaction between genotypes (either plant lines or genotypes at SNPs) and weather variables, such that different genotypes alter phenology differently as a response to a specific change in weather. For example, some genotypes might initiate green-up once daylengths reach 12 hours, but others require 14 hours. Alternatively (equivalently), an SNP might have an effect on greenup at 12 hours (among plants that are otherwise physiologically ready to trigger greenup on March 21, only those with a genotype trigger), while no effect on greenup with daylengths of 14 hours (e.g., if plants aren't physiologically ready to greenup until June when daylengths are beyond 14 hours, both aa and AA genotypes will greenup at the same time, assuming this locus doesn't affect physiological maturity).

Either way, GxE and (I assume) GxWeather are typically tested in one of two ways. Either genotype effects are compared among environments (which differ in their mean value for weather variables) and GxWeather would be inferred if environments with similar weather have similar genotype effects. Or a model is fit with an environmental (maybe weather?) variable as a covariate and the genotype:environment interaction is measured as a change of slope between genotypes. Basically, the former uses effect size estimates across environments that differ in mean for weather, while the latter uses variation in weather within an experiment to find GxWeather effects.

However, the analytical approach here seems to combine these in a non-intuitive way and I don't think it can discover the desired patterns. As I understand from the methods, weather-related variables are first extracted for each genotype in each trial based on their green-up or flowering date, so within each trial each genotype "sees" a different value for this weather variable. For example, "daylength 14 days before green-up" is used as a weather variable. The correlation between these extracted genotype-specific weather variables across the 8 trials is then measured and used as a candidate mixture component for the among-trial covariance in mash. The weight assigned to these weather-related covariance matrices is then interpreted as evidence of genotype-by-weather interactions. However, the correlation among genotypes between these weather variables does not measure the similarity in the weather itself across trials. Daylengths at green-up are very different in MO than SD, but the correlation in this variable among genotypes is high. Basically, the correlation/covariance statistic is mean-centered in each trial, so it loses information about the mean differences among trials. Instead, the covariance statistic focuses on the within-trial variation in weather. But the SNP effects are not estimated using this within-trial variation, they're main effects of the SNP averaged over the within-trial weather variation. Thus it is not clear to me that the interpretation of these mash weights is valid. I could see mash used to compare GxWeather effects modeled in each trial (using the 2nd GxE approach above), but that would be a different analysis. As is, mash is used to compare SNP main effects across trials, so it seems to me this comparison should be based on the average weather differences among trials.

A further issue with this analysis is that the weather variables don't take into account the sequence of weather events. If one genotype flowers after the 1st rain event and the second flowers after the 2nd rain event, they can get the same value for the cumulative rainfall 7d variable, but the lack of response after the 1st rain event is the key diagnostic for GxWeather. There's also the issue of circularity. Since weather values are defined based on observed phenology dates, they're effectively caused by the phenology dates. So then asking if they are associated with phenology is a bit circular. Also, it takes a couple of weeks after flowering is triggered developmentally before flowers open, so the < 2-week lags don't really make developmental sense.

Thus, I don't think this sentence in the abstract is a valid interpretation of the analysis: "in the Gulf subpopulation, 65% of genetic effects on the timing of vegetative growth covary with day length 14 days prior to green-up date, and 33% of genetic effects on the timing of flowering covary with cumulative rainfall in the week prior to flowering". There's nothing in this analysis that compares the genetic effects under 12h days to genetic effects under 14h days (as an example), or genetic effects with no rainfall prior to flowering to genetic effects with high rainfall prior to flowering. I think the only valid conclusion is: "65% of SNPs for green-up have a GxE pattern that mirrors the similarity in relationships between green-up and day length among trials." However I don't know how to interpret that statement in terms of the overall goals of the paper.

Next, I am confused about the framing in the abstract and the introduction of the GxE within and between subpopulations. The statement: "the key expectation that different genetic subpopulations, and even different genomic regions, have likely evolved distinct patterns of GxE" needs justification or clarification. The response to an environmental factor (ie plasticity) is a trait that can evolve between populations. This happens through the changing frequencies of alleles that cause different responses. But this doesn't necessarily mean that patterns of GxE are changing. GxE is the variance in plasticity. When traits are polygenic, population means can change a lot with little change in variance within each population. Most local adaptation literature is focused on changes in mean trait values or mean plasticities between populations, not changes in the variance of trait values or plasticities within populations. Focusing on the goal of this paper, differences in environmental or weather responses between the populations are interesting (Figure 1). However the comparisons of GxE between populations and with the combined population are hard to interpret. GxE within a population means that that population is not fixed for this component of plasticity, meaning that it likely hasn't been strongly locally selected. Doesn't this mean that in the context of comparing the two populations, loci with GxE within populations are less interesting than loci fixed for different values between populations? Also, if there is GxE in the Gulf population, by definition it is also present in the "Both" population. Not finding it there is just a power issue. If individuals in the two subpopulations never cross, the variance across the "Both" population isn't relevant in nature, it's an artificial construct of this experimental design. I wonder if there is confusion about the term "genetic" in GxE and as used in the first paragraph of the intro ("Genetic responses" and "Genetic sensitivity"). These sentences would be most clear if the "genetic" term referred to the mechanistic actions of gene products. But the rest of the paper is about genetic variation, ie the different effects of different alleles at a locus. I don't think this latter definition is what these first uses intend, which is confusing.

Note that the cited paper (26) is not relevant to this discussion about GxE patterns. This paper discusses the precision of estimating sub-group-specific genetic effects. With respect to the current paper, reference 26 shows that you might get more accurate measures of the SNP effects in the Gulf population using the full "Both" population dataset because i) the sample size is larger, and ii) as long as the true effects are not that different between populations. That paper is not focused on whether effect size variation is caused by evolution but on the technical question of whether GxG or GxE impacts the precision of within-group effect size estimates. The implication of paper 26 is that comparing SNP effects estimated in the "Both" population among gardens might be more powerful for detecting GxE than using only Gulf samples, even if there is some difference in SNP effects among populations. But if there magnitudes (or directions) of SNP effects change a lot among populations (ie not just changes in allele frequency), then modeling the populations separately will be more accurate.

Reviewer #2 (Public review):

The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

(1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

(2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

(3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

(4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

(5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

Reviewer #1 (Public review):

Summary

This work performed Raman spectral microscopy at the single-cell level for 15 different culture conditions in E. coli. The Raman signature is systematically analyzed and compared with the proteome dataset of the same culture conditions. With a linear model, the authors revealed correspondence between Raman pattern and proteome expression stoichiometry indicating that spectrometry could be used for inferring proteome composition in the future. With both Raman spectra and proteome datasets, the authors categorized co-expressed genes and illustrated how proteome stoichiometry is regulated among different culture conditions. Co-expressed gene clusters were investigated and identified as homeostasis core, carbon-source dependent, and stationary phase-dependent genes. Overall, the authors demonstrate a strong and solid data analysis scheme for the joint analysis of Raman and proteome datasets.

Strengths and major contributions

(1) Experimentally, the authors contributed Raman datasets of E. coli with various growth conditions.

(2) In data analysis, the authors developed a scheme to compare proteome and Ramen datasets. Protein co-expression clusters were identified, and their biological meaning was investigated.

Weaknesses

The experimental measurements of Ramen microscopy were conducted at the single-cell level; however, the analysis was performed by averaging across the cells. The author did not discuss if Ramen microscopy can used to detect cell-to-cell variability under the same condition.

Discussion and impact on the field

Ramen signature contains both proteomic and metabolomic information and is an orthogonal method to infer the composition of biomolecules. It has the advantage that single-cell level data could be acquired and both in vivo and in vitro data can be compared. This work is a strong initiative for introducing the powerful technique to systems biology and providing a rigorous pipeline for future data analysis.

Reviewer #2 (Public review):

Summary and strengths:

Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

Strengths:

The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

Weaknesses:

Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

Reviewer #1 (Public review):

Summary:

This work shows that a specific adenosine deaminase protein in Dictyostelium generates the ammonia that is required for tip formation during Dictyostelium development. Cells with an insertion in the ADGF gene aggregate but do not form tips. A remarkable result, shown in several different ways, is that the ADGF mutant can be rescued by exposing the mutant to ammonia gas. The authors also describe other phenotypes of the ADGF mutant such as increased mound size, altered cAMP signaling, and abnormal cell type differentiation. It appears that the ADGF mutant has defects in the expression of a large number of genes, resulting in not only the tip defect but also the mound size, cAMP signaling, and differentiation phenotypes.

Strengths:

The data and statistics are excellent.

Weaknesses:

The key weakness is understanding why the cells bother to use a diffusible gas like ammonia as a signal to form a tip and continue development. The rescue of the mutant by adding ammonia gas to the entire culture indicates that ammonia conveys no positional information within the mound. By the time the cells have formed a mound, the cells have been starving for several hours, and desperately need to form a fruiting body to disperse some of themselves as spores, and thus need to form a tip no matter what. One can envision that the local ammonia concentration is possibly informing the mound that some minimal number of cells are present (assuming that the ammonia concentration is proportional to the number of cells), but probably even a minuscule fruiting body would be preferable to the cells compared to a mound. This latter idea could be easily explored by examining the fate of the ADGF cells in the mound - do they all form spores? Do some form spores? Or perhaps the ADGF is secreted by only one cell type, and the resulting ammonia tells the mound that for some reason that cell type is not present in the mound, allowing some of the cells to transdifferentiate into the needed cell type. Thus elucidating if all or some cells produce ADGF would greatly strengthen this puzzling story.

Reviewer #2 (Public review):

Summary:

The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

Strengths:

The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

Weaknesses:

Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

Joint Public Review:

Summary:

In this manuscript, the authors investigate how different domains of the presynaptic protein UNC-13 regulate synaptic vesicle release in the nematode C. elegans. By generating numerous point mutations and domain deletions, they propose that two membrane-binding domains (C1 and C2B) can exhibit "mutual inhibition," enabling either domain to enhance or restrain transmission depending on its conformation. The authors also explore additional N-terminal regions, suggesting that these domains may modulate both miniature and evoked synaptic responses. From their electrophysiological data, they present a "functional switch" model in which UNC-13 potentially toggles between a basal state and a gain-of-function state, though the physiological basis for this switch remains partly speculative.

Strengths:

(1) The authors conduct a thorough exploration of how mutations in the C1, C2B, and other regulatory domains affect synaptic transmission. This includes single, double, and triple mutations, as well as domain truncations, yielding a large, informative dataset.

(2) The study includes systematically measure both spontaneous and evoked synaptic currents at neuromuscular junctions, under various experimental conditions (e.g., different Ca²⁺ levels), which strengthens the reliability of their functional conclusions.

(3) Findings that different domain disruptions produce distinct effects on mEPSCs, mIPSCs, and evoked EPSCs suggest UNC-13 may adopt an elevated functional state to regulate synaptic transmission.

Reviewer #2 (Public review):

The authors have constructively responded to previous referee comments and I believe that the manuscript is a useful addition to the literature. I particularly appreciate the quantitative approach to social behavior, but have two cautionary comments.

(1) Conceptually it is important to further justify why this particular maximum entropy model is appropriate. Maximum entropy models have been applied across a dizzying array of biological systems, including genes, neurons, the immune system, as well as animal behavior, so would seem quite beneficial to explain the particular benefits here, for mouse social behavior as coarse-grained through the eco-hab chamber occupancy. This would be an excellent chance to amplify what the models can offer for biological understanding, particularly in the realm of social behavior

(2) Maximum entropy models of even intermediate size systems involve a large number of parameters. The authors are transparent about that limitation here, but I still worry that the conclusion of the sufficiency of pairwise interactions is simply not general, and this may also relate to the differences from previous work. If, as the authors suggest in the discussion, this difference is one of a choice of variables, then that point could be emphasized. The suggestion of a follow up study with a smaller number of mice is excellent.

Reviewer #3 (Public review):

Summary:

Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

Strengths:

The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

Weaknesses:

A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

Reviewer #2 (Public review):

Summary:

The authors present a new model for animal pose estimation. The core feature they highlight is the model's stability compared to existing models in terms of keypoint drift. The authors test this model across a range of new and existing datasets. The authors also test the model with two mice in the same arena. For the single animal datasets the authors show a decrease in sudden jumps in keypoint detection and the number of undetected keypoints compared with DeepLabCut and SLEAP. Overall average accuracy, as measured by root mean squared error, generally shows generally similar but sometimes superior performance to DeepLabCut and better performance compared to SLEAP. The authors confusingly don't quantify the performance of pose estimation in the multi (two) animal case instead focusing on detecting individual identity. This multi-animal model is not compared with the model performance of the multi-animal mode of DeepLabCut or SLEAP.

Strengths:

The major strength of the paper is successfully demonstrating a model that is less likely to have incorrect large keypoint jumps compared to existing methods. As noted in the paper, this should lead to easier-to-interpret descriptions of pose and behavior to use in the context of a range of biological experimental workflows.

Weaknesses:

There are two main types of weaknesses in this paper. The first is a tendency to make unsubstantiated claims that suggest either model performance that is untested or misrepresents the presented data, or suggest excessively large gaps in current SOTA capabilities. One obvious example is in the abstract when the authors state ADPT "significantly outperforms the existing deep-learning methods, such as DeepLabCut, SLEAP, and DeepPoseKit." All tests in the rest of the paper, however, only discuss performance with DeepLabCut and SLEAP, not DeepPoseKit. At this point, there are many animal pose estimation models so it's fine they didn't compare against DeepPoseKit, but they shouldn't act like they did. Similar odd presentation of results are statements like "Our method exhibited an impressive prediction speed of 90{plus minus}4 frames per second (fps), faster than DeepLabCut (44{plus minus}2 fps) and equivalent to SLEAP (106{plus minus}4 fps)." Why is 90{plus minus}4 fps considered "equivalent to SLEAP (106{plus minus}4 fps)" and not slower? I agree they are similar but they are not the same. The paper's point of view of what is "equivalent" changes when describing how "On the single-fly dataset, ADPT excelled with an average mAP of 92.83%, surpassing both DeepLabCut and SLEAP (Figure 5B)" When one looks at Figure 5B, however, ADPT and DeepLabCut look identical. Beyond this, oddly only ADPT has uncertainty bars (no mention of what uncertainty is being quantified) and in fact, the bars overlap with the values corresponding to SLEAP and DeepPoseKit. In terms of making claims that seem to stretch the gaps in the current state of the field, the paper makes some seemingly odd and uncited statements like "Concerns about the safety of deep learning have largely limited the application of deep learning-based tools in behavioral analysis and slowed down the development of ethology" and "So far, deep learning pose estimation has not achieved the reliability of classical kinematic gait analysis" without specifying which classical gait analysis is being referred to. Certainly, existing tools like DeepLabCut and SLEAP are already widely cited and used for research.

The other main weakness in the paper is the validation of the multi-animal pose estimation. The core point of the paper is pose estimation and anti-drift performance and yet there is no validation of either of these things relating to multi-animal video. All that is quantified is the ability to track individual identity with a relatively limited dataset of 10 mice IDs with only two in the same arena (and see note about train and validation splits below). While individual tracking is an important task, that literature is not engaged with (i.e. papers like Walter and Couzin, eLife, 2021: https://doi.org/10.7554/eLife.64000) and the results in this paper aren't novel compared to that field's state of the art. On the other hand, while multi-animal pose estimation is also an important problem the paper doesn't engage with those results either. The two methods already used for comparison in the paper, SLEAP and DeepPoseKit, already have multi-animal modes and multi-animal annotated datasets but none of that is tested or engaged with in the paper. The paper notes many existing approaches are two-step methods, but, for practitioners, the difference is not enough to warrant a lack of comparison. The authors state that "The evaluation of our social tracking capability was performed by visualizing the predicted video data (see supplement Videos 3 and 4)." While the authors report success maintaining mouse ID, when one actually watches the key points in the video of the two mice (only a single minute was used for validation) the pose estimation is relatively poor with tails rarely being detected and many pose issues when the mice get close to each other.

Finally, particularly in the methods section, there were a number of places where what was actually done wasn't clear. For example in describing the network architecture, the authors say "Subsequently, network separately process these features in three branches, compute features at scale of one-fourth, one-eight and one-sixteenth, and generate one-eight scale features using convolution layer or deconvolution layer." Does only the one-eight branch have deconvolution or do the other branches also? Similarly, for the speed test, the authors say "Here we evaluate the inference speed of ADPT. We compared it with DeepLabCut and SLEAP on mouse videos at 1288 x 964 resolution", but in the methods section they say "The image inputs of ADPT were resized to a size that can be trained on the computer. For mouse images, it was reduced to half of the original size." Were different image sizes used for training and validation? Or Did ADPT not use 1288 x 964 resolution images as input which would obviously have major implications for the speed comparison? Similarly, for the individual ID experiments, the authors say "In this experiment, we used videos featuring different identified mice, allocating 80% of the data for model training and the remaining 20% for accuracy validation." Were frames from each video randomly assigned to the training or validation sets? Frames from the same video are very correlated (two frames could be just 1/30th of a second different from each other), and so if training and validation frames are interspersed with each other validation performance doesn't indicate much about performance on more realistic use cases (i.e. using models trained during the first part of an experiment to maintain ids throughout the rest of it.)

Editors' note: None of the original reviewers responded to our request to re-review the manuscript. The attached assessment statement is the editor's best attempt at assessing the extent to which the authors addressed the outstanding concerns from the previous round of revisions.

Reviewer #1 (Public review):

Summary:

This study aims to uncover molecular and structural details underlying the broad substrate specificity of glycosaminoglycan lyases belonging to a specific family (PL35). They determined the crystal structures of two such enzymes, conducted in vitro enzyme activity assays, and a thorough structure-guided mutagenesis campaign to interrogate the role of specific residues. They made progress towards achieving their aims and I appreciate the attempt of the authors to address my initial comments on the paper.

Impact on the field:

I expect this work will have limited impact on the field, although it does stand on its own as a solid piece of structure-function analysis.

Strengths:

The major strengths of the study were the combination of structure and enzyme activity assays, comprehensive structural analysis, as well as a thorough structure-guided mutagenesis campaign.

Weaknesses:

(Before revision) -the authors claim to have done a ICP-MS experiment to show Mn2+ binds to their enzyme, but did not present the data. The authors could have used the anomalous scattering properties of Mn2+ at the synchrotron to determine the presence and location of this cation (i.e. fluorescence spectra, and/or anomalous data collection at the Mn2+ absorption peak).<br /> *comment after revision: I appreciate that the authors included this data now, and it looks fine.

(Before revision) -the authors have an over-reliance on molecular docking for understanding the position of substrates bound to the enzyme. The docking analysis performed was cursory at best; Autodock Vina is a fine program but more rigorous software could have been chosen, as well we molecular dynamics simulations. As well the authors do not use any substrate/product-bound structures from the broader PL enzyme family to guide the placement of the substrates in the GAGases, and interpret the molecular docking models.<br /> *comment after revision: the authors used another docking program, which is fine, but did not do any MD analysis or comment on why not. Also maybe it is just me but I still do not see a figure explicitly showing an overlay/superposition of the docking results with crystal structures of similar enzymes with similar ligands. The authors do have a statement in this regard but I believe a figure (e.g. an additional panel on S2) would be very helpful to the reader.

(Before revision)-the conclusion that the structures of GAGase II and VII are most similar to the structures of alginate lyases (Table 2 data), and the authors' reliance on DALI, are both questioned. DALI uses a global alignment algorithm, which when used for multi-domain enzymes such as these tends to result in sub-optimal alignment of active site residues, particularly if the active site is formed between the two domains as is the case here. The authors should evaluate local alignment methods focused on optimization of the superposition of a single domain; these methods may result in a more appropriate alignment of the active site residues, and different alignment statistics. This may influence the overall conclusion of the evolutionary history of these PL35 enzymes.<br /> *comment after revision: I'm not sure the authors understood my suggestion as the reply reiterates the original conclusions. I suggest local structural alignment of *only* the toroid and antiparallel β-sheet domains, not global alignment of both domains, as this would improve the accuracy of the structural similarity conclusions.

(Before revision)-the data on the GAGase III residue His188 is not well interpreted; substitution of this residue clearly impacts HA and HS hydrolysis as well. The data on the impact on alginate hydrolysis is weak, which could be due to the fact that the WT enzyme has poor activity against alginate to start with.<br /> *comment after revision: I appreciate that the authors used higher amounts of H188A variants and still do not see activity on alginate, which strengthens the conclusions regarding this substrate. However this variant also has decreased activity against HS (Figure 5C) and thus H188 appears to be important for more substrates than just alginate. The discussion section should be updated accordingly.

(Before revision)-the authors did not use the words "homology", "homologous", or "homolog" correctly (these terms mean the subjects have a known evolutionary relationship, which may or may not be known in the contexts the authors used these targets); the words "similarity" and "similar" are recommended to be used instead.<br /> *comment after revision: I thank the authors for addressing this.

(Before revision)-the authors discuss a "shorter" cavity in GAGases, which does not make sense, and is not supported by any figure or analysis. I recommend a figure with a surface representation of the various enzymes of interest, with dimensions of the cavity labeled (as a supplemental figure). The authors also do not specifically define what subsites are in the context of this family of enzymes, nor do they specifically label or indicate the location of the subsites on the figures of the GAGase II and IV enzyme structures.<br /> *comment after revision: I thank the authors for improving their figures and text description on this point.

Reviewer #3 (Public review):

Summary:

The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

Strengths:

The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

Weaknesses:

The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

Reviewer #1 (Public review):

Summary:

The manuscript under review investigates the role of periosteal stem cells (P-SSC) in bone marrow regeneration using a whole bone subcutaneous transplantation model. While the model is somewhat artificial, the findings were interesting, suggesting the migration of periosteal stem cells into the bone marrow and their potential to become bone marrow stromal cells. This indicates a significant plasticity of P-SSC consistent with previous reports using fracture models (Cell Stem Cell 29:1547, Dev Cell 59:1192).

Major comments from previous round of review:

(1) The authors assert that the periosteal layer was completely removed in their model, which is crucial for their conclusions. To substantiate this claim, it is recommended that the authors provide evidence of the successful removal of the entire periosteal stem cell (P-SSC) population. A colony-forming assay, with and without periosteal removal, could serve as a suitable method to demonstrate this.

(2) The observation that P-SSCs do not express Kitl or Cxcl12, while their bone marrow stromal cell (BM-MSC) derivatives do, is a key finding. To strengthen this conclusion, the authors are encouraged to repeat the experiment using Cxcl12 or Scf reporter alleles. Immunofluorescence staining that confirms the migration of periosteal cells and their transformation into Cxcl12- or Scf-reporter-positive cells would significantly enhance the paper's key conclusion.

(3) On page 8, line 20, the authors' statement regarding the detection of Periostin+ cells outside the periosteum layer could be misinterpreted due to the use of the periostin antibody. Given that periostin is an extracellular matrix protein, the staining may not accurately represent Periostin-expressing cells but rather the presence of periostin in the extracellular matrix. The authors should revise this section for greater precision.

Comments on revised version:

My comments from the previous round of review have mostly been addressed.

Reviewer #2 (Public review):

Summary:

The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

Strengths:

These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

Weaknesses:

There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

Comments on the current version: The authors have addressed my concerns adequately

Reviewer #1 (Public review):

In this study, Tiang et al. explore the role of ubiquitination of non-structural protein 16 (nsp16) in the SARS-CoV-2 life cycle. nsp16, in conjunction with nsp10, performs the final step of viral mRNA capping through its 2'-O-methylase activity. This modification allows the virus to evade host immune responses and protects its mRNA from degradation. The authors demonstrate that nsp16 undergoes ubiquitination and subsequent degradation by the host E3 ubiquitin ligases UBR5 and MARCHF7 via the ubiquitin-proteasome system (UPS). Specifically, UBR5 and MARCHF7 mediate nsp16 degradation through K48- and K27-linked ubiquitination, respectively. Notably, degradation of nsp16 by either UBR5 or MARCHF7 operates independently, with both mechanisms effectively inhibiting SARS-CoV-2 replication in vitro and in vivo. Furthermore, UBR5 and MARCHF7 exhibit broad-spectrum antiviral activity by targeting nsp16 variants from various SARS-CoV-2 strains. This research advances our understanding of how nsp16 ubiquitination impacts viral replication and highlights potential targets for developing broadly effective antiviral therapies.

Strengths:

The proposed study is of significant interest to the virology community because it aims to elucidate the biological role of ubiquitination in coronavirus proteins and its impact on the viral life cycle. Understanding these mechanisms will address broadly applicable questions about coronavirus biology and enhance our overall knowledge of ubiquitination's diverse functions in cell biology. Employing in vivo studies is a strength.

Weaknesses:

Minor comments:<br /> Figure 5A- The authors should ensure that the figure is properly labeled to clearly distinguish between the IP (Immunoprecipitation) panel and the input panel.

Reviewer #3 (Public review):

Summary:

The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

Strengths:

The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

Comments on revisions:

I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

Reviewer #1 (Public review):

Summary:

The authors investigated causal inference in the visual domain through a set of carefully designed experiments, and sound statistical analysis. They suggest the early visual system has a crucial contribution to computations supporting causal inference.

Strengths:

(1) I believe the authors target an important problem (causal inference) with carefully chosen tools and methods. Their analysis rightly implies the specialization of visual routines for causal inference and the crucial contribution of early visual systems to perform this computation. I believe this is a novel contribution and their data and analysis are in the right direction.<br /> (2) Authors sufficiently discuss the alternative perspective to causal inference.<br /> (3) The authors also expand the discussions beyond pure psychophysics and also include neural aspects.

Weaknesses:

I would not call them weaknesses, perhaps a different perspective:

(1) Authors arguing pro a mere bottom-up contribution of early sensory areas for causal inference. Certainly, as the authors suggested, early sensory areas have a crucial contribution, and the authors expand it to other possibilities in their discussion (but more for more complex scenario). It would say, even in simple cases, we can still consider the effect of top down processes. This particularly makes sense in light of recent studies. These studies progressively suggest perception as an active process that also weighs in strongly, the top-down cognitive contributions. For instance, the most simple cases of perception have been conceptualized along this line (Martin, Solms, and Sterzer 2021) and even some visual illusions (Safavi and Dayan 2022), and other extensions (Kay et al. 2023). Thus, I believe it would be helpful to extend the discussion on the top-down and cognitive contributions of causal inference (of course that can also be hinted at, based on recent developments). Even adaptation, which is central in this study, can be influenced by top-down factors (Keller et al. 2017).

Lastly, I hope the authors find this review helpful. I generally want to try to end all of my reviews with areas of the paper I liked because I think this should be part of the feedback. Certainly, there were many in this manuscript as well (clever questions, experimental design and statistical analysis) that I had to highlight further. I congratulate the authors again on their manuscript and hope they will find it helpful.

Bibliography

Aller, Mate, and Uta Noppeney. 2018. "To Integrate or Not to Integrate: Temporal Dynamics of Bayesian Causal Inference." Biorxiv, December, 504118. .

Cao, Yinan, Christopher Summerfield, Hame Park, Bruno Lucio Giordano, and Christoph Kayser. 2019. "Causal Inference in the Multisensory Brain." Neuron 102 (5): 1076-87.e8. .

Coen, Philip, Timothy P. H. Sit, Miles J. Wells, Matteo Carandini, and Kenneth D. Harris. 2021. "The Role of Frontal Cortex in Multisensory Decisions." Biorxiv, April. Cold Spring Harbor Laboratory, 2021.04.26.441250. .

Kay, Kendrick, Kathryn Bonnen, Rachel N. Denison, Mike J. Arcaro, and David L. Barack. 2023. "Tasks and Their Role in Visual Neuroscience." Neuron 111 (11). Elsevier: 1697-1713. .

Keller, Andreas J, Rachael Houlton, Björn M Kampa, Nicholas A Lesica, Thomas D Mrsic-Flogel, Georg B Keller, and Fritjof Helmchen. 2017. "Stimulus Relevance Modulates Contrast Adaptation in Visual Cortex." Elife 6. eLife Sciences Publications, Ltd: e21589.

Kording, K. P., U. Beierholm, W. J. Ma, S. Quartz, J. B. Tenenbaum, and L. Shams. 2007. "Causal Inference in Multisensory Perception." PloS One 2: e943. .

Martin, Joshua M., Mark Solms, and Philipp Sterzer. 2021. "Useful Misrepresentation: Perception as Embodied Proactive Inference." Trends Neurosci. 44 (8): 619-28. .

Safavi, Shervin, and Peter Dayan. 2022. "Multistability, Perceptual Value, and Internal Foraging." Neuron, August. .

Shams, L. 2012. "Early Integration and Bayesian Causal Inference in Multisensory Perception." In The Neural Bases of Multisensory Processes, edited by M. M. Murray and M. T. Wallace. Frontiers in Neuroscience. Boca Raton (FL).

Shams, Ladan, and Ulrik Beierholm. 2022. "Bayesian Causal Inference: A Unifying Neuroscience Theory." Neuroscience & Biobehavioral Reviews 137 (June): 104619.

Reviewer #2 (Public review):

This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

Reviewer #3 (Public review):

Summary:

This paper presents evidence from three behavioral experiments that causal impressions of "launching events", in which one object is perceived to cause another object to move, depend on motion direction-selective processing. Specifically, the work uses an adaptation paradigm (Rolfs et al., 2013), presenting repetitive patterns of events matching certain features to a single retinal location, then measuring subsequent perceptual reports of a test display in which the degree of overlap between two discs was varied, and participants could respond "launch" or "pass". The three experiments report results of adapting to motion direction, motion speed and "object identity", and examine how the psychometric curves for causal reports shift in these conditions depending on the similarity of adapter and test. While causality reports in the test display were selective for motion direction (Experiment 1), they were not selective for adapter-test speed differences (Experiment 2) nor for changes in object identity induced via color swap (Experiment 3). These results support the notion of a biological implementation of causality perception in the visual system, possibly even independently of computations of object identity.

Strengths:

The setup of the research question and hypotheses are exceptional. The authors thoroughly discuss relevant literature to clearly link their launch/pass paradigm to impressions of causality, strengthening their hypothesis and conclusions. The experiments are carefully performed (appropriate equipment, careful control of eye movements). The slip adaptor is a really nice control condition and effectively mitigates the need to control for motion direction with a drifting grating or similar. Participants were measured with sufficient precision, and a power curve analysis was conducted to determine the sample size. Data analysis and statistical quantification is appropriate. Data and analysis code will be shared on publication, in keeping with open science principles. The paper is concise and well written.

Weaknesses:

I would like to emphasise that in the employed paradigm and previously conducted similar study, the only report options are "launch" or "pass". As pointed out by the authors' reply, the adaptation to launches seems to be a highly specific process and likely is a consequence of the causal interaction between the objects. I would nonetheless be interested to see which of the stimulus features driving the adaptation effect observed here are relevant/irrelevant to subjective causal impressions in an experiment.

References:

Rolfs, M., Dambacher, M., & Cavanagh, P. (2013). Visual Adaptation of the Perception of Causality. Current Biology, 23(3), 250-254. https://doi.org/10.1016/j.cub.2012.12.017

Reviewer #1 (Public review):

Summary:

Machii et al. reported a possible molecular mechanism underlying the parallel evolution of lip hypertrophy in African cichlids. The multifaceted approach taken in this manuscript is highly valued, as it uses histology, proteomics, and transcriptomics to reveal how phylogenetically distinct thick-lips have evolved in parallel. Findings from histology and proteomics connected to wnt signaling through the transcriptome are very exciting.

Strengths:

There is consistency between the results and it is possible to make a strong argument from the results.

Comments on revised version:

The issues I pointed out in the previous review have been carefully answered, and all issues have been addressed. The main points of the manuscript are clear, and the conclusions are easy to understand. The enlarged lips are a notable example of convergent evolution in African cichlids.

Reviewer #1 (Public review):

Summary:

The manuscript focuses on the olfactory system of Pieris brassicae larvae and the importance of olfactory information in their interactions with the host plant Brassica oleracea and the major parasitic wasp Cotesia glomerata. The authors used CRISPR/Cas9 to knockout odorant receptor co-receptors (Orco), and conducted a comparative study on the behavior and olfactory system of the mutant and wild-type larvae. The study found that Orco-expressing olfactory sensory neurons in antennae and maxillary palps of Orco knockout (KO) larvae disappeared, and the number of glomeruli in the brain decreased, which impairs the olfactory detection and primary processing in the brain. Orco KO caterpillars show weight loss and loss of preference for optimal food plants; KO larvae also lost weight when attacked by parasitoids with the ovipositor removed, and mortality increased when attacked by untreated parasitoids. On this basis, the authors further studied the responses of caterpillars to volatiles from plants attacked by the larvae of the same species and volatiles from plants on which the caterpillars were themselves attacked by parasitic wasps. Lack of OR-mediated olfactory inputs prevents caterpillars from finding suitable food sources and from choosing spaces free of enemies.

Strengths:

The findings help to understand the important role of olfaction in caterpillar feeding and predator avoidance, highlighting the importance of odorant receptor genes in shaping ecological interactions.

Weaknesses:

There are the following major concerns:

(1) Possible non-targeted effects of Orco knockout using CRISPR/Cas9 should be analyzed and evaluated in Materials and Methods and Results.

(2) Figure 1E: Only one olfactory receptor neuron was marked in WT. There are at least three olfactory sensilla at the top of the maxillary palp. Therefore, to explain the loss of Orco-expressing neurons in the mutant (Figure 1F), a more rigorous explanation of the photo is required.

(3) In Figure 1G, H, the four glomeruli are circled by dotted lines: their corresponding relationship between the two figures needs to be further clarified.

(4) Line 130: Since the main topic in this study is the olfactory system of larvae, the experimental results of this part are all about antennal electrophysiological responses, mating frequency, and egg production of female and male adults of wild type and Orco KO mutant, it may be considered to include this part in the supplementary files. It is better to include some data about the olfactory responses of larvae.

(5) Line 166: The sentences in the text are about the choice test between " healthy plant vs. infested plant", while in Fig 3C, it is "infested plant vs. no plant". The content in the text does not match the figure.

(6) Lines 174-178: Figure 3A showed that the body weight of Orco KO larvae in the absence of parasitic wasps also decreased compared with that of WT. Therefore, in the experiments of Figure 3A and E, the difference in the body weight of Orco KO larvae in the presence or absence of parasitic wasps without ovipositors should also be compared. The current data cannot determine the reduced weight of KO mutant is due to the Orco knockout or the presence of parasitic wasps.

(7) Lines 179-181: Figure 3F shows that the survival rate of larvae of Orco KO mutant decreased in the presence of parasitic wasps, and the difference in survival rate of larvae of WT and Orco KO mutant in the absence of parasitic wasps should also be compared. The current data cannot determine whether the reduced survival of the KO mutant is due to the Orco knockout or the presence of parasitic wasps.

(8) In Figure 4B, why do the compounds tested have no volatiles derived from plants? Cruciferous plants have the well-known mustard bomb. In the behavioral experiments, the larvae responses to ITC compounds were not included, which is suggested to be explained in the discussion section.

(9) The custom-made setup and the relevant behavioral experiments in Figure 4C need to be described in detail (Line 545).

(10) Materials and Methods Line 448: 10 μL paraffin oil should be used for negative control.

Reviewer #2 (Public review):

Summary:

This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

Strengths:

This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

Weaknesses:

I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

Reviewer #1 (Public review):

The study introduces an open-source, cost-effective method for automating the quantification of male social behaviors in Drosophila melanogaster. It combines machine-learning-based behavioral classifiers developed using JAABA (Janelia Automatic Animal Behavior Annotator) with inexpensive hardware constructed from off-the-shelf components. This approach addresses the limitations of existing methods, which often require expensive hardware and specialized setups. The authors demonstrate that their new "DANCE" classifiers accurately identify aggression (lunges) and courtship behaviors (wing extension, following, circling, attempted copulation, and copulation), closely matching manually annotated ground-truth data. Furthermore, DANCE classifiers outperform existing rule-based methods in accuracy. Finally, the study shows that DANCE classifiers perform as well when used with low-cost experimental hardware as with standard experimental setups across multiple paradigms, including RNAi knockdown of the neuropeptide Dsk and optogenetic silencing of dopaminergic neurons.

The authors make creative use of existing resources and technology to develop an inexpensive, flexible, and robust experimental tool for the quantitative analysis of Drosophila behavior. A key strength of this work is the thorough benchmarking of both the behavioral classifiers and the experimental hardware against existing methods. In particular, the direct comparison of their low-cost experimental system with established systems across different experimental paradigms is compelling. While JAABA-based classifiers have been previously used to analyze aggression and courtship (Tao et al., J. Neurosci., 2024; Sten et al., Cell, 2023; Chiu et al., Cell, 2021; Isshi et al., eLife, 2020; Duistermars et al., Neuron, 2018), the demonstration that they work as well without expensive experimental hardware opens the door to more low-cost systems for quantitative behavior analysis.

Although the study provides a detailed evaluation of DANCE classifier performance, its conclusions would be strengthened by a more comprehensive analysis. The authors assess classifier accuracy using a bout-level comparison rather than a frame-level analysis, as employed in previous studies (Kabra et al., Nat Methods, 2013). They define a true positive as any instance where a DANCE-detected bout overlaps with a manually annotated ground-truth bout by at least one frame. This criterion may inflate true positive rates and underestimate false positives, particularly for longer-duration courtship behaviors. For example, a 15-second DANCE-classified wing extension bout that overlaps with ground truth for only one frame would still be considered a true positive. A frame-level analysis performance would help address this possibility.

In summary, this work provides a practical and accessible approach to quantifying Drosophila behavior, reducing the economic barriers to the study of the neural and molecular mechanisms underlying social behavior.

Reviewer #2 (Public review):

Summary:

This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

Strengths:

The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

Weaknesses:

Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

Reviewer #3 (Public review):

The preprint by Yadav et al. describes a new setup to quantify a number of aggression and mating behaviors in Drosophila melanogaster. The investigation of these behaviors requires the analysis of a large number of videos to identify each kind of behavior displayed by a fly. Several approaches to automatize this process have been published before, but each of them has its limitations. The authors set out to develop a new setup that includes very low-cost, easy-to-acquire hardware and open-source machine-learning classifiers to identify and quantify the behavior.

Strengths:

(1) The study demonstrates that their cheap, simple, and easy-to-obtain hardware works just as well as custom-made, specialized hardware for analyzing aggression and mating behavior. This enables the setup to be used in a wide range of settings, from research with limited resources to classroom teaching.

(2) The authors used previously published software to train new classifiers for detecting a range of behaviors related to aggression and mating and to make them freely available. The classifiers are very positively benchmarked against a manually acquired ground truth as well as existing algorithms.

(3) The study demonstrates the applicability of the setup (hardware and classifiers) to common methods in the field by confirming a number of expected phenotypes with their setup.

Weaknesses:

(1) When measuring the performance of the duration-based classifiers, the authors count any bout of behavior as true positive if it overlaps with a ground-truth positive for only 1 frame - despite the minimal duration of a bout is 10 frames, and most bouts are much longer. That way, true positives could contain cases that are almost totally wrong as long there was an overlap of a single frame. For the mating behaviors that are classified in ongoing bouts, I think performance should be evaluated based on the % of correctly classified frames, not bouts.

(2) In the methods part, only one of the pre-existing algorithms (MateBook), is described. Given that the comparison with those algorithms is a so central part of the manuscript, each of them should be briefly explained and the settings used in this study should be described.

Taken together, this work can greatly facilitate research on aggression and mating in Drosophila. The combination of low-cost, off-the-shelf hardware and open-source, robust software enables researchers with very little funding or technical expertise to contribute to the scientific process and also allows large-scale experiments, for example in classroom teaching with many students, or for systematic screenings.

Reviewer #2 (Public Review):

In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

(1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

(2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

(3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

(4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

(5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

(6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

(7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

(9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

(10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

Reviewer #1 (Public Review):

Summary:

In this manuscript, Quach et al. report a detailed investigation into the defense mechanisms of Caenorhabditis elegans in response to predatory threats from Pristionchus pacificus. Based on principles from predatory imminence and prey refuge theories, the authors delineate three defense modes (pre-encounter, post-encounter, and circa-strike) corresponding to increasing levels of threat proximity. These modes are observed in a controlled but naturalistic setup and are quantified by multiple behavioral outputs defined in time and/or space domains allowing nuanced phenotypic assays. The authors demonstrate that C. elegans displays graded defense behavioral responses toward varied lethality of threats and that only life-threatening predators trigger all three defense modes. The study also offers a narrative on the behavioral strategies and underlying molecular regulation, focusing on the roles of SEB-3 receptors and NLP-49 peptides in mediating responses in these defense modes. They found that the interplay between SEB-3 and NLP-49 peptides appears complex, as evidenced by the diverse outcomes when either or both genes are manipulated in various behavioral modes.

Strengths:

The paper presents an interesting story, with carefully designed experiments and necessary controls, and novel findings and implications about predator-induced defensive behaviors and underlying molecular regulation in this important model organism. The design of experiments and description of findings are easy to follow and well-motivated. The findings contribute to our understanding of stress response systems and offer broader implications for neuroethological studies across species.

Weaknesses:

Although overall the study is well designed and movitated, the paper could benefit from further improvements on some of the methods descriptions and experiment interpretations.

Reviewer #1 (Public review):

Summary:

This paper describes molecular dynamics simulations (MDS) of the dynamics of two T-cell receptors (TCRs) bound to the same major histocompatibility complex molecule loaded with the same peptide (pMHC). The two TCRs (A6 and B7) bind to the pMHC with similar affinity and kinetics, but employ different residue contacts. The main purpose of the study is to quantify via MDS the differences in the inter- and intra-molecular motions of these complexes, with a specific focus on what the authors describe as catch-bond behavior between the TCRs and pMHC, which could explain how T-cells can discriminate between different peptides in the presence of weak separating force.

Strengths:

The authors present extensive simulation data that indicates that, in both complexes, the number of high-occupancy inter-domain contacts initially increases with applied load, which is generally consistent with the authors' conclusion that both complexes exhibit catch-bond behavior, although to different extents. In this way, the paper expands our understanding of peptide discrimination by T-cells. The conclusions of the study are generally well supported by data. Further, the paper makes predictions about the relative strength of the catch-bond response of the two TCRs, which could be tested experimentally through protein mutagenesis and force application in Atomic Force Microscopy.

Reviewer #2 (Public review):

In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

Reviewer #3 (Public review):

Summary:

The paper by Chang-Gonzalez et al. is a molecular dynamics (MD) simulation study of the dynamic recognition (load-induced catch bond) by the T cell receptor (TCR) of the complex of peptide antigen (p) and the major histocompatibility complex (pMHC) protein. The methods and simulation protocols are essentially identical as those employed in a previous study by the same group (Chang-Gonzalez et al., eLife 2024). In the current manuscript the authors compare the binding of the same pMHC complex to two different TCRs, B7 and A6 which was investigated in the previous paper. While the binding is more stable for both TCRs under load (of about 10-15 pN) than in the absence of load, the main difference is that B7 shows a smaller amount of stable contacts with the pMHC than A6.

Strengths:

The topic is interesting because of the relevance of mechanosensing in biological processes including cellular immunology. The MD simulations provide strong evidence that different TCRs can respond mechanically in a different way upon binding the same pMHC complex. These findings are useful for interpreting how mechanical force is employed for modulating different function of T cells.

Joint public review

Summary:

The authors examine the eigenvalue spectrum of the covariance matrix of neural recordings in the whole-brain larval zebrafish during hunting and spontaneous behavior. They find that the spectrum is approximately power law, and, more importantly, exhibits scale-invariance under random subsampling of neurons. This property is not exhibited by conventional models of covariance spectra, motivating the introduction of the Euclidean random matrix model. The authors show that this tractable model captures the scale invariance they observe. They also examine the effects of subsampling based on anatomical location or functional relationships. Finally, they discuss the benefit of neural codes which can be subsampled without significant loss of information.

Strengths:

With large-scale neural recordings becoming increasingly common, neuroscientists are faced with the question: how should we analyze them? To address that question, this paper proposes the Euclidean random matrix model, which embeds neurons randomly in an abstract feature space. This model is analytically tractable and matches two nontrivial features of the covariance matrix: approximate power law scaling, and invariance under subsampling. It thus introduces an important conceptual and technical advance for understanding large-scale simultaneously recorded neural activity.

Comment:

Are there quantitative comparisons of the collapse indices for the null models in Figure 2 and the data covariance in 2F? If so, this could be potentially useful to report.

Reviewer #1 (Public review):

Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents certain weaknesses that could be improved. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice.

Comments on revised version:

Some of the recommendations provided by this Reviewer in the first version of the manuscript have been successfully addressed in the revision. However, others, particularly those related to human translation, remain unresolved due to the lack of additional samples for analysis. Since the revised title now indicates that the mechanisms described were primarily observed in mice, it seems reasonable to defer addressing this issue to future studies.

Reviewer #2 (Public review):

Summary:

This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

Strengths:

The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

Weaknesses:

Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

(1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

- Thanks for the clarification provided on your revised version of the manuscript

(2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

- Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

(3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

- I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

(4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

- Thanks for providing the miRNA quantification on the revised version of the manuscript.

(5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

- Thanks for the clarification provided on your revised version of the manuscript.

(6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

- Thanks for addressing this concern raised by R1 and R2.

(7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

- I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

Comments on revised version:

The authors have addressed most of the changes suggested by R1 and R2.

Reviewer #1 (Public review):

Summary:

This paper explores how diverse forms of inhibition impact firing rates in models for cortical circuits. In particular, the paper studies how the network operating point affects the balance of direct inhibition from SOM inhibitory neurons to pyramidal cells, and disinhibition from SOM inhibitory input to PV inhibitory neurons. This is an important issue as these two inhibitory pathways have largely been studies in isolation. A combination of analytical calculations and direct numerical simulations provide convincing evidence that the interplay of these inhibitory circuits can separately control network gain and stability.

Strengths

The paper has improved in revision, and the intuitive summary statements added to the end of each results section are quite helpful. The addition of numerical simulations to extend the conclusions beyond the linear range of network behavior are also quite helpful.

Weaknesses

None

Reviewer #2 (Public review):

Summary:

Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

Strengths:

(1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

(2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

(3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

Weaknesses:

(1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

(2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

Reviewer #3 (Public review):

Summary:

Bos et al study a computational model of cortical circuits with excitatory (E) and two subtypes of inhibition - parvalbumin (PV) and somatostatin (SOM) expressing interneurons. They perform stability and gain analysis of simplified models with nonlinear transfer functions when SOM neurons are perturbed. Their analysis suggests that in a specific setup of connectivity, instability and gain can be untangled, such that SOM modulation leads to both increase in stability and gain, in contrast to the typical direction in neuronal networks where increased gain results in decreased stability.

Strengths:

- Analysis of the canonical circuit in response to SOM perturbations. Through numerical simulations and mathematical analysis, the authors have provided a rather comprehensive picture of how SOM modulation may affect response changes.<br /> - Shedding light on two opposing circuit motifs involved in the canonical E-PV-SOM circuitry - namely, direct inhibition (SOM -> E) vs disinhibition (SOM -> PV -> E). These two pathways can lead to opposing effects, and it is often difficult to predict which one results from modulating SOM neurons. In simplified circuits, the authors show how these two motifs can emerge and depend on parameters like connection weights.<br /> - Suggesting potentially interesting consequences for cortical computation. The authors suggest that certain regimes of connectivity may lead to untangling of stability and gain, such that increases in network gain are not compromised by decreasing stability. They also link SOM modulation in different connectivity regimes to versatile computations in visual processing in simple models.

Weaknesses:

- Computationally, the analysis is solid, but it's very similar to previous studies (del Molino et al, 2017). Many studies in the past few years have done the perturbation analysis of a similar circuitry with or without nonlinear transfer functions (some of them listed in the references). This study applies the same framework to SOM perturbations, which is a useful computational analysis, in view of the complexity of the high-dimensional parameter space.<br /> - A general weakness of the paper is a lack of direct comparison to biological parameters or experiments. How different experiments can be reconciled by the results obtained here, and what new circuit mechanisms can be revealed? In its current form, the paper reads as a general suggestion that different combinations of gain modulation and stability can be achieved in a circuit model equipped with many parameters (12 parameters). This is potentially interesting but not surprising, given the high dimensional space of possible dynamical properties. A more interesting result would have been to relate this to biology, by providing reasoning why it might be relevant to certain circuits (and not others), or to provide some predictions or postdictions, which are currently not very strong in the manuscript.<br /> - Tuning curves are simulated for an individual orientation (same for all neurons), not considering the heterogeneity of neuronal networks with multiple orientation selectivity (and other visual features) - making the model too simplistic.

Reviewer #1 (Public review):

Summary:

In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift diffusion model, they further find that the best fitting model has different attentional discounts on the taste and health attributes, and that the attentional discount on the health information was larger for the hungry participants.

Strengths:

The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 8 different variants of the DDM, including recent models like the maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

Weaknesses:

While I do appreciate the within-participant design, it does raise a small concern about potential demand effects. The authors' results would have been more compelling if they had replicated when only analyzing the first session from each participant. However, the authors did demonstrate that there was no effect of order on the results, which helps to alleviate this concern.

Reviewer #2 (Public review):

Summary:

This study investigates the effect of fed vs hungry state on food decision making.

70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

Strengths:

The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

Weaknesses:

My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

Comments on revisions: No further comments - all my questions addressed.

Reviewer #3 (Public review):

Summary:

This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry, and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

Strengths:

This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

In summary the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

Weaknesses:

Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) to consuming a drink versus nothing, or (c) both.

Comments on revisions:

The authors addressed all my comments appropriately and I have no further requests. Thank you for the added discussion of findings and extra analyses.

Reviewer #1 (Public Review):

The authors recorded from multiple mossy cells (MCs) of the dentate gyrus in slices or in vivo using anesthesia. They recorded MC spontaneous activity during spontaneous sharp waves (SWs) detected in area CA3 (in vitro) or in CA1 ( in vivo). They find variability of the depolarization of MCs in response to a SW. They then used deep learning to parse out more information. They conclude that CA3 sends different "information" to different MCs. However, this is not surprising because different CA3 neurons project to different MCs and it was not determined if every SW reflected the same or different subsets of CA3 activity.

The strengths include recording up to 5 MCs at a time. The major concerns are in the finding that there is variability. This seems logical, not surprising. Also it is not clear how deep learning could lead to the conclusion that CA3 sends different "information" to different MCs. It seems already known from the anatomy because CA3 neurons have diverse axons so they do not converge on only one or a few MCs. Instead they project to different MCs. Even if they would, there are different numbers of boutons and different placement of boutons on the MC dendrites, leading to different effects on MCs. There also is a complex circuitry that is not taken into account in the discussion or in the model used for deep learning. CA3 does not only project to MCs. It also projects to hilar and other dentate gyrus GABAergic neurons which have complex connections to each other, MCs, and CA3. Furthermore, MCs project to MCs, the GABAergic neurons, and CA3. Therefore at any one time that a SW occurs, a very complex circuitry is affected and this could have very different effects on MCs so they would vary in response to the SW. This is further complicated by use of slices where different parts of the circuit are transected from slice to slice.

It is also not discussed if SWs have a uniform frequency during the recording session. If they cluster, or if MC action potentials occur just before a SW, or other neurons discharge before, it will affect the response of the MC to the SW. If MC membrane potential varies, this will also effect the depolarization in response to the SW.

In vivo, the SWs may be quite different than in vivo but this is not discussed. The circuitry is quite different from in vitro. The effects of urethane could have many confounding influences.

Furthermore, how much the in vitro and in vivo SWs tell us about SWs in awake behaving mice is unclear.

Also, methods and figures are hard to understand.

Reviewer #2 (Public Review):

• A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

• An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

• An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

• A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

Reviewer #3 (Public Review):

Compared to the pyramidal cells of the CA1 and CA3 regions of the hippocampus, and the granule cells of the dentate gyrus (DG), the computational role(s) of mossy cells of the DG have received much less attention over the years and are consequently not well understood. Mossy cells receive feedforward input from granule cells and feedback from CA3 cells. One significant factor is the compression of the large number of CA3 cells that input onto a much smaller population of mossy cells, which then send feedback connections to the granule cell layer. The present paper seeks to understand this compression in terms of neural coding, and asks whether the subthreshold activity of a small number of mossy cells can predict above chance levels the shapes of individual SWs produced by the CA3 cells. Using elegant multielectrode intracellular recordings of mossy cells, the authors use deep learning networks to show that they can train the network to "predict" the shape of a SW that preceded the intracellular activity of the mossy cells. Putatively, a single mossy cell can predict the shape of SWs above chance. These results are interesting, but there are some conceptual issues and questions about the statistical tests that must be addressed before the results can be considered convincing.

Strengths<br /> (1) The paper uses technically challenging techniques to record from multiple mossy cells at the same time, while also recording SWs from the LFP of the CA3 layer. The data appear to be collected carefully and analyzed thoughtfully.<br /> (2) The question of how mossy cells process feedback input from CA3 is important to understand the role of this feedback pathway in hippocampal processing.<br /> (3) Given the concerns expressed below about proper statistical testing are resolved, the data appear supportive of the main conclusions of the authors and suggest that, to some degree, the much smaller population of mossy cells can conserve the information present in the larger population of CA3 cells, presumably by using a more compressed, dense population code.

Weaknesses<br /> (4) Some of the statistical tests appear inappropriate because they treat each CA3 SW and associated Vm from a mossy cell as independent samples. This violates the assumptions of statistical tests such as the Kolmogorov-Smirnov tests of Figure 3C and Fig 3E. Although there is large variability among the SWs recorded and among the Vm's, they cannot be considered independent measurements if they derive from the same cell and same recording site of an individual animal. This becomes especially problematic when the number of dependent samples adds up to the tens of thousands, providing highly inflated numbers of samples that artificially reduce the p values. Techniques such as mixed-effects models are being increasingly used to factor out the effects of within cell and within animal correlations in the data. The authors need to do something similar to factor out these contributions in order to perform statistical tests, throughout the manuscript when this problem occurs.<br /> (5) A separate statistical problem occurs when comparing real data against a shuffled, surrogate data set. From the methods, I gather that Figure 3C combined data from 100 surrogate shuffles to compare to the real data. It is inappropriate to do a classic statistical test of data against such shuffles, because the number of points in the pooled surrogate data sets are not true samples from a population. It is a mathematical certainty that one can eventually drive a p value to < 0.05 just by increasing the number of shuffles sufficiently. Thus, the p value is determined by the number of computer shuffles allowed by the time and processing power of a computer, rather than by sampling real data from the population. Figures such as 4C and 5A are examples that test data against shuffle appropriately, as a single value is determined to be within or outside the 95% confidence interval of the shuffle, and this determination is not directly affected by the number of shuffles performed.<br /> (6) The last line of the Discussion states that this study provides "important insights into the information processing of neural circuits at the bottleneck layer," but it is not clear what these insights are. If the statistical problems are addressed appropriately, then the results do demonstrate that the information that is reflected in SWs can be reconstructed by cells in the MC bottleneck, but it is not certain what conceptual insights the authors have in mind. They should discuss more how these results further our understanding of the function of the feedback connection from CA3 to the mossy cells, discuss any limitations on their interpretation from recording LFPs rather than the single-unit ensemble activity (where the information is really encoded).<br /> 7) In Figure 1C, the maximum of the MC response on the first inset precedes the SW, and the onset of the Vm response may be simultaneous with SW. This would suggest that the SW did not drive the mossy cell, but this was a coincident event. How many SW-mossy cell recordings are like this? Do the authors have a technical reason to believe that these are events in which the mossy cell is driven by the CA3 cells active during the SW?

Reviewer #1 (Public review):

Summary:

This manuscript described a structure-guided approach to graft important antigenic loops of the neuraminidase to a homotypic but heterologous NA. This approach allows the generation of well-expressed and thermostable recombinant proteins with antigenic epitopes of choice to some extent. The loop-grafted NA was designated hybrid.

Strengths:

The hybrid NA appeared to be more structurally stable than the loop-donor protein while acquiring its antigenicity. This approach is of value when developing a subunit NA vaccine which is difficult to express. So that antigenic loops could be potentially grafted to a stable NA scaffold to transfer strain-specific antigenicity.

Weaknesses:

However, major revisions to better organize the text, and figure and make clarifications on a number of points, are needed. There are a few cases in which a later figure was described first, data in the figures were not sufficiently described, or where there were mismatched references to figures.

More importantly, the hybrid proteins did not show any of the advantages over the loop-donor protein in the format of VLP vaccine in mouse studies, so it's not clear why such an approach is needed to begin with if the original protein is doing fine.

Reviewer #2 (Public review):

In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

Major points

(1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

(2) The rationale regarding the PR8 hybrid is not well described and should be described better.

(3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

(4) Figure 5A and 7A: Negative controls are missing.

(5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

https://www.fedex.com/fedextrack/?trknbr=286005179179&trkqual=12029~286005179179~FDEG

Reviewer #1 (Public review):

Summary:

In this manuscript, Wu et al. introduce a novel approach to reactivate the Muller glia cell cycle in the mouse retina by simultaneously reducing p27Kip1 and increasing cyclin D1 using a single AAV vector. The approach effectively promotes Muller glia proliferation and reprogramming without disrupting retinal structure or function. Interestingly, reactivation of the Muller glia cell cycle downregulates IFN pathway, which may contribute to the induced retinal regeneration. The results presented in this manuscript may offer a promising approach for developing Müller glia cell-mediated regenerative therapies for retinal diseases.

Comments on revisions:

The authors have revised the manuscript and addressed my concerns.

Reviewer #2 (Public review):

This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

Reviewer #1 (Public review):

Summary:

Mehmet Mahsum Kaplan et al. demonstrate that Meis2 expression in neural crest-derived mesenchymal cells is crucial for whisker follicle (WF) development, as WF fails to develop in wnt1-Cre;Meis2 cKO mice. Advanced imaging techniques effectively support the idea that Meis2 is essential for proper WF development and that nerves, while affected in Meis2 cKO, are dispensable for WF development and not the primary cause of WF developmental failure. The study also reveals that although Meis2 significantly downregulates Foxd1 in the mesenchyme, this is not the main reason for WF development failure. The paper presents valuable data on the role of mesenchymal Meis2 in WF development. However, it is still not known what is the molecular mechanisms that link Meis2 to impact the epithelial compartment.

Strengths:

(1) The authors describe a novel molecular mechanism involving Mesenchymal Meis2 expression, which plays a crucial role in early WF development.<br /> (2) They employ multiple advanced imaging techniques to illustrate their findings beautifully.<br /> (3) The study clearly shows that nerves are not essential for WF development.

Weaknesses:

The paper lacks clarity on how Meis2 loss, along with the observed general reduction in proliferation and changes in extracellular matrix and cell adhesion, leads specifically to the loss of whisker follicles. Future studies addressing this gap, perhaps with methods enabling higher cell recovery or epithelial cell inclusion in the sequenced cells, could provide valuable insights into the specific roles of Meis2 in this context.

Reviewer #2 (Public review):

Summary:

In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

Strengths:

The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

Comments on revised version:

In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

Additional comments:

The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

Reviewer #1 (Public Review):

Summary:

In this work, the authors present a novel, multi-layer computational model of motor control to produce realistic walking behaviour of a Drosophila model in the presence of external perturbations and under sensory and motor delays. The novelty of their model of motor control is that it is modular, with divisions inspired by the fly nervous system, with one component based on deep learning while the rest are based on control theory. They show that their model can produce realistic walking trajectories. Given the mostly reasonable assumptions of their model, they convincingly show that the sensory and motor delays present in the fly nervous system are the maximum allowable for robustness to unexpected perturbations.

Their fly model outputs torque at each joint in the leg, and their dynamics model translates these into movements, resulting in time-series trajectories of joint angles. Inspired by the anatomy of the fly nervous system, their fly model is a modular architecture that separates motor control at three levels of abstraction:<br /> (1) oscillator-based model of coupling of phase angles between legs,<br /> (2) generation of future joint-angle trajectories based on the current state and inputs for each leg (the trajectory generator), and<br /> (3) closed-loop control of the joint-angles using torques applied at every joint in the model (control and dynamics).

These three levels of abstraction ensure coordination between the legs, future predictions of desired joint angles, and corrections to deviations from desired joint-angle trajectories. The parameters of the model are tuned in the absence of external perturbations using experimental data of joint angles of a tethered fly. A notable disconnect from reality is that the dynamics model used does not model the movement of the body and ground contacts as is the case in natural walking, nor the movement of a ball for a tethered fly, but instead something like legs moving in the air for a tethered fly.

In order to validate the realism of the generated simulated walking trajectories, the authors compare various attributes of simulated to real tethered fly trajectories and show qualitative and quantitative similarities, including using a novel metric coined as Kinematic Similarity (KS). The KS score of a trajectory is a measure of the likelihood that the trajectory belongs to the distribution of real trajectories estimated from the experimental data. While such a metric is a useful tool to validate the quality of simulated data, there is some room for improvement in the actual computation of this score. For instance, the KS score is computed for any given time-window of walking simulation using a fraction of information from the joint-angle trajectories. It is unclear if the remaining information in joint-angle trajectories that are not used in the computation of the KS score can be ignored in the context of validating the realism of simulated walking trajectories.

The authors validate simulated walking trajectories generated by the trained model under a range of sensorimotor delays and external perturbations. The trained model is shown to generate realistic joint-angle trajectories in the presence of external perturbations as long as the sensorimotor delays are constrained within a certain range. This range of sensorimotor delays is shown to be comparable to experimental measurements of sensorimotor delays, leading to the conclusion that the fly nervous system is just fast enough to be robust to perturbations.

Strengths:

This work presents a novel framework to simulate Drosophila walking in the presence of external perturbations and sensorimotor delay. Although the model makes some simplifying assumptions, it has sufficient complexity to generate new, testable hypotheses regarding motor control in Drosophila. The authors provide evidence for realistic simulated walking trajectories by comparing simulated trajectories generated by their trained model with experimental data using a novel metric proposed by the authors. The model proposes a crucial role in future predictions to ensure robust walking trajectories against external perturbations and motor delay. Realistic simulations under a range of prediction intervals, perturbations, and motor delays generating realistic walking trajectories support this claim. The modular architecture of the framework provides opportunities to make testable predictions regarding motor control in Drosophila. The work can be of interest to the Drosophila community interested in digitally simulating realistic models of Drosophila locomotion behaviors, as well as to experimentalists in generating testable hypotheses for novel discoveries regarding neural control of locomotion in Drosophila. Moreover, the work can be of broad interest to neuroethologists, serving as a benchmark in modelling animal locomotion in general.

Weaknesses:

As the authors acknowledge in their work, the control and dynamics model makes some simplifying assumptions about Drosophila physics/physiology in the context of walking. For instance, the model does not incorporate ground contact forces and inertial effects of the fly's body. It is not clear how these simplifying assumptions would affect some of the quantitative results derived by the authors. The range of tolerable values of sensorimotor delays that generate realistic walking trajectories is shown to be comparable with sensorimotor delays inferred from physiological measurements. It is unclear if this comparison is meaningful in the context of the model's simplifying assumptions. The authors propose a novel metric coined as Kinematic Similarity (KS) to distinguish realistic walking trajectories from unrealistic walking trajectories. Defining such an objective metric to evaluate the model's predictions is a useful exercise, and could potentially be applied to benchmark other computational animal models that are proposed in the future. However, the KS score proposed in this work is calculated using only the first two PCA modes that cumulatively account for less than 50% of the variance in the joint angles. It is not obvious that the information in the remaining PCA modes may not change the log-likelihood that occurs in the real walking data.

Comments on revisions:

The authors have addressed the concerns and questions raised in the original review.

Reviewer #2 (Public Review):

Summary:

In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

Strengths:

Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

Weaknesses:

The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

(1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

(2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

(3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

Comments on revisions:

The authors have addressed the concerns and questions raised in the original review.

Reviewer #1 (Public review):

The authors introduces DIPx, a deep learning framework for predicting synergistic drug combinations for cancer treatment using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset. While the approach is innovative, I have following concerns and comments, and hopefully will improve the study's rigor and applicability, making it a more powerful tool in real clinical world.

(1) In the abstract: "We trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set, while Test Set 2 contained combinations absent from the training set, thus indicating the model's ability to handle novel combinations". Test Set 1 comprises combinations already present in the training set, likely leading overfitting issue. The model might show inflated performance metrics on this test set due to prior exposure to these combinations, not accurately reflecting its true predictive power on unknown data, which is crucial for discovering new drug synergies. The testing approach reduces the generalizability of the model's findings to new, untested scenarios.

(2) The model struggles with predicting synergies for drug combinations not included in its training data (showing only Spearman correlation 0.26 in Test Set 2). This limits its potential for discovering new therapeutic strategies. Utilizing techniques such as transfer learning or expanding the training dataset to encompass a wider range of drug pairs could help to address this issue.

(3) The use of pan-cancer datasets, while offering broad applicability, may not be optimal for specific cancer subtypes with distinct biological mechanisms. Developing subtype-specific models or adjusting the current model to account for these differences could improve prediction accuracy for individual cancer types.

(4) Line 127, "Since DIPx uses only molecular data, to make a fair comparison, we trained TAJI using only molecular features and referred to it as TAJI-M.". TAJI was designed to use both monotherapy drug-response and molecular data, and likely won't be able to reach maximum potential if removing monotherapy drug-response from the training model. It would be critical to use the same training datasets and then compare the performances. From the Figure 6 of TAJI's paper (Li et al., 2018, PMID: 30054332) , i.e., the mean Pearson correlation for breast cancer and lung cancer are around 0.5 - 0.6.

The following 2 concerns had been include in the Discussion section which are great:

(1) Training and validating the model using cell lines may not fully capture the heterogeneity and complexity of in vivo tumors. To increase clinical relevance, it would be beneficial to validate the model using primary tumor samples or patient-derived xenografts.

(2) The Pathway Activation Score (PAS) is derived exclusively from primary target genes, potentially overlooking critical interactions involving non-primary targets. Including these secondary effects could enhance the model's predictive accuracy and comprehensiveness.

Comments on revisions:

The authors replied to my concerns but they did not address my comments/concerns. Especially for my concern #1: They trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set. Therefore, test Set 1 comprises combinations already present in the training set, likely leading overfitting issue but they claimed "There is no danger overfitting here" in their "Author Response" letter.

All my other concerns are unchanged too.

Reviewer #2 (Public review):

Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

(1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

Reviewer #3 (Public review):

Summary:

Predicting how two different drugs act together by looking at their specific gene targets and pathways is crucial for understanding the biological significance of drug combinations. This study incorporates drug-specific pathway activation scores (PASs) to estimate synergy scores as one of the key advancements for synergy prediction. The new algorithm, Drug synergy Interaction Prediction (DIPx), developed in this study, uses gene expression, mutation profiles, and drug synergy data to train the model and predict synergy between two drugs. Comprehensive comparisons with another best-performing algorithm, TAIJI-M, highlight the potential of its capabilities.

Strengths:

DIPx uses target and driver genes to elucidate pathway activation scores (PASs) to predict drug synergy. This approach integrates gene expression, mutation profiles, and drug synergy data to capture information about the functional interactions between drug targets, thereby providing a potential biological explanation for the synergistic effects of combined drugs. DIPx's performance was tested using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset, especially in Test Set 1, where the Spearman correlation coefficient between predicted and observed drug synergy was 0.50 (95% CI: 0.47-0.53). DIPx's ability to handle novel combinations, as evidenced by its performance in Test Set 2, indicates its potential for predictions of new and untested drug combinations.

Weaknesses:

While the DIPx algorithm shows promise in predicting drug synergy based on pathway activation scores, it's essential to consider its limitations. One limitation is that the availability of training data for specific drug combinations may influence its predictive capability. Further testing and experimental validation of the predictions in future studies would be necessary to fully assess the algorithm's generalizability and robustness.

Reviewer #1 (Public review):

Summary:

Jocher, Janssen, et al examine the robustness of comparative functional genomics studies in primates that make use of induced pluripotent stem cell-derived cells. Comparative studies in primates, especially amongst the great apes, are generally hindered by the very limited availability of samples, and iPSCs, which can be maintained in the laboratory indefinitely and defined into other cell types, have emerged as promising model systems because they allow the generation of data from tissues and cells that would otherwise be unobservable.

Undirected differentiation of iPSCs into many cell types at once, using a method known as embryoid body differentiation, requires researchers to manually assign all cell types in the dataset so they can be correctly analysed. Typically, this is done using marker genes associated with a specific cell type. These are defined a priori, and have historically tended to be characterised in mice and humans and then employed to annotate other species. Jocher, Janssen, et al ask if the marker genes and features used to define a given cell type in one species are suitable for use in a second species, and then quantify the degree of usefulness of these markers. They find that genes that are informative and cell type specific in a given species are less valuable for cell type identification in other species, and that this value, or transferability, drops off as the evolutionary distance between species increases.

This paper will help guide future comparative studies of gene expression in primates (and more broadly) as well as add to the growing literature on the broader challenges of selecting powerful and reliable marker genes for use in single-cell transcriptomics.

Strengths:

Marker gene selection and cell type annotation is a challenging problem in scRNA studies, and successful classification of cells often requires manual expert input. This can be hard to reproduce across studies, as, despite general agreement on the identity of many cell types, different methods for identifying marker genes will return different sets of genes. The rise of comparative functional genomics complicates this even further, as a robust marker gene in one species need not always be as useful in a different taxon. The finding that so many marker genes have poor transferability is striking, and by interrogating the assumption of transferability in a thorough and systematic fashion, this paper reminds us of the importance of systematically validating analytical choices. The focus on identifying how transferability varies across different types of marker genes (especially when comparing TFs to lncRNAs), and on exploring different methods to identify marker genes, also suggests additional criteria by which future researchers could select robust marker genes in their own data.

The paper is built on a substantial amount of clearly reported and thoroughly considered data, including EBs and cells from four different primate species - humans, orangutans, and two macaque species. The authors go to great lengths to ensure the EBs are as comparable as possible across species, and take similar care with their computational analyses, always erring on the side of drawing conservative conclusions that are robustly supported by their data over more tenuously supported ones that could be impacted by data processing artefacts such as differences in mappability, etc. For example, I like the approach of using liftoff to robustly identify genes in non-human species that can be mapped to and compared across species confidently, rather than relying on the likely incomplete annotation of the non-human primate genomes. The authors also provide an interactive data visualisation website that allows users to explore the dataset in depth, examine expression patterns of their own favourite marker genes and perform the same kinds of analyses on their own data if desired, facilitating consistency between comparative primate studies.

Weaknesses and recommendations:

(1) Embryoid body generation is known to be highly variable from one replicate to the next for both technical and biological reasons, and the authors do their best to account for this, both by their testing of different ways of generating EBs, and by including multiple technical replicates/clones per species. However, there is still some variability that could be worth exploring in more depth. For example, the orangutan seems to have differentiated preferentially towards cardiac mesoderm whereas the other species seemed to prefer ectoderm fates, as shown in Figure 2C. Likewise, Supplementary Figure 2C suggests a significant unbalance in the contributions across replicates within a species, which is not surprising given the nature of EBs, while Supplementary Figure 6 suggests that despite including three different clones from a single rhesus macaque, most of the data came from a single clone. The manuscript would be strengthened by a more thorough exploration of the intra-species patterns of variability, especially for the taxa with multiple biological replicates, and how they impact the number of cell types detected across taxa, etc.

The same holds for the temporal aspect of the data, which is not really discussed in depth despite being a strength of the design. Instead, days 8 and 16 are analysed jointly, without much attention being paid to the possible differences between them. Are EBs at day 16 more variable between species than at day 8? Is day 8 too soon to do these kinds of analyses? Are markers for earlier developmental progenitors better/more transferable than those for more derived cell types?

(2) Closely tied to the point above, by necessity the authors collapse their data into seven fairly coarse cell types and then examine the performance of canonical marker genes (as well as those discovered de novo) across the species. However some of the clusters they use are somewhat broad, and so it is worth asking whether the lack of specificity exhibited by some marker genes and driving their conclusions is driven by inter-species heterogeneity within a given cluster.

Reviewer #2 (Public review):

Summary:

The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

Strengths:

To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

Weaknesses:

However, several critical points need to be addressed.

(1) Use of Liftoff for GTF Annotation

The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

(2) Transcript Filtering and Potential Biases

The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

(3) Data Integration with Harmony

The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

Reviewer #1 (Public review):

Summary:

This is an important and very well-presented set of experiments following up on prior work from the lab investigating knock-down (KD) of EMC10 in restoration of neuronal and cognitive deficits in 22q11.2 Del models, including now both human iPSCs and a mouse model in vivo now with ASOs.

The valuable progress in this current manuscript is the development of ASOs, and the proof of efficacy in vivo in mouse of the ASO in knock-down of EMC10 and amelioration of in vivo behavioral phenotypes.

The experiments include: iPSC studies demonstrating elevations of EMC10 in a solid collection of paired iPSC lines. These studies also provide evidence of manipulation of EMC10 by overexpression and inhibition of miRNAs that exist in the 22q11 interval. The iPSC studies also nicely demonstrate rescue of impairments with KD of EMC10 in neuronal arborization as well as KCl induced neuronal activity. The major in vivo contributions reflect impressive demonstration of efficacy of two ASOs in vivo on both KD of EMC10 in vivo and through improvement in behavioral abnormalities in the 22q11 mouse in a range of different behaviors, including social behavior and learning behaviors.

Overall, there are many strengths reflected in this study, including in particular the synergy between in vitro studies in human cell models and in vivo studies in the well characterized mouse model. The experiments are generally rigorously performed and well powered, and nicely presented. The claims with regard to the mechanisms of EMC10 elevations and the importance of restoration of EMC10 expression to neuronal morphology and behavior are well supported by the data. The work may be further supported in future studies, by investigation of rescue by ASOs of circuit dysfunction in vivo or ex vivo through electrophysiology in the mouse model. Also, in future studies, investigation of the mechanism by which EMC10, an ER protein involved in protein processing, may function in the observed neuronal abnormalities; however, these studies are clearly for future investigations.

The potential impact of the work is found in the potential value of the ASO approach to the treatment of 22q11, or the pre-clinical evidence that knock-down of this protein may lead to some amelioration of cognitive symptoms. Overall, a very convincing and complementary set of experiments to support EMC10 KD as a therapeutic strategy.

Review of revision: The authors have addressed the questions from the prior review.

Reviewer #2 (Public review):

This manuscript by Yu et al. demonstrates that activation of caspase-3 is essential for synapse elimination by microglia, but not by astrocytes. This study also reveals that caspase-3 activation-mediated synapse elimination is required for retinogeniculate circuit refinement and eye-specific territories segregation in dLGN in an activity-dependent manner. Inhibition of synaptic activity increases caspase-3 activation and microglial phagocytosis, while caspase-3 deficiency blocks microglia-mediated synapse elimination and circuit refinement in the dLGN. The authors further demonstrate that caspase-3 activation mediates synapse loss in AD, loss of caspase-3 prevented synapse loss in AD mice. Overall, this study reveals that caspase-3 activation is an important mechanism underlying the selectivity of microglia-mediated synapse elimination during brain development and in neurodegenerative diseases.

A previous study (Gyorffy B. et al., PNSA 2018) has shown that caspase-3 signal correlates with C1q tagging of synapses (mostly using in vitro approaches), which suggests that caspase-3 would be an underlying mechanism of microglial selection of synapses for removal. The current study provides convincing in vivo evidence demonstrating that caspase-3 activation is essential for microglial elimination of synapses during both brain development and neurodegeneration.

Reviewer #2 (Public review):

The authors investigated the similarity (or lack thereof) of neural dynamics while monkeys reached to and manipulated one of 4 objects in each trial, compared to observing similar movements performed by experimenters. They focused on mirror neurons (MNs) and rather convincingly showed that MNs dynamics are dissimilar during executing vs. observing actions. The manuscript has improved quite significantly compared to the previous version and I congratulate the authors for that. However, there are still a few points I would like to raise that I think will improve the manuscript scientifically and make it more pleasant to read.

- I appreciate the nicely compiled literature review which provides the context for the manuscript.<br /> - Message: The takeaway message of the paper is inconsistent and changes throughout the paper. To me, the main takeaway is that observation and execution subspaces progress during the trial (Fig 4), and that they are distinct processes and rather dissimilar, as stated in #440-441, #634-635, etc. But the title of the paper implies the opposite. Some of the interpretations of the results (e.g., Fig 8) also imply similarity of dynamics.<br /> - Readability: I have many issues with the readability/organisation of the paper. Unfortunately, I still find the quality of data presentation low. Below I list a few points:<br /> (1) In 5 sessions out of 9, there are fewer than 20 neurons categorised as AE. This means this population is under-sampled in the data which makes applying any neural population techniques questionable. Moreover, the relevance of the AE analysis is also sometimes unclear: In Fig 4, the AE-related panels are just referred to once in the paper. Yet AE results are presented right next to the main results throughout the paper.<br /> (2) Figures are low resolution and pixelated. There are some faded horizontal and vertical lines in Fig1B that are barely visible. Moreover, it may be my personal preference, but I think Fig1 is more confusing than helpful. Although panel A shows some planes rotating, indicating time-varying dynamics, I couldn't understand what more panel B is trying to convey. The arrow of time is counterclockwise, but the planes progress clockwise (i > ii > iii). Similarly, panel C just seems to show some points being projected to orthogonal subspaces (even though later in the paper we'll see that observation and execution subspaces are not orthogonal), and the CCA subspace illustrated in the same high-d space, which mathematically may be inaccurate, as CCA projects the data to a new space.<br /> In Fig 2A, the objects are too small and pixelated as well. I suggest an overhaul of the figures to make the paper more accessible.<br /> (3) Clarity of the text: The manuscript text could be more concise, to the point, avoiding repetitions, self-consistent, and simply readable. To name a few issues: Single letter acronyms were used to refer to trial epochs (I/G/M/H). M alone has been re-defined 13 different times in the text as in: ...Movement (M)..., excluding every related figure. The acronym (I) refers to the instruction epoch, the high-d space in Fig 1, and panel I of some figures. The acronym MN for Mirror Neurons was defined 4 separate times in the text yet spelled out as Mirror Neuron more than 2 dozen times. CD is defined in the caption of Fig 3 and never used, despite condition-dependent being a common term in the text. Many sentences, e.g., "In contrast, throughout..." in #265-#269, and "To summarize,..." in #270-#275, are too long with difficult wording. To get the point from these sentences, I had to read them many times, and go back and forth between them and the figure. Rewriting such sentences makes the manuscript much more accessible.<br /> - Figure 3: It appears that the condition independent signal has been calculated by subtracting the average of the 4 neural trajectories in Fig 3A, corresponding to different objects. Whereas #133 suggests that it should be calculated by subtracting the average firing rate of different conditions. Assuming I got the methods right, dynamics being "knotted" (#234) after removing the condition independent signal could be because they are similar, so subtracting the condition independent signal leaves us with the noise component. This matters for the manuscript especially since this is the reason for performing the more sensitive instantaneous subspaces.<br /> - Decoding results: I appreciate that the authors improved the decoding results in this version of the manuscript. Now it is much more interesting. However oddly, it appears that only data from 1 monkey is shown. #370 says the results from the other 2 are similar. The decoding data from every monkey must be shown. If the results are similar, they must be at least in Supplements. Currently, only 1 session (out of 3) in the Observation condition seems to decode the object type. This effect, if consistent across animals and session, is very interesting on its own and challenges other claims in the paper.<br /> - Figure8: I reiterate the issue #7 in my previous review. I appreciate the authors clearing some methods, but my concern persists. As per line #839, spiking activity has been smoothed with a 50ms kernel. Thus, unless trial data is concatenated, I suspect the 100ms window used for this analysis is too short (small sample size), thus the correlation values (CCs) might be spurious. References cited in this section use a smaller smoothing kernel (30ms) and a much longer window (~450ms).<br /> Moreover, I don't know why the authors chose to show correlation values in 3D space! Values of Fig8C-red are impossible to know. Furthermore, the manuscript insists on CC values of the Hold period being high, which is probably correct. But I wonder why the focus on the Hold period? I think the most relevant epoch for analysing the MNs is the Movement where the actual action happens. Interestingly, in the movement epoch, the CC values are visibly low. The reason why Hold results are more important and why the CCs in Movement are so low should be clarified in the text. Especially, statements like that in #661 seem particularly unjustified.

Reviewer #3 (Public review):

In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

Reviewer #4 (Public review):

Summary:

In this study, the authors explore the neural dynamics of mirror neurons in the premotor cortex, focusing on the relationship between neural activity during action execution and observation. The study presents a rich dataset from three monkeys, with recordings from two regions per monkey. The authors use a method to analyze instantaneous neural subspaces and track their temporal evolution. Consistent with prior literature, they report that execution and observation subspaces remain largely distinct throughout the trial. However, after applying canonical correlation analysis, they observe a notable alignment between execution and observation activities, suggesting the presence of shared neural codes. The study is well-designed, and the analyses are thoroughly documented, occasionally overly so in the main text. While most findings are compelling, I find the conclusions drawn from Figure 8 less convincing. Specifically, I am skeptical about the application of CCA in this context and the subsequent interpretations regarding execution-observation similarity, which is a central claim of the manuscript.

• The authors cite Safaie et al. 2023 as a precedent for applying CCA to align neural population dynamics. However, in that study, CCA was used to align neural dynamics across different animals, a justifiable approach given that neural trajectories exist in separate neural state spaces for each animal. Here, CCA is applied to align execution and observation activities within the same neural state space of the same MNs. I find this application of CCA less well-justified, as it may overestimate execution-observation similarity.<br /> • The control conditions presented in Figures 8C and 8D are somewhat reassuring, as they show that the similarity introduced by CCA is not universally high. However, these controls appear to be limited to the Hold epoch. It remains unclear whether the same holds true for the Go and Movement epochs.<br /> • In Figure 5, the authors display low-dimensional representations of four objects across task epochs during execution (A) and observation (B). The diagonals of the matrices reveal clear differences between execution and observation configurations across all four epochs. The authors suggest using CCA to align these configurations; however, this alignment seems to require time-specific application of CCA for each epoch (as demonstrated in Figure 8 for the Hold epoch). The need for time-specific adjustments likely depends on the fact that execution and observation subspaces are continuously shifting over time (as authors show in Figure 4), but this approach appears to be a strained attempt to demonstrate similarity between execution and observation codes.<br /> • The authors themselves offer an alternative hypothesis (line 730): that "PM MN population activity during action observation, rather than representing movements made by another individual similar to one's own movements, instead may represent different movements one might execute oneself in response to those made by another individual". This interpretation appears more congruent with the data presented.<br /> • In the end, I am left with a sense of ambiguity: which analysis should be considered more reliable, the negligible correspondence between execution and observation activity depicted in Figure 7, or the considerable similarity shown in Figure 8? The authors should address this apparent contradiction and provide a clearer discussion to reconcile these findings.

Reviewer #1 (Public review):

Summary:

From a forward genetic mosaic mutant screen using EMS, the authors identify mutations in glucosylceramide synthase (GlcT), a rate-limiting enzyme for glycosphingolipid (GSL) production, that result in EE tumors. Multiple genetic experiments strongly support the model that the mutant phenotype caused by GlcT loss is due to by failure of conversion of ceramide into glucosylceramide. Further genetic evidence suggests that Notch signaling is comprised in the ISC lineage and may affect the endocytosis of Delta. Loss of GlcT does not affect wing development or oogenesis, suggesting tissue-specific roles for GlcT. Finally, an increase in goblet cells in UGCG knockout mice, not previously reported, suggests a conserved role for GlcT in Notch signaling in intestinal cell lineage specification.

Strengths:

Overall, this is a well-written paper with multiple well-designed and executed genetic experiments that support a role for GlcT in Notch signaling in the fly and mammalian intestine. I do, however, have a few comments below.

Weaknesses:

(1) The authors bring up the intriguing idea that GlcT could be a way to link diet to cell fate choice. Unfortunately, there are no experiments to test this hypothesis.

(2) Why do the authors think that UCCG knockout results in goblet cell excess and not in the other secretory cell types?

(3) The authors should cite other EMS mutagenesis screens done in the fly intestine.

(4) The absence of a phenotype using NRE-Gal4 is not convincing. This is because the delay in its expression could be after the requirement for the affected gene in the process being studied. In other words, sufficient knockdown of GlcT by RNA would not be achieved until after the relevant signaling between the EB and the ISC occurred. Dl-Gal4 is problematic as an ISC driver because Dl is expressed in the EEP.

(5) The difference in Rab5 between control and GlcT-IR was not that significant. Furthermore, any changes could be secondary to increases in proliferation.

Reviewer #2 (Public review):

Summary:

This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

Strengths:

The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

Weaknesses:

This study is not, however, without caveats and several specific conclusions are not fully convincing.

First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

Reviewer #3 (Public review):

Summary:

In this paper, Tang et al report the discovery of a Glycoslyceramide synthase gene, GlcT, which they found in a genetic screen for mutations that generate tumorous growth of stem cells in the gut of Drosophila. The screen was expertly done using a classic mutagenesis/mosaic method. Their initial characterization of the GlcT alleles, which generate endocrine tumors much like mutations in the Notch signaling pathway, is also very nice. Tang et al checked other enzymes in the glycosylceramide pathway and found that the loss of one gene just downstream of GlcT (Egh) gives similar phenotypes to GlcT, whereas three genes further downstream do not replicate the phenotype. Remarkably, dietary supplementation with a predicted GlcT/Egh product, Lactosyl-ceramide, was able to substantially rescue the GlcT mutant phenotype. Based on the phenotypic similarity of the GlcT and Notch phenotypes, the authors show that activated Notch is epistatic to GlcT mutations, suppressing the endocrine tumor phenotype and that GlcT mutant clones have reduced Notch signaling activity. Up to this point, the results are all clear, interesting, and significant. Tang et al then go on to investigate how GlcT mutations might affect Notch signaling, and present results suggesting that GlcT mutation might impair the normal endocytic trafficking of Delta, the Notch ligand. These results (Fig X-XX), unfortunately, are less than convincing; either more conclusive data should be brought to support the Delta trafficking model, or the authors should limit their conclusions regarding how GlcT loss impairs Notch signaling. Given the results shown, it's clear that GlcT affects EE cell differentiation, but whether this is via directly altering Dl/N signaling is not so clear, and other mechanisms could be involved. Overall the paper is an interesting, novel study, but it lacks somewhat in providing mechanistic insight. With conscientious revisions, this could be addressed. We list below specific points that Tang et al should consider as they revise their paper.

Strengths:

The genetic screen is excellent.

The basic characterization of GlcT phenotypes is excellent, as is the downstream pathway analysis.

Weaknesses:

(1) Lines 147-149, Figure 2E: here, the study would benefit from quantitations of the effects of loss of brn, B4GalNAcTA, and a4GT1, even though they appear negative.

(2) In Figure 3, it would be useful to quantify the effects of LacCer on proliferation. The suppression result is very nice, but only effects on Pros+ cell numbers are shown.

(3) In Figure 4A/B we see less NRE-LacZ in GlcT mutant clones. Are the data points in Figure 4B per cell or per clone? Please note. Also, there are clearly a few NRE-LacZ+ cells in the mutant clone. How does this happen if GlcT is required for Dl/N signaling?

(4) Lines 222-225, Figure 5AB: The authors use the NRE-Gal4ts driver to show that GlcT depletion in EBs has no effect. However, this driver is not activated until well into the process of EB commitment, and RNAi's take several days to work, and so the author's conclusion is "specifically required in ISCs" and not at all in EBs may be erroneous.

(5) Figure 5C-F: These results relating to Delta endocytosis are not convincing. The data in Fig 5C are not clear and not quantitated, and the data in Figure 5F are so widely scattered that it seems these co-localizations are difficult to measure. The authors should either remove these data, improve them, or soften the conclusions taken from them. Moreover, it is unclear how the experiments tracing Delta internalization (Fig 5C) could actually work. This is because for this method to work, the anti-Dl antibody would have to pass through the visceral muscle before binding Dl on the ISC cell surface. To my knowledge, antibody transcytosis is not a common phenomenon.

(6) It is unclear whether MacCer regulates Dl-Notch signaling by modifying Dl directly or by influencing the general endocytic recycling pathway. The authors say they observe increased Dl accumulation in Rab5+ early endosomes but not in Rab7+ late endosomes upon GlcT depletion, suggesting that the recycling endosome pathway, which retrieves Dl back to the cell surface, may be impaired by GlcT loss. To test this, the authors could examine whether recycling endosomes (marked by Rab4 and Rab11) are disrupted in GlcT mutants. Rab11 has been shown to be essential for recycling endosome function in fly ISCs.

(7) It remains unclear whether Dl undergoes post-translational modification by MacCer in the fly gut. At a minimum, the authors should provide biochemical evidence (e.g., Western blot) to determine whether GlcT depletion alters the protein size of Dl.

(8) It is unfortunate that GlcT doesn't affect Notch signaling in other organs on the fly. This brings into question the Delta trafficking model and the authors should note this. Also, the clonal marker in Figure 6C is not clear.

(9) The authors state that loss of UGCG in the mouse small intestine results in a reduced ISC count. However, in Supplementary Figure C3, Ki67, a marker of ISC proliferation, is significantly increased in UGCG-CKO mice. This contradiction should be clarified. The authors might repeat this experiment using an alternative ISC marker, such as Lgr5.

Reviewer #1 (Public review):

Summary:

The authors propose a transformer-based model for the prediction of condition - or tissue-specific alternative splicing and demonstrate its utility in the design of RNAs with desired splicing outcomes, which is a novel application. The model is compared to relevant existing approaches (Pangolin and SpliceAI) and the authors clearly demonstrate its advantage. Overall, a compelling method that is well thought out and evaluated.

Strengths:

(1) The model is well thought out: rather than modeling a cassette exon using a single generic deep learning model as has been done e.g. in SpliceAI and related work, the authors propose a modular architecture that focuses on different regions around a potential exon skipping event, which enables the model to learn representations that are specific to those regions. Because each component in the model focuses on a fixed length short sequence segment, the model can learn position-specific features. Another difference compared to Pangolin and SpliceAI which are focused on modeling individual splice junctions is the focus on modeling a complete alternative splicing event.

(2) The model is evaluated in a rigorous way - it is compared to the most relevant state-of-the-art models, uses machine learning best practices, and an ablation study demonstrates the contribution of each component of the architecture.

(3) Experimental work supports the computational predictions.

(4) The authors use their model for sequence design to optimize splicing outcomes, which is a novel application.

Weaknesses:

No weaknesses were identified by this reviewer, but I have the following comments:

(1) I would be curious to see evidence that the model is learning position-specific representations.

(2) The transformer encoders in TrASPr model sequences with a rather limited sequence size of 200 bp; therefore, for long introns, the model will not have good coverage of the intronic sequence. This is not expected to be an issue for exons.

(3) In the context of sequence design, creating a desired tissue- or condition-specific effect would likely require disrupting or creating motifs for splicing regulatory proteins. In your experiments for neuronal-specific Daam1 exon 16, have you seen evidence for that? Most of the edits are close to splice junctions, but a few are further away.

(4) For sequence design, of tissue- or condition-specific effect in neuronal-specific Daam1 exon 16 the upstream exonic splice junction had the most sequence edits. Is that a general observation? How about the relative importance of the four transformer regions in TrASPr prediction performance?

(5) The idea of lightweight transformer models is compelling, and is widely applicable. It has been used elsewhere. One paper that came to mind in the protein realm:<br /> Singh, Rohit, et al. "Learning the language of antibody hypervariability." Proceedings of the National Academy of Sciences 122.1 (2025): e2418918121.

Reviewer #2 (Public review):

Summary:

The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

Strengths:

(1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

(2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

Weaknesses:

(1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

(2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

(3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

(4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

(5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

(6) L214, ablations of individual features are missing.

(7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

(8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

(9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

(10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

Reviewer #1 (Public review):

Summary

Fleming et al. present the first, proteomics-based attempt to identify the possible mechanism of action of ALS-linked DNAJC7 molecular chaperone in pathology. Impressively, it is the first report of DNAJC7 interactome studies, using a suitable iPSC-derived lower motor neuron model. Using a co-immunoprecipitation approach the authors identified that the interactome of DNAJC7 is predominantly composed of proteins engaged in response to stress, but also that this interactome is enriched in RNA-binding proteins. The authors also created a DNAJC7 haploinsufficiency cellular model and show the resulting increased insolubility of HNRNPU protein which causes disruptions in its functionality as shown by analysis of its transcriptional targets. Finally, this study uses pharmacological agents to test the effect of decreased DNAJC7 expression on cell response to proteotoxic stress and finds evidence that DNAJC7 regulates the activation of Heat shock factor 1 (HSF1) protein upon stress conditions.

Strengths

(1)This study uses the best so far model to study the interactome and possible mechanism of action of DNAJC7 molecular chaperone in an iPSC-derived cellular model of motor neurons. Furthermore, the authors also looked into available transcriptome databases of ALS patient samples to further test whether their findings may yield relevance to pathology.

(2) The extent to which the authors are explicit about the sample sizes, protocols, and statistical tests used throughout this manuscript, should be applauded. This will help the whole field in their efforts to reliably replicate the results in this study.

Weaknesses

(1) The most significant caveat of interactome experiments inherently comes from the method of choice. It is possible that by using the co-purification approach of DNAJC7 IP the resulting pool of binding partners is depleted in proteins that interact with DNAJC7 weakly or transiently. An alternative approach presumably more sensitive towards weaker binders could use the TurboID-based proximity-labeling method.

(2) The authors mention in Results (and Figure 2D) that HNRNPA1 was identified as DNAJC7-interacting protein in their co-IP experiments, however, an identifier for this protein cannot be found in Figure 1C and Table S1 listing the proteomics results. Could the authors appropriately update Figure 1C and Table S1, or if HNRNPA1 wasn't really a hit then remove it from listed HNRNPs?

(3) No further validation of DNAJC7-interacting proteins from the heat-shock protein (HSP) family. Current validation of mass spectrometry-identified proteins comes from IP-western blots with antibodies against HSPs. It would be interesting to further inspect possible interactions of these proteins by inspecting co-localization with immunocytochemistry.

(4) Similarly, the observation of DNAJC7 haploinsufficiency causing an increase in HNRNPU insolubility could be also easily further confirmed by checking for the emergence of "puncta" under a fluorescence microscope, in addition to provided WB experiments from MN lysates.

(5) I would like to recommend the authors to also provide with this manuscript a complete dataset (possibly in the form of a table, presented similarly as Table S1) resulting from experiments presented in Figures 2F and S2D. The information on upregulated and downregulated targets in their DNAJC7 haploinsufficiency model would be a valuable resource for the field and enable further investigations.

Reviewer #2 (Public review):

Summary:

The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

Strengths:

The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

Weaknesses:

Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

Reviewer #3 (Public review):

Summary:

Fleming et al sought to better understand DNAJC7's function in motor neurons as mutations in this gene have been associated with amyotrophic lateral sclerosis (ALS). The research question is relevant and important. The authors use an induced pluripotent stem cell (iPSC) line to derive motor neurons (iMNs) finding that DNAJC7 interacts with RNA-binding proteins (RBP) in wild-type cells and a truncated mutant DNAJC7[R156*] disrupts the RBP, hnRNPU, by promoting its accumulation into insoluble fractions. Given that DNAJC7 is predicted to regulate stress responses, the authors then find that DNAJC7[R156*] expression sensitizes the iMNs to proteosomal stress by disrupting the expression of the key heat stress response regulator, HSF1. These findings support that loss-of-function mutations in DNAJC7 will indeed sensitize motor neurons to proteotoxic stress, potentially driving ALS. The association with RBPs, which routinely are found to be disrupted in ALS, is of interest and warrants further study.

Strengths:

(1) The research question is relevant and important. The authors provide interesting data that DNAJC7 mutations impact two important features in ALS, the dysregulation of RNA binding proteins and the sensitivity of motor neurons to proteotoxic stress.

(2) The authors provide solid data to support their findings and the assays are appropriate.

Weaknesses:

(1) The authors rely on a single iPSC line throughout the text, using the same line to make the mutation-carrying cells. iPSCs are highly variable and at minimum 3 lines, typically 5 lines, should be used to define consistent findings. This work would be greatly strengthened if 3 or more lines were used to confirm consistent effects. This is particularly concerning given that iPSCs were differentiated using growth factors versus genetic induction. Growth-factor-based differentiations are more variable.

(2) The authors argue that HSF1 and its targets are downregulated in sporadic ALS and mutant C9orf72 ALS. The first concern is that these transcriptomics data were derived from cortical tissue which does not contain motor neurons (Pineda et al. 2024 Cell 187: 1971-1989.e1916). The second concern is that the inclusion of C9orf72 mutant tissue is not well justified as (1) this mutation is associated with an upregulation of HSF1 and its targets in patients (Mordes et al, Acta Neuropathol Commun 2018 6(1):55; Lee et al Neuron 2023 111(9):1381-1390) and (2) the C9orf72 mutation is associated with a ALS/FTD spectrum disorder defined by TDP-43 pathology. Disease mechanisms associated with this spectrum disorder may not overlap with traditional ALS which is typically defined by SOD1 pathology.

(3) As a whole, the findings are mechanistically disjointed, and additional experiments or discussion would help to connect the dots a bit more.

Reviewer #1 (Public review):

Summary:

The study shows that Zizyphi spinosi semen (ZSS), particularly its non-extracted simple crush powder, has significant therapeutic effects on neurodegenerative diseases. It removes Aβ, tau, and α-synuclein oligomers, restores synaptophysin levels, enhances BDNF expression and neurogenesis, and improves cognitive and motor functions in mouse AD, FTD, DLB, and PD models. Additionally, ZSS powder reduces DNA oxidation and cellular senescence in normal-aged mice, increases synaptophysin, BDNF, and neurogenesis, and enhances cognition to levels comparable to young mice.

Weaknesses:

(1) While the study demonstrates that ZSS has protective effects across a wide range of animal models, including AD, FTD, DLB, PD, and both young and aged mice, it is broad and lacks a detailed investigation into the underlying mechanisms. This is the most significant concern.

(2) The authors highlight that the non-extracted simple crush powder of ZSS shows more substantial effects than its hot water extract and extraction residue. However, the manuscript provides very limited data comparing the effects of these three extracts.

(3) The authors have not provided a rationale for the dosing concentrations used, nor have they tested the effects of the treatment in normal mice to verify its impact under physiological conditions.

(4) Regarding the assessment of cognitive function in mice, the authors only utilized the Morris Water Maze (MWM) test, which includes a five-day spatial learning training phase followed by a probe trial. The authors focused solely on the learning phase. However, it is relevant to note that data from the learning phase primarily reflects the learning ability of the mice, while the probe trial is more indicative of memory. Therefore, it is essential that probe trial data be included for a more comprehensive analysis. A justification should be included to explain why the latency of 1st is about 50s not 60s.

(5) The BDNF immunohistochemical staining in the manuscript appears to be non-specific.

(6) The central pathological regions in PD are the substantia nigra and striatum. Please replace the staining results from the cortex and hippocampus with those from these regions in the PD model.

Reviewer #2 (Public review):

Summary:

The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

Strengths:

The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

Weaknesses:

The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

Reviewer #3 (Public review):

ZSS has been widely used in Traditional Chinese Medicine as a sleep-promoting herb. This study tests the effects of ZSS powder and extracts on AD, PD, and aging, and broad protective effects were revealed in mice.

However, this work did not include a mechanistic study or target data on ZSS were included, and PK data were also not involved. Mechanisms or targets and PK study are suggested. A human PK study is preferred over mice or rats. E.g. which main active ingredients and the concentration in plasma, in this context, to study the pharmacological mechanisms of ZSS.

Reviewer #1 (Public review):

Summary:

This study aims to provide imaging methods for users of the field of human layer-fMRI. This is an emerging field with 240 papers published so far. Different than implied in the manuscript, 3T is well represented among those papers. E.g. see the papers below that are not cited in the manuscript. Thus, the claim on the impact of developing 3T methodology for wider dissemination is not justified. Specifically, because some of the previous papers perform whole brain layer-fMRI (also at 3T) in more efficient, and more established procedures.

The authors implemented a sequence with lots of nice features. Including their own SMS EPI, diffusion bipolar pulses, eye-saturation bands, and they built their own reconstruction around it. This is not trivial. Only a few labs around the world have this level of engineering expertise. I applaud this technical achievement. However, I doubt that any of this is the right tool for layer-fMRI, nor does it represent an advancement for the field. In the thermal noise dominated regime of sub-millimeter fMRI (especially at 3T) it is established to use 3D readouts over 2D (SMS) readouts. While it is not trivial to implement SMS, the vendor implementations (as well as the CMRR and MGH implementations) are most widely applied across the majority of current fMRI studies already. The author's work on this does not serve any previous shortcomings in the field.

The mechanism to use bi-polar gradients to increase the localization specificity is doubtful to me. In my understanding, killing the intra-vascular BOLD should make it less specific. Also, the empirical data do not suggest a higher localization specificity to me.

Embedding this work in the literature of previous methods is incomplete. Recent trends of vessel signal manipulation with ABC or VAPER are not mentioned. Comparisons with VASO are outdated and incorrect.

The reproducibility of the methods and the result is doubtful (see below).

I don't think that this manuscript is in the top 50% of the 240 layer-fmri papers out there.

3T layer-fMRI papers that are not cited:

Taso, M., Munsch, F., Zhao, L., Alsop, D.C., 2021. Regional and depth-dependence of cortical blood-flow assessed with high-resolution Arterial Spin Labeling (ASL). Journal of Cerebral Blood Flow and Metabolism. https://doi.org/10.1177/0271678X20982382

Wu, P.Y., Chu, Y.H., Lin, J.F.L., Kuo, W.J., Lin, F.H., 2018. Feature-dependent intrinsic functional connectivity across cortical depths in the human auditory cortex. Scientific Reports 8, 1-14. https://doi.org/10.1038/s41598-018-31292-x

Lifshits, S., Tomer, O., Shamir, I., Barazany, D., Tsarfaty, G., Rosset, S., Assaf, Y., 2018. Resolution considerations in imaging of the cortical layers. NeuroImage 164, 112-120. https://doi.org/10.1016/j.neuroimage.2017.02.086

Puckett, A.M., Aquino, K.M., Robinson, P.A., Breakspear, M., Schira, M.M., 2016. The spatiotemporal hemodynamic response function for depth-dependent functional imaging of human cortex. NeuroImage 139, 240-248. https://doi.org/10.1016/j.neuroimage.2016.06.019

Olman, C.A., Inati, S., Heeger, D.J., 2007. The effect of large veins on spatial localization with GE BOLD at 3 T: Displacement, not blurring. NeuroImage 34, 1126-1135. https://doi.org/10.1016/j.neuroimage.2006.08.045

Ress, D., Glover, G.H., Liu, J., Wandell, B., 2007. Laminar profiles of functional activity in the human brain. NeuroImage 34, 74-84. https://doi.org/10.1016/j.neuroimage.2006.08.020

Huber, L., Kronbichler, L., Stirnberg, R., Ehses, P., Stocker, T., Fernández-Cabello, S., Poser, B.A., Kronbichler, M., 2023. Evaluating the capabilities and challenges of layer-fMRI VASO at 3T. Aperture Neuro 3. https://doi.org/10.52294/001c.85117

Scheeringa, R., Bonnefond, M., van Mourik, T., Jensen, O., Norris, D.G., Koopmans, P.J., 2022. Relating neural oscillations to laminar fMRI connectivity in visual cortex. Cerebral Cortex. https://doi.org/10.1093/cercor/bhac154

Strengths:

See above. The authors developed their own SMS sequence with many features. This is important to the field. And does not leave sequence development work to view isolated monopoly labs. This work democratises SMS.<br /> The questions addressed here are of high relevance to the field: getting tools with good sensitivity, user-friendly applicability, and locally specific brain activity mapping is an important topic in the field of layer-fMRI.

Weaknesses:

(1) I feel the authors need to justify why flow-crushing helps localization specificity. There is an entire family of recent papers that aims to achieve higher localization specificity by doing the exact opposite. Namely, MT or ABC fRMRI aims to increase the localization specificity by highlighting the intravascular BOLD by means of suppressing non-flowing tissue. To name a few:

Priovoulos, N., de Oliveira, I.A.F., Poser, B.A., Norris, D.G., van der Zwaag, W., 2023. Combining arterial blood contrast with BOLD increases fMRI intracortical contrast. Human Brain Mapping hbm.26227. https://doi.org/10.1002/hbm.26227.

Pfaffenrot, V., Koopmans, P.J., 2022. Magnetization Transfer weighted laminar fMRI with multi-echo FLASH. NeuroImage 119725. https://doi.org/10.1016/j.neuroimage.2022.119725

Schulz, J., Fazal, Z., Metere, R., Marques, J.P., Norris, D.G., 2020. Arterial blood contrast ( ABC ) enabled by magnetization transfer ( MT ): a novel MRI technique for enhancing the measurement of brain activation changes. bioRxiv. https://doi.org/10.1101/2020.05.20.106666

Based on this literature, it seems that the proposed method will make the vein problem worse, not better. The authors could make it clearer how they reason that making GE-BOLD signals more extra-vascular weighted should help to reduce large vein effects.

The empirical evidence for the claim that flow crushing helps with the localization specificity should be made clearer. The response magnitude with and without flow crushing looks pretty much identical to me (see Fig, 6d).<br /> It's unclear to me what to look for in Fig. 5. I cannot discern any layer patterns in these maps. It's too noisy. The two maps of TE=43ms look like identical copies from each other. Maybe an editorial error?

The authors discuss bipolar crushing with respect to SE-BOLD where it has been previously applied. For SE-BOLD at UHF, a substantial portion of the vein signal comes from the intravascular compartment. So I agree that for SE-BOLD, it makes sense to crush the intravascular signal. For GE-BOLD however, this reasoning does not hold. For GE-BOLD (even at 3T), most of the vein signal comes from extravascular dephasing around large unspecific veins and the bipolar crushing is not expected to help with this.

(2) The bipolar crushing is limited to one single direction of flow. This introduces a lot of artificial variance across the cortical folding pattern. This is not mentioned in the manuscript. There is an entire family of papers that perform layer-fmri with black-blood imaging that solves this with a 3D contrast preparation (VAPER) that is applied across a longer time period, thus killing the blood signal while it flows across all directions of the vascular tree. Here, the signal cruising is happening with a 2D readout as a "snap-shot" crushing. This does not allow the blood to flow in multiple directions.<br /> VAPER also accounts for BOLD contaminations of larger draining veins by means of a tag-control sampling. The proposed approach here does not account for this contamination.

Chai, Y., Li, L., Huber, L., Poser, B.A., Bandettini, P.A., 2020. Integrated VASO and perfusion contrast: A new tool for laminar functional MRI. NeuroImage 207, 116358. https://doi.org/10.1016/j.neuroimage.2019.116358

Chai, Y., Liu, T.T., Marrett, S., Li, L., Khojandi, A., Handwerker, D.A., Alink, A., Muckli, L., Bandettini, P.A., 2021. Topographical and laminar distribution of audiovisual processing within human planum temporale. Progress in Neurobiology 102121. https://doi.org/10.1016/j.pneurobio.2021.102121

If I would recommend anyone to perform layer-fMRI with blood crushing, it seems that VAPER is the superior approach. The authors could make it clearer why users might want to use the unidirectional crushing instead.

(3) The comparison with VASO is misleading.<br /> The authors claim that previous VASO approaches were limited by TRs of 8.2s. The authors might be advised to check the latest literature of the last years.<br /> Koiso et al. has performed whole brain layer-fMRI VASO at 0.8mm at 3.9 seconds (with reliable activation) and 2.7 seconds (with unconvincing activation pattern, though), and 2.3 (without activation).<br /> Also, whole brain layer-fMRI BOLD at 0.5mm and 0.7mm has been previously performed by the Juelich group at TRs of 3.5s (their TR definition is 'fishy' though).

Koiso, K., Müller, A.K., Akamatsu, K., Dresbach, S., Gulban, O.F., Goebel, R., Miyawaki, Y., Poser, B.A., Huber, L., 2023. Acquisition and processing methods of whole-brain layer-fMRI VASO and BOLD: The Kenshu dataset. Aperture Neuro 34. https://doi.org/10.1101/2022.08.19.504502

Yun, S.D., Pais‐Roldán, P., Palomero‐Gallagher, N., Shah, N.J., 2022. Mapping of whole‐cerebrum resting‐state networks using ultra‐high resolution acquisition protocols. Human Brain Mapping. https://doi.org/10.1002/hbm.25855

Pais-Roldan, P., Yun, S.D., Palomero-Gallagher, N., Shah, N.J., 2023. Cortical depth-dependent human fMRI of resting-state networks using EPIK. Front. Neurosci. 17, 1151544. https://doi.org/10.3389/fnins.2023.1151544

The authors are correct that VASO is not advised as a turn-key method for lower brain areas, incl. Hippocampus and subcortex. However, the authors use this word of caution that is intended for inexperienced "users" as a statement that this cannot be performed. This statement is taken out of context. This statement is not from the academic literature. It's advice for the 40+ user base that want to perform layer-fMRI as a plug-and-play routine tool in neuroscience usage. In fact, sub-millimeter VASO is routinely being performed by MRI-physicists across all brain areas (including deep brain structures, hippocampus etc). E.g. see Koiso et al. and an overview lecture from a layer-fMRI workshop that I had recently attended: https://youtu.be/kzh-nWXd54s?si=hoIJjLLIxFUJ4g20&t=2401

Thus, the authors could embed this phrasing into the context of their own method that they are proposing in the manuscript. E.g. the authors could state whether they think that their sequence has the potential to be disseminated across sites, considering that it requires slow offline reconstruction in Matlab?<br /> Do the authors think that the results shown in Fig. 6c are suggesting turn-key acquisition of a routine mapping tool? In my humble opinion it looks like random noise, with most of the activation outside the ROI (in white matter).

(4) The repeatability of the results is questionable.<br /> The authors perform experiments about the robustness of the method (line 620). The corresponding results are not suggesting any robustness to me. In fact the layer profiles in Fig. 4c vs. Fig 4d are completely opposite. Location of peaks turn into locations of dips and vice versa.<br /> The methods are not described in enough detail to reproduce these results.<br /> The authors mention that their image reconstruction is done "using in-house MATLAB code" (line 634). They do not post a link to github, nor do they say if they share this code.

It is not trivial to get good phase data for fMRI. The authors do not mention how they perform the respective coil-combination.<br /> No data are shared for reproduction of the analysis.

(5) The application of NODRIC is not validated.<br /> Previous applications of NORDIC at 3T layer-fMRI have resulted in mixed success. When not adjusted for the right SNR regime it can result in artifactual reductions of beta scores, depending on the SNR across layers. The authors could validate their application of NORDIC and confirm that the average layer-profiles are unaffected by the application of NORDIC. Also, the NORDIC version should be explicitly mentioned in the manuscript.

Akbari, A., Gati, J.S., Zeman, P., Liem, B., Menon, R.S., 2023. Layer Dependence of Monocular and Binocular Responses in Human Ocular Dominance Columns at 7T using VASO and BOLD (preprint). Neuroscience. https://doi.org/10.1101/2023.04.06.535924

Knudsen, L., Guo, F., Huang, J., Blicher, J.U., Lund, T.E., Zhou, Y., Zhang, P., Yang, Y., 2023. The laminar pattern of proprioceptive activation in human primary motor cortex. bioRxiv. https://doi.org/10.1101/2023.10.29.564658

Comments on revisions:

Among all the concerns mentioned above, I think there is only one of the specific issues that was sufficiently addressed.<br /> The authors implemented a combination of three consecutive-dimensional flow crushers. Other concerns were not sufficiently addressed to change my confidence level of the study.<br /> - While the abstract is still focusing on the utility of using 3T, they do not give credit to early 3T layer-fMRI papers leading the way to larger coverage and connectivity applications.<br /> - While the author's choice of using custom SMS 2D readout is justified for them. I do not think that this very method will utilize widespread 3T whole brain connectivity experiments across the global 3T community. This lowers the impact of the paper.<br /> - The images in Fig. 5 are still suspiciously similar. To the level that the noise pattern outside the brain is identical across large parts of the maps with and without PR.<br /> - Maybe it's my ignorance, but I still do not agree why flow crushing focuses the local BOLD responses to small vessels.<br /> - While my feel of a misleading representation of the literature had been accompanied by explicit references, the authors claim that they cannot find them?!? Or claim that they are about something else (which they are not, in my viewpoint).<br /> Data and software are still not shared (not even example data, or nii data).

Reviewer #2 (Public review):

This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

Strengths:

The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

Reviewer #3 (Public review):

Summary:

The authors are looking for a spatially specific functional brain response to visualise non-invasively with 3T (clinical field strength) MRI. They propose a velocity-nulled weighting to remove signal from draining veins in a submillimeter multiband acquisition.

Strengths:

- This manuscript addresses a real need in the cognitive neuroscience community interested in imaging responses in cortical layers in-vivo in humans.<br /> - An additional benefit is the proposed implementation at 3T, a widely available field strength.

Weaknesses:

- The comparison in Figure 4 for different b-values shows % signal changes. However, as the baseline signal changes with added diffusion weighting, this is rather uninformative. A plot of t-values against cortical depth would be more insightful.<br /> - Surprisingly, the %-signal change for a b-value of 0 is below 1% for 3/4 participants, even at the cortical surface. This raises some doubts about the task or ROI definition. A finger-tapping task should reliably engage the primary motor cortex, even at 3T, and even in individual participants.<br /> - The double peak patter in the BOLD weighted images in Figure 4 is unexpected given the existing literature on BOLD responses as a function of cortical depth.<br /> - Although I'd like to applaud the authors for their ambition with the connectivity analysis, the low significance threshold used in these maps (z=1,64) leads to concerns about the SNR of the underlying data.

I remain unconvinced of the conclusion that the developed VN fMRI exhibited layer specificity - the double peak which is taken as a marker of specificity is not absent in the BOLD responses either, and overall BOLD and VN response profiles as a function of cortical depth are quite similar.

Reviewer #1 (Public review):

Summary:

In this study, Millard and colleagues investigated if the analgesic effect of nicotine on pain sensitivity, assessed with two pain models, is mediated by Peak Alpha Frequency (PAF) recorded with resting state EEG. The authors found indeed that nicotine (4 mg, gum) reduced pain ratings during phasic heat pain but not cuff pressor algometry compared to placebo conditions. Nicotine also increased PAF (globally). However, mediation analysis revealed that the reduction in pain ratings elicited by the phasic heat pain after taking nicotine was not mediated by the changes in PAF. Also, the authors only partially replicated the correlation between PAF and pain sensitivity at baseline (before nicotine treatment). At the group-level no correlation was found, but an exploratory analysis showed that the negative correlation (lower PAF, higher pain sensitivity) was present in males but not in females. The authors discuss the lack of correlation.<br /> In general, the study is rigorous, methodology is sound and the paper is well written. Results are compelling and sufficiently discussed.

Strengths:

Strengths of this study are the pre-registration, proper sample size calculation and data analysis. But also the presence of the analgesic effect of nicotine and the change in PAF.

Weaknesses:

It would even be more convincing if they had manipulated PAF directly.

Reviewer #2 (Public review):

Summary:

The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

Strengths:

I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

Weaknesses:

The weakness of the study revolves around two aspects:

(1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

(2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

Reviewer #3 (Public review):

In this manuscript, Millard et al. investigate the effects of nicotine on pain sensitivity and peak alpha frequency (PAF) in resting state EEG. To this end, they ran a randomized, double-blind, placebo-controlled experiment involving 62 healthy adults that received either 4 mg nicotine gum (n=29) or placebo (n=33). Prolonged heat and pressure were used as pain models. Resting state EEG and pain intensity (assessed with a visual analog scale) were measured before and after the intervention. Additionally, several covariates (sex at birth, depression and anxiety symptoms, stress, sleep quality, among others) were recorded. Data was analyzed using ANCOVA-equivalent two-wave latent change score models, as well as repeated measures analysis of variance. Results do not show experimentally relevant changes of PAF or pain intensity scores for neither of the prolonged pain models due to nicotine intake.

The main strengths of the manuscript are its solid conceptual framework and the thorough experimental design. The researchers make a good case in the introduction and discussion for the need to further investigate the association of PAF and pain sensitivity. Furthermore, they proceed to carefully describe every aspect of the experiment in great detail, which is excellent for reproducibility purposes. Finally, they analyze the data from different and provide an extensive report of their results.

There are relevant weaknesses to highlight. Firstly, authors preregistered the study and the analysis plan, but the preregistration does not contain an estimation of the expected effect sizes or the rationale for the selected the sample size. Furthermore, the authors interpret their results in a way that is not supported by the evidence (which is notorious in the abstract and the first paragraph of the discussion). Even though some of the differences are statistically significant (e.g., global PAF, pain intensity ratings during heat pain), these differences are far from being experimentally or clinically relevant. The effect sizes observed are not sufficiently large to consider that pain sensitivity was modulated by the nicotine intake, which puts into question all the answers to the research questions posed in the study. The authors attempt to nuance this throughout the discussion, but in a way that is not compatible with the main claims.