Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
751 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
-
[14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
-
5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-aD-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
-
1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-Dmannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
-
3.37 (t, J = 2 Hz, 1 H), 3.34 (s, 3H, OMe); 13C NMR (020, 75 MHz) 8 103.01, 102.17, 100.70,99.71,78.64,77.46,77.21,77.05,75.50,75.31, 75.17, 73.79, 72.92, 72.60, 72.48, 72.24, 70.82, 70.23, 69.94, 68.40, 68.08, 66.62, 60.99, 60.79, 60.46, 56.83; HRMS(FAB): Calculated for [ M+ Nat C25H44021Na 703.227279, found 703.226277.
-
MR ( 020, 300 MHz) 8 5.23.(q, J = 1.46 Hz, 1 H, H-1"'), 5.20 (d, J = 1.22 Hz, 1 H, H-1"), 4.86 (bs, 1H, H-1), 4.26 (d, J = 8.51 Hz, 1H, H-1'), 3.95 (d, J = 1.83 Hz, 1 H, H-2"), 3.93 (m, 1 H), 3.9 (d, J= 2.53 Hz, 1 H, H-2), 3.76 (bs, 1 H), 3.75 (bs, 1 H, H-2"), 3.54 (d, J = 1.8 Hz, 3H), 3.40 (d, J = 7.91 Hz, 1 H, H-2'),
-
at -30°C when TlC showed complete disappearance of the reactants. The mixture was quenched with pyridine (2 ml), filtered through celite pad and the filtrate was co-concentrated with toluene. The residue was purified by silica column using ethyl ace'late-hexane (32:68) to provide fully protected tetrasaccharide cap (43, 0.019 g, 63~~) domain of LPG; R, = 0.236 in 50% ethyl acetate-hexane; [a]D +12.06 (c 0.058, CHCI3); 1H NMR (COCI3, 300 MHz) 8 7.29-7.14.(m, 30H, ArH), 5.33 (d, J = 1.8 Hz, 11-l), 5.38-5.32 (m, 3H), 5.28-5.23 (d, J = 9.9 Hz, 2H), 5.18 (dd, J = 1.8, 1.5 Hz, 1 H), 4.93-4.89 (d, J = 11 Hz, 2H), 4.75-4.74 (d, J = 2.1 Hz, 1 H, H-1'or H-1"'), 4.66-4.60 (rn, 2H), 4.62-4.61 (d, J = 1.64 Hz, 1H, H-1"' or H-1"), 4.54-4.50 (d, J = 12 Hz, 2H), 4.44-4.42 (d, J = 6.9 Hz, 1H, H-1'), 4.40-4.38 (d, J = 6.1 Hz, 1H), 4.35-4.31 (d, J = 9.9 Hz, 2H), 4.25 (m, 1 H), 4.29-4.17 (m, 4H), 4.14-4.07 (m, 4H), 4.04 (m, 2H), 4.00 (m, :2H), 3.89 (d, J = 2.7 Hz, 1 H), 3.83-3.80 (m, 1 H), 3.74-3.68 (m, 1 H), 3.57-3.52 (m, 1 H), 3.46 (s, 3H, OMe), 3.44-3.32 (m, 4H), 2.09, 2.03, 2.01, 2.00, 1.99, 1.97, 1.96 (7 x s, 21 H, 7 x OCOCH3); 13C NMR (COCI3, 75 MHz) 8 174.9, 173.5, 171.2, 170.3, 169.6, 169.5, 169.3, 146.6, 138.9, 138.6, 132.6, 130.9, 129.8, 128.4, 128.2, 128.1, 128.07,128.0,127.76,127.72,127.65,127.54,127.4, 127.34, 127.3, 126.9, 109.15, 103, 100.6, 98.56, 74.7, 74.5, 73.2, 72.9, 72.5, 69.6, 68.1, 66.1, 62.3, 62.1, 61.9, 56.8,20.76,20.58; HRMS(FAS): Calcd. for [M+Nar C81H94028Na 1537.58290, found 1537.58270. Methyl 0-( a-D-man nopyranosyl )-( 1--72)-O-a-D-mannopyranosyl-(1--72)-0-[J3-D-galactopyranosyl-(1--74)]-a-D-mannopyranoside (44). Solution of the fully protected tetrasaccharide cap 43 (2 mg, 0.0014 mmol) in absolute EtOH (3 ml) and palladium hydroxide (5 mg, 20 wt %) was stirred under slight pressure of hydrogen for 4 h. The reaction mixture was filtered through celite and the filtrate concentrated under reduced pressure to obtain debenzylated product. This was dissolved in anhydrous CH30H (1.5 ml), catalytic amount of sodium methoxide (0.8 mg) was added and the solution was stirred for 2 h at rt. The reaction mixture was quenched with 3 drops of 0.5% HCI solution and excess of CH30H was removed under reduced pressure and the residue was lyophilized three times with the addition of water (500 Jll) to remove traces of HC!. This provided pure methyl glycoside of the tetrasaccharide cap 44 in quantitative yield; R, = 0.276 in nPrOH:acetone:H20 (first run 9:6:5, second run 5:4:1); 1H N
-
eves (4 A, 150 mg) under nitrogen for 30 min. The mixture was then cooled to -30°C and trimethylsilyltriflate solution (TMSOTf, 3.66 III dissolved in 1 ml CH2CI2) was added dropwise keeping the reaction temperature at -30°C. The reaction mixture was stirred for another 15 min
-
0.09 in 50% ethylacetate-hexane; [aJo +19.54 (c 0.22, CHCI3); 1H NMR (CDCI3, 300 MHz) .85.40-5.42 (dd, J = 2.4,3.3 Hz, 1H, H-3), 5.38-5.37 (d, J = 3.3 Hz, 1H, H-1), 5.36-5.33 (m, 2H, H-4', H-4), 5.30-5.23 (m, 2H, H-2', H-3), 4.92 (d, J = 1.8 Hz, 1 H, H-1'),4.23-4.19 (m, 2H, H-6a', H-6b'), 4.17-4.14 (dd, J = 3.7,5.1 Hz, 1H, H-2), 4.13-4.11 (m, 2H, H-6a,6b), 4.08-4.05 (ddd, J = 2.7,2.4 Hz, 1 H, H-5), 3.65-3.59 (m, 1 H, H-5'), 2.13-1.99 (7 x s, 21 H, COMe); 13C NMR (CDCI3, 75 MHz) 8 171.0, 170.6, 170.3, 169.7, 169.6, 169.4, 169.37, 169.3, 98.6, 92.5, 77.2, 70.4, 69.97, 69.6, 69.5, 68.97, 68.3, 66.2, 66.0, 62.27, 62.1,20.77-20.54; HRMS(FAB): Calcd for [M+Hr C26H37018 637.197990, found 637.200305. 3,4,6-Tri-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-(a-D-mannopyranosyl)-(3-D-manno pyranosyl trichloroacetimidate (42). To a solution of heptaacetate 41 (254 mg, 0.4 mmol) in anhydrous CH2CI2 (3 ml) at O°C was added successively, trichloroacetonitrile (10.0 equiv, 400 Ill) and DBU (0.0325 equiv, 20 Ill). After stirring for 1 h at 0 °C TlC showed completion of the reaction. Solvent was evaporated under reduced pressure and the residue was flash chromatographed (30:70, ethyl acetate-hexane) to give the disaccharide donor 42 (O.185g, 60%); [aJo +31.21, (c 1.36, CHCI3); 1H NMR (CDCb, 300 MHz) 8 8.71 (1 H, s, NH), 6.41 (d, J = 1.86 Hz, 1H, H-1), 5.49-5.46 (bd, J = 9.9 Hz, 1H, H-4), 5.43-5.38 (dd, J = 3.45,10.2 Hz, 1H, H-3'), 5.35-5.31 (dd, J = 3.15, 10.2 Hz, 1 H, H-3), 5.28-5.23 (m, 1 H, H-4'), 5.28-5.26 (dd, J = 1.8, 3.3 Hz, 1 H, H-2'), 4.98 (d, J = 1.5 Hz, 1 H, H-1 '), 4.29-4.27 (1 H, dd, J = 2.55,5.1, H-2), 4.24-4.14 (5H, m, H-6'a, 6'b, 5', 6a, 6b), 4.12-4.10 (ddd, J = 3,3.6,3.6 Hz, 1 H, H-5), 2.14-2.00 (7 x s, 21 H, COMe); 13C NMR (CDCb, 75 MHz) 8 170.6, 170.5, 170.2, 169.78, 169.59, 169.37, 169.10,99.1,95.4,76.4,75.4,74.8,71.1, 69.7, 69.5, 69.4, 68.2, 66.0, 65.2, 62.1, 61.5, 20.74-20.53; HRMS(ESMS): Calcd for [M+Nar C28H36018NCI3Na 802.0896, found 802.0801. Methyl 0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosYI)-(1-72)-0-(3,4,6-tri-0-acetyl-a-D-mannopyranosYI)-(1-72)-0-[(2,3,4,6-tetra-O-benzyl-(3-D-galactopyra nosyl)-(1-74)]-3,6-di-O-benzyl-a-D-mannopyranoside (43). A solution of the protected Gal-Man acceptor 35 (0.018 g, 0.020 mmol) and mannobiose trichloroacetamidate donor 42 (0.031 g, 0.04 mmol) in anhydrous CH2CI2 (2 ml) was stirred with freshly activated molecular si
-
NMR (CDCI3, 300 MHz) /55.78 (d, J = 0.9 Hz, 1 H, H-1), 5.46-5.50 (dd, J = 9.9 Hz, 1H, H-4', H-2'), 5.29-5.31 (dd, J = 3.6,1.95 Hz, 1H, H-4), 5.09-5.13 (dd, J = 9.6, 3 Hz, 1 H, H-3), 5.00 (d, J = 1.8 Hz, 1 H, H-1'), 4.40 (m, 1 H, H-5'), 4.14-4.16 (dd, J = 3,1.2 Hz, 1H, H-2), 4.01-4.34 (m, 4H, H-6', H-6), 3.76-3.80 (m, 1H, H-5), 2.01-2.15 (8 x s, 24H, COMe); 13C NMR (CDCI3, 75 MHz) 820.3-20.77,60.2, 61.6, 62.1, 65.6, 66.0, 68.2, 68.7, 69.8, 72.0, 73.1, 74.5, 75.1, 77.1, 90.8, 98.2, 168.2, 169.1, 169.3, 169.5, 169.6, 170.4, 170.7, 171. HRMS(FAB): Calcd. for [M+Nar C2sH3S019Na 701.190499, found 701.187839. 3,4,6-Tri-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosyl)-j3-D-manno pyranose (41). The mannobiose octaacetate 40 (300 mg, 0.47 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (39 mL) at -20°C and stirred for 5 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated. Flash column chromatography of the crude product with 40% ethyl acetate-hexane resulted in pure heptaacetate 41 (0.225 g, 91 %); R, =
-
mixture was left at rt for 90 min. after which a solution of sodium acetate (42.5 g) in water (53 mL) at 5 °C was slowly added, keeping the internal temperature of the mixture around 35°C. The resultant solution was then poured onto ice, and the mixture was extracted with CH2CI2 (60 mL x 3). The organic layer was thoroughly washed with cold water and saturated aqueous NaHC03 solution, dried over Na2S04 and concentrated. The residue was crystallized from dry ether to afford pure 39 (3.5 g), and was characterized by comparison with data of commercially available material from Sigma. 1 ,3,4,6-Tetra-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosyl)-j3-D-mannopyranose (40). A solution of man nose trichloroacetimidate donor 38 (985 mg, 2 mmol) and freshly prepared 39 (348 mg, 1 mmol) in anhydrous CH2CI2 (20 mL) was stirred with activated molecular sieves (10 g, 4 A) under nitrogen for 30 min. The reaction mixture was cooled to -30°C and a solution of trimethylsilyltriflate (TMSOTf, 220 ilL, 1.2 mmol) in anhydrous CH2CI2 (10 mL) was added dropwise. The temperature was maintained below -30°C for 15 min when TLC indicated completion of the reaction. The mixture was quenched with pyridine (5 mL), filtered through celite, and the filtrate was co-concentrated with toluene. Flash chromatography of the crude product with 50 % ethyl acetate-hexane afforded pure mannobiose octaacetate 40 as amorphous solid (0.406 g, 60%); R, = 0.208 in 50% ethylacetate-hexane; [a]D +9 (c 0.25, CHCI3); 1H
-
2,3,4,6-Tetra-O-acetyl-a-D-mannopyranosyl-trichloroacetimidate (38) 1,2,3,4,6-penta-O-acetyl-a-D-mannopyranose (36, 500 mg, 128 mmol) was dissolved in dry CH3CN saturated with dimethylamine (35 mL) and stirred at -20°C for 1 h after which TLC confirmed complete disappearance of the starting material. Extra dimethylamine was removed under reduced pressure at room temperature and the reaction mixture was concentrated. Flash column chromatography (25:75 ethyl acetate-hexane) provided 2,3,4,6-tetra-O-acetyl-a-D-mannopyranose (37, 445 mg) in quantitative yield. To a solution of compound 37 (0.335 g, 0.962 mmol) in anhydrous CH2CI2 (3 mL) was added trichloroacetonitrile (CI3CCN, 10.0 equiv, 1 mL) and 1,8-diaza bicyclo[5.4.0]undec-7-ene (DBU, 74.7 uL, 0.05 equiv) at O°C. After stirring for 75 min, the solvent was evaporated under reduced pressure and the residue purified by flash chromatography with 20 % ethyl acetate-hexane to give pure 38 (331 mg,70%); 1H NMR (CDCI3, 300 MHz) 8 8.77 (s, 1 H, NH), 6.26 (d, J = 1.8 Hz, 1 H, H-1), 5.45 (dd, J = 2.3 Hz, 1 H, H-2), 5.39-5.37 (dd, J = 2,5 Hz, 1 H, H-3), 5.42-5.33 (m, 1 H, H-4 ), 4.18 (m, 1 H, H-5), 4.12-4.29 (m, 2H, H-6); 13C NMR (CDCI3, 75 MHz) 8 170.45, 169.68, 169.60, 169.50, 159.62, 94.39, 71.08, 68.67, 68.13, 67.73, 65.26, 61.91, 20.54; HRMS(ESMS): Calcd. for [M+Hr C1sH2101ONCI3 491.0153, found 491.0187. 1,3,4,6-Tetra-O-acetyl-f3-D-mannopyranose (39). Few crystals of D-mannose were added to acetic anhydride (53 mL), followed by the addition of 6-7 drops of 60% perchloric acid. This solution was maintained at 45°C and to this was added 0-mannose (14 g) portionwise with constant stirring for 20 min. the mixture was then left at rt for 1 h and subsequently cooled to 15°C. Phosphorus tribromide (13.4 mL) was added dropwise to this mixture, followed by the addition of water (4.8 mL). The
-
using 20% ethyl acetate in hexane to yield methyl 0-(2,3,4,6-tetra-O-benzyl-a-D-galactopyranosyl)-(1-74)-3,6-di-O-benzyl-a-D-mannopyranoside 35 (149 mg, 64.5%); R, = 0.27 in 50% ethyl acetate-hexane; [a]o +3.891, (c 0.257, CHCI3 ); 1H NMR (CDCI3, 300 MHz) 87.7-6.89 (m, 30H, Ph), 4.96-4.31 (m, 12H, PhCH2), 4.47-4.45 (d, J = 5 Hz, 1H, H-1'), 4.35 (d, J = 2.1 Hz, 1H, H-1), 4.08 ("t", J = 8.7 Hz, 1H, H-4), 4.03 (bs, 1 H, H-2), 3.9-3.89 (d, J = 2.4 Hz, 1 H, H-4'), 3.84-3.80 (dd, J = 2.5, 8.1 Hz, 1 H, H-3), 3.78-3.73 (dd, J = 5.4, 10.4 Hz, 1 H, H-2'), 3.55-3.47 (m, 7H), 3.52 (s, 3H, OMe); 13C NMR (CDCI3, 75 MHz) .8138.85, 138.63, 138.39, 138.33, 137.88, 135.52 (6 ipso C), 128.30-127.29 (ArC's), 103.07, 100.65,82.48,79.75,76.91,75.27,75.06,74.49, 73.39, 73.07, 72.54, 72.33, 68.52, 68.29, 56.87; HRMS(FAB): calcd for [M+Nar CSSHSOOllNa 919.4033333, found 919.400521.
-
(232 mg, 91 %); Rt= 0.16 in 50% ethyl acetate-hexane; [a]o +21.84 (c 0.238, CHCI3); 1H NMR (COCI3, 300 MHz) 8 5.0 (d, J = 2.1 Hz, 1H, H-1), 4.55 (d, J = 12.9 Hz, 1H, H-3), 4.55 (m, 1 H, H-4), 4.40-4.22 (m, 3H, H-1', 2', 4'), 3.85 (m, 2H, H-5, 5'), 3.50 (m, 2H, H-6), 3.40 (m, 2H, H-6'), 3.11 (d, J = 2.1 Hz, 1 H, H-2); 13C NMR (COCI3, 75 MHz) 8 138.6-138.2 (6 ipso C), 128.3-127.4 (ArC's), 102.51,82,4,79.7,76.6,75.2, 74.6, 73.5, 73.47, 73.41, 73.0, 72.69, 72.61, 69.17, 68.36; HRMS(ESMS): calcd for [M+Nat CS4Hs601O Na 887.3771 found 887.3761. Methyl 0-(2,3,4,6-tetra-O-benzyl-a-D-galactopyranosYI)-(174)-3, 6 -di-O-benzyl-a-D-glucopyranoside (34). The a-epoxide (33, 232 mg, 0.268 mmol) was dissolved in anhydrous CH30H (150 mL) and allowed to stir at rt for 4 h. The solvent was evaporated and the residue dried under vacuum to yield B-methyl lactoside 34 (231 mg, 96.08%); Rt= 0.37 in 50% ethyl acetate in hexane; [a]o +12 (c 0.200, CHCI3); 1H NMR (COCh, 300 MHz) 8 7.32-7.20 (m, 30H, Ph), 5.11-4.34 (m, 12H, PhCH2), 4.29 (s,1H, H-1'), 4.25 (s, 1H, H-2'), 4.22-4.19 (dd, J = 3.6,7.5 Hz, 1H, H-1), 3.95 (m,1H, H-3), 3.90 (d, J = 2.7 Hz, 1 H, H-4'), 3.8-3.78 (dd, J = 4.35, 11 Hz, 1 H, H-3'), 3.76-3.69 (m, 2H, H-2, H-4), 3.54 (s, 3H, OMe), 3.57-3.33 (m, 6H); 13C NMR (COCb, 300 MHz) 8 138.92, 138.82, 138.68, 138.39, 138.22, 137.92 (6 ipso C), 128.29-127.35 (ArC's), 103.40, 102.69, 82.65, 74.62, 74.54, 73.36, 73.32, 73.06, 72.94, 72.52, 68.09, 56.87; HRMS(FAB): calcd for [M+Nat CSSH60011Na 919.4033, found 919.4023. Methyl 0-(2,3,4,6-tetra-O-benzYI-a-D-galactopyranosyl)-(174)-3,6 -di-O-benzyl-a-D-mannopyranoside (35). A solution of oxalyl chloride (95.8 JlL, 0.177 mmol) in anhyd CH2CI2 (7 mL) was cooled to -78°C, and anhydrous OMSO (154.3 JlL, 0.349 mmol) was added dropwise. The mixture was stirred at -78°C for 10 min and solution of methyl glycoside 34 (231 mg, 0.258 mmol) in CH2CI2 (11.5 mL) was added over 10 min. The cloudy solution was stirred for 40 min followed by addition of triethylamine (5 mL) to give a clear solution. The mixture was brought to rt, diluted with cold water (30 mL) and extracted with CH2CI2• The organic layer was dried over Na2S04 and concentrated under reduced pressure to yield the oxidised 2-ulose intermediate (Rt = 0.53 in 50% ethyl acetate in hexane). This product was dissolved in 50% CH2CI2 in CH30H (4 mL) and NaBH4 (150 mg, 3.96 mmol) was added at 0 °C. The reaction mixture was brought to rt and after 4 h it was diluted with CH2CI2 and washed with cold water. The organic layer was collected, dried over Na2S04 and concentrated to give a crude product which was purified by flash chromatography
-
am of nitrogen gas, and further dried under vacuum to provide a semisolid hexa-O-benzyl lactal 1,2a-epoxide 33
-
dissolved in water (100 mL) and extracted with CH2Cb (3 x 60 mL). All the organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyllactal (30, 7.2 g, 87.8%) as amorphous solid [a]o -18 (c 1.0, CHCI3)84. Hexa-O-benzyl lactal (32). A solution of hexa-O-acetyl lactal (30, 7.26 g, 0.013 mmol), dry sodium carbonate (9 g, 0.085 mol) in anhyd CH30H (150 mL) was stirred at rt for 90 min. The suspension was filtered to remove extra Na2C03 and the filtrate was concentrated under reduced pressure to give deacetylated lactal 31 (same as described in Scheme-1) as an amorphous solid (3.87 g, 97.7%); R, = 0.2 in 7:3 CHCkCH30H; [a]o +27 (c 1.6, H20)84. Compound 31 (500 mg, 1.62 mmol) dissolved in anhydrous DMF (5 mL) was added dropwise at 0 °C to a suspension of NaH (1.3 g, 60% dispersion in paraffin) in DMF (5 mL), followed by addition of benzyl bromide (2 mL, 16.8 mmol) and few crystals of tetrabutyl ammonium iodide. The reaction mixture was brought to rt and stirred for 3 h. After completion of the reaction, the mixture was cooled to 0 °C and quenched with CH30H (5 mL), diluted with cold water (50 mL) and extracted with diethyl ether (3 x 30 mL). The ethereal layer was dried over Na2S04 and concentrated to give a crude product which was flash chromatographed using 5% ethyl acetate in hexane to provide compound 32 (792 mg, 60.2%); R, = 0.6 in 50% ethyl acetate-hexane; [a]o -2.1 (c 0.726, CHCI3); 1H NMR (CDCI3, 300 MHz) () 6.43 (dd, J = 6.2,1.1 Hz, 1H, H-1), 4.92 (brd, J = 10.8 Hz, 1 H, H-3'), 4.86 (m, 1 H, H-2), 4.53 (dd, J = 10.5, 1.2 Hz, 1 H, H-4'), 4.35 ( d, J = 4.2 Hz, 2H, H-1'), 4.29 (brs, 1 H, H-4), 4.26 (m, 1 H, H-3), 3.86-3.74 (m, 2H, H-5, 5'), 3.65 (m, 2H, H-6), 3.45 (d, J = 4.2 Hz, 2H, H-1'); 13C NMR (CDCI3, 75 MHz) () 138.6-138.2 (6 ipso C), 128.3-127.4 (ArC's), 102.51, 82.4,79.7, 76.6, 75.2, 74.6, 73.5, 73.47, 73.41,73.0,72.69,72.61,69.17,68.36; HRMS (FAB): calcd for [M+Nat CS4Hs60sNa 871.382204, found 871.386586. Hexa-O-benzyl-lactal-1,2a-epoxide (33). A solution of 3,3-dimethyl dioxirane (DMD) in acetone was freshly prepareds3.s4 by adding potassium monoperoxy sulphate (Oxone, DuPont, 25 g, 0.041 mol) into a mixture of water (20 mL), acetone (13 mL, 0.177 mol), sodium bicarbonate (12 g) in a two neck flask with vigorous stirring at rt. The DMD solution was received through a water condenser (5°C) by application of slight vacuum into a flask cooled to -50°C. DMD was added dropwise to a solution of compound 32 (250 mg, 0.3 mmol) in anhydrous CH2CI2 (2 mL) at 0 °C. After 2 h the reaction mixture was concentrated with a strea
-
Hexa-O-acetyl lactal (30). A solution of Vitamin B12 (310 mg, 0.22B mmol) in anhydrous CH30H (BO ml) was thoroughly purged with nitrogen for 30 min and zinc powder (17.5 g, 267.6 mmol) and ammonium chloride (14.2 g, 266.25 mmol) were added to the solution. The reaction mixture was stirred for another 45 min and heptaacetyl lactosyl bromide (29), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (4B% hydrobromic acid in acetic acid)], was dissolved in CH30H (30 ml) and added. Immediately after addition of the bromide, the dark red solution changed to reddish yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, and the celite pad was washed with CH30H and the filtrate was concentrated under reduced pressure to give a white and red solid product. This was
-
Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
-
Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
-
Selective cleavage of phosphoglycans from the resin. This was accomplished by taking the PG loaded resin (3 mg) and Wilkinson's catalyst (1 mg) in argon-purged solvent mixture (300 Ill, toluene-PrOH-H20, 2:1 :0.08 containing 0.01 N HCI) and shaking it for 7 h at rt. The cleavage after first cycle of coupling provided 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galacto pyranosyl]-a-D-mannopyranosyl-phosphate. This intermediate was subjected to full deprotection to provide ~-D-galactopyranosyl-a-D-mannopyranosyl phosphate (25) and compared with authentic sample earlier reported86 by our laboratory; [a]D = +10° (c 0.1, H20); lH NMR (D20, assignments by 2D COSY and TOCSY experiments) 0 3.45 (dd, J = 6.67 and 1.5 Hz, 1 H, H-2'), 3.46 (m, 1 H, H-5), 3.60 (m, 1 H, H-5'), 3.53-3.56 (m, 2H, H-2,3'), 3.68 (m, 2H, H-6), 3.76 (t, J = 7.11 and 2.64 Hz, 1 H, H-3), 3.83 (m, 2H, H-6'), 3.83 (m, 1 H, H-4'), 3.94 (m, 1 H, H-2), 4.38 (d, J = 9.65 Hz, 1 H, H-4), 4.38 (d, J = 7.6 Hz, 1 H, H-1'), 5.27 (dd, J1H-P = 6.8 Hz and J1•2 = 1.9 Hz, 1 H, H-1); 31p NMR 0 -2.07; ESMS, 421.2 [M-1 Ht; HRMS (ESMS): calcd for [M-Hr C12H22014P 421.2720 found 421.2718. Similar procedure was used to cleave phosphotetrasaccharide 22 from resin followed by complete deprotection, which provided compound 23 that was characterized by its comparison with standard prepared by solution method.
-
opyranosyl phosphate] triethylammonium salt (22). The butenediol-linker functionalized Merrifield resin (19, 50 mg, 0.43 mmol/g, 0.021 mmol) was swollen in anhydrous pyridine (100 Ill) for 15 min, followed by addition of phosphoglycan H-phosphonate donor 6 (26 mg, 0.03 mmol) dissolved in anhydrous pyridine (500 Ill). Now pivaloyl chloride (20 Ill) was added and the resin mixture was shaken for 2 h. Thereafter a 200 III solution of iodine (4 mg) in 95% aqueous pyridine was added and stirring continued for another hour. The resin was then thoroughly washed with CH30H (700 III x 3) and dried over P20S overnight to afford acceptor-functionalized resin (20, 50 mg). ~ The coupled intermediate was characterized by positive ion ESMS after cleaving it off from the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl-a-Dmannopyranose which was identical to compound 5, already synthesized by solution method described earlier; ESMS m/z 731.3 (M+Nat. This compound on full deprotection with 48% aqueous HF-CH3CN (5:95) and CH30H-H20-EhN (5:2:1) provided disaccharide Gal1 ,4~Man (24); lH NMR 8 5.12 (d, J = 1.67 Hz, 1 H, H-1 a), 4.85 (d, 1 H, J = 0.98 Hz, 1 H, H-1 ~), 4.40-4.36 (m, 2H, H-1' and H-4), 3.75 (dd, 1 H, H-2'),3.94-3.92 (m, 2H, H-4' and H-2), 3.89-3.83 (m, 2H, H-6'), 3.81-3.79 (dd, 1H, J= 6 and 2 Hz, 1 H, H-3), 3.75-3.71 (m, 2H, H-6), 3.63-3.59 (dd, 1 H, H-3'), 3.51-3.46 (m, 2H, H-5, H-5'); ESMS: m/z 341.0 [M-Hr. To a part of the PG loaded resin 20 (15 mg), 48% aqueous HF-CH3CN (5:95,500 Ill) was added at 0 °C and the mixture was stirred on a orbital shaker for 3 h. The resin was then washed with CH30H (500 III x 2) and dried under vacuum to afford acceptor bound resin (21) with free 6' hydroxyl groups. This intermediate was again characterized by ESMS after cleaving it off from a small part of the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-O-acetyl-4-0-(2,3,4-tri-O-acetyl-~D-galactopyranosyl)-a-D-mannopyranose. Authenticity of this compound was confirmed by its comparison (TlC, NMR, ESMS) with standard separately prepared via solution synthesis by deprotection (HF-CH3CN) of TBDMS group from compound 5 (Scheme-1). A second cycle of PG coupling was carried out with identical procedure given above to afford phosphotetrasaccharide (22).
-
and water (150 mL). The organic layer was dried (Na2S04) and concentrated. The crude product was purified by silica column chromatography (20% ethyl acetate in hexane with 1% EhN) to afford 17 (4.2 g, 80%); Rf = 0.3 in 50% ethyl acetate in hexane; 1H NMR (CDCI3, 300 MHz): <52.03 (s, 1 H), 3.68 (d, J = 4.8 Hz, 2H), 3.78 (s, 6H), 4.03 (d, J = 5.4 Hz, 2H), 5.73-5.75 (m, 2H), 6.82 (tt, J = 1.2 and 9.0 Hz, 4H), 7.25-7.44 (m, 9H); 13C NMR (CDCb, 75 MHz): 55.12, 55.13, 58.75, 59.93, 113.05, 126.68,127.76,127.99,128.95,129.87,130.92, 136.07,144.79,158.37; ESMS m/z 413.39 (M+Nat Preparation of functionalized resin by coupling of linker (19). 4-(4,4'-Dimethoxytrityl)-2-cis-butenol (17, 1 g, 2.56 mmol) was dissolved in anhydrous DMF (8 mL). Upon cooling to 0 °C, sodium hydride (60% dispersion in mineral oil, 150 mg, 3.75 mmol) was added and the solution was stirred for 1 h. Merrifield's resin (18, 650 mg, chloromethylated polystyrene cross-linked with 1 % divinylbenzene, Fluka-63865) was added along with tetra-butylammonium iodide (95 mg, 0.256 mmol) and shaking was continued for an additional hour at 0 °C after which the reaction mixture was brought to rt and shaken for another 12 h. The capping of unreacted sites on resin was accomplished by addition of CH30H (100 ilL) and sodium hydride (100 mg) and shaking the contents for another 4 h, after which more CH30H (5 mL) was added and the resin was washed sequentially with 1:1 CH30H: DMF (10 mL), THF (10 mL x 3) and CH2CI2 (10 mL x 3). The resin was dried over P20s under vacuum to afford 836 mg of the linker-attached resin (19). To quantify loading8S of linker onto the solid support, a stock solution of 3% TFA in CH2CI2 (10 ml) was prepared which contained effectively 0.167 mg of the protected resin. The resulting orange colour liberated by the release of dimethoxytrityl (DMTr) cation was measured by UV at 503 nm, and the loading of the linker onto the resin was calculated to be 0.43 mmol/g of resin. The deprotection of the entire DMTr-linker functionalized resin was then carried out by treating the resin with 1 % TFA in CH2CI2 (10 mL). Further washing with CH2CI2 (20 mL x 3), 1% EhN in CH2CI2 (10 mL) and CH2CI2 (10 mL) and drying under vacuum afforded 640 mg of deprotected resin ready for coupling with phosphoglycan donors. Solid Phase Synthesis of 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a.-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldi methylsi lyl)-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a.-D-mann
-
Synthesis of SOlid-phase linker, 4-(4,4'-Dimethoxytrityl)-cis-2-butenol (17). To a solution of cis-butene-1,4-diol (16, 4.7 mL, 5 g, 56.7 mmol) in anhydrous pyridine (100 mL) at 0 °C was added 4,4'-dimethoxytrityl chloride (6.4 g, 18.9 mmol). The reaction mixture was gradually brought to rt over 3 h and stirred for additional 12 h. Ethyl acetate (200 mL) was added and the organic phase was washed with water (150 mL), saturated aqueous NaHC03 (200 mL), saturated aqueous NaCI (200 mL)
-
(250 ~L) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M TEAS solution (pH=7, 1 mL). The clear solution was stirred for 15 min. after which CH2CI2 was added and the organic layer was washed with ice cold water (1 mL x 2), cold 1 M TEAS buffer (1 mL x 2), dried over Na2S04, and concentrated to yield compound 13 (5.1 mg, 86%); ESMS m/z 1'427.9 (M-Et3N-H): 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl -(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-~D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate] } bistriethylammonium salt (14). Mixture of compounds 13 (5.1 mg, 0.003 mmol) and 6 (5 mg, 0.007 mmol) was dried by evaporation of pyridine (500 ~L x 2). The residue was dissolved in anhydrous pyridine (200 ~L) and pivaloyl chloride (2.4 ~L, 0.02 mmol) was added. The mixture was stirred at rt for 1 h and a freshly prepared iodine solution (200 ~L, 4 mg, 0.015 mmol in pyridine-water, 95:5) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M aqueous Na2S203 solution (2 mL x 2), ice-cold 1 M TEAS buffer (2 mL x 2), dried over Na2S04 and concentrated to afford 14 (4.5 mg, 61%); Rf = 0.11 in 10% CH30H in CH2CI2; ESMS m/z2061.44 (M-2EhN-H), 2062.35 (M-2EhN). ~-D-Galactopyranosyl-(1~4)-a-D-mannopyranoside {6-~-D-galactopyranosyl(1~4)-a-D-mannopyranosyl phosphate 6-[ ~-D-galactopyranosyl-(1~4)-a-Dmannopyranosyl phosphate]} bis-triethylammonium salt (15). The global deprotection of fully protected phosphohexasaccharide 14 was carried out by same method as given for preparation of compound 9, and this compound was identical to PG oligomer 12 prepared by upstream extension described earlier.
-
(19 x OCOCH3), 3.50 (m, 6H, H2-6 Gal/Gal'/Gal"), 3.87-3.94 (m, 3H, H-5, Gal/Gal'/Gal"), 4.14-4.07 (m, 3H, 5-H, Man/Man'/Man"), 4.30-4.35 (m, 3H, 4-H, Man/Man'/Man"), 4.39 (m, 6H, H2-6, Man/Man'/Man"), 4.48 (m, 2H, 3-H, Man'/Man"), 4.52 (m, 1 H, 3-H, Man), 4.94 (d, J = 7.7 Hz, 3H, H-1, Gal/Gal'/Gal"), 5.28 (m, 6H, 2-H Man, H-4 Gal/Gal'/Gal", H-3 Gal'/Gal"), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 2H, H-2 Gal'/Gal"), 5.45 (dd, JHH = 1.9 and JHP = 7.0 Hz, 2H, H-1, Man'/Man"), 5.46 (m, 3H, H-2, Gal/Gal'/Gal"), 6.01 (d, J = 1.9 Hz, 1 H, 1-H, Man); 31p_NMR: 8 -1.94; ESMS m/z2061.44 (M-2Et3N-H), 2062.35 (M-2Et3N). ~-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside {S-~-D-galactopyranosyl(1~4)-a-D-ma nnopyranosyl phosphate S-[ ~-D-galactopyranosyl-(1~4)-a-Dmannopyranosyl phosphate]) bis-triethylammonium salt (12). The global deprotection of fully protected phosphohexasaccharide 11 was carried out by same method as given for preparation of compound 9 earlier; 1 H-NMR (020), due to Oligomeric nature of the molecule (three identical PG repeats), all NMR peaks could not be assigned,: 3.45 (m, 3H, H-2, Gal/Gal'/Gal"), 3.46 (m, 2H, H-5, Man'/Man"), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 3H, H-3, Gal/Gal'/Gal"), 3.60 (m, 3H, H-5, Gal/Gal'/Gal"), 3.68 (m, 6H, H2-6, Man/Man'/Man"), 3.76 (m, 3H, H-3, Man/Man'/Man"), 3.80 (m, 6H, H2-6, Gal/Gal'/Gal"), 3.83 (m, 3H, H-4, GaVGal'/Gal"), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 2H, H-2, Man'/Man"), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J= 7.6 Hz, 2H, H-1, Gal'/Gal"), 4.35 (d, J= 7.6, 1H, H-1, Gal), 5.09 (d, J= 1.8, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed und
-
= 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the anomeric deprotected product in quantitative yield. To a stirred solution of imidazole (6 mg, 0.87 mmol) in anhydrous CH3CN (250 J!L) at 0 °C was added PCI3 (10 J!L, 0.112 mmol) and EhN (30 J!L, 0.215 mmol). The mixture was stirred for 20 min, after which a solution of the above compound in anhydrous CH3CN
-
Man), 61.37 (C-6, Man'), 62.30 (C-6, Gal'), 65.53 (C-6, d, Jcp = 5.5 Hz, Gal), 69.28 (C-4, Gal), 69.83 (C-4, Gal' and C-3, Man'), 70.84 (C-3, Man and C-2, Man), 71.08 (C-2, d, Jcp = 7.4 Hz, Man'), 72.13 (C-2, Gal' and C-2, Gal), 72.34 (C-5, Man), 73.69 (C-3, Gal', C-3, Gal and C-5, Man'), 74.89 (C-5, d, JcP = 7.5 Hz, Gal), 76.52 (C-5, Gal'), 77.05 (C-4, Man'), 78.14 (C-4, Man), 97.03 (C-1, d, Jcp = 5.5 Hz, Man'), 100.76 (C-1, Man), 104.20 (C-1, Gal'), 104.42 (C-1, Gal); 31p-NMR: -1.29; ESMS m/z 745.38 (M-Et3N-H)"; HRMS (ESMS): calcd for (M-Et3N-H)" C24H42024P 745.1804, found 745.1830. 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mann opyranoside 6-(2,3,4-tri-O-acetyl-(3-D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyla-D-mannopyranosylphosphate ) triethylammonium salt (10). A solution of 48% aqueous HF in CH3CN (5:95, 5 ml) was added to compound 8 (20 mg, 0.015 mmol) at 0 DC and stirred at 0 DC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated to give compound 10 (15.6 mg, 85%); ESMS m/z 1290.4 (M-EhN-H)" 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactopyrano syl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl -(3-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate ]) bis-triethylammonium salt (11). Mixture of phosphotetrasaccharide acceptor 10 (15.6 mg, 0.015 mmol) and H-phosphonate donor 6 (20.8 mg, 0.024 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (500 Ill), and pivaloyl chloride (10 Ill, 0.083 mmol) was added. The mixture was stirred for 1 h at rt after which a freshly prepared solution of iodine (500 Ill, 16 mg, 0.06 mmol in pyridine-water, 95:5) was added. After 30 min, CH2CI2 was added and the solution was washed successively with cold 1 M aq Na2S203 solution (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. The silica column purification using 5% CH30H in CH2CI2 with 1 % EhN afforded compound 11 (16 mg, 63%); R, = 0.11 in 10% CH30H in CH2Cb; lH-NMR (CDCI3); assignments by 1 H_l H COSY and HMQC experiments. Due to repeating nature (three repeats of phosphoglycan) of the molecule, all NMR peaks could not be assigned:1H NMR 0 0.01 (s, 6H, OSiM~CMe3), 0.84 (s, 9H, OSiMe2CMe3), 2.15-1.96
-
2.15 (13 x OCOCH3), 3.50 (m, 4H, H2-6 Gal and Gal'), 3.87 (m, 1 H, H-5, Gal'), 3.94 (m, 1H, H-5, Gal), 4.07-4.10 (m, 1H, H-5, Man'), 4.07-4.14 (m, 1H, H-5, Man), 4.35 (m, 1 H, H-4, Man'), 4.39 (m, 4H, 4-H, H2-6, Man and H2-6, Man'), 4.40 (m, 1 H, H-4, Man), 4.48 (m, 1 H, H-3, Man'), 4.52 (m, 1 H, H-3, Man), 4.94 (d, J = 7.7 Hz, 2H, H-1 ,Gal and H-1, Gal'), 5.28 (m, 4H, H-2 Man, H-4 Gal, H-3 Gal' and H-4 Gal'), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 1 H, H-2 Gal'), 5.45 (dd, JHH= 1.9 and JHP = 7.0 Hz, 1 H, H-1, Man'), 5.46 (m, 1 H, H-2, Gal), 6.01 (d, J = 2.7 Hz, 1 H, H-1, Man); 13C NMR: 0 -5.75, 17.95 and 25.57 (for TBOMS group), 20.48-20.79 (CH~02 x 13), 60.06 (C-6, Gal'), 60.42 (d, Jcp = 8 Hz, C-6, Gal), 62.22 (C-6, Man), 62.63 (C-6, Man'), 66.55 (d, C-2, Man'), 67.46 (d, C-5, Gal), 68.27 (C-4, Gal), 68.64 (C-4, Gal'), 69.37 (C-3, Man'), 69.66 (C-5, Man), 69.84 (C-3, Man), 70.14 (C-5, Man'), 70.75 (C-2, Gal'), 70.88 (C-2, Gal), 71.20 (C-2, Man), 73.31 (C-3, Gal'), 73.76 (C-3, Gal), 74.24 (C-4, Man'), 77.15 (C-4, Man), 78.95 (C-5, Gal'), 90.41 (d, C-1, Man'), 91.69 (C-1, Gal), 101.08 (C-1, Man), 101.29 (C-1, Gal'), 168-171 (CH3CO x 13); 31p_NMR: 0 -2.90 (dt, JPH 7.5 and 10); ESMS m/z 1405.2 (M-EhN-Hf; HRMS (ESMS): calcd for (M-Et3N-Hf C56H82037PSi 1405.4042, found 1405.4105. J3-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside 6-[J3-D-galactopyranosyl-(1~)-a-D-mannopyranosyl phosphate] triethylammonium salt (9). A solution of 48% aqueous HF in CH3CN (5:95, 1.5 ml) was added to compound 8 (15 mg, 0.01 mmol) at 0 °C. The solution was stirred at 0 °C for 2 h. The reaction was quenched by the addition of aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated. The residue was dissolved in anhydrous CH30H (500 Ill) and NaOMe (15 mg) was added, the solution was stirred overnight at rt, deionized with AG-X8 resin (H+), filtered and immediately neutralized with Et3N. After concentration, water (500 III x 3) was evaporated off from the residue to afford tetrasaccharide phosphodiester 9 (7.9 mg, 94%); [a]o = 34° (c 0.15, H20); lH-NMR (020), lH_1H_ COSY assignments: 3.45 (m, 2H, H-2, GaVGal'), 3.46 (m, 1 H, H-5, Man'), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 2H, H-3, Gal/Gal'), 3.60 (m, 2H, H-5, Gal/Gal'), 3.68 (m, 4H, H2-6, Man/Man'), 3.76 (m, 2H, H-3, Man/Man'), 3.80 (m, 4H, H2-6, Gal/Gal'), 3.83 (m, 2H, H-4, GaVGal'), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 1 H, H-2, Man'), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J = 7.6 Hz, 1 H, H-1, Gal'), 4.35 (d, J = 7.6 Hz, 1 H, H-1, Gal), 5.09 (d, J = 1.8 Hz, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 Hz and JHP = 6.8 Hz, 1 H, H-1, Man'); 13C-NMR, assignment made by 20 lH_13C HETCOR experiment, 61.37 (C-6,
-
66.57 (C-4'), 69.36 (C-3), 69.53 (C-5), 69.69 (C-2'), 71.20 (C-2). 73.30 (C-3'), 73.86 (C-5'), 91.59 (C-4), 92.54 (C-1), 101.09 (C-1'), 169.13-170.49 (COMe); 31p NMR: 8= 0.13; ESMS m/z 771.26 (M-Et3N-Hr; HRMS (ESMS): calcd for (M-EbN-Hr C30H48019PSi 771.2297, found 771.2276. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4-tri-O-acetyl-j3-D-galactopyranosyl)-a-D-manno pyranose (7). A solution of 48% aqueous HF in CH3CN (5:95, 8 ml) was added to compound 4 (100 mg, 0.132 mmol) at 0 °C and the solution was stirred for 2 h. The reaction was quenched with aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2. The organic layer was washed thoroughly with water, dried over Na2S04 and concentrated to give 7 (72 mg, 85.7%); Rt = 0.3 in 70% ethyl acetate in hexane; [a]o = +4.6° (c 0.3, CHCI3); 1H NMR (CDCI3, 300 MHz) 81.97-2.16 (m, 21 H, 7 x OAc), 3.67-3.74 (m, 3H, H-5',6), 4.08-4.14 (m, 3H, H-5,6'), 4.58 (d, J = 7.8 Hz, 1H, H-1'), 5.16 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.23 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.32 (d, J = 3.3 Hz, 1 H, H-4), 5.41 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 6.01 (d, J = 2.1 Hz, 1 H, H-1); 13C NMR (CDCI3, 75 MHz) 8 20.42-20.77 (7 x COMe), 60.74 (C-6'), 62.25 (C-6), 67.56 (C-4'), 68.31 (C-3), 69.35 (C-5), 69.43 (C-2'), 70.77 (C-2), 70.83 (C-3'), 73.98 (C-5'), 74.32 (C-4), 90.45 (C-1), 101.30 (C-1'), 168.32-170.80 (7 x COMe),; ESMS m/z659.28 (M+Nar; HRMS (ESMS): calcd for (M+NH4r C26H40N018 654.2245, found 654.2272. 2,3,4-Tri-O-acetyl-j3-D-galactopyranosyl-(1-?4)-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-j3-D-galactopyranosyl -(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mannopyranosyl phosphate] triethyl ammonium salt (8). Mixture of H-phosphonate donor 6 (32 mg, 0.036 mmol) and acceptor 7 (23 mg, 0.036 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (600 Ill) and pivaloyl chloride (15 Ill, 0.123 mmol) was added. The reaction mixture was stirred for 1 h at rt and a freshly prepared iodine solution (600 Ill, 18 mg, 0.078 mmol in pyridine-water, 95:5) was added. After 30 min. CH2CI2 (10 ml) was added and the solution was washed successively with cold 1 M aqueous solution of Na2S203 (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. Column chromatography on silica gel (3% CH30H in CH2CI2 with 1 % EbN) afforded product 8 (40 mg, 73.8%); Rt= 0.21 in 10% CH30H in CH2CI2; [a]o = -6.1° (c 0.18, CHCI3); 1H_ NMR (CDCI3, 300 MHz); assignments confirmed by 1H_1H COSY and HMQC experiments: 1 H NMR 8 0.01 (5, 6H, OSiM9:2CMe3), 0.84 (s, 9H, OSiMe2CMe3). 1.96-
-
2,3,6-Tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactop yranosyl]-a-D-mannopyranose (5). Compound 4 (100 mg, 0.132 mmol) was dissolved in saturated Me2NH solution in anhydrous CH3CN (20 ml) at -20°C and stirred for 3 h after which TlC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the desired anomeric deprotected compound 5 in quantitative yield; R, = 0.25 in 70% ethyl acetate in hexane; [a]D = +3.75° (c 0.16, CHCI3); 1H NMR (CDCI3, 300 MHz) 80.01 (s, 6H, M~SiCMe3), 0.84 (s, 9H, Me2SiCMSJ), 1.95-2.19 (m, 18H, 6 x OAc), 3.56-3.66 (m, 4H, H-6,6'), 3.91 (m, 1H, H-5), 4.12-4.16 (m, 2H, H-5', OH), 4.40 (d, J= 4.5 Hz, 1H, H-4), 4.40 (d, J= 7.8 Hz, 1 H, H-1'), 4.99 (dd, J = 3.3 and 7.8 Hz, H-3'), 5.09 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'), 5.17 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.23 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 5.43 (m, 2H, H-4',1); 13C NMR (CDCI3, 75 MHz) 8 -5.77 (M~SiCMe3), 17.98 , (Me2SiCMe3)" 20.40-21.38 (OAc), 25.58 (Me2SiCMe3), 60.06 (C-6'), 62.62 (C-6), 66.56 (C-4'), 68.78 (C-3), 69.30 (C-5), 69.51 (C-2'), 70.06 (C-2), 71.21 (C-3'), 73.37 (C-5'), 74.15 (C-4), 91.82 (C-1), 101.04 (C-1'), 169.10-170.52 (COMe); ESMS m/z 731.3 (M+Nat. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethyl silyl)-(3-D-galactopyranosyl]-a-D-mannopyranosyl hydrogen phosphonate (6). To a stirred solution of imidazole (224 mg, 3.28 mmol) in anhydrous CH3CN (5 ml) at o °C was added PCI3 (160 Ill, 1.8 mmol) and EhN (480 Ill, 3.44 mmol). The mixture was stirred for 20 min, after which a solution of compound 5 dissolved in anhydrous CH3CN (5 ml) was added dropwise. The mixture was stirred at 0 °C for 3 hand quenched with 1 M triethylammonium bicarbonate (TEAS) buffer (pH 7, 2 ml). The clear solution was stirred for 15 min, diluted with CH2CI2 (20 ml), and the organic layer was washed with ice cold water (10 ml x 2) and cold 1 M TEAS solution (10 ml x 2) successively, dried over Na2S04 and concentrated to yield phosphoglycan donor 6 (100 mg, 86%); R, = 0.45 in 20% CH30H in CH2CI2; [a]D = -4.5° (c 0.27, CHCb); 1H NMR (CDCI3, 300 MHz) 8 0.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, M~SiCMSJ), 1.95-2.09 (m, 18H, 6 x OAc), 3.49-3.68 (m, 4H, H-6,6'), 3.88 (m, 1 H, H-5), 4.14 (m, 1 H, H-5'),4.36 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1'), 4.95 (dd, J = 3.3 and 7.8 Hz, 1H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.41 (d, J = 3.3 Hz, 1 H, H-4'), 5.48 (dd, J = 1.8 and 8 Hz, 1 H, H-1), 6.92 (d, JH,p= 637.0 Hz, 1H, H-1); 13C NMR (CDCI3, 75 MHz) 8 -5.80, (M~SiCMe3), 17.98 (Me2SiCMe3), 20.48-20.76 (OAc), 25.57 (Me2SiCMSJ), 60.10 (C-6'), 62.42 (C-6),
-
chromatography (8% CH30H in CH2CI2) to provide compound 2 (10.8 g, 79.5%); Rf = 0.47 in 15% CH30H in CH2CI2; [a]o = +3.45° (c 0.29, CH30H); 1H NMR (020, 300 MHz) 00.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, Me2SiCM~), 3.48 (m, 1 H, H-2'), 3.58 (m, 1 H, H-3'), 3.65 (m, 1 H, H-5), 3.76 (m, 4H, H-6,6'), 3.82 (d, J = 3.1 Hz, 1 H, H-4'), 3.92 (m, 1 H, H-5'), 4.38 (m, 1 H, H-3), 4.31 (d, J = 5.7 Hz, 1 H, H-4), 4.46 (d, J = 7.8 Hz, 1 H, H-1'), 4.76 (dd, J = 3.6 and 6.3 Hz, 1 H, H-2), 6.37 (dd, J = 1.1 and 6.2 Hz, 1 H, H-1); 13C NMR (020, 75 MHz) 0 -4.84 (M~SiCMe3), 25.23 (Me2SiCM~), 59.57 (C-6'), 60.89 (C-6), 67.14 (C-4'), 68.45 (C-3), 70.87 (C-5), 72.52 (C-2'), 75.23 (C-2), 76.68 (C-3'), 77.43 (C-5'), 101.73 (C-4), 102.87 (C-1'), 143.88 (C-1); ESMS m/z 445.10 (M+Naf; HRMS (FAB): calcd for (M+Lif C18H3409SiLi 429.2132, found 429.2126. 1,2,3,6-Tetra-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-( t-butyldimethylsilyl)-~-D-gala ctopyranosyl]-a-D-mannopyranose (4). A solution of 2 (5 g, 11.8 mmol) in water (50 mL) was stirred, to which was added a solution of m-CPBA (6.5 g, 36 mmol) in diethyl ether (50 mL) dropwise at -10 °C. The reaction mixture was brought to 0 °C and stirred for 4 h, and aqueous layer was extracted thoroughly with ether, Iyoph iii zed to afford 4-0-[6-0-( t-butyldi methylsilyl)-f3-0-galactopyranosyl]-a-0-mannopyranose (3) . This was dissolved in anhydrous pyridine (25 mL) and acetic anhydride (25 mL) was added dropwise at 0 °C. The mixture was gradually brought to rt and stirred for 16 h, and after completion of the reaction it was quenched with ice and diluted with CH2CI2. The organic layer was washed with water, dried (Na2S04) and concentrated to give a syrup which was purified by silica column (20% ethyl acetate in hexane) to provide compound 4 as white amorphous solid (7.5 g, 84%); [a]o = +6.72° (c 0.55, CHCI3); Rf = 0.69 in 70% ethyl acetate in hexane; 1H NMR (COCI3, 300 MHz) 0 0.01 (s, 6H, M~SiCMe3)' 0.84 (s, 9H, Me2SiCMe3), 1.95-2.14 (m, 21 H, 7 x OAc), 3.56-3.64 (m, 4H, H-6,6'), 4.17-5.04 (m, 2H, H-5,5'), 4.53 (d, J = 7.8 Hz, 1H, H-1'), 5.01 (dd, J = 3.3 and 7.8 Hz, 2H, H-4), 5.12 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1H, H-2), 5.34 (dd, J = 3.6 and 4.5 Hz, 1H, H-3), 5.41 (d, J = 3.3 Hz, 1H, H-4'), 6.01 (d, J = 2.1 Hz, 1H, H-1); 13C NMR (COCI3, 75 MHz) 8 -5.85 (M~SiCMe3), 17.94 (Me2SiCMe3), 20.40-20.86 (OAc), 25.54 (Me2SiCMe3), 60.01 (C-6'), 62.14 (C-6), 66.45 (C-4'), 68.18 (C-3), 69.25 (C-5), 69.39 (C-2'), 70.58 (C-2), 70.79 (C-3'), 73.38 (C-5'), 73.62 (C-4), 90.25 (C-1), 101.14 (C-1'), 168.08-170.23 (7 x CO); ESMS m/z 773.24 (M+Naf; HRMS (ESMS): calcd for (M+NH4f C32Hs4 N018 Si 768.3110, found 768.3139
-
Lactal (1). A solution of cyanocobalamin83 (Vitamin B12, 1.5 g, 1.14 mmol) in anhydrous CH30H (400 mL) was thoroughly purged with nitrogen gas for 30 min and zinc powder (87.5 g, 1.338 mol) and ammonium chloride (71 g, 1.33 mol) were added to the solution. The reaction was stirred for another 45 min and hepta-O-acetyl lactosyl bromide (47 g, 67.5 mmol), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (48% hydrobromic acid in acetic acid)], was dissolved in CH30H (150 mL) and added. Immediately after addition of the bromide, the dark red solution changed to reddish-yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, the celite pad was washed with CH30H and the filtrate was concentrated to give a white and red solid. This mixture was dissolved in water (500 mL) and extracted with CH2CI2 (300 mL x 3). Organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyl lactal (36 g, 87%) as an amorphous solid, mp 113° (lit84 mp 114°); [a)D = -18° (c 1.0, CHCI3) (Iit84, -18°, c 1.0, CHCI3). In the next step of complete deacylation, hexa-O-acetyl lactal (36 g, 64.5 mmol) and freshly dried Na2C03 (45 g, 425 mmol) were suspended in anhydrous CH30H (750 mL) and stirred for 90 min at rt. The suspension was filtered to remove excess of Na2C03 and the filtrate was concentrated under reduced pressure to give deprotected lactal (1) as an amorphous solid (19.4 g, 98%); R,= 0.2 in 30% CH30H in CH2CI2; mp 191-193°; [a]D = +27° (c 1.6, H20) (lit84, +27°, c 1.6, H20). 6'-0-(f-butyldimethylsilyl)-lactal (2). A solution of lactal (1, 10 g, 32.4 mmol) and BU2SnO (8 g, 32.5 mmol) in anhydrous CH30H (1000 mL) was heated to reflux for 4 h followed by removal of solvent which provided a yellow powder. The dibutyltin complex was dissolved in anhydrous THF (1000 mL) and TBDMSCI (4.9 g, 32.3 mmol) was added, and the solution was stirred for 48 h at rt. After the completion of reaction, the solvent was evaporated to give a residue which was purified by silica
-
The NMR spectra of the compounds were obtained on a 300 MHz (for 1H) NMR spectrometer (Avance-DRX 300; Bruker), equipped with a quadrinuclear probe (QNP) and an inverse gradient probe, using XWIN NMR software. Both these probes were 5 mm probes. Deutrated solvents (CDCI3, CD30D, 020 etc) were used for dissolving samples and locking the instrument. Tetramethylsilane (TMS, SiMe4) was used as the internal reference for 1H NMR and 80% ortha-phosphoric acid as external reference for 31 P-NMR. The chemical shifts have been expressed in terms of parts per million (ppm, 6) relative to TMS and coupling constants (J-values) have been expressed in Hertz (Hz). Molecular masses of the compounds were determined by mass spectrometry. Depending on the nature of the compound, electrospray-ionization (ES-MS) was obtained in negative or positive ion mode on a quadrupole mass spectrometer (VG Platform II; VG BioTech, Fisons Instruments, Altrincham, UK) using MassLynx software. High resolution mass spectra were obtained from IICT, Hyderabad and University of Kansas mass spectrometry facility. Optical rotations were obtained using a Perkin-Elmer 241 Spectropolarimeter. Measurements were made at 25°C using sodium D-line. The [alo values have been expressed in the units of 10.1 deg cm2 gm-1. The entire radioactivity operation was carried out in a fume-hood devoted to radiochemical work. Disposable items were discarded at a defined and instructed place. All other necessary precautions for handling radioactivity were taken. Liquid scintillation counting of samples was done on a scintillation counter using preset program for 1H ~ emitter. A suitable aliquot in triplicate was mixed with 5 mL scintillation fluid (Cocktail W-10 g PPO, 0.25 g POPPO and 100 g naphthalene per litre of 1,4-dioxan; SRL) in scintillation vials. For solvent blank, vial containing 5 mL scintillation cocktail was used.
-
All the reagents used in chemical syntheses and biosynthetic experiments were of the highest purity grade available. Glass-backed and aluminium TLC plates (Kieselgel 60 F254) were procured from Merck. Silica coated preparative glass-backed TLC plates were purchased from AnalTech. AG1-X8 and Dowex 2X8 anion exchange resins were obtained from Bio-Rad. All dry solvents were prepared in the laboratory using standard procedures for drying. Milli Q UF (Reverse Osmosed, ion exchanged and Ultra-filtered; Millipore Corporation, USA) grade water was used. For refluxing an oil-bath (high boiling silicone oil) was used and the temperature was controlled by a variostate and sensor. Stirring of the contents of reaction flasks, oil bath etc., were done using appropriate sized magnetic bars and Magnetic stirrer (Remi). For filtration of materials, Whatman #1 paper and Celite (Fluka) was used. For removing solvent from compounds, a flash evaporator (Rotavapour R-114, Buchi) was used which was connected to a water-chiller circulator and at times with a high vacuum pump to remove high boiling solvents. Monitoring the progress of reactions, analysis of column fractions and identification of reaction intermediates were done by thin layer chromatography on glass backed precoated TLC plates. The developed plates were air-dried and subjected to the following detection system: 1. Iodine vapors: Sublime iodine crystals were mixed with silica gel in an air-tight chamber. When the chamber was full of iodine vapors, the plates were exposed to this when yellowish brown spots were visible against white background. 2. Ultraviolet light: U.V. absorbing compounds were visualized by a hand-held UV lamp (Spectroline Model ENF-260C/F) employing both long and short wavelength UV. 3. Ammonium molybdate-ceric sulfate reagent: This reagent was prepared by dissolving ammonium molybdate (2.5 g) and ceric sulfate (1 g) in water (90 mL) and conc. Sulfuric acid (10 mL). The developed plates were immersed in this reagent and heated with a heat-gun (HEJET Model, Aldrich). Blue spots were observed when the compounds reacted with this reagent.
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
RFFIT is used for detennination of rabies virus neutralizing antibody (RVNA) titers. It is an in vitro cell culture based technique in which foci of virus-infected cells are observed by fluorescent antibody staining. In brief, mouse neuroblastoma (MNA) cells were cultured in T-25 tissue culture flasks in DMEM supplemented with 10% FCS at 35°C in humidified atmosphere of0.5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDT A in DMEM without FCS), centrifuged at 150 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T -25 flasks. Sera from immunized mice were heat inactivated at 56°C for 30 min and the RVNA titers were determined by RFFIT as described previously (Smith . et al., 1996). Briefly, 100 111 of various dilutions of the reference (Standard Rabies Immune Globulin, Biological Research and Reviews, FDA, Maryland, US) and the test sera were mixed with 100 111 Challenge Virus Strain-11 of rabies virus (containing 50 FFD50) in 8-well tissue culture chamber slides and incubated at 35°C in presence of 0.5% C02 for 90 min. After the incubation period, 0.2 ml of MNA cells ( 1 x 1 05) were added to each well and the slides incubated for 40 h following which these were fixed in chilled acetone and stained with FITC conjugated anti-rabies MAb (Centocor Inc, USA) for 45 min. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan). Data was expressed as neutralizing antibody titer that is the reciprocal of the serum dilution resulting in a 50% reduction in the number of the virus infected cells in the presence of the test serum.
-
Turku, Finland). Data were expressed as mean counts per minute (cpm) ± SE of triplicate cultures.
-
Single cell suspensions of splenocytes in RPMI-1640 medium were prepared from plasmid DNA immunized mice, on day 45, by mechanical disruption of the spleen. Red blood cells were lysed by exposing the cell pellet to 1 OX concentration of 50 mM PBS and immediately bringing the concentration to IX PBS by addition of water. Cells were diluted to a final concentration of 3 x 106 cells/ml in RPMI-1640 medium supplemented with l 0% FCS. A 100 J.ll aliquot of splenocytes was added to each well of a 96-well microtitration plate containing serial dilutions of refolded recombinant proteins (r-bmZP1, r-dZP3 orr-rG), diluted in the same medium, as a source of antigen. All assays were carried out in . triplicates. Three days after the addition of the cells, culture were pulsed with 1 J.lCi/well of eH] thymidine (NEN, Life Science Products, Boston, MA) for 16 h. Cells were lysed and harvested onto glass fibre filaments for liquid scintillation counting (Betaplate; Wallac,
-
weight) as a general anesthetic and ovaries were snap frozen in liquid nitrogen. Ovarian sections of 5 J.lm thickness were cut in a cryostat at -20°C and fixed in chilled methanol for 15 min at RT. Sections passing through follicles were selected, washed with 50 mM PBS and blocked with 3% normal goat serum (NGS) in PBS (v/v) at RT for 1 h. Sections were then washed two times with PBS and incubated with 1: 1 0 dilution of immune serum samples. Ovarian sections incubated with 1:10 dilution of mouse preimmune or immune sera from mice immunized with VR1020 vector served as negative controls. After incubation, the sections were washed three times with PBS and incubated with 1:800 dilution of goat anti-mouse IgG conjugated to FITC (Sigma) for 1 hat RT. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan).
-
Ability of mouse polyclonal antibodies, generated subsequent to immunization with VRbmZP1 and VRdZP3 plasmid DNA, to recognize native ZP was evaluated by indirect immunofluorescence assay. A normal cycling female bonnet monkey and a female dog were ovariectomized after administration of ketamine hydrochloride (5 mg/kg body
-
The antibody isotypes in the immune sera were determined, by indirect ELISA, using mouse MAb isotyping reagents (Sigma). The microtitration plates coated with r-dZP3 (400 ng/well) and blocked with 1% BSA, were incubated with doubling dilution of pooled serum samples of a group of immunized animals. All the incubations were carried out at 37°Cand were followed by three washings with PBST. The incubation was followed by addition of goat anti-mouse isotype specific antibodies at 1:1000 dilution. The binding was revealed by rabbit anti-goat lgG-HRPO conjugate (Pierce) at an optimized dilution of I: 10,000 and processed for enzymatic activity estimation as described earlier.
-
492 run with 620 nm as the reference filter. The antibody response generated was represented as the geometric mean of the absorbance of individual mice sera in a group of immunized animals. b1 addition, the antibody titer against r-dZP3 was also determined by ELISA. The assay was carried out as described above except that 100 ~l of doubling dilutions of the serum samples (dilutions made in PBST supplemented with 0.1% BSA) were added per well in duplicate. For each serum sample tested, a reciprocal of dilution giving an absorbance of 1.0 was calculated by regression analysis and represented as antibody units (AU).
-
Microtitration plates were coated with optimized concentration of r-bmZP1 (250 ng/well), r-dZP3 (400 ng/well) or r-rG (500 ng/well) in 50 mM PBS, pH 7.4, at 37°C for 1 h and then at 4°C, 0/N. The plates were washed once with PBS and incubated with 1% BSA, (200 Jll/ well) in PBS for 2 h at 37°C for blocking the non-specific sites. All subsequent incubations were carried out for 1 h at 37°C and each incubation was followed by three washings with PBS containing 0.05% Tween-20 (PBST). Post-blocking, the plates were incubated with 1 :50 dilution of either the preimmune or the immune serum samples obtained from mice immunized with the respective plasmid DNA. Antibodies bound tor-bmZP 1, r-dZP3 and r-rG were revealed with 1:2000 dilution of goat anti-mouse IgG (whole molecule) HRPO (Dako). Estimation of the enzymatic activity was carried out with 0.05% OPD in 50 mM citrate phosphate buffer, pH 5.0, containing 0.06% H202 as the substrate. The reaction was stopped with 50 Jll of 5 N H2S04 and the absorbance read at
-
d) Particle delivery using the Helios gene gun A day prior to immunization, hair were removed from the abdominal region of mice using a commercial depilatory agent (Anne French cream). Two cartridges/mouse ( ~ 2 Jlg DNA) were shot under pressurized helium gas ( 400 psi) intradermally at the shaven area of the abdomen of mice using the Helios gene gun. Two boosters comprising of two cartridges each were given on days 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 Jlglmouse in saline). Mice were bled retro-orbitally on days 0, 45 and 52 for analysis of antibody response.
-
tubing, which was cut into 0.5 inch pieces (cartridges). These cartridges were used to deliver DNA into epidermis of male/female mice. a) Preparation of DNA-gold microcarrier suspension Twenty five mg of gold microcarriers were weighed in a 1.5 ml eppendorf tube to which 100 J..Ll of 0.05 M spermidine was added and vortexed for 10 sec. To the above mixture 100 J..Ll of DNA (0.5 mg/ml) was added and vortexed for another 10 sec. While vortexing, 100 J..Ll of 1 M CaCh was added dropwise to the mixture and left at RT for 10 min to allow precipitation of DNA onto gold microcarriers. The DNA-gold pellet was collected by centrifuging at 12,000 X g for 1 min at RT. The pellet was washed thrice with 100% ethanol (freshly opened bottle), resuspended in 3 ml of 0.1mg/ml polyvinylpyrollidone (PVP) in ethanol and stored at -20°C till further use. b) Loading the DNA/microcarrier suspension into gold-coat tubing using the tubing prep station A 25 inch length of tubing was cut and fixed on tubing prep station, air dried by passing nitrogen gas through it for 15 min. The DNA/microcarrier suspension was vortexed and injected into the tubing using a 5 ml syringe and the microcarriers allowed to settle in the tubing for 3 min. Ethanol from the tubing was removed by slowly sucking into the syringe. The tubing was rotated, while passing the nitrogen gas, using the tubing prep station, for 20-30 sec to allow the microcarriers to evenly coat the inside of the tubing. c) Preparation of cartridges using the tubing cutter The tubing was cut into 0.5 inch long pieces (cartridges) by using the tubing cutter and cartridges stored at 4°C in vials containing desiccant pellets till further use.
-
Suspension of DNA adsorbed onto gold microcarriers at 0.5 Microcarrier Loading Quantity (MLQ; 50 J.lg DNA/25 mg gold microcarriers) was prepared and coated inside Tefzel
-
A day prior to immunization, hair were removed from both the hind limbs of the mice using a commercial depilatory agent (Anne French cream, Geoffrey Manners & Co. Ltd, Mumbai, India). Mice were immunized in a similar way as in the saline group but in addition, ten very short electric pulses were given at the site of injection immediately after DNA administration using a gas igniter (Upadhyay, 2001). Voltage delivered in each trigger was 18kV for 10-7s.
-
Inbred male BALB/c.T mice (6-8 week, Small Experimental Animal Facility, National Institute of Immunology, New Delhi, India) were immunized intramuscularly (i.m.) with 100 J.lg of respective plasmid DNA or VR1020 vector in 100 J.ll saline (0.9% NaCl) in the anterior tibialis muscle in the hind limbs (each receiving 50 J.ll). Two booster injections of 100 J.lg DNA in saline were given on day 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 J.lg/mouse in saline). Mice were anesthetized and bled retro-orbitally on days 0, 45 and 52 for analysis of respective antibody responses.
-
IV. IN-VIVO IMMUNIZATION STUDIES These experiments were carried out with the approval of Institutional Animal Ethics Committee. Three different modes of administration were used:
-
a) Purification oLin elusion bodies For the purification of inclusion bodies, the bacterial cell pellet from 1 liter culture was resuspended in 10 ml of Tris-HCl buffer (50 mM; pH 8.5) containing 5 mM EDTA and sonicated using Branson sonifier-450 for 8 cycles of 90 sec each (30 watt output; Branson Ultrasonic Corp., Danbury, CT, USA) on ice. The inclusion bodies were collected by centrifugation of the sonicate at 8000 X g for 30 min at 4°C. The pellet was washed twice with 15 ml of 50 mM Tris-HCl buffer with 5 mM EDTA containing 2% sodium deoxycholate in order to remove loosely bound E. coli proteins from the inclusion bodies. Subsequently, the inclusion body pellet was washed with 50 mM Tris-HCI buffer (pH 8.5), followed by a washing with the double distilled water. All the buffers used for the purification contained 20 mM of phenylmethyl sulphonyl fluoride (PMSF). b) Solubilization and renaturation The purified inclusion bodies were solubilized in 100 mM Tris-HCl (pH 12.0) containing 2M urea at RT for 30 min, and centrifuged at 8000 X g for 30 min at 4°C. The pH ofthe supernatant was brought down immediately to 8.5 with 1 N HCl and then extensively dialyzed against renaturation buffer (50 mM Tris-HCl buffer; pH 8.5, 1 mM EDT A, 0.1 mM reduced glutathione, 0.01 mM oxidized glutathione and 10% sucrose). The protein was finally dialyzed against 20 mM Tris-HCl, pH 8.5 and its concentration estimated using BCA.
-
The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).
-
reached a value of 0.5-0.6. The cultures were then induced with 1 mM IPTG for 2 h at 37°C. Cells were pelleted at 4000 X g for 30 min at 4°C and stored at -70°C until used.
-
For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600
-
incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water
-
The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent
-
COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
-
To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
-
albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively
-
Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum
-
6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.
-
A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at
-
stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells
-
The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
-
Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE
-
collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.
-
Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was
-
separately on LB plates containing 100 j...tg/ml ampicillin, 80 j...tg/ml of X-gal and 20 mM of IPTG. The plates were incubated at 37°C for 12 h.
-
The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated
-
The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).
-
The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.
-
mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
-
The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
GAAGATCTCAGACCATCTGGCCAACT-3' as the forward pnmer, and 5'-GAAGATCTT-TAAGTGTGGGAAACAGACTT-3' as the reverse primer as described for bmZPl except that primer annealing was performed at 53°C for 1 min.
-
The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-
-
Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.
-
Franklin Lakes, NJ, USA. Glass micro-slides and coverslips were purchased from Blue Star, Polar Industries and Co., India.
-
immunoglobulins-FITC conjugates were obtained from Pierce, Rockford, IL, USA. Anti-. rabies monoclonal antibody conjugated to FITC was purchased from Centocor Inc, Malvern, P A, USA. Others: Sodium chloride was purchased from S. D. fine-chem. Ltd., Mumbai, India, Lipofectamine and Trizol were obtained from Gibco-BRL, Rockville, MD, USA. UM-449 cell line was a kind gift by Prof. Nirbhay Kumar (TheW. Harry Feinstone Department of Molecular Microbiology and Immunology, John Hopkins University-School of Public Health, N. Wolfe Street, Baltimore, MD 21205, USA), COS-7 cell line was kindly provided by Dr. Chetan Chitnis (Malaria Research Group, International Center for Genetic Engineering and Biotechnology, New Delhi, India), MNA cell line, CVS-11 rabies virus and Standard Rabies Immune Globulin were kindly gifted by Dr. Charles E. Rupprecht (Rabies section, Division of Viral and Rickettsial Diseases, Centres for Disease Control and Prevention, Atlanta, Georgia 30333, USA), Nickel-nitrilotriacetic acid (Ni-NTA) was procured from QIAGEN, ultrafiltration assembly and YM30 membrane from Amicon Corp., Lexington, MA, USA. Bicinchoninic acid (BCA) was purchased from Pierce. Complete and incomplete Freund's adjuvants were procured from Difco laboratories. Nitrocellulose membrane, Tefzel tubing, gold microcarriers and Helios gene gun assembly were obtained from Bio-Rad. T -25, T -75 tissue culture flasks, 6-well tissue culture plates, 8-well tissue culture chamber slide and 96-well microtitration plates were procured from Nunc a/s, Rosakilde, Denmark. The 24-well tissue culture plates were procured from Corning glass works, Corning, NY, USA. The 96-well tissue culture plates were purchased from Becton Dickinson and Co.,
-
Bacterial strains and plasmids: DH5a and BL2l(DE3)pLysS strains of E. coli were purchased from Stratagene, La Jolla, CA, USA. SG13009[pREP4] E. coli strain was obtained from QIAGEN GmbH, Hilden, Germany. Expression vector, VRI 020 was a kind gift from VICAL Incorp., San Diego, CA, USA, pKB3-JE-13 clone was procured from ATCC, Rockville, MD, USA, pQE30 vector was procured from QIAGEN and pRSET-A vector was acquired from Invitrogen Corp., Carlsbad, California, USA. Kits: PCR-Script™ Amp cloning kit was obtained from Stratagene. Plasmid DNA purification mega kit was purchased from QIAGEN. The pGEM-T Easy cloning kit was purchased from Promega, Madison, WI, USA. Primers and Enzymes: Various oligonucleotide primers were custom made by Rama Biotechnologies, India Pvt. Ltd., Secundrabad, AP, India, Sigma-Genosys Ltd, New Delhi, India and Microsynth GmbH, Hilden, Germany. Restriction enzymes were obtained from New England BioLabs (NEB), Beverly, MA, USA and Promega, Taq DNA polymerase and T4 DNA ligase were bought from Promega. Shrimp Alkaline Phosphatase was bought from Amersham. Molecular weight markers: pGEM DNA markers were procured from Promega, /..DNA-Hind III digest and 1 kb DNA ladder were purchased from NEB. Prestained SDS-PAGE standards were obtained from Bio-Rad, Hercules, CA, USA. Antibodies and Conjugates: Rabbit anti-mouse IgG (whole molecule) conjugated to horseradish peroxidase (HRPO) was procured from Dako A/S, Glostrup, Denmark. Goat anti-mouse IgG-FITC conjugate was procured from Sigma. Mouse monoclonal antibody isotyping kit was also purchased from Sigma. Goat anti-mouse immunoglobulins-HRPO, goat anti-rabbit immunoglobulins-HRPO, rabbit anti-goat IgG-HRPO and goat anti-rabbit
-
Chemicals: Tris, glycine, acrylamide, N, N'-Methylene-bisacrylamide, sodium dodecyl sulfate (SDS), P-mercaptoethanol, N, N, N', N'-Tetramethylethylenediamine (TEMED), phenol, ethidium bromide, ethylenediaminetetraacetic acid (EDTA), agarose, Bromophenol blue, Coomassie brilliant blue-R250, calcium chloride, sodium acetate, glucose, lysozyme, glycerol, chloroform, lithium chloride, phenylmethyl sulphonyl fluoride (PMSF), spermidine, saponin, paraformaldehyde were procured from Sigma Chemical Co., St. Louis, MO, USA. Low melting point (LMP) agarose, isoamyl alcohol, sodium deoxycholate, oxidized glutathione, reduced glutathione, dimethyl sulfoxide (DMSO), 4-chloro-1-naphthol, isopropyl-P-D-thiogalactopyranoside (IPTG) and 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal), were purchased from Amresco, Solon, Ohio, USA. Ammonium persulfate and guanidine hydrochloride were purchased from Amersham, Cleveland, Ohio, USA. Alum was procured from Superfos Biosector, Elsenbakken, Frederikssund, Denmark. Reagents for Enzyme Immunoassay: Bovine serum albumin (BSA) and orthophenylene diamine (OPD) were purchased from Sigma. Tween-20 (polyoxyethylene-20-sorbitan monolaurate) was obtained from Amresco. Media and Antibiotics: Bacto tryptone, bacto yeast extract and bacto agar were obtained from Difco laboratories, Detroit, USA, Dulbecco's Modified Eagle's Medium (DMEM) and RPMI-1640 media were purchased from Sigma. Antibiotics such as gentamycin sulfate, ampicillin (sodium salt) and kanamycin were also obtained from Sigma. Fetal calf serum (FCS) was procured from Biological Industries, Hibbutz Beit, Haemek, Israel.
Tags
- Method-13-Method-2-Method-3-detail
- Method-14-detail
- Method-16-detail
- Method-1-Method-2-detail
- method-1-method-8-detail
- Method-13-Method-1-detail
- Method-15-detail
- Method-13-Method-2-detail
- Method-1-Method-4-detail
- Method-1-Method-1-detail
- Method-1-Method-6-detail
- Method-1-Method-3-detail
- Method-1-Method-11-Method-5-detail
- Method-13-Method-2-Method-1-detail
- Method-13-Method-2-Method-2-detail
- Method-1-Method-10-detail
- Method-13-detail
- Method-3-detail
- Method-1-Method-11-Method-3-detail
- Method-1-Method-11-Method-4-detail
- Method-1-Method-5-detail
- Material-1-detail
- Method-1-Method-11-Method-1-detail
- method-1-method-9-detail
- Method-1-Method-11-Method-2-detail
- Method-1-Method-7-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Throughoutthepresentwork,unlessotherwisegiven,thecontrolandexperimentalvaluesarethereplicatesofatleast6independentobservations.Thedataareexpressedasx±SE.StatisticalcomparisonsweremadebyStudents‘t’test(SnedecorandCochran,1967).Whereverneeded,estimatesofdegreesofstatisticalsignificantdifferencesbetweengroupsweremadebyanalysisofvariance.Allregressioncalculationsusedstandardprogrammesforlinearleastsquareregressionandcomparisonoftheslopesoftheregressionlineswereprepared.Correlationanalysiswasusedtorecordanyinteractionbetweentheparametersunderscrutinyandbodyweightofthefish.ThegeneralequationY-awborlogy=loga+blogwasusedtoshowvariousallometricrelationshipsbetweenbodyweightandO2uptakerate.WherevernecessarythedatawasalsosubjectedtocomputeranalysisusingaCompaq1702computerdevelopedbyWIPRO,Bangalore,India.
-
ITALYusinga96wellmicrolitreplatereadbyELISAmicroplatereader(modelEL3/Sx,BioTeKInstrumentsINC).Thefinalsolutionwasreadatawavelengthof450nm.Theplasmacortisolconcentrationwascalculatedbasedonaseriesofstandards.
-
PlasmacortisolwasmeasuredbyadirectimmunoenzymaticdeterminationofcortisolkitmanufacturedbyEquiparSriviaG.Ferrari,21/N-21047,SARONNO
-
Thecapabilityofheadkidneyneutrophilstomovewasassayedbyamigration-under-agarosetechniquemodifiedfromNelsonetal.(1975).ThemethodhasbeendescribedbySaloetal.(1998).Thedistance,thecellshadmigratedfromthemarginofthewelltowardsthewellcontainingcasein(directedmigration)andintheopposite direction(randommigration)weremeasuredunderthemicroscope.
-
Theenzyme-linkedimmunospot(ELISPOT)assaywasusedfortheenumeration of totalimmunoglobulinsecretingcells(ISC)andantigen(BCG)-specificantibody-secretingcells(ASC)inthespleenandtheblood.TheELISPOTassayfollowedby Aaltonenetal.(1994)wasused.
-
TheamountoftotalIgMandspecificantibovineY-globulin(BGG)antibodyinthefishplasmawasmeasuredbyanenzyme-linkedimmunosorbentassay(ELISA)asgiven byAaltonenetal.(1994)
-
Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.
-
Thespleenswereremovedandhomogenisedindividuallythroughanylonnet(80mesh).Forisolationoflymphocytes,thetissuehomogenatewaslayeredonatwo-stepPercolldensitygradientandcentrifugedfor30minat400xg.Thelymphocyteswerecollectedatthe1.040-1.080g/cm3interface,washedtwice(400xg,10min)withrHbss,andresuspendedin2mlrRPMl.Cellswerecountedbytrypanblueexclusioninahaemocytometer(viability>95%)andthenumberoflymphocytesfrombloodandspleenwereadjustedto2x106/ml
-
Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters
-
ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)
-
Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%
-
Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg
-
Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
-
phosphoricacidformedisreducedbytheadditionof1-amino2napthol~4-sulphonicacid(ANSA)reagenttoproducethebluecolor.Theactivityofthebluecolorwasreadat680nmagainstreagentblankusingaU.V.Spectrophotometer.Suitablestandardswererunthrougheachbatchofassays.Theenzymeactivitywasexpressedintermsofpgofinorganicphosphorusformedhr'1mg'1protein.
-
Aftereffluentexposure,thecontrolandeffluentexposedfishtissueswereremovedandplacedinabeakercontainingice-coldSEIbuffer(300mMsucrose,200mMNa2EDTA,50mMimidazole,pH7.23)foranalysisofNa+-K+ATPaseactivity.ThetissueswereimmediatelyfrozeninliquidN2andstoredat-80°Cuntilanalyzed. Thespecificactivitiesofsodium,potassium,magnesiumandcalciumdependentATPaseswereassayedaccordingtothemethodsdescribedbyWatsonandBeamish(1980)and Boeseetal.(1982).AdenosinetriphosphatasecatalysestheconversionofATPandADP.Duringthisconversion,onemolecule ofphosphorusisliberated.ATPaseAdenosinetriphosphate^...^Adenosinediphosphate+PTheinorganicphosphorusliberatedwasassayedaccordingtothemethodofFiskeandSubbarow(1925).Inthismethodtheproteinisprecipitatedwithtrichloroaceticacid.Theproteinfreefiltrateistreatedwithaceticacidmolybdatesolutionandthe
-
Thereactionproduction,p-nitrophenolinacidphosphatewasmeasuredspectrophotometricallyat415nmagainstreagentblank.Theenzymeactivitywascalculatedfromthestandardcurveandexpressedasmicromolesofp-nitrophenolformedperhourpermilligramprotein.Therateofhydrolysisofp-nitrophenolphophateisproportionaltotheenzymepresentinthetissue.p-nitrophenylphosphate+NaoH—phosphat?-—>p -nitrophenol+phosphateThecolordevelopedinalkalinephosphataseactivitywasreadat410nmagainstreagentblankspectrophotometrically.Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein
-
ThealkalinephosphataseactivitywasestimatedbythemethodofMorton(1955)usingp-nitrophenylphosphatesocolorlessinsolutionbutuponhydrolysis,thephosphategroupliberatesp-nitrophenylwhichishighlycoloredinalkalinesolution
-
AcidphosphatasewasassayedfollowingtheprocedureofMorton(1955).Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein.
-
LDHisthekeyenzymeinvolvedinglycolysis,andisresponsiblefortheanaerobicconversionofpyruvicacidtolacticacid,theterminalstageintheEmbden-Meyerhofpathway.Theenzymeactivitywasdeterminedinthecontrolandeffluentexposedfishbrain,gill,muscle,liver,heart,kidneyandair-breathingorgansfollowingSrikantanandKrishnamurthi(1955).TheopticaldensitiesweremeasuredinaUVSpectrophotometerusing340 nmfilterandtheresultsare expressedaspmolesofformazanmg'1proteinhr’1
-
Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1
-
Thisisanimportantenzymeinvolvedinthecitricacidcycle.Thehomogenatesofcontrolandeffluentexposedtissueswerepreparedin0.25MicecoldsucroseusingPotterElvehjemtypeglasshomogenizerandcentrifugedat3000rpmfor15min
-
Theacetylcholineconcentrationinthetissueswasestimatedspectrophotometricallyat540nmbythemethodofHestrin(1949)usingformicacid-acetonemixture(0.15mformicacidacetone,3:17V/V)astheextractionmediumAchconcentrationwascalculatedintermsofnmolAch/mgtissue
-
Aftereffluentexposure,thetissuesweredissectedout,weighedandhomogenizedin0.25Msucrose.Thehomogenateswerecentrifugedat10,000rev/minatatemperaturebelow8°C.AcetylcholinesteraseactivityofthesampleswasdeterminedatpH7.0usingafinalhomogenateconcentrationof25mgmf1at10°CwithmMacetylcholineiodideassubstrate and0.001or0.002NsodiumhydroxideastitrantfollowingHestron’smethodasgivenbyMetcalf(1951).ProteindeterminationsforalltheChEanalyseswereconductedonaliquotsofthehomogenatesusingamodificationoftheLowryetal.(1951)method.AchEactivityisexpressedinpmolesofacetylcholinechloridehydrolysedmgtissue'1hr'1
-
0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes
-
Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof
-
Immediatelyafterisolation,thetissueswereweighedandsubjectedtolipidextractionthatwascarriedoutinduplicateaccordingtoFolchetal.(1957)
-
Salineextracts(0.89%)oftissueswerepreparedinTeflonglasshomogenizer.ThecarbohydratecontentoftheextractwasdoneaccordingtothemethodofShibkoetal.(1967)
-
TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard
-
Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,liver,muscle,gill,kidneyandair-breathingorgans werepooled incoldcondition andusedforbiochemicalestimations.
-
Thegillandmuscleswereisolatedfromcontrolandeffluentexposed(7%)fishes.Physiologicalsalinesolution(0.75%NaCl)wasusedtorinseandcleanthetissues.Theywerethenimmediatelystudiedandphotographed.
-
Aftertheperiodofexposure,thecaudalfinwasseveredtogetthebloodforsmearing.BufferedLeishman'sstainofpH6.8gaveexcellentresults.Theworkreportedhereisbasedontheanalysisofslidesoffishestreatedwith7%effluentconcentrationsastheobservedchangesaremaximuminthesefishes.
-
Bloodsampleswereobtainedbycuttingthecaudalpeduncleandanalysedforlacticacidusinganenzymatictechnique(SigmaCo,1974)MeasurementsweremadeinQuartzcuvettesat340nmwithaBeckmanAVSpectrophotometer.Standardcurvesweremadeonthedaythebloodlacticaciddeterminationsweremade.
-
BloodglucosewasestimatedbyFolin-Wumethod(KlontzandSmith,1968).Glucoseonboilingwithalkalinecoppersolution,reducescopperfromthecuprictothecuprousstate(cuprousoxide).Thecuprousoxidesoformedreducesphosphomolybdicacidtothebluecoloredmolybdenumblue,whichismeasuredcolorimeterically.TheintensityofthebluecolorisproportionaltoglucoseconcentrationanditiscolorimetricallydeterminedinaBoschandLombSpectrophotometerat620nm
-
TheO2carryingcapacity(Vol%)ofbloodwascalculatedby multiplyingtheHbcontentwith1.25O2combiningpowerofHb/g(Johansen,1970).
-
ThebloodbicarbonatewasestimatedbythemanometricmethodofVanslykeandCullen(1969).
-
Meancorpuscularhaemoglobinconcentration(MCHC)istheaverageHbconcentrationperunitvolume(100)ofpackedredcells(W/V).Henceitisexpresseding/1whichisthesameaspercent(%).ItiscalculatedbythefollowingformulaHbMCHC=—......x100(g/dl)PCV
-
MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC
-
micro-haematocrittubewasfilledto100mmwithanticoagulatedblood.Oneendofthetubewassealedwithsealingwaxandthetubewasthenkeptinaverticalpositioninaglassbeakerstuffedwithcotton.Afteronehour,lengthoftheplasmacolumnwasmeasuredwitha rulergraduatedin0.5mm.
-
ESRwasdeterminedbythemicromethodbecausethequantityofbloodavailablefromindividualfishwasinsufficienttoadoptanymacromethod.Anon-heparinised
-
BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated
-
Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes
-
HaemoglobinwasdeterminedbySahlimethod.HaemoglobinisconvertedtoacidhaematinbytheactionofHC1.Theacidhaematinsolutionisfurtherdilutedwiththeaciduntilitscolormatchesexactlythatofthepermanentstandardofthecomparatorblock.TheHbconcentrationisreaddirectlyfromthecalibrationcurve.
-
BloodwastakenbyheartpunctureusingMS222astheanaesthetic.Nofishwasusedmorethanonce.
-
TheO2consumptionofthetissueswasmeasuredbymanometrictechniquesinaWarburgconstantvolumerespirometer(Gallenkemp,England)aspertheproceduresgivenbyUmbreitetal.(1959).Thecontrolandeffluentexposedfisheswerekilledandthebrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereisolated.ThetissueswereslicedandplacedinWarburgflasks(60-80mgtissuesflask)containing2.5mloffishringersolutionwithphosphatebufferatpH7.5asthesuspensionmediumforthetissuesand0.2ml15%KOH.Temperaturewas28°CduringO2uptakedetermination.Inordertocomparedatafromthedifferentseriesoftreatment,arespiratoryindexwascalculatedusingthefollowingformula:KO2treated-KO2controlr=100-------------------------------------x100KO2controlWhere,K=O2consumptioninpi/100mgwettissue/hrThisindexindicatespercentrespirationoftreatedtissuesrelatedtothecontrolvalues ofthesameseries.
-
ThecircadianrhythmofbimodalO2uptakeofcontrolandeffluenttreatedfisheswerestudiedseparatelyat28°±1°C.TheamountsofO2extractedfromwaterandairwereseparatelydeterminedforadayatregularintervalsof3hreach.TotalO2uptakeateachtimewasobtainedbysummingupthevaluesforaquaticandaerialrespirationobtainedatthecorrespondingtime.Throughoutthepresentstudy,theinitialO2contentofthewaterwaskeptconstant(6±0.5mgF1)
-
Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm
-
Theexperimentalsetup(Figure8and9)forthedeterminationofO2uptakesimultaneouslyfromairandwaterwassimilartothatusedearlierbyNatarajan(1972),Rani(1994)andVijayalakshmi(1996).Aclosedglassrespirometerof5litrecapacitywasfilledwith3.5litrefreshtapwater.Athermocolfloatwithasemicircularholeatitsperipherywasplacedoverthewater,whichseparatedtheair-waterinterphaseoftherespirometer.Theair-phaseoftherespirometerwasattachedtoafluidmanometer.Asthefishcomestothewatersurfaceandtakesair-gulp,thereisapressurechangeintheair-phasecausinganimbalanceinthemanometricfluid.AgraduatedsyringefilledwithpureO2(takenfrommedicalO2cylinder)isusedtorestoretheimbalanceofthemanometricfluid.TheamountthusneededshowstheaerialO2uptakeofthefish.TheexpiredCO2wasabsorbedbythepelletsofKOHinthepetridishoverthemanometricfluid.Theconcentrationofdissolvedoxygenoftheambientwaterwasestimatedbefore andaftertheexperimenttomeasuretheaquaticO2uptakebythefish.ThedifferenceintheDOandtheamountofwaterindicatestheactualaquaticO2uptake.Winkler’svolumetricmethod(Welch,1948)wasusedtoestimatetoDOofthewatersamples.Darkenedrespiratorychamberswereusedwithdimensionsthatwereclosetothoseofthefishinorderthatthefishshouldremaininmoreorlessthesamepositionbut havesufficientroomtomoveitsopercula.Theflowofwaterthroughtherespirometer wasregulatedandmeasuredbymeansofaflowmeter.APhilipsO2electrode(PI1056)waskeptinawaterjacketmaintainedatthesametemperatureastheclosedcirculation.SamplesoftheinflowandoverflowwatercouldalsobeledovertheO2electrode
-
Theexperimentalfishwasacclimatedtoglassrespirometersforabout24hrandtheywerenotgivenanyfoodduringthisperiod.TheeffluentexposedfishesalongwiththecontrolsweresubjectedtoO2consumptionseparately.Theexperimentswereperformedinaninsulatedroombetween8to10AMwithlightson.TherateoftotalO2uptakethroughgillsfromflowingwaters(DO=7.2mg021'1)wasmeasuredinfishesofdifferent body weights.Forthis,acylindricalglassrespirometerof2litrecapacitywasused.Thefishwasintroducedintherespirometerwhichwasconnectedtoalargeconstantlevelwatertanktomaintaintheflowofwaterunderconstanthydrostaticpressure.Thewaterenteredtherespirometeratonesideanditsflowperminutewasmeasuredasitlefttheotherside.Theflowwasadjustedaccordingtothesizeofthefish.Thefishwasacclimatizedtotherespirometeratleast12hrbeforereadingswere taken.ConcentrationofdissolvedoxygeninthesampleswasmeasuredbyWinkler’svolumetricmethod(Welch,1948).ThedifferenceinO?levelsbetweentheambientwaterandthatsuppliedtotherespirometeraswellaswiththerateofwaterflowandtheweightofthefishwasusedtocalculatetherateof O2uptakeintermsoftime(ml02hr'1)withthehelpoftheequation:V02=Vw(Ci02CE02)Where,VO2=02uptake(ml02hr'1)Vw=water(mlm'1)andCi02-CE02respectivelythe02concentrationofinletandoutletwaters.Arespirometercontainingnoanimalsservedasacontrolforadjustingcalculationsfor02uptakeinthewater.Uponremoval,fisheswereblottedwithpapertoweling, andweighed
-
Theeffectof2%,5%and7%effluentexposureontheoxygenuptakewasmeasuredatexperimentalconditions,viz.,(a)whenaccesstoairwasprevented(aquaticconsumption),(b)whenitwasallowed(bimodalrespiration)and(c)underaerialconditions(aerialrespiration)
-
SamplesofC.punctataweretakenfromtheacclimationtanksandslightlyblottedonpapertowelstoremoveexcesswater.TheywereplacedindividuallyonaWhatmanfilterpaperinaonelitreglassbeaker.Theindividualswereimmediatelytransferredtobigglassdesiccatorscontaining250mlofthefollowingsolutionsfordesiredhumiditylevelsusinggradedsolutionsofKOHasdescribedbySolomon(1951).Watergiving95to97%relativehumidity(RH),mean95%;sodiumchloridegiving72to76%relativehumidity,mean75%;calciumchloridegiving28to31%relativehumidity,mean35%.Thedesiccatorswereplacedinanincubatorataconstanttemperatureof28°±1°Cwithdeterminationsofsurvivalandbodyweightatregularintervals.Thecontainerswereweighedatintervalstothenearest0.1mgandweightlosswasassumedtoequalwater loss
-
Thefishessurvivedwithoutanymortalityintheeffluentconcentration ofnominalvalues2%,5%and7%.The30,60,90and120dayschronicexposurewith20fishaddedrandomlytoeachof60by40by240cmplastictankswasbegunwithfishfromthesameoriginastheseandintheinitialacutebioassays.Flowratesmaintainedtothetanksallowedfor twovolumesturnovers24hr.
-
Thefisheswereexposedtodifferentconcentrationsofeffluentandthenumberoffishineachconcentrationwasrecorded.Thedataweresubjectedtoprobitanalysis(Finney,1964)andDragstedtandBehven’sequation(Carpenter,1975)todetermineLC50values.Apresumableharmlessconcentration(C)oftheeffluentwasalsocalculatedbyusingthesafefactororapplicationfactor(Sprague,1971)employingtheformulaC=Where,48hrLC50xAS24 hrLC50S= -------------------48hr LC50A=0.3(constant)Thesafeconcentrationisausefulunitofmeasurementofacceptableamountoftheeffluent,whichhasnolethalityandstresstotheanimalexposed.Approximately1/3ofLCsoofvalueofeffluentwasselectedassublethalconcentrationinthepresentstudy.Fishesweredividedinto4groupsandkeptin401glassaquariacontaining wellwaterofpH7.2.GroupI,IIandIDwerekeptin2%,5%and7%ofeffluents(Figure7)respectivelyandexposedto24,48and72(short-term)periods.Allacutelethalitytestswereconductedaccordingtothe methodsofthe AmericanPublicHealthAssociation(1985).GroupIVservedascontrol.
-
experiments.Chemicalcharacterizationoftheeffluent(Table1)wascarriedoutbyusingstandardmethods(APHA,1985)
-
ThecementfactoryeffluentobtainedfromtheACCcementfactory,Madukkarai(Figure6)in101blackpolyethylenecontainerswerekeptinarefrigeratoruntilusedfor
-
Thetapwaterusedforacclimationandexperimentationhadthefollowingaveragecharacteristics:temperature(28°-30°C),pH(7.2-7.4),dissolvedoxygen(7.8-8.0ppm),CO2(2.08mll'1),salinity(0.190gF1)hardness(154ppmasCaCCF?),alkalinity(68ppmasCaC03)andconductivity(0.56mMhos).
-
Thefisheswerefedadlibitumwithboiledhen’seggsontwodaysinaweekandearthwormsontheremainingdays.Feedingwasstopped24hrpriortoexperimentation.Noprophylactictreatmentforanydiseaseproblemwasnecessaryatanytimeduring acclimationandtest
-
Theywereheld(28°±0.5°C;naturalphotoperiod)in240litretapwatertanks(1x1x0.3m)andacclimatedtothelaboratoryconditionsforaweekbeforeexperimentation.Agentlecontinuouswaterflowwasmaintainedthroughtheaquariaforconstantwaterrenewal.
-
Channapunctata(Family:Channidae)(15-20g;10-15cm)usedinthisinvestigationwerewildcaughtandbroughttothelaboratoryinplasticbuckets.
Tags
- Method-14-detail
- Method-18-Method-1-Method-1-detail
- Method-16-detail
- Material-20-detail
- Method-8-Method-4-detail
- Method-19-Method-8-detail
- Method-2-detail
- Method-17-Method-1-detail
- Method-10-Method-6-Method-3-detail
- Method-17-Method-7-detail
- Method-17-Method-3-detail
- Method-16-Method-3-detail
- Method-10-Method-2-detail
- Method-10-Method-4-detail
- Method-19-Method-5-detail
- Method-9-detail
- Method-19-Method-2-detail
- Method-10-Method-3-detail
- Method-10-Method-6-Method-1-detail
- Method-17-Method-5-detail
- Method-8-Method-1-detail
- Method-17-Method-6-detail
- Method-6-detail
- Method-16-Method-2-detail
- Method-10-Method-1-detail
- Method-8-Method-2-detail
- Method-19-Method-1-detail
- Method-18-Method-1-Method-2-detail
- Method-19-Method-4-detail
- Method-17-Method-4-detail
- Method-1-detail
- Method-15-detail
- Method-12-detail
- Method-17-Method-2-detail
- Method-5-detail
- Method-13-detail
- Method-3-detail
- Method-7-detail
- Method-8-Method-3-detail
- Method-19-Method-7-detail
- Method-18-Method-1-detail
- Method-16-Method-1-detail
- Method-11-detail
- Method-4-detail
- Method-10-Method-5-detail
- Method-17-Method-8-detail
- Method-19-Method-3-detail
- Method-8-Method-5-detail
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-
until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
-
Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Percentage lethality was calculated as:100×((number of non-CyO/ number CyO)×100)
-
Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}
-
Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
otal RNA was isolated from cell lines after 48 hrs of transfection using trizol (Invitrogen, U.S.A.). 32p labeled antisense HBx mRNA was in vitro transcribed using T7 RNA Polymerase and Riboprobe kit (Promega, U.S.A.), as described earlier. For generating antisense HBx probe, plasmid DNA was linearized with Bam HI and subjected to transcription. Total RNA was quantitated and equal concentration (15-20 pg) was loaded after adding loading dye (50%glycerol, 1 mM EDTA, 0.25% bromophenol blue, 0.25% xylene cyanol FF) on 1% formaldehyde-agarose gel and 1X MOPS was used as the running buffer. The gel was then run at 5 V /em length of the gel. The gel was then treated with 2.5% HCl for 15 min for depurination, 0.4N NaOH for another 15 min and then in 3 M sodium acetate for 15 min, before the transfer was set. Also the nylon membrane prior to transfer was first treated with distilled water for 5 min and then in 0.4 N NaOH for 20 min. The overnight transfer was set up using 20X sse buffer as the transfer buffer at room temperature. Thereafter, the membrane was cross-linked by uv and then dipped in 2X sse for 20 min. For pre-hybridization the membrane was soaked in Rapid hybridization buffer (Amersham Biosciences, U.K.) for 2 hr at 65oC in the hybridizing oven. The probe was then added and further incubation for 4 hrs was carried out. Post hybridization the membrane was washed thrice with 6X sse at 37oC on a shaker. The membrane was then dried on a filter paper and wrapped in a saran wrap. The membrane was then analyzed by autoradiography. For ensuring the equal loading, the formaldehyde-agarose gel was also stained with EtBr for 23s and 18s rRNA
-
ubjected to three washes with PBST and two washes with PBS. The blot was developed using the substrate DAB (Sigma, U.S.A.) or with ECL (Amersham Biosciences, U.K.)
-
he protein samples were diluted with 4X sample buffer which is essentially SDS-reducing buffer (O.SM Tris-Cl, pH 6.8, Glycerol, 10% (w /v) SDS, 2-J3-mercaptoethanol, 0.05% (w /v) bromophenol blue). The samples were denatured at 1000C for 10 min and the proteins were resolved on 12-15% SDS-polyacrylamide gel at 25-30mA. For detection, the proteins were transferred on to nitrocellulose (NC) membrane (Hybond-C extra, Amersham, U.K.) at 200mA, for either 1 hr or at 12 rnA, 40C for overnight. After the transfer was over, the NC membrane was washed thrice with PBST (1X PBS with 0.1% Tween 20) and blocked with 2% BSA for 2hrs (in PBST) at room temperature. Primary antibody to HBx/Vif/ APOBEC3G-NT raised in rabbit and were diluted to 1:1,000 in PBST. One hour incubation with the primary antibody was followed by three washes with PBST (10 min each) and then 1 hr incubation with 1:1,000 dilution of the secondary antibody (Anti-rabbit IgG (Fe) HRP conjugate) was carried out. The blot was further
-
After transfection the cells were harvested and protein was isolated from the celllysates. The cells from each well were pelleted at 2000 rpm for 10 min at 40C. The supernatant was carefully removed and the pellet was incubated on ice for 1 hr after adding 50pl of lysis buffer (1% triton X100, 0.1mM EDTA, 0.1mM EGTA, 1mM DTT, 1X PI, all in 1X PBS) with intermittent vortexing. The tubes were centrifuged at maximum rpm for 10 min at 40C and the supernatant, containing the proteins, was collected and stored at -700C. The purified protein fractions were quantitated using the BCA protein assay kit and the O.D. was taken at 562nm
-
annealing at 25°C for 5 minutes, the reaction was incubated at 42°C for one hour.
-
series of primers were designed to detect the levels of intact gene of interest or Rz in the cell lysate. The levels of RNA were quantitated by carrying out reverse transcriptase based-PCR using the Im.Prom-11™ Reverse Transcriptase system (Promega, U.S.A.). 1}lg of template RNA and 1}lM terminal primers were combined in 5pl reaction volume and the primer I template mix was thermally denatured at 70°C for 5 minutes and chilled on ice. A reverse transcription reaction mix of volume 15 pl was assembled on ice to contain nuclease-free water, 1X reaction buffer, 1pl reverse transcriptase, 6 mM magnesium chloride, 0.5 mM dNTPs and 1 U ribonuclease inhibitor RNasin. As a final step, the template-primer combination was added to the reaction mix on ice. Following an initia
-
After transfection the cells were harvested and RNA was isolated from the celllysates using Trizol reagent (Invitrogen) and purified according to the manufacturer's directions. Briefly, the cells were lysed directly in the culture dish by adding 1ml of Trizol reagent to each well. The homogenized sample was incubated at room temperature for 5 min to permit complete dissociation of the nucleoprotein complexes. For purifying the RNA, 200pl of chloroform was added, the tubes were shaken vigorously for 15 seconds and incubated at room temperature for 2-3 min. Tubes were centrifuged at 12,000 ref for 15 min at 40C. The aqueous phase was collected, mixed with 500pl isopropanol and incubated at room temperature for 10 min. Centrifugation was carried out at 12,000 ref for 10 min at 40C. The supernatant was carefully removed and the RNA pellet was washed with 1ml of 70% ethanol by vortexing and then centrifuging at 7500 ref for 5 min. The pellet was air dried and dissolved in 20pl of NFW.
-
The cells were assayed for Luciferase gene expression using Luciferase Assay kit (Promega, U.S.A.). After transfection, the cells were washed twice with PBS and then lysed by adding reporter lysis buffer provided in the kit. The cell lysate was collected from individual wells in eppendorf tubes, the cells were twice freeze-thawed in liquid N2 and then centrifuged at 13,000 rpm for 10 min at 40C. The supernatant was transferred to a fresh tube. 20¢ of cell extract was mixed with lOOp! of luciferase assay reagent that was kept at room temparature. The activity was determined using a luminometer (Packard lumicount, U.S.A.
-
incubator until the cells were 60% confluent. For each transfection, 1-2pg of DNA was diluted in 100 pi serum free media. Also, lOpl of lipofectin reagent · was diluted in 100 pi of serum free media and allowed to stand at room temperature for 30-45 minutes. The two solutions were combined, mixed gently and incubated at room temperature for 15 minutes. The cells were washed once with 2ml of serum free medium. For each transfection, 0.8 ml of serum free medium was added to each tube containing lipofectin-DNA complexes. The complex was mixed gently and overlaid onto cells. The plate was incubated for 4-6 hrs in a CDl incubator. The medium in each well was replaced with serum containing medium and the cells were further incubated for varying periods of time at 370C. The concentration of lipofectamine 2000 was used in the ratio 1:2 or 1:3 with DNA. The Rzs and Dzs were either co-transfected with the plasmid DNA of interest or when required to be transfected alone then pBSK+/-was used as carrier plasmid for better transfection efficiency. In order to ensure uniform transfection efficiency a reporter plasmid DNA (pSV -~ gal, Promega) was used
-
Transfection of cell lines used was carried out u5ing lipofectin reagent (Invitrogen, U.S.A.). In a six well plate 10 s cells/ well were seeded in 2m1 medium supplemented with serum. The cells were incubated in a CD2
-
All the cell lines were grown and maintained in Dulbecco' s modified Eagle's medium (DMEM) with 10% Fetal bovine serum (FBS) and 1% antibiotic-antimycotic (penicillin, streptromycin and amphotericin B). The cells were maintained at 37<>C with 5% C02 in a humidified CD2 incubator (Nuaire-IR Autoflow CD2 Water-Jacketed incubator)
-
dried. These were counted directly to determine the total counts. In duplicate tubes, 1pl of the diluted probe was added to 100pg of carrier nucleic acid (tRNA or Herring Sperm DNA) in a total volume of 100pl. To this 500pl of ice-cold 5% TCA was added, mixed thoroughly and incubated on ice for 15-20 min. Glass fiber filters were wet (in duplicate) properly with 5% TCA and then these samples were applied on to them under vacuum. The filters were washed twice with 5ml of chilled 5% TCA and then air dried after rinsing with 2m1 of acetone. All the dry filters were inserted into scintillation vials containing scintillation fluid and the counts were taken in a liquid scintillation a-counter (LKB Wallac, 1219 Rackbeta, Sweden). The percentage incorporation, specific activity and the total amount of RNA made was then calculated according to the standard procedures. % incorporation =Incorporated cpm X100 Totalcpm Total RNA made (ng) = % incorporation X 338 Specific activity of probe = Total cpm incorporated p.g of RNA synthesized
-
To determine the percentage of incorporation and probe specific activity, 1:10 dilution of the labeled probe was made in NFW. lpl of this was spotted on to duplicate glass fiber filters (Whatman GF/ A, U.S.A.) and ai
-
polymerase and [a-32p] UTP (specific activity 3000Ci/mmole). The Riboprobe in vitro Transcription Systems (Promega) was used to make the in vitro transcripts. According to the manufacturer's directions, 0.2-lpg of the linearized DNA template was combined with the following components, in a final volume of 20pl, at room temperature in the following order: 4pl of SX transcription buffer (200mM Tris-HCl, pH 7.5, 30mM MgCh, lOmM Spermidine, 50mM NaCl), 2pl of lOOmM DTT, 20U of RNasin Ribonuclease inhibitor, 2.5mM each of ATP, GTP and CTP (pH 7.0), 2.4pl of lOOpM UTP (pH 7.0), Spl (50pCi at lOpCi/pl) of [a-32P]UTP and 15-20U of T7 or SP6 RNA Polymerase. For carrying out cold in vitro transcription all the four nucleotides (ATP, GTP, CTP, and UTP) were added at 2.5mM concentration and the reaction volume was made up with nuclease free water. The mixture was incubated at 370C for 60 min. The reaction was stopped using the stop buffer (50mM Tris-Cl, pH 7.5, SmM EDTA, 25pg tRNA/ml) and chilled on ice. RQl RNase-free DNase was added at a concentration of lU/pg of template DNA and incubated at 370C for 15 min to remove the DNA template following transcription. The transcripts were then purified by phenol : chloroform : isoamyl alcohol and chloroform : isoamyl alcohol extractions, followed by precipitation with 2.5 volumes of absolute alcohol and 0.5 volumes of 7.5M ammonium acetate and then 0.5 volumes of 1M ammonium acetate to remove the unincorporated nucleotides. After centrifugation for 30 min at 13,000 rpm the supernatant was carefully removed. The pellet was washed with 70% ethanol, vacuum dried and dissolved in 20pl of NFW
-
Plasmids containing the ribozymes or substrates were linearized at their 3' end with the appropriate enzymes. The linearized DNA was purified using the Qiagen Gel Extraction kit as described before (section 7.9). In vitro transcription reaction was then carried out using both T7 or SP6 RNA
-
with 4 ml of equilibration buffer QBT (750mM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100) and the column was allowed to empty by gravity flow. The supernatant was applied to the QIAGEN-tip and allowed to enter the resin by gravity flow. The QIAGEN-tip was washed thrice with 10ml of wash buffer QC (l.OM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol). The DNA was then eluted with 5 ml of elution buffer QF (1.25M NaCl, 50mM Tris-Cl, pH 8.5, 15% isopropanol). The DNA was precipitated by adding 0.7 volumes of isopropanol to the eluted DNA. It was thoroughly mixed and centrifuged immediately at 13,000 rpm for 30 min at 40C. The supernatant was carefully decanted. The DNA pellet was washed with 2 ml of 70% ethanol, and centrifuged at 13,000 rpm for 15 min at 40C. The supernatant was carefully decanted without disturbing the pellet. The pellet was air dried for 5-10 min and the DNA was dissolved in 200 p.l of RNase-DNase free water. To determine the yield, DNA concentration was determined both by Ultra Violet (UV) Spectrophotometry (DU-65 spectrophotometer, Beckman, U.S.A.) and quantitative analysis on an agarose gel using a UV Transilluminator (UVP, California, U.S.A.). All the putative clones were then screened for the correct recombinant clones by restriction enzyme digestion using appropriate enzymes. The digested samples were checked on an agarose gel along with an appropriate size marker to assess the size of the insert from the putative clones. The clones containing very small fragments were further confirmed by sequencing both strands of the DNA
-
For large scale plasmid DNA isolation, the bacterial cells were cultured in 100ml of LB medium with 100pg/ml of ampicillin. The cultures were grown for 8-10 hours at 37<>C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAGEN Plasmid Midi kit (100). Briefly, the bacterial cells were harvested by centrifuging at 6000 rpm for 10 min at 4<>C. The bacterial pellet was resuspended in 4 ml of the resuspension buffer P1 (50mM Tris-Cl, pH 8.0, 10mM EDTA, 100l!g/ml RNase A). 4 ml of lysis buffer P2 (200mM NaOH, 1% SDS) was added, mixed gently by inverting 4-6 times and incubated at room temperature for not more than 5 min. Further 4 ml of chilled neutralization buffer P3 (3.0 M potassium acetate, pHS.S) was added, mixed gently as before and incubated on ice for 10 min. It was then centrifuged at maximum rpm for 30 min at 4<>C. The supernatant containing the plasmid DNA was immediately removed andre-centrifuged at 10,000 rpm for 15 min at 4<>C. The supernatant was now collected in fresh tubes and kept on ice. A QIAGEN-tip 100 was equilibrated
-
added and mixed by gently inverting the tube 4-6 times. The microfuge tubes were then centrifuged at 13,000 rpm for 10 min. QIAprep spin columns were placed in 2-ml collection tubes and the supernatant was applied to these columns. These were then centrifuged for 1 min and the flow-through was discarded. The Qiaprep columns were then washed by adding 0.75ml of buffer PE and centrifuged for 1 min. The flow-through was discarded and an additional centrifugation was given for another minute to remove traces of the wash buffer. The QIAprep columns were placed in a fresh 1.5ml microfuge tube. Finally, to elute out the DNA, 50pl of buffer EB (10mM Tris-Cl, pH 8.5) or RNase-DNase free water was applied to the center of each column and then centrifuged for 1 min after letting it stand for 1 min. The flow-through contained the DNA of interest.
-
Each single colony (white colonies, in case of blue-white screening), was inoculated individually in Sml Luria-Bertani (LB) medium with 100p.g/ml of ampicillin. The cultures were grown for 8-10 hours at 370C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN, U.K.). According to the manufacturer's directions, the pelleted bacterial cells were resuspended in 250pl of buffer P1 and transferred to a microfuge tube. 250pl of buffer P2 was then added and mixed gently by inverting the tube 4-6 times. Further, 350pl of buffer N3 was
-
The PCR products were ligated with T-tailed vectors (pGEM-T Easy, pTARGE-TfM from Promega or pcDNA3.1 from Invitrogen). In general, the ligation was carried out at a vector: insert molar ratio of 1:3 or 1:4 in a 10pl reaction volume finally containing 1X T4 DNA ligase buffer (300mM Tris-HCl, pH 7.8, 100mM MgCh, 100mM DTT, lOmM dATP) and lU of T4 DNA ligase (Promega, U.S.A.). The reaction mix was incubated at 160C for 16 hrs (overnight). Following the reaction, the ligated DNA was transformed into Calcium Chloride treated E.coli-DH5a or XL-Blue1 competent cells with a high transformation efficiency. The transformed cells were plated on to Luria-Bertani-Agar plates containing 100p.g/ml of ampicillin. Additionally, for blue-white screening of the colonies, 20pl of SOmg/ml of X-Gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside) and 10pl of 0.1M IPTG (lsopropyl-J3-thiogalactopyranoside) (Promega, U.S.A.) was used. The plated cells were incubated at 370C for 8-10 hours
-
eppendorf tube had DNA of interest. The purified DNA fragments were checked on an agarose gel, with an appropriate marker, before setting up the ligation reaction
-
The plasmid DNAs for cloning, were digested with the respective enzymes, checked on an appropriate percentage of agarose gel along with 100 bp ladder or .A Hind ill marker (Promega, USA) and the required fragments were eluted from the gel using the Qiagel Gel Extraction kit (Qiagen, U.K.). According to the manufacturer's directions, the area of the gel containing the DNA fragment was excised using a clean and sharp blade, minimizing the amount of surrounding agarose excised with the fragment. The gel slice was weighed and placed in a microfuge tube. Three volumes of Gel Solubilization Buffer (QG) was added for every one volume of gel. The gel piece was then vortexed and incubated at 500C for 10 min. The contents were mixed in between, by inverting the tube few times, to ensure gel dissolution. It was then centrifuged at 13,000 rpm for 1min. The flow through in the discard column was carefully removed. Then 500 p.l of buffer PB was added to remove the traces of gel and the tube was centrifuged at 13,000 rpm for 1 min. The flow through in the discard column was removed and 750 p.l of Wash Buffer (PE) (containing ethanol) was added and the tube was centrifuged at 13,000 rpm for 1 min. The flow through was discarded and another spin at maximum for 2 min was given to remove the traces of wash buffer. The column was then put on a fresh tube and finally, to elute the DNA, 40 p.l of Tris-EDTA buffer (TE) or RNase-DNase-free water was added and then centrifuged at 13,000 rpm for 1 min. The flow through in the
-
CR conditions for amplification of vif gene of HIV -1 1. Denaturation-940C-5min 2. Denaturation-940C-30sec 3. Annealing-630C-30sec 4. Extension-720C-45sec 5. Final extension-720C-5min
-
The polymerase chain reaction (PCR) was carried out using the PCR Core System I (Promega, U.S.A.). 200ng of template DNA/oligonucleotide and 1 pM terminal primers were combined in 2Spl reaction volume finally containing 1X Mg free reaction buffer (500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% Triton X-100), dNTP mix with 0.2mM of each, 1.5mM MgCh and 0.62SU of Taq DNA Polymerase. 30 thermal reaction cycles from steps 2-4 were repeatedly carried out, in GeneAmp PCR 2400 machine (Perkin Elmer, USA). PCR amplification was analyzed by 1-2% agarose gel electrophoresis using a 100 bp ladder or A Hind ill marker (Promega, USA). PCR conditions for amplification of HBx gene of HBV 1. Denaturation-94oC-5min 2. Denaturation-94oC-1min 3. Annealing-42oC-2min 4. Extension-72oC-2min 5. Final extension-72oC-5min PCR conditions for amplification of hammerhead-Rz 1. Denaturation-94oC-5min 2. Denaturation-94oC-30sec 3. Annealing-42oC-1min 4. Extension-72oC-15sec 5. Final extension-72oC-2min
-
Oligonucleotides used in this study were chemically synthesized by Sigma-Genosys (The Woodlands, TX, U.S.A.).
-
DNA restriction enzymes were purchased from New England Biolabs (Massachusetts, USA) and Promega Corporation, (Madison, U.S.A.). RNase A was obtained from Qiagen (West Sussex, U.K.). DNA ligase, RNA polymerase, RNAsin, Taq DNA polymerase, T7 RNA polymerase, SP6 RNA Polymerase and alkaline phosphatase were obtained from Promega Biotech.
-
32P-a-rUTP (3000Ci/mmol) was obtained from Perkin Elmer (California, USA).
-
The cell lines, HEK 293 (human embryonic kidney cells) and HepG2 (human hepatocellular carcinoma) cells were obtained from ATCC. APOBEC3G-HA-293 cell line was obtained from the National Institutes of Health (Bethesda, Maryland, USA) AIDS Repository and grown according to standard procedures. Ecoli strains DHSa or XL-Blue were used for DNA cloning
-
was used to amplify the oligonucleotides (Promega Biotech, Madison, USA). pGEMT-Easy and p-TARGET cloning vectors were also obtained from Promega. In vitro transcription was carried out using Riboprobe transcription system (Promega Biotech, Madison, U.S.A.). BCA protein assay kit was obtained from Pierce Biotechnology (Rockford, IL, U.S.A.). Reverse transcription was carried out using lmProm-TI™ Reverse Transcriptase kit from Promega. Luciferase activity in the cell extracts was measured using Luciferase assay System (Promega Biotech., U.S.A.).
-
Qiaprep spin mini kit and Qiagen plasmid midi kit (West Sussex, U.K.) were used for isolation of DNA. Isolation of DNA fragments from gel was carried out using QiaGel extraction kits or PCR products were purified using nucleotide removal kit from Qiagen (West Sussex, U.K.). PCR core system I
-
Agarose, ampicillin, ammonium acetate, Tris Base, EDTA, SDS, sodium-acetate, potassium-acetate, boric acid, disodium-hydrogen-phosphate, sodium-dihydrogen-phosphate, sodium chloride ethidium bromide, urea, ammonium persulphate, MOPS, glycerol, sodium bicarbonate, Triton X-100, dithiothreitol, magnesium chloride, BSA, IPTG, Orange G, DEPC, Tween-20, acrylamide, calcium chloride, trypsin, EDTA, sodium citrate, bromophenol blue, xylene cyanol FF, were obtained from Sigma-Aldrich Co. (Missouri, U.S.A.). X-gal, NTP and dNTP, sodium chloride, bis-acrylamide, TEMED, PCR buffer and Magnesium chloride for PCR, DNA markers, were from Promega Biotech Co. (Madison, U.S.A.). All other chemicals were at least of analytical grade and were from Qualigens laboratories (Bombay, India) or Merck (New Jersey, U.S.A.) Trizol reagents, DMEM, lipofectin, lipofectamine 2000, antimycotic-antibiotic, gentamicin, RNase-DNase free water were obtained from Invitrogen-GffiCO/BRL (Maryland, U.S.A.). Fetal bovine serum was obtained from Biological Industries (Beit Haemek, Israel). Luria Bertini medium and Luria Miller agar for bacterial culture were obtained from Difco Laboratories (Detroit, U.S.A.). Pre-stained rainbow protein markers, nylon and nitro-cellulose membranes, ECL reagent, all were obtained from Amersham Biosciences (Buckinghamshire, U.K.).
Tags
- method-12-detail
- method-9-detail
- material-2-detail
- method-1-detail
- method-14-detail
- method-6-detail
- method-2-detail
- method-15-detail
- material-1-detail
- material-6-detail
- method-11-detail
- material-3-detail
- method-7-detail
- method-3-detail
- method-10-detail
- material-4-detail
- method-5-detail
- method-4-detail
- material-5-detail
- method-13-detail
- method-8-detail
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Visible Spectrophotometer was from Shimadzu (Tokyo, Japan). 11Quant Microplate Reader was procured from Biotek Instruments Inc. (Winooski, VT). Gene Pulsar X Cell electroporator was purchased from Bio-Rad Laboratories (Hercules, CA) while the cuvettes for electroporating cells were obtained from BTX Harvard Apparatus Inc. (Holliston, MA). BD Calibur flow cytometer was purchased from BD Biosciences (San Jose, CA). Hu 13 Midi DNA gel electrophoresis apparatus was procured from Scie Plas (Cambridge, UK). Protean II and III polycacrylamide gel system and Mini Transblot cells were procured from Bio-Rad Laboratories (Hercules, CA). Electrophoresis Power supply EPS 500/400 was purchased from Pharmacia Biotech-AB (Uppsala, Sweden). Peltier Thermal Cycler -200 was purchased from MJ research (Waltham, MA). UVP Gel Doc-It System was purchased from UVP Bio Imaging Systems Inc. (Upland, CA). JEOL JEM-2100F field emission transmission electron microscope at the Advanced Instrumentation facility, Jawaharlal Nehru University was used to capture images. GC-MS was performed with an Agilent 7890A gas chromatography instrument coupled to an Agilent 5975C mass spectrometer and an Agilent ChemStation software (version G1701EA, Agilent Technologies, Palo Alto, CA) A HP-5MS capillary column (30m x 0.25mm i.d) coated with 0.25 11m film 5% phenyl methyl siloxane was used for separation
-
Forma II Series water jacketed C02 incubator for cell culture was purchased from Thermo Fischer Scientific Inc. (Waltham, MA), BOD incubator for Leishmania cultures was obtained from Jeiotech (Korea) while 37°C incubator for bacterial cultures was purchased from Thermotech Instruments (P) Ltd (Raipur, India). Gyratory incubation shaker (Ecotron) was purchased from Infors-HT (Bottmingen, Switzerland). Optiphot fluorescence microscope, Nikon E600W upright fluorescence microscope and Nikon confocal microscope C1 were from Nikon (Tokyo, Japan). FluoStar Optima and FluoStar Omega fluorescence readers were purchased from BMG Lab technologies Inc. (Offenburg, Germany). UV-160A UV
-
Results are expressed as mean ±SE. An unpaired two tailed student's t-test using Sigma Plot Version 10 & 11 was used for statistical analys
-
epoxy resins used for infiltration and embedding are not miscible with water. This was carried out by sequentially incubating the agar blocks in 25% methanol for 5 min, 50% methanol for 7 min, 70% methanol for 10 min, 95% methanol for 20 min and finally 100% methanol for 30 min followed by two more changes of methanol for 30 min each. The blocks were then incubated with transitional solvent propylene oxide for 30 min with one change at 15 min. Epoxy resin used for infiltration penetrates the cell and fills the spaces in between providing a hard medium that can withstand the cutting and electron beams. The blocks were first incubated for 30 min with a mixture of propylene oxide and resin in a ratio of 2:1. This was followed by incubation for 60 min with propylene oxide and resin in a 1:1 ratio. Finally, the blocks were put in pure resin and kept overnight at RT under shaking conditions. The following day, the agar blocks were placed in a bean capsule and overlayed with pure resin and incubated at 55°C to allow it to harden. Sectioning and Viewing: This was carried out at the Advanced Instrumentation Research Facility at Jawaharlal Nehru University
-
Sample Processing: Leishmania donovani cultures to be viewed under transmission electron microscope were pelleted at 1258 x g for 5min at RT. The pellet obtained were washed with PBS (0.22p. Filtered) and then resuspended in EM Fixative ( 4% Paraformaldehyde, 25% Glutaraldehyde, 0.1M Sodium Cacodylate) which had also been passed through a 0.22 p.m filter to remove any particulate matter that may interfere later with imaging. The cells were incubated in the fixative for 4-5 hours at RT followed by overnight incubation at 4°C. Subsequently the pellets were washed with sodium cacodylate buffer (0.1M sodium cacodylate, pH 7.3). The pellet was then embedded in 3%agar to prevent loss during subsequent washings. For this, agar was added to the pellet while vortexing so that the cells and agar mix well, then the agar was allowed to set. The MCT with the agar block was then cut to extract the block which itself was cut into smaller pieces to allow the solutions that will be added later to percolate well into the agar block. Post fixation was carried out to increase contrast and stability of fine structure, by incubating with 1% osmium tetraoxide for 2hr at RT. The blocks were then washed thoroughly with distilled water. Sample dehydration has to be carried out because the
-
taining withER Tracker™ Blue White DPX: ER Tracker™ is a dapoxyl dye that specifically stains ER in live cells. Since the dye was not found to retain after fixation, live cell staining was performed when fixation was required before staining with antibodies against the CYP proteins. Once washed, the cells were blocked with 3% NGS prepared in 0.001% Digitonin for 30 min at 4°C. This was followed by washing cells with chilled PBS at centrifugation at 805 x g for 10 min at 4°C. Then the cells were incubated with the appropriate primary antibody prepared in 0.001% digitonin for 1h at 4°C. The unbound primary antibody was washed off with chilled PBS three times by centrifugation at 805 x g for 10 min at 4°C. Cells were then incubated with appropriate secondary antibody again prepared in 0.001 % digitonin for 1h on ice. This was followed by three washes with chilled PBS as before. ER Tracker Blue (1p.M) then added to cells which were incubated on ice for 30mins on ice. The excess dye was washed and the cells viewed under the microscope after mounting on slides with anti-fading mounting media
-
The protocols for immunostaining cells with different antibodies and dyes were standardized individually for the respective staining procedure: Staining with MitoTracker® Red: MitoTracker® probes diffuse passively across the plasma membrane and accumulate into the active mitochondria. 100]1M stock solutions of MitoTracker Red CMX Ros were prepared in DMSO. Cells were stained at a final concentration of 100nM for 10 min at 37°C, at RT in the dark. The excess unbound dye was washed off and the cells were ready to be viewed under the microscope or processed further for fixation and antibody staining. Staining with antibodies (Table 3.9): Log phase cells were centrifuged at 129 x g for 5 min at RT to remove all dead cells. The live cells were washed 2X with PBS to remove any adherent media and FBS. Fixation was carried out with 2% formaldehyde at RT for 15 min. The fixed cells were washed 2X with PBS by centrifugation at 805 x g at RT for 5 min. They were then blocked using 3% Normal Goat Serum (NGS) prepared in 0.01% Saponin for 30 min at RT. After a wash with PBS, the cells were incubated with appropriate dilution of primary antibody prepared in 0.01% saponin for 1h at RT. The unbound antibody was thoroughly washed off by at least three washes with PBS. Incubation with respective fluorophore conjugated secondary antibody, again diluted in 0.01% saponin, and was carried out for 45 min at RT. The unbound antibody was thoroughly washed off by at least three washes with PBS. The cells were resuspended in a small volume of PBS and mounted on a slide along with anti-fading mounting media (10% glycerol and 0.001% P-phenylenediamine)
-
injection, programmed at 20°C min-1 to 200 °C and held for 10 min, then at 10 °C min-1 to 230 °C, and finally at 5 °C min-1 to 320 °C and held for 5 min. Injection temperature was set at 260 °C. High purity helium was used as carrier gas of 1.0 mL min-1 flow-rate. The spectrophotometers were operated in electron-impact (EI) mode, full scan of 40-550 amu or selected ion monitoring (SIM) was used, the ionization energy was 70 e V. Calibration curve was generated using n-hexane stock solutions of standard ergosterol dilutions (5-300 ng/mL) in duplicates and plotting the peak area versus the concentration (Yang et al., 2009).
-
Gas chromatography (GC) is a common type of chromatography used in analytic chemistry for separating and analysing compounds that can be vaporised without decomposition, while Mass spectrometry (MS) is an analytical technique that measures the mass-to-charge ratio of charged particles and thus determining masses for determining the elemental composition of a sample or molecule, and for elucidating the chemical structures of molecules. Combined together the technique of GC-MS can be used to identify individual components in a mixture and also quantitate them. The sterol extracts prepared in 3.2.C.14 were dried under nitrogen (N2) gas, resuspended in n-hexane and derivatized with BSTF A (N,O-bis (trimethylsilyl) trifluoroacetamide) containing 1% TMCS (trimethylchlorosilane) at 70 °C for 1 hr. The derivative mixture was dried under N2 (gas) to remove excess BSTFA and subsequently re-dissolved in n-hexane. The column temperature was set at 100°C and held for 5 min for
-
Chromatography is the technique of separation of compounds on the basis of their distribution/ partition between two phases. Thin Layer Chromatography (TLC) is a solid-liquid form of chromatography where the stationary phase is normally polar absorbent and the liquid phase is the mobile phase made up of a single or combination of solvents depending on the solutes to be separated. The sterol isolated by method described in 3.2.C.14, were also run on a Thin Layer Chromatogram. Standard ergosterol dilutions and samples from wild-type and half knock out parasites were spotted on a Silica Gel G plate. The sterols were resolved using a binary solvent [hexane/ ethyl acetate (75/25)]. The sterols were visualized using Mo' s stain (12.5g Ammonium molybdate (VI) tetrahydrate, 5.0g Ammonium cerium (IV) sulphate, 50mL concentrated sulphuric acid, water upto 500mL
-
30nm corresponds only to the intermediate. Since equal number of cells was taken for estimation, the height of the peak was taken as a measure of the ergosterol content
-
Ergosterol content was measured as described by Arthington-Skaggs et al. (1999) with slight modifications. Briefly, equal number of cells were harvested and washed with PBS to remove media and FBS. They were resuspended in 3mL of 25% alcoholic KOH (25g KOH, 35mL sterile distilled water brought to lOOmL with ethanol) and vortexed for one minute. The cell suspension was transferred to a glass vial and incubated at 85°C for 1 hr. The vial was cooled to room temperature followed by the addition of 1mL sterile distilled water and 3mL of n-heptane. The vial was vortexed for 3 mins after which the heptane layer was collected. It was diluted 5 times in absolute ethanol and transferred to a cuvette. A spectrum was recorded between 220nm and 300nm. The peak at 281.5nm corresponds to ergosterol along with some intermediates.
-
A bioluminescent ATP determination kit from Invitrogen (Carlsbad, CA) was used to quantitate ATP levels. The assay is based on luciferase' s requirement for ATP for producing light (emission maxima at 560nm). The assay was carried out as described previously (Mukherjee et al., 2002). Briefly, a standard reaction mix was prepared-1X reaction buffer, 0.1p.M DTT, O.Sp.M Luciferin and 12.5 p.g/ mL Luciferase. 100 p.L was aliquoted into each well of a 96 well white plate and a base line reading measured using Fluostar Omega using the luminometer adaptor. Then either 106 parasites or different concentrations of A TP (prepared from the stock solution provided in the kit) were added to these wells as test and standard curve samples respectively. Again luminescence was measured and the baseline subtracted from the readings. The different dilutions of ATP were used to plot the standard curve which was then used to calculate the ATP levels in cells expressed as nmol/106 cells.
-
he MTT Lysis buffer (20% SDS , 50% Dimethyl formamide) and the O.D.s7onm was measured. The standard curve was plotted and the equation derived, used to calculate the number of metabolically viable cells in experimental groups. Percentage of viable cells was calculated by comparing the number of viable cells in treated wells with that of untreated wells
-
MTT micromethod is a colorimetric assay based upon the conversion of the (yellow) MTT reagent (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide), a tetrazole to purple formazan in the mitochondria (succinate dehydrogenase) of the living cell which is quantified by measuring the optical density at 570nm. When the amount of purple formazan produced by untreated control cells is compared to that of treated cells, the effectiveness of the agent can be deduced through the production of a dose-response curve. Parasites in their log phase were harvested and the dead cells removed at 129 x g for 5min at RT. The live cells were resuspended in phenol red-free DMEM containing 10% FBS to a cell count of 2.5 X 107. 1mL of above culture was plated into each well of a 24 well plate and appropriate treatments were given for desired duration of time. Some untreated cells were also kept aside for generating the standard curve. After appropriate treatment, from each well of the 24 well plate 200pL was aliquotted into 4 wells of a 96 well plate. To each well of the 96 well plate, 10pL of MTT solution (5mg/ mL prepared in PBS and filtered with 0.22p filter) was added and the plate incubated at 23°C for 2-3 hours till colour develops in the control cells. A standard curve was also plated by taking different dilutions of untreated cells and processed similarly. Once colour developed, the reaction was stopped by lysing the cells using
-
hydrolysis of the non-fluorescent derivative dichlorodihydrofluorescein. In the presence of an appropriate oxidant, dichlorodihydrofluorescein is oxidised to the highly fluorescent 2, 7 -dichlorofluorescein. Log phase cultures were taken and dead cells pelleted at 129 x g for 5 min at RT. The live cells were resuspended in fresh phenol red-free DMEM containing 10% FBS to get a cell density of 107 cells per mL. The cells were loaded with the dye (Stock solution prepared in DMSO to a final concentration of 1pg/pL) by incubating every 107 cells with 2pL of stock solution for 15 to 20 min on an end to end shaker at RT and then washed with medium. The cells were incubated for another 15 min to allow de-esterification to occur. 200pL was aliquotted into each well of a black plate and a basal reading taken at 485nm/ 520nm. Subsequently stained cells were exposed to appropriate treatments and fluorescence monitored at appropriate intervals of time. For each experiment, measurements were prepared in quadruplets and expressed as arbitrary f1uorescence intensity units (AFU)
-
CM-H2DCFDA (5-(and-6)-chloromethyl -21,7'-dichlorodihydro fluorescein diacetate, acetyl ester) has been used as a detector of ROS as described previously (Mukherjee et al., 2002).This probe is a non-polar, non-fluorescent dye that diffuses readily into cells, where it is trapped by
-
Rhod-2 acetoxymethyl ester is a fluorescent long wavelength calcium indicator, where the AM ester forms are cationic, resulting in a potential driven uptake into the mitochondria making them selective detectors of mitochondrial calcium. Log phase cultures were taken and dead cells pelleted at 129 x g for 5 min at RT. The live cells were washed twice with Kreb' s buffer (118mM Sodium chloride, 5.4mM Potassium chloride, 1.2mM Magnesium chloride, 1.2mM Potassium dihydrogen phosphate, 25mM Sodium hydrogen phosphate, llmM glucose, 1.5mM Calcium chloride, pH 7.4) by centrifugation at 1258 x g for 5 min to wash off all traces of medium and FBS. Washed cells were loaded with 1:1 mixture of Rhod -2 AM (1p.g/p.L stock solution prepared in DMSO) and 20%w/v Pluronic F127 for 1h at RT in the dark with shaking. Excess dye was removed by one wash with Kreb' s buffer followed by incubation of cells at RT for a further 30min for complete hydrolysis of the dye trapped in the mitochondria. Fluorescence intensities of the stained cells were measured fluorimetrically at excitation of 530nm and emission of 576nm or alternatively acquired by flow cytometer.
-
1mL medium were stained with 1p.L of the dye (1ng/mL) and incubated at 37°C for 10 min in the dark. The unbound dye was washed off with either PBS or medium and cells analysed by flow cytometry or microscopy. Nonylacridine Orange (NAO): NAO (Molecular probes) is a probe which interacts specifically with non-oxidized cardiolipin, a lipid that is exclusively localized in . the inner mitochondrial membrane (Petit et al., 1992). A stock solution of 100p.M was prepared in DMSO and 1p.l (1nM) was used to stain 107 cells in 1mL medium for 10 min at 37°C. The excess dye washed off with PBS and cells were fixed with 4% formaldehyde for 3 min. Subsequently they were analysed with flow cytometry or microscopy
-
Mito Tracker Green®: Mito Tracker® Green (Invitrogen, Carlsbad, CA) is an agent that interacts with mitochondrial lipids and is essentially non-fluorescent in aqueous solution, only becoming fluorescent once it accumulates in the lipid environment of the mitochondria. Since the entry of the dye is not dependent on the mitochondrial membrane potential, it can be used to measure/ compare the mitochondrial mass of cells both in live as well as fixed states. MitoTracker Green® stock solution was prepared in DMSO (1pg/pL) and stored at -20°C. To stain cells
-