10,000 Matching Annotations
  1. Mar 2025
    1. Reviewer #1 (Public review):

      Summary:

      This paper presents a method for reconstructing videos from mouse visual cortex neuronal activity using a state-of-the-art dynamic neural encoding model. The authors achieve high-quality reconstructions of 10-second movies at 30 Hz from two-photon calcium imaging data, reporting a 2-fold increase in pixel-by-pixel correlation compared to previous methods. They identify key factors for successful reconstruction including the number of recorded neurons and model ensembling techniques.

      Strengths:

      (1) A comprehensive technical approach combining state-of-the-art neural encoding models with gradient-based optimization for video reconstruction.

      (2) Thorough evaluation of reconstruction quality across different spatial and temporal frequencies using both natural videos and synthetic stimuli.

      (3) Detailed analysis of factors affecting reconstruction quality, including population size and model ensembling effects.

      (4) Clear methodology presentation with well-documented algorithms and reproducible code.

      (5) Potential applications for investigating visual processing phenomena like predictive coding and perceptual learning.

      Weaknesses:

      The main metric of success (pixel correlation) may not be the most meaningful measure of reconstruction quality:

      High correlation may not capture perceptually relevant features.

      Different stimuli producing similar neural responses could have low pixel correlations The paper doesn't fully justify why high pixel correlation is a valuable goal

      Comparison to previous work (Yoshida et al.) has methodological concerns: Direct comparison of correlation values across different datasets may be misleading; Large differences in the number of recorded neurons (10x more in the current study); Different stimulus types (dynamic vs static) make comparison difficult; No implementation of previous methods on the current dataset or vice versa.

      Limited exploration of how the reconstruction method could provide insights into neural coding principles beyond demonstrating technical capability.

      The claim that "stimulus reconstruction promises a more generalizable approach" (line 180) is not well supported with concrete examples or evidence.

      The paper would benefit from addressing how the method handles cases where different stimuli produce similar neural responses, particularly for high-speed moving stimuli where phase differences might be lost in calcium imaging temporal resolution.

    2. Reviewer #2 (Public review):

      This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

      This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

      While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

      (1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

      (2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

      (3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

      (4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

      (5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

      (6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

      (7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

    3. Reviewer #3 (Public review):

      Summary:

      This paper presents a method for reconstructing input videos shown to a mouse from the simultaneously recorded visual cortex activity (two-photon calcium imaging data). The publicly available experimental dataset is taken from a recent brain-encoding challenge, and the (publicly available) neural network model that serves to reconstruct the videos is the winning model from that challenge (by distinct authors). The present study applies gradient-based input optimization by backpropagating the brain-encoding error through this selected model (a method that has been proposed in the past, with other datasets). The main contribution of the paper is, therefore, the choice of applying this existing method to this specific dataset with this specific neural network model. The quantitative results appear to go beyond previous attempts at video input reconstruction (although measured with distinct datasets). The conclusions have potential practical interest for the field of brain decoding, and theoretical interest for possible future uses in functional brain exploration.

      Strengths:

      The authors use a validated optimization method on a recent large-scale dataset, with a state-of-the-art brain encoding model. The use of an ensemble of 7 distinct model instances (trained on distinct subsets of the dataset, with distinct random initializations) significantly improves the reconstructions. The exploration of the relation between reconstruction quality and the number of recorded neurons will be useful to those planning future experiments.

      Weaknesses:

      The main contribution is methodological, and the methodology combines pre-existing components without any new original components. The movie reconstructions include a learned "transparency mask" to concentrate on the most informative area of the frame; it is not clear how this choice impacts the comparison with prior experiments. Did they all employ this same strategy? If not, shouldn't the quantitative results also be reported without masking, for a fair comparison?

    1. Reviewer #1 (Public review):

      Summary:

      This study is built on the emerging knowledge of trained immunity, where innate immune cells exhibit enhanced inflammatory responses upon being challenged by a prior insult. Trained immunity is now a very fast-evolving field and has been explored in diverse disease conditions and immune cell types. Earhart and the team approached the topic from a novel angle and were the first to explore a potential link to the complement system.

      The study focused on the central complement protein C3 and investigated how its signalling may modulate immune training in alveolar macrophages. The authors first performed in vivo experiments in C57BL mouse models to observe the presence of enhanced inflammation and C3a in BAL fluid following immune training. These changes were then compared with those from C3-deficient mice, which confirmed the involvement of C3a. This trained immunity was further validated in ex vivo experiments using primary alveolar macrophage, which was blunted in C3-deficiency, and, intriguingly, rescued by adding exogenous C3 protein, but not C3a. The genetic-based findings were supported by pharmacological experiments using the C3aR antagonist SB290157. Mechanistically, transcriptomic analyses suggested the involvement of metabolism-linked, particularly glycolytic, genes, which was in agreement with an upregulation of glycolytic flux in WT but not C3-deficient macrophages.

      Collectively, these data suggest that C3, possibly through engaging with C3aR, contributes to trained immunity in alveolar macrophages.

      Strengths:

      The conclusions reached were well supported by in vivo and ex vivo experiments, encompassing both genetic-knockout animal models and pharmacological tools.

      The transcriptomic and cell metabolism studies provided valuable mechanistic insights.

      Weaknesses:

      For the in vivo experiments, the histopathological and other inflammatory markers (Figure 1) were not directly linked to alveolar macrophages by experimental evidence. Other innate immune cells (eg. dendritic cells, neutrophils) and endothelial cells could also be involved in immune training and contribute to the pathological outcomes. These cells were not examined or mentioned in the study.

      For the ex vivo experiments assessing immune training in alveolar macrophages, only the release of selected inflammatory factors were measured. Macrophage activities constitute multiple aspects (e.g. phagocytosis, ROS production, microbe killing), which should also be considered to better depict the effect of trained immunity.

      The proposed mechanism of C3 getting cleaved intracellularly and then binding to lysosomal C3aR needs to be further supported by experimental evidence.

      There was an absence of any validation in human-based models.

    2. Reviewer #2 (Public review):

      Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

      (1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

      (2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

      (3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

      (4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

      (5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

      (6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

    1. Reviewer #1 (Public review):

      Summary:

      The authors aimed to characterize neurocomputational signals underlying interpersonal guilt and responsibility. Across two studies, one behavioral and one fMRI, participants made risky economic decisions for themselves or for themselves and a partner; they also experienced a condition in which the partners made decisions for themselves and the participant. The authors also assessed momentary happiness intermittently between choices in the task. Briefly, results demonstrated that participants' self-reported happiness decreased after disadvantageous outcomes for themselves and when both they and their partner were affected; this effect was exacerbated when participants were responsible for their partner's low outcome, rather than the opposite, reflecting experienced guilt. Consistent with previous work, BOLD signals in the insula correlated with experienced guilt, and insula-right IFG connectivity was enhanced when participants made risky choices for themselves and safe choices for themselves and a partner.

      Strengths:

      This study implements an interesting approach to investigating guilt and responsibility; the paradigm in particular is well-suited to approach this question, offering participants the chance to make risky v. safe choices that affect both themselves and others. I appreciate the assessment of happiness as a metric for assessing guilt across the different task/outcome conditions, as well as the implementation of both computational models and fMRI.

      Weaknesses:

      In spite of the overall strengths of the study, I think there are a few areas in which the paper fell a bit short and could be improved.

      (1) While the framing and goal of this study was to investigate guilt and felt responsibility, the task implemented - a risky choice task with social conditions - has been conducted in similar ways in past research that were not addressed here. The novelty of this study would appear to be the additional happiness assessments, but it would be helpful to consider the changes noted in risk-taking behavior in the context of additional studies that have investigated changes in risky economic choice in social contexts (e.g., Arioli et al., 2023 Cerebral Cortex; Fareri et al., 2022 Scientific Reports).

      (2) The authors note they assessed changes in risk preferences between social and solo conditions in two ways - by calculating a 'risk premium' and then by estimating rho from an expected utility model. I am curious why the authors took both approaches (this did not seem clearly justified, though I apologize if I missed it). Relatedly, in the expected utility approach, the authors report that since 'the number of these types of trials varied across participants', they 'only obtained reliable estimates for [gain and loss] trials in some participants' - in study 1, 22 participants had unreliable estimates and in study 2, 28 participants had unreliable estimates. Because of this, and because the task itself only had 20 gains, 20 losses, and 20 mixed gambles per condition, I wonder if the authors can comment on how interpretable these findings are in the Discussion. Other work investigating loss aversion has implemented larger numbers of trials to mitigate the potential for unreliable estimates (e.g., Sokol-Hessner et al., 2009).

      (3) One thing seemingly not addressed in the Discussion is the fact that the behavioral effect did not replicate significantly in study 2.

      (4) Regarding the computational models, the authors suggest that the Reponsibility and Responsibility Redux models provided the best fit, but they are claiming this based on separate metrics (e.g., in study 1, the redux model had the lowest AIC, but the responsibility only model had the highest R^2; additionally, the basic model had the lowest BIC). I am wondering if the authors considered conducting a direct model comparison to statistically compare model fits.

      (5) In the reporting of imaging results, the authors report in a univariate analysis that a small cluster in the left anterior insula showed a stronger response to low outcomes for the partner as a result of participant choice rather than from partner choice. It then seems as though the authors performed small volume correction on this cluster to see whether it survived. If that is accurate, then I would suggest that this result be removed because it is not recommended to perform SVC where the volume is defined based on a result from the same whole-brain analysis (i.e., it should be done a priori).

    2. Reviewer #2 (Public review):

      Summary

      This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

      Strengths

      This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

      The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

      The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

      Weaknesses

      As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

      As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

      This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

      However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of a fed vs hungry state on food decision-making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings:

      Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

    2. Reviewer #3 (Public review):

      Summary:

      This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

      Strengths:

      This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

      The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

      In summary, the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

      Weaknesses:

      Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

      On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

      On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) consuming a drink versus nothing, or (c) both.

    3. Reviewer #1 (Public review):

      Summary:

      In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift-diffusion model, they further find that the best-fitting model has different attentional discounts on the taste and health attributes and that the attentional discount on the health information was larger for the hungry participants.

      Strengths:

      The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 9 different variants of the DDM, including recent models like the mtDDM and maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

      Weaknesses:

      First, in examining some of the model fits in the supplements, e.g. Figures S9, S10, S12, S13, it looks like the "taste weight" parameter is being constrained below 1. Theoretically, I understand why the authors imposed this constraint, but it might be unfairly penalizing these models. In theory, the taste weight could go above 1 if participants had a negative weight on health. This might occur if there is a negative correlation between attractiveness and health and the taste ratings do not completely account for attractiveness. I would recommend eliminating this constraint on the taste weight.

      Second, I'm not sure about the mediation model. Why should hunger change the dwell time on the chosen item? Shouldn't this model instead focus on the dwell time on the tasty option?

      Third, while I do appreciate the within-participant design, it does raise a small concern about potential demand effects. I think the authors' results would be more compelling if they replicated when only analyzing the first session from each participant. Along similar lines, it would be useful to know whether there was any effect of order.

      Fourth, the authors report that tasty choices are faster. Is this a systematic effect, or simply due to the fact that tasty options were generally more attractive? To put this in the context of the DDM, was there a constant in the drift rate, and did this constant favor the tasty option?

      Fifth, I wonder about the mtDDM. What are the units on the "starting time" parameters? Seconds? These seem like minuscule effects. Do they align with the eye-tracking data? In other words, which attributes did participants look at first? Was there a correlation between the first fixations and the relative starting times? If not, does that cast doubt on the mtDDM fits? Did the authors do any parameter recovery exercises on the mtDDM?

    1. Reviewer #1 (Public review):

      Summary:

      Mancl et al. present cryo-EM structures of the Insulin Degrading Enzyme (IDE) dimer and characterize its conformational dynamics by integrating structures with SEC-SAXS, enzymatic activity assays, and all-atom molecular dynamics (MD) simulations. They present five cryo-EM structures of the IDE dimer at 3.0-4.1 Å resolution, obtained with one of its substrates, insulin, added to IDE in a 1:2 ratio. The study identified R668 as a key residue mediating the open-close transition of IDE, a finding supported by simulations and experimental data. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface.

      Strengths:

      The study by Mancl et al. uses a combination of experimental (cryoEM, SEC-SAXS, enzymatic assays) and computational (MD simulations, multibody analysis, 3DVA) techniques to provide a comprehensive characterization of IDE dynamics. The identification of R668 as a key residue mediating the open-to-close transition of IDE is a novel finding, supported by both simulations and experimental data presented in the manuscript. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface. The study identifies the structural basis and key residues for IDE dynamics that were not revealed by static structures.

      Weaknesses:

      Based on MD simulations and enzymatic assays of IDE, the authors claim that the R668A mutation in IDE affects the conformational dynamics governing the open-closed transition, which leads to altered substrate binding and catalysis. The functional importance of R668 would be substantiated by enzymatic assays that included some of the other known substrates of IDE than insulin such as amylin and glucagon.

      It is unclear to what extent the force field (FF) employed in the MD simulations favors secondary structures and if the lack of any observed structural changes within the IDE domains in the simulations - which is taken to suggest that the domains behave as rigid bodies - stems from bias by the FF.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

    1. Reviewer #1 (Public review):

      This work employs both in vitro and in vivo/transplant methods to investigate the contribution of BDNF/TrkB signaling to enhancing differentiation and dentin-repair capabilities of dental pulp stem cells in the context of exposure to a variety of inflammatory cytokines. A particular emphasis of the approach is the employment of dental pulp stem cells in which BDNF expression has been enhanced using CRISPR technology. Transplantation of such cells is said to improve dentin regeneration in a mouse model of tooth decay.

      The study provides several interesting findings, including demonstrating that exposure to several cytokines/inflammatory agents increases the quantity of (activated) phospho-Trk B in dental pulp stem cells.

      However, a variety of technical issues weaken support for the major conclusions offered by the authors. These technical issues include the following:

      (1) It remains unclear exactly how the cytokines tested affect BDNF/TrkB signaling. For example, in Figure 1C, TNF-alpha increases TrkB and phospho-TrkB immunoreactivity to the same degree, suggesting that the cytokine promotes TrkB abundance without stimulating pathways that activate TrkB, whereas in Figure 2D, TNF-alpha has little effect on the abundance of TrkB, while increasing phospho-TrkB, suggesting that it affects TrkB activation and not TrkB abundance.

      (2) I find the histological images in Figure 3 to be difficult to interpret. I would have imagined that DAPI nuclear stains would reveal the odontoblast layer, but this is not apparent. An adjacent section labeled with conventional histological stains would be helpful here. Others have described Stro-1 as a stem cell marker that is expressed on a minority of cells associated with vasculature in the dental pulp, but in the images in Figure 3, Stro-l label is essentially co-distributed with DAPI, in both control and injured teeth, indicating that it is expressed in nearly all cells. Although the authors state that the Stro-1-positive cells are associated with vasculature, but I see no evidence that is true.

      (3) The data presented convincingly demonstrate that they have elevated BDNF expression in their dental pulp stem cells using a CRISPR-based approach I have a number of questions about these findings. Firstly, nowhere in the paper do they describe the nature of the CRISPR plasmid they are transiently transfecting. Some published methods delete segments of the BDNF 3'-UTR while others use an inactivated Cas9 to position an active transactivator to sequences in the BDNF promoter. If it is the latter approach, transient transfection will yield transient increases in BDNF expression. Also, as BDNF employs multiple promoters, it would be helpful to know which promoter sequence is targeted, and finally, knowing the identity of the guide RNAs would allow assessment for the potential of off-target effects I am guessing that the investigators employ a commercially obtained system from Santa Cruz, but nowhere is this mentioned. Please provide this information.

      (4) Another question left unresolved is whether their approach elevated BDNF, proBDNF, or both. Their 28 kDa western blot band apparently represents proBDNF exclusively, with no mature BDNF apparent, yet only mature BDNF effectively activates TrkB receptors. On the other hand, proBDNF preferentially activates p75NTR receptors. The present paper never mentions p75NTR, which is a significant omission, since other investigators have demonstrated that p75NTR controls odontoblast differentiation.

      (5) In any case, no evidence is presented to support the conclusion that the artificially elevated BDNF expression has any effect on the capability of the dental pulp stem cells to promote dentin regeneration. The results shown in Figures 4 and 5 compare dentin regeneration with BDNF-over-expressing stem cells with results lacking any stem cell transplantation. A suitable control is required to allow any conclusion about the benefit of over-expressing BDNF.

      (6) Whether increased BDNF expression is beneficial or not, the evidence that the BDNF-overexpressing dental pulp stem cells promote dentin regeneration is somewhat weak. The data presented indicate that the cells increase dentin density by only 6%. The text and figure legend disagree on whether the p-value for this effect is 0.05 or 0.01. In either case, nowhere is the value of N for this statistic mentioned, leaving uncertainty about whether the effect is real.

      (7) The final set of experiments applies transcriptomic analysis to address the mechanisms mediating function differences in dental pulp stem cell behavior. Unfortunately, while the Abstract indicates " we conducted transcriptomic profiling of TNFα-treated DPSCs, both with and without TrkB antagonist CTX-B" that does not describe the experiment described, which compared the transcriptome of control cells with cells simultaneously exposed to TNF-alpha and CTX-B. Since CTX-B blocks the functional response of cells to TNF-alpha, I don't understand how any useful interpretation can be attached to the data without controls for the effect of TNF alone and CTX-B alone.

    2. Reviewer #2 (Public review):

      Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

      Strengths:<br /> The potential application to dentin regeneration is interesting.

      Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

      (1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

      (2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

      (3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

      (4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

      (5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

    3. Reviewer #3 (Public review):

      In general, although the authors interpret their results as pointing towards a possible role of BDNF in dentin regeneration, the results are over-interpreted due to the lack of proper controls and focus on TrkB expression, but not its isoforms in inflammatory processes. Surprisingly, the authors do not study the possible role of p75 in this process, which could be one of the mechanisms intervening under inflammatory conditions.

      (1) The authors claim that there are two Trk receptors for BDNF, TrkA and TrkB. To date, I am unaware of any evidence that BDNF binds to TrkA to activate it. It is true that two receptors have been described in the literature, TrkB and p75 or NGFR, but the latter is not TrkA despite its name and capacity to bind NGF along with other neurotrophins. It is crucial for the authors to provide a reference stating that TrkA is a receptor for BDNF or, alternatively, to correct this paragraph.

      (2) The authors discuss BDNF/TrkB in inflammation. Is there any possibility of p75 involvement in this process?

      (3) The authors present immunofluorescence (IF) images against TrkB and pTrkB in the first figure. While they mention in the materials and methods section that these antibodies were generated for this study, there is no proof of their specificity. It should be noted that most commercial antibodies labeled as anti-TrkB recognize the extracellular domain of all TrkB isoforms. There are indications in the literature that pathological and excitotoxic conditions change the expression levels of TrkB-Fl and TrkB-T1. Therefore, it is necessary to demonstrate which isoform of TrkB the authors are showing as increased under their conditions. Similarly, it is essential to prove that the new anti-p-TrkB antibody is specific to this Trk receptor and, unlike other commercial antibodies, does not act as an anti-phospho-pan-Trk antibody.

      (4) I believe this initial conclusion could be significantly strengthened, without opening up other interpretations of the results, by demonstrating the specificity of the antibodies via Western blot (WB), both in the presence and absence of BDNF and other neurotrophins, NGF, and NT-3. Additionally, using WB could help reinforce the quantification of fluorescence intensity presented by the authors in Figure 1. It's worth noting that the authors fixed the cells with 4% PFA for 2 hours, which can significantly increase cellular autofluorescence due to the extended fixation time, favoring PFA autofluorescence. They have not performed negative controls without primary antibodies to determine the level of autofluorescence and nonspecific background. Nor have they indicated optimizing the concentration of primary antibodies to find the optimal point where the signal is strong without a significant increase in background. The authors also do not mention using reference markers to normalize specific fluorescence or indicating that they normalized fluorescence intensity against a standard control, which can indeed be done using specific signal quantification techniques in immunocytochemistry with a slide graded in black-and-white intensity controls. From my experience, I recommend caution with interpretations from fluorescence quantification assays without considering the aforementioned controls.

      (5) In Figure 2, the authors determine the expression levels of TrkA and TrkB using qPCR. Although they specify the primers used for GAPDH as a control in materials and methods, they do not indicate which primers they used to detect TrkA and TrkB transcripts, which is essential for determining which isoform of these receptors they are detecting under different stimulations. Similarly, I recommend following the MIQE guidelines (Minimum Information for Publication of Quantitative Real-Time PCR experiments), so they should indicate the amplification efficiency of their primers, the use of negative and positive controls to validate both the primer concentration used, and the reaction, the use of several stable reference genes, not just one.

      (6) Moreover, the authors claim they are using the same amounts of cDNA for qPCRs since they have quantified the amounts using a Nanodrop. Given that dNTPs are used during cDNA synthesis, and high levels remain after cDNA synthesis from mRNA, it is not possible to accurately measure cDNA levels without first cleaning it from the residual dNTPs. Therefore, I recommend that the authors clarify this point to determine how they actually performed the qPCRs. I also recommend using two other reference genes like 18S and TATA Binding Protein alongside GAPDH, calculating the geometric mean of the three to correctly apply the 2^-ΔΔCt formula.

      (7) Similarly, given that the newly generated antibodies have not been validated, I recommend introducing appropriate controls for the validation of in-cell Western assays.

      (8) The authors' conclusion that TrkB levels are minimal (Figure 2E) raises questions about what they are actually detecting in the previous experiments might not be the TrkB-Fl form. Therefore, it is essential to demonstrate beyond any doubt that both the antibodies used to detect TrkB and the primers used for qPCR are correct, and in the latter case, specify at which cycle (Ct) the basal detection of TrkB transcripts occurs. Treatment with TNF-alpha for 14 days could lead to increased cell proliferation or differentiation, potentially increasing overall TrkB transcript levels due to the number of cells in culture, not necessarily an increase in TrkB transcripts per cell.

      (9) Overall, there are reasonable doubts about whether the authors are actually detecting TrkB in the first three images, as well as the phosphorylation levels and localization of this receptor in the cells. For example, in Figure 3 A to J, it is not clear where TrkB is expressed, necessitating better resolution images and a magnified image to show in which cellular structure TrkB is expressed.

      (10) In Figure 4, the authors indicate they have generated cells overexpressing BDNF after recombination using CRISPR technology. However, the WB they show in Figure 4B, performed under denaturing conditions, displays a band at approximately 28kDa. This WB is absolutely incorrect with all published data on BDNF detection via this technique. I believe the authors should demonstrate BDNF presence by showing a WB with appropriate controls and BDNF appearing at 14kDa to assume they are indeed detecting BDNF and that the cells are producing and secreting it. What antibodies have been used by the authors to detect BDNF? Have the authors validated it? There are some studies reporting the lack of specificity of certain commercial BDNF antibodies, therefore it is necessary to show that the authors are convincingly detecting BDNF.

      (11) While the RNA sequencing data indicate changes in gene expression in cells treated with TNFalpha+CTX-B compared to control, the authors do not show a direct relationship between these genetic modifications with the rest of their manuscript's argument. I believe the results from these RNA sequencing assays should be put into the context of BDNF and TrkB, indicating which genes in this signaling pathway are or are not regulated, and their importance in this context.

    1. Reviewer #1 (Public review):

      Summary:

      In this study, authors utilized in situ cryo-electron tomography (cryo-ET) to uncover the native thylakoid architecture of spinach chloroplasts and mapped the molecular organization of these thylakoids with single-molecule resolution. The obtained images show the detailed ultrastructural features of grana membranes and highlight interactions between thylakoids and plastoglobules. Interestingly, despite the distinct three-dimensional architecture of vascular plant thylakoids, their molecular organization closely resembles that of green algae. The pronounced lateral segregation of PSII and PSI was observed at the interface between appressed and non-appressed thylakoid regions, without evidence of a specialized grana margin zone where these complexes might intermix. Furthermore, unlike isolated thylakoid membranes, photosystem II (PSII) did not form a semi-crystalline array and distributed uniformly within the membrane plane and across stacked grana membranes in intact chloroplasts. Based on the above observations, the authors propose a simplified two-domain model for the molecular organization of thylakoid membranes that can apply to both green algae and vascular plants. This study suggests that the general understanding of the functional separation of thylakoid membranes in vascular plants should be reconsidered.

      Strengths:

      By employing and refining AI-driven computational tools for the automated segmentation of membranes and identification of membrane proteins, this study successfully quantifies the spatial organization of photosynthetic complexes both within individual thylakoid membranes and across neighboring stacked membranes.

      Weaknesses:

      This study's weakness is that it requires the use of chloroplasts isolated from leaves and the need to freeze them on a grid for observation, so it is unclear to what extent the observations reflect physiological conditions. In particular, the mode of existence of the thylakoid membrane complexes seems to be strongly influenced by the physicochemical environment surrounding the membranes, as indicated by the different distribution of PSII between intact chloroplasts and those with ruptured envelope membranes.

    2. Reviewer #2 (Public review):

      Summary:

      For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

      Strengths:

      By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

    1. Reviewer #1 (Public review):

      Summary:

      This paper proposes a new set of local synaptic plasticity rules that differs from classic rules in two regards: First, working under the assumption that signals coming into synapses change smoothly over time and thus have temporal correlations such that immediate activity is positively correlated with subsequent activity, it proposes both fast plasticity that immediately corrects errors as well as slower plasticity. Second, it derives these rules from optimal, Bayesian control theory principles that, even without the fast component of plasticity, are shown to provide more accurate performance than classic, non-Bayesian plasticity rules. As a proof of principle, it applies these to a simple cerebellar learning example that demonstrates how the proposed rules lead to learning performance that exceeds that achieved with classic cerebellar learning rules. The work also provides a potential normative explanation for post-climbing fiber spike pauses in Purkinje cell firing and proposes testable predictions for cerebellar experiments. Overall, I found the idea to be compelling and potentially broadly applicable across many systems. Further, I thought the work was a rare, very beautiful display of the application of optimal control theory to fundamental problems in neuroscience. My comments are all relatively minor and more expressions of interest than criticism.

      Comments:

      (1) The algorithm assumes, reasonably, that inputs are relatively smooth. However, I was wondering if this could make additional experimental predictions for the system being exceptionally noisy or otherwise behaving in signature ways if one were able to train a real biological network to match a rapidly changing or non-smooth function that does not align with the underlying assumptions of the model.

      (2) The algorithm assumes that one can, to a good approximation, replace individual input rates by their across-synapse average. How sensitive is the learning to this assumption, as one might imagine scenarios where a neuron is sensitive to different inputs for different tasks or contexts so that a grand average might not be correct? Or, the functional number of inputs driving the output might be relatively low or otherwise highly fluctuating and less easily averaged over.

      (3) On the cerebellar example, it is nice that the Bayesian example provides a narrower PF-CF interval for plasticity than the classical rules, but the window is not nearly as narrow as the Suvrathan et al. 2016 paper cited by the authors. Maybe this is something special about that system having well-defined, delayed feedback, but (optional) further comments or insights would be welcome if available.

      (4) In the discussion, I appreciated the comparison with the Deneve work which has fast and slow feedback components. I was curious whether, although non-local, there were also conceptual similarities with FORCE learning in which there is also an immediate correction of activity through fast changing of synaptic weights, which then aids the slow long-term learning of synaptic weights.

    2. Reviewer #2 (Public review):

      Summary:

      Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

      Strengths:

      Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

      Weaknesses:

      The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

    1. Reviewer #1 (Public review):

      The ventral nerve cord (VNC) of organisms like Drosophila is an invaluable model for studying neural development and organisation in more complex organisms. Its well-defined structure allows researchers to investigate how neurons develop, differentiate, and organise into functional circuits. As a critical central nervous system component, the VNC plays a key role in controlling motor functions, reflexes, and sensory integration.

      Particularly relevant to this work, the VNC provides a unique opportunity to explore neuronal hemilineages - groups of neurons that share molecular, genetic, and functional identities. Understanding these hemilineages is crucial for elucidating how neurons cooperate to form specialized circuits, essential for comprehending normal brain function and dysfunction.

      A significant challenge in the field has been the lack of developmentally stable, hemilineage-specific driver lines that enable precise tracking and measurement of individual VNC hemilineages. The authors address this need by generating and validating a comprehensive, lineage-specific split-GAL4 driver library.

      Strengths and weaknesses

      The authors select new marker genes for hemilineages from previously published single-cell data of the VNC. They generate and validate specific and temporally stable lines for almost all the hemilineages in the VNC. They successfully achieved their aims, and their results support their conclusions. This will be a valuable resource for investigating neural circuit formation and function.

    2. Reviewer #2 (Public review):

      It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

    3. Reviewer #3 (Public review):

      Summary:

      Soffers et al. developed a comprehensive genetic toolkit that enables researchers to access neuronal hemilineages during developmental and adult time points using scRNA-seq analysis to guide gene cassette exchange-based or CRISPR-based tool building. Currently, research groups studying neural circuit development are challenged with tying together findings in the development and mature circuit function of hemilineage-related neurons. Here, authors leverage publicly available scRNA-seq datasets to inform the development of a split-Gal4 library that targets 32 of 34 hemilineages in development and adult stages. The authors demonstrated that the split-Gal4 library, or genetic toolkit, can be used to assess the functional roles, neurotransmitter identity, and morphological changes in targeted cells. The tools presented in this study should prove to be incredibly useful to Drosophila neurobiologists seeking to link neural developmental changes to circuit assembly and mature circuit function. Additionally, some hemilineages have more than one split-Gal4 combination that will be advantageous for studies seeking to disrupt associated upstream genes.

      Strengths:

      Informing genetic tool development with publicly available scRNA-seq datasets is a powerful approach to creating specific driver lines. Additionally, this approach can be easily replicated by other researchers looking to generate similar driver lines for more specific subpopulations of cells, as mentioned in the Discussion.

      The unification of optogenetic stimulation data of 8B neurons and connectomic analysis of the Giant-Fiber-induced take-off circuit was an excellent example of the utility of this study. The link between hemilineage-specific functional assays and circuit assembly has been limited by insufficient genetic tools. The tools and data present in this study will help better understand how collections of hemilineages develop in a genetically constrained manner to form circuits amongst each other selectively.

      Weaknesses:

      Although cell position, morphology (to some extent), and gene expression are good markers to track cell identity across developmental time, there are genetic tools available that could have been used to permanently label cells that expressed genes of interest from birth, ensuring that the same cells are being tracked in fixed tissue images.

      Although gene activation is a good proxy for assaying neurochemical features, relying on whether neurochemical pathway genes are activated in a cell to determine its phenotype can be misleading given that the Trojan-Gal4 system commandeers the endogenous transcriptional regulation of a gene but not its post-transcriptional regulation. Therefore, neurochemical identity is best identified via protein detection. (strong language used in this section of the paper).

      The authors mainly rely on the intersectional expression of transcription factors to generate split-Gal4 lines and target hemilineages specifically. However, the Introduction (Lines 97-99) makes a notable point about how driver lines in the past, which have also predominantly relied on the regulatory sequences of transcription factors, lack the temporal stability to investigate hemilineages across time. This point seems to directly conflict with the argument made in the Results (Lines 126-127) that states that most transcription factors are stably expressed in hemilineage neurons that express them. It is generally known that transcription factors can be expressed stably or transiently depending on the context. It is unclear how using the genes of transcription factors in this study circumvents the issue of creating temporally stable driver lines.

    1. Reviewer #1 (Public review):

      Summary:

      The authors introduce ImPaqT, a modular toolkit for zebrafish transgenesis, utilizing the Golden Gate cloning approach with the rare-cutting enzyme PaqCI. The toolkit is designed to streamline the construction of transgenes with broad applications, particularly for immunological studies. By providing a versatile platform, the study aims to address limitations in generating plasmids for zebrafish transgenesis.

      Strengths:

      The ImPaqT toolkit offers a modular method for constructing transgenes tailored to specific research needs. By employing Golden Gate cloning, the system simplifies the assembly process, allowing seamless integration of multiple genetic elements while maintaining scalability for complex designs. The toolkit's utility is evident from its inclusion of a diverse range of promoters, genetic tools, and fluorescent markers, which cater to both immunological and general zebrafish research needs. Furthermore, the modular design ensures expandability, enabling researchers to customize constructs for diverse experimental designs. The validation provided in the manuscript is solid, demonstrating the successful generation of several functional transgenic lines. These examples highlight the toolkit's efficacy, particularly for immune-focused applications.

      Weaknesses:

      While the toolkit's technical capabilities are well-demonstrated, there are several areas where additional validation and examples could enhance its impact. One limitation is the lack of data showing whether the toolkit can be directly used for rapid cloning and testing of enhancers or promoters, particularly cloning them directly from PCR using PaqCI overhangs without needing an entry vector. Similarly, the feasibility of cloning genes directly from PCR products into the system is not demonstrated, which would significantly increase the utility for researchers working with genomic elements.

      The authors discuss potential applications such as using the toolkit for tissue-specific knockout applications by assembling CRISPR/Cas9 gRNA constructs. However, they do not demonstrate the cloning of short fragments, such as gRNA sequences downstream of a U6 promoter, which would be an important proof-of-concept to validate these applications. Furthermore, while the manuscript focuses on macrophage-specific promoters, the widely used mpeg1.1 promoter is not included or tested, which limits the toolkit's appeal for researchers studying macrophages and microglia.

      Another potential limitation is the handling of sequences containing PaqCI recognition sites. Although the authors discuss domestication to remove these sites, a demonstration of cloning strategies for such cases or alternative methods to address these challenges would provide practical guidance for users.

    2. Reviewer #2 (Public review):

      Summary:

      Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

      Strengths:

      The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

      Weaknesses:

      (1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

      (2) There is no statement for the upper limitation of the expandability.

      (3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

    1. Reviewer #1 (Public review):

      Summary:

      Optogenetic tools enable very precise spatiotemporal control of the signaling pathway. The authors developed an optimized light-regulated PKC epsilon, Opto-PKCepsilon using AlphaFold for rational design. Interactome and phosphoproteome studies of light-activated Opto-PKCepsilon confirmed a high similarity of interaction partners to PMA-stimulated wild-type PKCepsilon and high specificity for PKCepsilon substrates. Light-dependent recruitment of Opto-PKCepsilon to the plasma membrane revealed the specific phosphorylation of the insulin receptor at Thr 1160 and recruitment to mitochondria the phosphorylation of the complex I subunit NDUFS4 correlating with reduced spare respiratory capacity, respectively. The interactome and phosphoproteome studies confirm the functionality of Opto-PKCepsilon.

      Strengths:

      AlphaFold simulations enable the design of an optimized Opto-PKCepsilon with respect to dark-light activity. Opto-PKCepsilon is a versatile tool to study the function of PKCepsilon in a precisely controlled manner.

      Weaknesses:

      Light-controlled PCKepsilon was recently reported by Gada et al. (2022). Ong et al. developed an optimized Opto-PKCepsilon and presented in their manuscript the potential of this tool for controlling signaling pathways. However, some data have to be improved and appropriate controls are still missing for some experiments.

      Major comments:

      (1) The group of proteins detected as phosphorylated PKC substrates (phospho-Ser PKC substrate antibody) induced by Opto-PKCepsilon varies significantly between Figure 1 C and Figure 2 C. Have the authors any explanation for this? Do both figures show similar areas of the membrane? The size marker indicates that this is not the case.

      (2) The ratio of endogenous and exogeneous PCKepsilon is quite different in the experiments shown in Figure 1 C and Figure 2 C. What is the reason for this effect?

      (3) In addition to the overall phosphorylation of PKC substrates, the PKCepsilon mutants should be tested for phosphorylation of a known PKCepsilon substrate. The phosphorylation of the insulin receptor at Thr 1160 by Opto-PKCepsilon (see Figure 6) is very convincing and would provide clearer results for comparing the mutants.

      (4) The quality of the fluorescence images shown in Figure 5 is poor and should be improved. In addition, a MitoTracker dye for mitochondria labeling should be included to confirm the mitochondrial localization of Opto-PKCepsilon.

      (5) Figure S6 shows a light experiment in the absence of insulin, as stated in the headline of the figure legend and in the main text. Does this mean that Figure 6B shows an experiment in which the cells were exposed to light in the presence of insulin? If so, this should be mentioned in the legend of the figure and in the main text. What influence does insulin have on IR phosphorylation at Thr 1160?

      (6) The signal of NDUSF4 phosphorylation induced by Opto-PKCepsilon is weak in the experiment shown in Figure 7E. What about the effect of shorter and longer exposure times? How many times was this experiment repeated?

    2. Reviewer #2 (Public review):

      Summary:

      The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

      Strengths:

      (1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

      (2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

      (3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

      Weaknesses:

      (1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

      (2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

      (3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

    1. Reviewer #1 (Public review):

      Summary:

      The authors present results and analysis of an experiment studying the genetic architecture of phenology in two geographically and genetically distinct populations of switchgrass when grown in 8 common gardens spanning a wide range of latitudes. They focused primarily on two measures of phenology - the green-up date in the spring, and the date of flowering. They observed generally positive correlations of flowering date across the latitudinal gradient, but negative correlations between northern and southern (i.e. Texas) green-up dates. They use GWAS and multivariate meta-analysis methods to identify and study candidate genetic loci controlling these traits and how their effect sizes vary across these gardens. They conclude that much of the genetic architecture is garden-specific, but find some evidence for photoperiod and rainfall effects on the locus effect sizes.

      Strengths:

      The strengths of the study are in the large scale and quality of the field trials, the observation of negative correlations among genotypes across the latitudinal gradient, and the importance of the central questions: Can we predict how genetic architecture will change when populations are moved to new environments? Can we breed for more/less sensitivity to environmental cues?

      Weaknesses:

      I have tried hard to understand the concept of the GxWeather analysis presented here, but still do not see how it tests for interactions between weather and genetic effects on phenology. I may just not understand it correctly, but if so, then I think more clarity in the logical model would help - maybe a figure explaining how this approach can detect genotype-weather interactions. Also, since this is a proposal for a new approach to detecting gene-environment effects, simulations would be useful to show power and false positive rates, or other ways of validating the results. The QTL validation provided is not very convincing because the same trials and the same ways of calculating weather values are used again, so it's not really independent validation, plus the QTL intervals are so large overlap between QTL and GWAS is not very strong evidence.

      The term "GxWeather" is never directly defined, but based on its pairing with "GxE" on page 5, I assumed it means an interaction between genotypes (either plant lines or genotypes at SNPs) and weather variables, such that different genotypes alter phenology differently as a response to a specific change in weather. For example, some genotypes might initiate green-up once daylengths reach 12 hours, but others require 14 hours. Alternatively (equivalently), an SNP might have an effect on greenup at 12 hours (among plants that are otherwise physiologically ready to trigger greenup on March 21, only those with a genotype trigger), while no effect on greenup with daylengths of 14 hours (e.g., if plants aren't physiologically ready to greenup until June when daylengths are beyond 14 hours, both aa and AA genotypes will greenup at the same time, assuming this locus doesn't affect physiological maturity).

      Either way, GxE and (I assume) GxWeather are typically tested in one of two ways. Either genotype effects are compared among environments (which differ in their mean value for weather variables) and GxWeather would be inferred if environments with similar weather have similar genotype effects. Or a model is fit with an environmental (maybe weather?) variable as a covariate and the genotype:environment interaction is measured as a change of slope between genotypes. Basically, the former uses effect size estimates across environments that differ in mean for weather, while the latter uses variation in weather within an experiment to find GxWeather effects.

      However, the analytical approach here seems to combine these in a non-intuitive way and I don't think it can discover the desired patterns. As I understand from the methods, weather-related variables are first extracted for each genotype in each trial based on their green-up or flowering date, so within each trial each genotype "sees" a different value for this weather variable. For example, "daylength 14 days before green-up" is used as a weather variable. The correlation between these extracted genotype-specific weather variables across the 8 trials is then measured and used as a candidate mixture component for the among-trial covariance in mash. The weight assigned to these weather-related covariance matrices is then interpreted as evidence of genotype-by-weather interactions. However, the correlation among genotypes between these weather variables does not measure the similarity in the weather itself across trials. Daylengths at green-up are very different in MO than SD, but the correlation in this variable among genotypes is high. Basically, the correlation/covariance statistic is mean-centered in each trial, so it loses information about the mean differences among trials. Instead, the covariance statistic focuses on the within-trial variation in weather. But the SNP effects are not estimated using this within-trial variation, they're main effects of the SNP averaged over the within-trial weather variation. Thus it is not clear to me that the interpretation of these mash weights is valid. I could see mash used to compare GxWeather effects modeled in each trial (using the 2nd GxE approach above), but that would be a different analysis. As is, mash is used to compare SNP main effects across trials, so it seems to me this comparison should be based on the average weather differences among trials.

      A further issue with this analysis is that the weather variables don't take into account the sequence of weather events. If one genotype flowers after the 1st rain event and the second flowers after the 2nd rain event, they can get the same value for the cumulative rainfall 7d variable, but the lack of response after the 1st rain event is the key diagnostic for GxWeather. There's also the issue of circularity. Since weather values are defined based on observed phenology dates, they're effectively caused by the phenology dates. So then asking if they are associated with phenology is a bit circular. Also, it takes a couple of weeks after flowering is triggered developmentally before flowers open, so the < 2-week lags don't really make developmental sense.

      Thus, I don't think this sentence in the abstract is a valid interpretation of the analysis: "in the Gulf subpopulation, 65% of genetic effects on the timing of vegetative growth covary with day length 14 days prior to green-up date, and 33% of genetic effects on the timing of flowering covary with cumulative rainfall in the week prior to flowering". There's nothing in this analysis that compares the genetic effects under 12h days to genetic effects under 14h days (as an example), or genetic effects with no rainfall prior to flowering to genetic effects with high rainfall prior to flowering. I think the only valid conclusion is: "65% of SNPs for green-up have a GxE pattern that mirrors the similarity in relationships between green-up and day length among trials." However I don't know how to interpret that statement in terms of the overall goals of the paper.

      Next, I am confused about the framing in the abstract and the introduction of the GxE within and between subpopulations. The statement: "the key expectation that different genetic subpopulations, and even different genomic regions, have likely evolved distinct patterns of GxE" needs justification or clarification. The response to an environmental factor (ie plasticity) is a trait that can evolve between populations. This happens through the changing frequencies of alleles that cause different responses. But this doesn't necessarily mean that patterns of GxE are changing. GxE is the variance in plasticity. When traits are polygenic, population means can change a lot with little change in variance within each population. Most local adaptation literature is focused on changes in mean trait values or mean plasticities between populations, not changes in the variance of trait values or plasticities within populations. Focusing on the goal of this paper, differences in environmental or weather responses between the populations are interesting (Figure 1). However the comparisons of GxE between populations and with the combined population are hard to interpret. GxE within a population means that that population is not fixed for this component of plasticity, meaning that it likely hasn't been strongly locally selected. Doesn't this mean that in the context of comparing the two populations, loci with GxE within populations are less interesting than loci fixed for different values between populations? Also, if there is GxE in the Gulf population, by definition it is also present in the "Both" population. Not finding it there is just a power issue. If individuals in the two subpopulations never cross, the variance across the "Both" population isn't relevant in nature, it's an artificial construct of this experimental design. I wonder if there is confusion about the term "genetic" in GxE and as used in the first paragraph of the intro ("Genetic responses" and "Genetic sensitivity"). These sentences would be most clear if the "genetic" term referred to the mechanistic actions of gene products. But the rest of the paper is about genetic variation, ie the different effects of different alleles at a locus. I don't think this latter definition is what these first uses intend, which is confusing.

      Note that the cited paper (26) is not relevant to this discussion about GxE patterns. This paper discusses the precision of estimating sub-group-specific genetic effects. With respect to the current paper, reference 26 shows that you might get more accurate measures of the SNP effects in the Gulf population using the full "Both" population dataset because i) the sample size is larger, and ii) as long as the true effects are not that different between populations. That paper is not focused on whether effect size variation is caused by evolution but on the technical question of whether GxG or GxE impacts the precision of within-group effect size estimates. The implication of paper 26 is that comparing SNP effects estimated in the "Both" population among gardens might be more powerful for detecting GxE than using only Gulf samples, even if there is some difference in SNP effects among populations. But if there magnitudes (or directions) of SNP effects change a lot among populations (ie not just changes in allele frequency), then modeling the populations separately will be more accurate.

    2. Reviewer #2 (Public review):

      The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

      Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

      (1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

      (2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

      (3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

      (4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

      (5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

      To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

    1. Reviewer #1 (Public review):

      Summary

      This work performed Raman spectral microscopy at the single-cell level for 15 different culture conditions in E. coli. The Raman signature is systematically analyzed and compared with the proteome dataset of the same culture conditions. With a linear model, the authors revealed correspondence between Raman pattern and proteome expression stoichiometry indicating that spectrometry could be used for inferring proteome composition in the future. With both Raman spectra and proteome datasets, the authors categorized co-expressed genes and illustrated how proteome stoichiometry is regulated among different culture conditions. Co-expressed gene clusters were investigated and identified as homeostasis core, carbon-source dependent, and stationary phase-dependent genes. Overall, the authors demonstrate a strong and solid data analysis scheme for the joint analysis of Raman and proteome datasets.

      Strengths and major contributions

      (1) Experimentally, the authors contributed Raman datasets of E. coli with various growth conditions.

      (2) In data analysis, the authors developed a scheme to compare proteome and Ramen datasets. Protein co-expression clusters were identified, and their biological meaning was investigated.

      Weaknesses

      The experimental measurements of Ramen microscopy were conducted at the single-cell level; however, the analysis was performed by averaging across the cells. The author did not discuss if Ramen microscopy can used to detect cell-to-cell variability under the same condition.

      Discussion and impact on the field

      Ramen signature contains both proteomic and metabolomic information and is an orthogonal method to infer the composition of biomolecules. It has the advantage that single-cell level data could be acquired and both in vivo and in vitro data can be compared. This work is a strong initiative for introducing the powerful technique to systems biology and providing a rigorous pipeline for future data analysis.

    2. Reviewer #2 (Public review):

      Summary and strengths:

      Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

      They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

      Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

      Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

      Strengths:

      The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

      Weaknesses:

      Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

    1. Reviewer #1 (Public review):

      Summary:

      This work shows that a specific adenosine deaminase protein in Dictyostelium generates the ammonia that is required for tip formation during Dictyostelium development. Cells with an insertion in the ADGF gene aggregate but do not form tips. A remarkable result, shown in several different ways, is that the ADGF mutant can be rescued by exposing the mutant to ammonia gas. The authors also describe other phenotypes of the ADGF mutant such as increased mound size, altered cAMP signaling, and abnormal cell type differentiation. It appears that the ADGF mutant has defects in the expression of a large number of genes, resulting in not only the tip defect but also the mound size, cAMP signaling, and differentiation phenotypes.

      Strengths:

      The data and statistics are excellent.

      Weaknesses:

      The key weakness is understanding why the cells bother to use a diffusible gas like ammonia as a signal to form a tip and continue development. The rescue of the mutant by adding ammonia gas to the entire culture indicates that ammonia conveys no positional information within the mound. By the time the cells have formed a mound, the cells have been starving for several hours, and desperately need to form a fruiting body to disperse some of themselves as spores, and thus need to form a tip no matter what. One can envision that the local ammonia concentration is possibly informing the mound that some minimal number of cells are present (assuming that the ammonia concentration is proportional to the number of cells), but probably even a minuscule fruiting body would be preferable to the cells compared to a mound. This latter idea could be easily explored by examining the fate of the ADGF cells in the mound - do they all form spores? Do some form spores? Or perhaps the ADGF is secreted by only one cell type, and the resulting ammonia tells the mound that for some reason that cell type is not present in the mound, allowing some of the cells to transdifferentiate into the needed cell type. Thus elucidating if all or some cells produce ADGF would greatly strengthen this puzzling story.

    2. Reviewer #2 (Public review):

      Summary:

      The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

      Strengths:

      The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

      Weaknesses:

      Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

    1. Joint Public Review:

      Summary:

      In this manuscript, the authors investigate how different domains of the presynaptic protein UNC-13 regulate synaptic vesicle release in the nematode C. elegans. By generating numerous point mutations and domain deletions, they propose that two membrane-binding domains (C1 and C2B) can exhibit "mutual inhibition," enabling either domain to enhance or restrain transmission depending on its conformation. The authors also explore additional N-terminal regions, suggesting that these domains may modulate both miniature and evoked synaptic responses. From their electrophysiological data, they present a "functional switch" model in which UNC-13 potentially toggles between a basal state and a gain-of-function state, though the physiological basis for this switch remains partly speculative.

      Strengths:

      (1) The authors conduct a thorough exploration of how mutations in the C1, C2B, and other regulatory domains affect synaptic transmission. This includes single, double, and triple mutations, as well as domain truncations, yielding a large, informative dataset.

      (2) The study includes systematically measure both spontaneous and evoked synaptic currents at neuromuscular junctions, under various experimental conditions (e.g., different Ca²⁺ levels), which strengthens the reliability of their functional conclusions.

      (3) Findings that different domain disruptions produce distinct effects on mEPSCs, mIPSCs, and evoked EPSCs suggest UNC-13 may adopt an elevated functional state to regulate synaptic transmission.

    1. Reviewer #2 (Public review):

      The authors have constructively responded to previous referee comments and I believe that the manuscript is a useful addition to the literature. I particularly appreciate the quantitative approach to social behavior, but have two cautionary comments.

      (1) Conceptually it is important to further justify why this particular maximum entropy model is appropriate. Maximum entropy models have been applied across a dizzying array of biological systems, including genes, neurons, the immune system, as well as animal behavior, so would seem quite beneficial to explain the particular benefits here, for mouse social behavior as coarse-grained through the eco-hab chamber occupancy. This would be an excellent chance to amplify what the models can offer for biological understanding, particularly in the realm of social behavior

      (2) Maximum entropy models of even intermediate size systems involve a large number of parameters. The authors are transparent about that limitation here, but I still worry that the conclusion of the sufficiency of pairwise interactions is simply not general, and this may also relate to the differences from previous work. If, as the authors suggest in the discussion, this difference is one of a choice of variables, then that point could be emphasized. The suggestion of a follow up study with a smaller number of mice is excellent.

    2. Reviewer #3 (Public review):

      Summary:

      Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

      Strengths:

      The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

      Weaknesses:

      A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a new model for animal pose estimation. The core feature they highlight is the model's stability compared to existing models in terms of keypoint drift. The authors test this model across a range of new and existing datasets. The authors also test the model with two mice in the same arena. For the single animal datasets the authors show a decrease in sudden jumps in keypoint detection and the number of undetected keypoints compared with DeepLabCut and SLEAP. Overall average accuracy, as measured by root mean squared error, generally shows generally similar but sometimes superior performance to DeepLabCut and better performance compared to SLEAP. The authors confusingly don't quantify the performance of pose estimation in the multi (two) animal case instead focusing on detecting individual identity. This multi-animal model is not compared with the model performance of the multi-animal mode of DeepLabCut or SLEAP.

      Strengths:

      The major strength of the paper is successfully demonstrating a model that is less likely to have incorrect large keypoint jumps compared to existing methods. As noted in the paper, this should lead to easier-to-interpret descriptions of pose and behavior to use in the context of a range of biological experimental workflows.

      Weaknesses:

      There are two main types of weaknesses in this paper. The first is a tendency to make unsubstantiated claims that suggest either model performance that is untested or misrepresents the presented data, or suggest excessively large gaps in current SOTA capabilities. One obvious example is in the abstract when the authors state ADPT "significantly outperforms the existing deep-learning methods, such as DeepLabCut, SLEAP, and DeepPoseKit." All tests in the rest of the paper, however, only discuss performance with DeepLabCut and SLEAP, not DeepPoseKit. At this point, there are many animal pose estimation models so it's fine they didn't compare against DeepPoseKit, but they shouldn't act like they did. Similar odd presentation of results are statements like "Our method exhibited an impressive prediction speed of 90{plus minus}4 frames per second (fps), faster than DeepLabCut (44{plus minus}2 fps) and equivalent to SLEAP (106{plus minus}4 fps)." Why is 90{plus minus}4 fps considered "equivalent to SLEAP (106{plus minus}4 fps)" and not slower? I agree they are similar but they are not the same. The paper's point of view of what is "equivalent" changes when describing how "On the single-fly dataset, ADPT excelled with an average mAP of 92.83%, surpassing both DeepLabCut and SLEAP (Figure 5B)" When one looks at Figure 5B, however, ADPT and DeepLabCut look identical. Beyond this, oddly only ADPT has uncertainty bars (no mention of what uncertainty is being quantified) and in fact, the bars overlap with the values corresponding to SLEAP and DeepPoseKit. In terms of making claims that seem to stretch the gaps in the current state of the field, the paper makes some seemingly odd and uncited statements like "Concerns about the safety of deep learning have largely limited the application of deep learning-based tools in behavioral analysis and slowed down the development of ethology" and "So far, deep learning pose estimation has not achieved the reliability of classical kinematic gait analysis" without specifying which classical gait analysis is being referred to. Certainly, existing tools like DeepLabCut and SLEAP are already widely cited and used for research.

      The other main weakness in the paper is the validation of the multi-animal pose estimation. The core point of the paper is pose estimation and anti-drift performance and yet there is no validation of either of these things relating to multi-animal video. All that is quantified is the ability to track individual identity with a relatively limited dataset of 10 mice IDs with only two in the same arena (and see note about train and validation splits below). While individual tracking is an important task, that literature is not engaged with (i.e. papers like Walter and Couzin, eLife, 2021: https://doi.org/10.7554/eLife.64000) and the results in this paper aren't novel compared to that field's state of the art. On the other hand, while multi-animal pose estimation is also an important problem the paper doesn't engage with those results either. The two methods already used for comparison in the paper, SLEAP and DeepPoseKit, already have multi-animal modes and multi-animal annotated datasets but none of that is tested or engaged with in the paper. The paper notes many existing approaches are two-step methods, but, for practitioners, the difference is not enough to warrant a lack of comparison. The authors state that "The evaluation of our social tracking capability was performed by visualizing the predicted video data (see supplement Videos 3 and 4)." While the authors report success maintaining mouse ID, when one actually watches the key points in the video of the two mice (only a single minute was used for validation) the pose estimation is relatively poor with tails rarely being detected and many pose issues when the mice get close to each other.

      Finally, particularly in the methods section, there were a number of places where what was actually done wasn't clear. For example in describing the network architecture, the authors say "Subsequently, network separately process these features in three branches, compute features at scale of one-fourth, one-eight and one-sixteenth, and generate one-eight scale features using convolution layer or deconvolution layer." Does only the one-eight branch have deconvolution or do the other branches also? Similarly, for the speed test, the authors say "Here we evaluate the inference speed of ADPT. We compared it with DeepLabCut and SLEAP on mouse videos at 1288 x 964 resolution", but in the methods section they say "The image inputs of ADPT were resized to a size that can be trained on the computer. For mouse images, it was reduced to half of the original size." Were different image sizes used for training and validation? Or Did ADPT not use 1288 x 964 resolution images as input which would obviously have major implications for the speed comparison? Similarly, for the individual ID experiments, the authors say "In this experiment, we used videos featuring different identified mice, allocating 80% of the data for model training and the remaining 20% for accuracy validation." Were frames from each video randomly assigned to the training or validation sets? Frames from the same video are very correlated (two frames could be just 1/30th of a second different from each other), and so if training and validation frames are interspersed with each other validation performance doesn't indicate much about performance on more realistic use cases (i.e. using models trained during the first part of an experiment to maintain ids throughout the rest of it.)

      Editors' note: None of the original reviewers responded to our request to re-review the manuscript. The attached assessment statement is the editor's best attempt at assessing the extent to which the authors addressed the outstanding concerns from the previous round of revisions.

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to uncover molecular and structural details underlying the broad substrate specificity of glycosaminoglycan lyases belonging to a specific family (PL35). They determined the crystal structures of two such enzymes, conducted in vitro enzyme activity assays, and a thorough structure-guided mutagenesis campaign to interrogate the role of specific residues. They made progress towards achieving their aims and I appreciate the attempt of the authors to address my initial comments on the paper.

      Impact on the field:

      I expect this work will have limited impact on the field, although it does stand on its own as a solid piece of structure-function analysis.

      Strengths:

      The major strengths of the study were the combination of structure and enzyme activity assays, comprehensive structural analysis, as well as a thorough structure-guided mutagenesis campaign.

      Weaknesses:

      (Before revision) -the authors claim to have done a ICP-MS experiment to show Mn2+ binds to their enzyme, but did not present the data. The authors could have used the anomalous scattering properties of Mn2+ at the synchrotron to determine the presence and location of this cation (i.e. fluorescence spectra, and/or anomalous data collection at the Mn2+ absorption peak).<br /> *comment after revision: I appreciate that the authors included this data now, and it looks fine.

      (Before revision) -the authors have an over-reliance on molecular docking for understanding the position of substrates bound to the enzyme. The docking analysis performed was cursory at best; Autodock Vina is a fine program but more rigorous software could have been chosen, as well we molecular dynamics simulations. As well the authors do not use any substrate/product-bound structures from the broader PL enzyme family to guide the placement of the substrates in the GAGases, and interpret the molecular docking models.<br /> *comment after revision: the authors used another docking program, which is fine, but did not do any MD analysis or comment on why not. Also maybe it is just me but I still do not see a figure explicitly showing an overlay/superposition of the docking results with crystal structures of similar enzymes with similar ligands. The authors do have a statement in this regard but I believe a figure (e.g. an additional panel on S2) would be very helpful to the reader.

      (Before revision)-the conclusion that the structures of GAGase II and VII are most similar to the structures of alginate lyases (Table 2 data), and the authors' reliance on DALI, are both questioned. DALI uses a global alignment algorithm, which when used for multi-domain enzymes such as these tends to result in sub-optimal alignment of active site residues, particularly if the active site is formed between the two domains as is the case here. The authors should evaluate local alignment methods focused on optimization of the superposition of a single domain; these methods may result in a more appropriate alignment of the active site residues, and different alignment statistics. This may influence the overall conclusion of the evolutionary history of these PL35 enzymes.<br /> *comment after revision: I'm not sure the authors understood my suggestion as the reply reiterates the original conclusions. I suggest local structural alignment of *only* the toroid and antiparallel β-sheet domains, not global alignment of both domains, as this would improve the accuracy of the structural similarity conclusions.

      (Before revision)-the data on the GAGase III residue His188 is not well interpreted; substitution of this residue clearly impacts HA and HS hydrolysis as well. The data on the impact on alginate hydrolysis is weak, which could be due to the fact that the WT enzyme has poor activity against alginate to start with.<br /> *comment after revision: I appreciate that the authors used higher amounts of H188A variants and still do not see activity on alginate, which strengthens the conclusions regarding this substrate. However this variant also has decreased activity against HS (Figure 5C) and thus H188 appears to be important for more substrates than just alginate. The discussion section should be updated accordingly.

      (Before revision)-the authors did not use the words "homology", "homologous", or "homolog" correctly (these terms mean the subjects have a known evolutionary relationship, which may or may not be known in the contexts the authors used these targets); the words "similarity" and "similar" are recommended to be used instead.<br /> *comment after revision: I thank the authors for addressing this.

      (Before revision)-the authors discuss a "shorter" cavity in GAGases, which does not make sense, and is not supported by any figure or analysis. I recommend a figure with a surface representation of the various enzymes of interest, with dimensions of the cavity labeled (as a supplemental figure). The authors also do not specifically define what subsites are in the context of this family of enzymes, nor do they specifically label or indicate the location of the subsites on the figures of the GAGase II and IV enzyme structures.<br /> *comment after revision: I thank the authors for improving their figures and text description on this point.

    2. Reviewer #3 (Public review):

      Summary:

      The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

      Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

      Strengths:

      The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

      Weaknesses:

      The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript under review investigates the role of periosteal stem cells (P-SSC) in bone marrow regeneration using a whole bone subcutaneous transplantation model. While the model is somewhat artificial, the findings were interesting, suggesting the migration of periosteal stem cells into the bone marrow and their potential to become bone marrow stromal cells. This indicates a significant plasticity of P-SSC consistent with previous reports using fracture models (Cell Stem Cell 29:1547, Dev Cell 59:1192).

      Major comments from previous round of review:

      (1) The authors assert that the periosteal layer was completely removed in their model, which is crucial for their conclusions. To substantiate this claim, it is recommended that the authors provide evidence of the successful removal of the entire periosteal stem cell (P-SSC) population. A colony-forming assay, with and without periosteal removal, could serve as a suitable method to demonstrate this.

      (2) The observation that P-SSCs do not express Kitl or Cxcl12, while their bone marrow stromal cell (BM-MSC) derivatives do, is a key finding. To strengthen this conclusion, the authors are encouraged to repeat the experiment using Cxcl12 or Scf reporter alleles. Immunofluorescence staining that confirms the migration of periosteal cells and their transformation into Cxcl12- or Scf-reporter-positive cells would significantly enhance the paper's key conclusion.

      (3) On page 8, line 20, the authors' statement regarding the detection of Periostin+ cells outside the periosteum layer could be misinterpreted due to the use of the periostin antibody. Given that periostin is an extracellular matrix protein, the staining may not accurately represent Periostin-expressing cells but rather the presence of periostin in the extracellular matrix. The authors should revise this section for greater precision.

      Comments on revised version:

      My comments from the previous round of review have mostly been addressed.

    2. Reviewer #2 (Public review):

      Summary:

      The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

      Strengths:

      These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

      Weaknesses:

      There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

      Comments on the current version: The authors have addressed my concerns adequately

    1. Reviewer #1 (Public review):

      In this study, Tiang et al. explore the role of ubiquitination of non-structural protein 16 (nsp16) in the SARS-CoV-2 life cycle. nsp16, in conjunction with nsp10, performs the final step of viral mRNA capping through its 2'-O-methylase activity. This modification allows the virus to evade host immune responses and protects its mRNA from degradation. The authors demonstrate that nsp16 undergoes ubiquitination and subsequent degradation by the host E3 ubiquitin ligases UBR5 and MARCHF7 via the ubiquitin-proteasome system (UPS). Specifically, UBR5 and MARCHF7 mediate nsp16 degradation through K48- and K27-linked ubiquitination, respectively. Notably, degradation of nsp16 by either UBR5 or MARCHF7 operates independently, with both mechanisms effectively inhibiting SARS-CoV-2 replication in vitro and in vivo. Furthermore, UBR5 and MARCHF7 exhibit broad-spectrum antiviral activity by targeting nsp16 variants from various SARS-CoV-2 strains. This research advances our understanding of how nsp16 ubiquitination impacts viral replication and highlights potential targets for developing broadly effective antiviral therapies.

      Strengths:

      The proposed study is of significant interest to the virology community because it aims to elucidate the biological role of ubiquitination in coronavirus proteins and its impact on the viral life cycle. Understanding these mechanisms will address broadly applicable questions about coronavirus biology and enhance our overall knowledge of ubiquitination's diverse functions in cell biology. Employing in vivo studies is a strength.

      Weaknesses:

      Minor comments:<br /> Figure 5A- The authors should ensure that the figure is properly labeled to clearly distinguish between the IP (Immunoprecipitation) panel and the input panel.

    2. Reviewer #3 (Public review):

      Summary:

      The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

      Strengths:

      The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

      Comments on revisions:

      I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

    1. Reviewer #1 (Public review):

      Summary:

      The authors investigated causal inference in the visual domain through a set of carefully designed experiments, and sound statistical analysis. They suggest the early visual system has a crucial contribution to computations supporting causal inference.

      Strengths:

      (1) I believe the authors target an important problem (causal inference) with carefully chosen tools and methods. Their analysis rightly implies the specialization of visual routines for causal inference and the crucial contribution of early visual systems to perform this computation. I believe this is a novel contribution and their data and analysis are in the right direction.<br /> (2) Authors sufficiently discuss the alternative perspective to causal inference.<br /> (3) The authors also expand the discussions beyond pure psychophysics and also include neural aspects.

      Weaknesses:

      I would not call them weaknesses, perhaps a different perspective:

      (1) Authors arguing pro a mere bottom-up contribution of early sensory areas for causal inference. Certainly, as the authors suggested, early sensory areas have a crucial contribution, and the authors expand it to other possibilities in their discussion (but more for more complex scenario). It would say, even in simple cases, we can still consider the effect of top down processes. This particularly makes sense in light of recent studies. These studies progressively suggest perception as an active process that also weighs in strongly, the top-down cognitive contributions. For instance, the most simple cases of perception have been conceptualized along this line (Martin, Solms, and Sterzer 2021) and even some visual illusions (Safavi and Dayan 2022), and other extensions (Kay et al. 2023). Thus, I believe it would be helpful to extend the discussion on the top-down and cognitive contributions of causal inference (of course that can also be hinted at, based on recent developments). Even adaptation, which is central in this study, can be influenced by top-down factors (Keller et al. 2017).

      Lastly, I hope the authors find this review helpful. I generally want to try to end all of my reviews with areas of the paper I liked because I think this should be part of the feedback. Certainly, there were many in this manuscript as well (clever questions, experimental design and statistical analysis) that I had to highlight further. I congratulate the authors again on their manuscript and hope they will find it helpful.

      Bibliography

      Aller, Mate, and Uta Noppeney. 2018. "To Integrate or Not to Integrate: Temporal Dynamics of Bayesian Causal Inference." Biorxiv, December, 504118. .

      Cao, Yinan, Christopher Summerfield, Hame Park, Bruno Lucio Giordano, and Christoph Kayser. 2019. "Causal Inference in the Multisensory Brain." Neuron 102 (5): 1076-87.e8. .

      Coen, Philip, Timothy P. H. Sit, Miles J. Wells, Matteo Carandini, and Kenneth D. Harris. 2021. "The Role of Frontal Cortex in Multisensory Decisions." Biorxiv, April. Cold Spring Harbor Laboratory, 2021.04.26.441250. .

      Kay, Kendrick, Kathryn Bonnen, Rachel N. Denison, Mike J. Arcaro, and David L. Barack. 2023. "Tasks and Their Role in Visual Neuroscience." Neuron 111 (11). Elsevier: 1697-1713. .

      Keller, Andreas J, Rachael Houlton, Björn M Kampa, Nicholas A Lesica, Thomas D Mrsic-Flogel, Georg B Keller, and Fritjof Helmchen. 2017. "Stimulus Relevance Modulates Contrast Adaptation in Visual Cortex." Elife 6. eLife Sciences Publications, Ltd: e21589.

      Kording, K. P., U. Beierholm, W. J. Ma, S. Quartz, J. B. Tenenbaum, and L. Shams. 2007. "Causal Inference in Multisensory Perception." PloS One 2: e943. .

      Martin, Joshua M., Mark Solms, and Philipp Sterzer. 2021. "Useful Misrepresentation: Perception as Embodied Proactive Inference." Trends Neurosci. 44 (8): 619-28. .

      Safavi, Shervin, and Peter Dayan. 2022. "Multistability, Perceptual Value, and Internal Foraging." Neuron, August. .

      Shams, L. 2012. "Early Integration and Bayesian Causal Inference in Multisensory Perception." In The Neural Bases of Multisensory Processes, edited by M. M. Murray and M. T. Wallace. Frontiers in Neuroscience. Boca Raton (FL).

      Shams, Ladan, and Ulrik Beierholm. 2022. "Bayesian Causal Inference: A Unifying Neuroscience Theory." Neuroscience & Biobehavioral Reviews 137 (June): 104619.

    2. Reviewer #2 (Public review):

      This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

      The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

      The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

      The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

      The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

      The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

      One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

      In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

      Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

      Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

      Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

    3. Reviewer #3 (Public review):

      Summary:

      This paper presents evidence from three behavioral experiments that causal impressions of "launching events", in which one object is perceived to cause another object to move, depend on motion direction-selective processing. Specifically, the work uses an adaptation paradigm (Rolfs et al., 2013), presenting repetitive patterns of events matching certain features to a single retinal location, then measuring subsequent perceptual reports of a test display in which the degree of overlap between two discs was varied, and participants could respond "launch" or "pass". The three experiments report results of adapting to motion direction, motion speed and "object identity", and examine how the psychometric curves for causal reports shift in these conditions depending on the similarity of adapter and test. While causality reports in the test display were selective for motion direction (Experiment 1), they were not selective for adapter-test speed differences (Experiment 2) nor for changes in object identity induced via color swap (Experiment 3). These results support the notion of a biological implementation of causality perception in the visual system, possibly even independently of computations of object identity.

      Strengths:

      The setup of the research question and hypotheses are exceptional. The authors thoroughly discuss relevant literature to clearly link their launch/pass paradigm to impressions of causality, strengthening their hypothesis and conclusions. The experiments are carefully performed (appropriate equipment, careful control of eye movements). The slip adaptor is a really nice control condition and effectively mitigates the need to control for motion direction with a drifting grating or similar. Participants were measured with sufficient precision, and a power curve analysis was conducted to determine the sample size. Data analysis and statistical quantification is appropriate. Data and analysis code will be shared on publication, in keeping with open science principles. The paper is concise and well written.

      Weaknesses:

      I would like to emphasise that in the employed paradigm and previously conducted similar study, the only report options are "launch" or "pass". As pointed out by the authors' reply, the adaptation to launches seems to be a highly specific process and likely is a consequence of the causal interaction between the objects. I would nonetheless be interested to see which of the stimulus features driving the adaptation effect observed here are relevant/irrelevant to subjective causal impressions in an experiment.

      References:

      Rolfs, M., Dambacher, M., & Cavanagh, P. (2013). Visual Adaptation of the Perception of Causality. Current Biology, 23(3), 250-254. https://doi.org/10.1016/j.cub.2012.12.017

    1. Reviewer #1 (Public review):

      Summary:

      Machii et al. reported a possible molecular mechanism underlying the parallel evolution of lip hypertrophy in African cichlids. The multifaceted approach taken in this manuscript is highly valued, as it uses histology, proteomics, and transcriptomics to reveal how phylogenetically distinct thick-lips have evolved in parallel. Findings from histology and proteomics connected to wnt signaling through the transcriptome are very exciting.

      Strengths:

      There is consistency between the results and it is possible to make a strong argument from the results.

      Comments on revised version:

      The issues I pointed out in the previous review have been carefully answered, and all issues have been addressed. The main points of the manuscript are clear, and the conclusions are easy to understand. The enlarged lips are a notable example of convergent evolution in African cichlids.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript focuses on the olfactory system of Pieris brassicae larvae and the importance of olfactory information in their interactions with the host plant Brassica oleracea and the major parasitic wasp Cotesia glomerata. The authors used CRISPR/Cas9 to knockout odorant receptor co-receptors (Orco), and conducted a comparative study on the behavior and olfactory system of the mutant and wild-type larvae. The study found that Orco-expressing olfactory sensory neurons in antennae and maxillary palps of Orco knockout (KO) larvae disappeared, and the number of glomeruli in the brain decreased, which impairs the olfactory detection and primary processing in the brain. Orco KO caterpillars show weight loss and loss of preference for optimal food plants; KO larvae also lost weight when attacked by parasitoids with the ovipositor removed, and mortality increased when attacked by untreated parasitoids. On this basis, the authors further studied the responses of caterpillars to volatiles from plants attacked by the larvae of the same species and volatiles from plants on which the caterpillars were themselves attacked by parasitic wasps. Lack of OR-mediated olfactory inputs prevents caterpillars from finding suitable food sources and from choosing spaces free of enemies.

      Strengths:

      The findings help to understand the important role of olfaction in caterpillar feeding and predator avoidance, highlighting the importance of odorant receptor genes in shaping ecological interactions.

      Weaknesses:

      There are the following major concerns:

      (1) Possible non-targeted effects of Orco knockout using CRISPR/Cas9 should be analyzed and evaluated in Materials and Methods and Results.

      (2) Figure 1E: Only one olfactory receptor neuron was marked in WT. There are at least three olfactory sensilla at the top of the maxillary palp. Therefore, to explain the loss of Orco-expressing neurons in the mutant (Figure 1F), a more rigorous explanation of the photo is required.

      (3) In Figure 1G, H, the four glomeruli are circled by dotted lines: their corresponding relationship between the two figures needs to be further clarified.

      (4) Line 130: Since the main topic in this study is the olfactory system of larvae, the experimental results of this part are all about antennal electrophysiological responses, mating frequency, and egg production of female and male adults of wild type and Orco KO mutant, it may be considered to include this part in the supplementary files. It is better to include some data about the olfactory responses of larvae.

      (5) Line 166: The sentences in the text are about the choice test between " healthy plant vs. infested plant", while in Fig 3C, it is "infested plant vs. no plant". The content in the text does not match the figure.

      (6) Lines 174-178: Figure 3A showed that the body weight of Orco KO larvae in the absence of parasitic wasps also decreased compared with that of WT. Therefore, in the experiments of Figure 3A and E, the difference in the body weight of Orco KO larvae in the presence or absence of parasitic wasps without ovipositors should also be compared. The current data cannot determine the reduced weight of KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (7) Lines 179-181: Figure 3F shows that the survival rate of larvae of Orco KO mutant decreased in the presence of parasitic wasps, and the difference in survival rate of larvae of WT and Orco KO mutant in the absence of parasitic wasps should also be compared. The current data cannot determine whether the reduced survival of the KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (8) In Figure 4B, why do the compounds tested have no volatiles derived from plants? Cruciferous plants have the well-known mustard bomb. In the behavioral experiments, the larvae responses to ITC compounds were not included, which is suggested to be explained in the discussion section.

      (9) The custom-made setup and the relevant behavioral experiments in Figure 4C need to be described in detail (Line 545).

      (10) Materials and Methods Line 448: 10 μL paraffin oil should be used for negative control.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #1 (Public review):

      The study introduces an open-source, cost-effective method for automating the quantification of male social behaviors in Drosophila melanogaster. It combines machine-learning-based behavioral classifiers developed using JAABA (Janelia Automatic Animal Behavior Annotator) with inexpensive hardware constructed from off-the-shelf components. This approach addresses the limitations of existing methods, which often require expensive hardware and specialized setups. The authors demonstrate that their new "DANCE" classifiers accurately identify aggression (lunges) and courtship behaviors (wing extension, following, circling, attempted copulation, and copulation), closely matching manually annotated ground-truth data. Furthermore, DANCE classifiers outperform existing rule-based methods in accuracy. Finally, the study shows that DANCE classifiers perform as well when used with low-cost experimental hardware as with standard experimental setups across multiple paradigms, including RNAi knockdown of the neuropeptide Dsk and optogenetic silencing of dopaminergic neurons.

      The authors make creative use of existing resources and technology to develop an inexpensive, flexible, and robust experimental tool for the quantitative analysis of Drosophila behavior. A key strength of this work is the thorough benchmarking of both the behavioral classifiers and the experimental hardware against existing methods. In particular, the direct comparison of their low-cost experimental system with established systems across different experimental paradigms is compelling. While JAABA-based classifiers have been previously used to analyze aggression and courtship (Tao et al., J. Neurosci., 2024; Sten et al., Cell, 2023; Chiu et al., Cell, 2021; Isshi et al., eLife, 2020; Duistermars et al., Neuron, 2018), the demonstration that they work as well without expensive experimental hardware opens the door to more low-cost systems for quantitative behavior analysis.

      Although the study provides a detailed evaluation of DANCE classifier performance, its conclusions would be strengthened by a more comprehensive analysis. The authors assess classifier accuracy using a bout-level comparison rather than a frame-level analysis, as employed in previous studies (Kabra et al., Nat Methods, 2013). They define a true positive as any instance where a DANCE-detected bout overlaps with a manually annotated ground-truth bout by at least one frame. This criterion may inflate true positive rates and underestimate false positives, particularly for longer-duration courtship behaviors. For example, a 15-second DANCE-classified wing extension bout that overlaps with ground truth for only one frame would still be considered a true positive. A frame-level analysis performance would help address this possibility.

      In summary, this work provides a practical and accessible approach to quantifying Drosophila behavior, reducing the economic barriers to the study of the neural and molecular mechanisms underlying social behavior.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    3. Reviewer #3 (Public review):

      The preprint by Yadav et al. describes a new setup to quantify a number of aggression and mating behaviors in Drosophila melanogaster. The investigation of these behaviors requires the analysis of a large number of videos to identify each kind of behavior displayed by a fly. Several approaches to automatize this process have been published before, but each of them has its limitations. The authors set out to develop a new setup that includes very low-cost, easy-to-acquire hardware and open-source machine-learning classifiers to identify and quantify the behavior.

      Strengths:

      (1) The study demonstrates that their cheap, simple, and easy-to-obtain hardware works just as well as custom-made, specialized hardware for analyzing aggression and mating behavior. This enables the setup to be used in a wide range of settings, from research with limited resources to classroom teaching.

      (2) The authors used previously published software to train new classifiers for detecting a range of behaviors related to aggression and mating and to make them freely available. The classifiers are very positively benchmarked against a manually acquired ground truth as well as existing algorithms.

      (3) The study demonstrates the applicability of the setup (hardware and classifiers) to common methods in the field by confirming a number of expected phenotypes with their setup.

      Weaknesses:

      (1) When measuring the performance of the duration-based classifiers, the authors count any bout of behavior as true positive if it overlaps with a ground-truth positive for only 1 frame - despite the minimal duration of a bout is 10 frames, and most bouts are much longer. That way, true positives could contain cases that are almost totally wrong as long there was an overlap of a single frame. For the mating behaviors that are classified in ongoing bouts, I think performance should be evaluated based on the % of correctly classified frames, not bouts.

      (2) In the methods part, only one of the pre-existing algorithms (MateBook), is described. Given that the comparison with those algorithms is a so central part of the manuscript, each of them should be briefly explained and the settings used in this study should be described.

      Taken together, this work can greatly facilitate research on aggression and mating in Drosophila. The combination of low-cost, off-the-shelf hardware and open-source, robust software enables researchers with very little funding or technical expertise to contribute to the scientific process and also allows large-scale experiments, for example in classroom teaching with many students, or for systematic screenings.

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    2. Reviewer #1 (Public Review):

      Summary:

      In this manuscript, Quach et al. report a detailed investigation into the defense mechanisms of Caenorhabditis elegans in response to predatory threats from Pristionchus pacificus. Based on principles from predatory imminence and prey refuge theories, the authors delineate three defense modes (pre-encounter, post-encounter, and circa-strike) corresponding to increasing levels of threat proximity. These modes are observed in a controlled but naturalistic setup and are quantified by multiple behavioral outputs defined in time and/or space domains allowing nuanced phenotypic assays. The authors demonstrate that C. elegans displays graded defense behavioral responses toward varied lethality of threats and that only life-threatening predators trigger all three defense modes. The study also offers a narrative on the behavioral strategies and underlying molecular regulation, focusing on the roles of SEB-3 receptors and NLP-49 peptides in mediating responses in these defense modes. They found that the interplay between SEB-3 and NLP-49 peptides appears complex, as evidenced by the diverse outcomes when either or both genes are manipulated in various behavioral modes.

      Strengths:

      The paper presents an interesting story, with carefully designed experiments and necessary controls, and novel findings and implications about predator-induced defensive behaviors and underlying molecular regulation in this important model organism. The design of experiments and description of findings are easy to follow and well-motivated. The findings contribute to our understanding of stress response systems and offer broader implications for neuroethological studies across species.

      Weaknesses:

      Although overall the study is well designed and movitated, the paper could benefit from further improvements on some of the methods descriptions and experiment interpretations.

    1. Reviewer #1 (Public review):

      Summary:

      This paper describes molecular dynamics simulations (MDS) of the dynamics of two T-cell receptors (TCRs) bound to the same major histocompatibility complex molecule loaded with the same peptide (pMHC). The two TCRs (A6 and B7) bind to the pMHC with similar affinity and kinetics, but employ different residue contacts. The main purpose of the study is to quantify via MDS the differences in the inter- and intra-molecular motions of these complexes, with a specific focus on what the authors describe as catch-bond behavior between the TCRs and pMHC, which could explain how T-cells can discriminate between different peptides in the presence of weak separating force.

      Strengths:

      The authors present extensive simulation data that indicates that, in both complexes, the number of high-occupancy inter-domain contacts initially increases with applied load, which is generally consistent with the authors' conclusion that both complexes exhibit catch-bond behavior, although to different extents. In this way, the paper expands our understanding of peptide discrimination by T-cells. The conclusions of the study are generally well supported by data. Further, the paper makes predictions about the relative strength of the catch-bond response of the two TCRs, which could be tested experimentally through protein mutagenesis and force application in Atomic Force Microscopy.

    2. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    3. Reviewer #3 (Public review):

      Summary:

      The paper by Chang-Gonzalez et al. is a molecular dynamics (MD) simulation study of the dynamic recognition (load-induced catch bond) by the T cell receptor (TCR) of the complex of peptide antigen (p) and the major histocompatibility complex (pMHC) protein. The methods and simulation protocols are essentially identical as those employed in a previous study by the same group (Chang-Gonzalez et al., eLife 2024). In the current manuscript the authors compare the binding of the same pMHC complex to two different TCRs, B7 and A6 which was investigated in the previous paper. While the binding is more stable for both TCRs under load (of about 10-15 pN) than in the absence of load, the main difference is that B7 shows a smaller amount of stable contacts with the pMHC than A6.

      Strengths:

      The topic is interesting because of the relevance of mechanosensing in biological processes including cellular immunology. The MD simulations provide strong evidence that different TCRs can respond mechanically in a different way upon binding the same pMHC complex. These findings are useful for interpreting how mechanical force is employed for modulating different function of T cells.

    1. Joint public review

      Summary:

      The authors examine the eigenvalue spectrum of the covariance matrix of neural recordings in the whole-brain larval zebrafish during hunting and spontaneous behavior. They find that the spectrum is approximately power law, and, more importantly, exhibits scale-invariance under random subsampling of neurons. This property is not exhibited by conventional models of covariance spectra, motivating the introduction of the Euclidean random matrix model. The authors show that this tractable model captures the scale invariance they observe. They also examine the effects of subsampling based on anatomical location or functional relationships. Finally, they discuss the benefit of neural codes which can be subsampled without significant loss of information.

      Strengths:

      With large-scale neural recordings becoming increasingly common, neuroscientists are faced with the question: how should we analyze them? To address that question, this paper proposes the Euclidean random matrix model, which embeds neurons randomly in an abstract feature space. This model is analytically tractable and matches two nontrivial features of the covariance matrix: approximate power law scaling, and invariance under subsampling. It thus introduces an important conceptual and technical advance for understanding large-scale simultaneously recorded neural activity.

      Comment:

      Are there quantitative comparisons of the collapse indices for the null models in Figure 2 and the data covariance in 2F? If so, this could be potentially useful to report.

    1. Reviewer #1 (Public review):

      Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

      The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents certain weaknesses that could be improved. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice.

      Comments on revised version:

      Some of the recommendations provided by this Reviewer in the first version of the manuscript have been successfully addressed in the revision. However, others, particularly those related to human translation, remain unresolved due to the lack of additional samples for analysis. Since the revised title now indicates that the mechanisms described were primarily observed in mice, it seems reasonable to defer addressing this issue to future studies.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #1 (Public review):

      Summary:

      This paper explores how diverse forms of inhibition impact firing rates in models for cortical circuits. In particular, the paper studies how the network operating point affects the balance of direct inhibition from SOM inhibitory neurons to pyramidal cells, and disinhibition from SOM inhibitory input to PV inhibitory neurons. This is an important issue as these two inhibitory pathways have largely been studies in isolation. A combination of analytical calculations and direct numerical simulations provide convincing evidence that the interplay of these inhibitory circuits can separately control network gain and stability.

      Strengths

      The paper has improved in revision, and the intuitive summary statements added to the end of each results section are quite helpful. The addition of numerical simulations to extend the conclusions beyond the linear range of network behavior are also quite helpful.

      Weaknesses

      None

    2. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    3. Reviewer #3 (Public review):

      Summary:

      Bos et al study a computational model of cortical circuits with excitatory (E) and two subtypes of inhibition - parvalbumin (PV) and somatostatin (SOM) expressing interneurons. They perform stability and gain analysis of simplified models with nonlinear transfer functions when SOM neurons are perturbed. Their analysis suggests that in a specific setup of connectivity, instability and gain can be untangled, such that SOM modulation leads to both increase in stability and gain, in contrast to the typical direction in neuronal networks where increased gain results in decreased stability.

      Strengths:

      - Analysis of the canonical circuit in response to SOM perturbations. Through numerical simulations and mathematical analysis, the authors have provided a rather comprehensive picture of how SOM modulation may affect response changes.<br /> - Shedding light on two opposing circuit motifs involved in the canonical E-PV-SOM circuitry - namely, direct inhibition (SOM -> E) vs disinhibition (SOM -> PV -> E). These two pathways can lead to opposing effects, and it is often difficult to predict which one results from modulating SOM neurons. In simplified circuits, the authors show how these two motifs can emerge and depend on parameters like connection weights.<br /> - Suggesting potentially interesting consequences for cortical computation. The authors suggest that certain regimes of connectivity may lead to untangling of stability and gain, such that increases in network gain are not compromised by decreasing stability. They also link SOM modulation in different connectivity regimes to versatile computations in visual processing in simple models.

      Weaknesses:

      - Computationally, the analysis is solid, but it's very similar to previous studies (del Molino et al, 2017). Many studies in the past few years have done the perturbation analysis of a similar circuitry with or without nonlinear transfer functions (some of them listed in the references). This study applies the same framework to SOM perturbations, which is a useful computational analysis, in view of the complexity of the high-dimensional parameter space.<br /> - A general weakness of the paper is a lack of direct comparison to biological parameters or experiments. How different experiments can be reconciled by the results obtained here, and what new circuit mechanisms can be revealed? In its current form, the paper reads as a general suggestion that different combinations of gain modulation and stability can be achieved in a circuit model equipped with many parameters (12 parameters). This is potentially interesting but not surprising, given the high dimensional space of possible dynamical properties. A more interesting result would have been to relate this to biology, by providing reasoning why it might be relevant to certain circuits (and not others), or to provide some predictions or postdictions, which are currently not very strong in the manuscript.<br /> - Tuning curves are simulated for an individual orientation (same for all neurons), not considering the heterogeneity of neuronal networks with multiple orientation selectivity (and other visual features) - making the model too simplistic.

    1. Reviewer #1 (Public review):

      Summary:

      In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift diffusion model, they further find that the best fitting model has different attentional discounts on the taste and health attributes, and that the attentional discount on the health information was larger for the hungry participants.

      Strengths:

      The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 8 different variants of the DDM, including recent models like the maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

      Weaknesses:

      While I do appreciate the within-participant design, it does raise a small concern about potential demand effects. The authors' results would have been more compelling if they had replicated when only analyzing the first session from each participant. However, the authors did demonstrate that there was no effect of order on the results, which helps to alleviate this concern.

    2. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.

    3. Reviewer #3 (Public review):

      Summary:

      This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry, and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

      Strengths:

      This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

      The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

      In summary the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

      Weaknesses:

      Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

      On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

      On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) to consuming a drink versus nothing, or (c) both.

      Comments on revisions:

      The authors addressed all my comments appropriately and I have no further requests. Thank you for the added discussion of findings and extra analyses.

    1. Reviewer #1 (Public Review):

      The authors recorded from multiple mossy cells (MCs) of the dentate gyrus in slices or in vivo using anesthesia. They recorded MC spontaneous activity during spontaneous sharp waves (SWs) detected in area CA3 (in vitro) or in CA1 ( in vivo). They find variability of the depolarization of MCs in response to a SW. They then used deep learning to parse out more information. They conclude that CA3 sends different "information" to different MCs. However, this is not surprising because different CA3 neurons project to different MCs and it was not determined if every SW reflected the same or different subsets of CA3 activity.

      The strengths include recording up to 5 MCs at a time. The major concerns are in the finding that there is variability. This seems logical, not surprising. Also it is not clear how deep learning could lead to the conclusion that CA3 sends different "information" to different MCs. It seems already known from the anatomy because CA3 neurons have diverse axons so they do not converge on only one or a few MCs. Instead they project to different MCs. Even if they would, there are different numbers of boutons and different placement of boutons on the MC dendrites, leading to different effects on MCs. There also is a complex circuitry that is not taken into account in the discussion or in the model used for deep learning. CA3 does not only project to MCs. It also projects to hilar and other dentate gyrus GABAergic neurons which have complex connections to each other, MCs, and CA3. Furthermore, MCs project to MCs, the GABAergic neurons, and CA3. Therefore at any one time that a SW occurs, a very complex circuitry is affected and this could have very different effects on MCs so they would vary in response to the SW. This is further complicated by use of slices where different parts of the circuit are transected from slice to slice.

      It is also not discussed if SWs have a uniform frequency during the recording session. If they cluster, or if MC action potentials occur just before a SW, or other neurons discharge before, it will affect the response of the MC to the SW. If MC membrane potential varies, this will also effect the depolarization in response to the SW.

      In vivo, the SWs may be quite different than in vivo but this is not discussed. The circuitry is quite different from in vitro. The effects of urethane could have many confounding influences.

      Furthermore, how much the in vitro and in vivo SWs tell us about SWs in awake behaving mice is unclear.

      Also, methods and figures are hard to understand.

    2. Reviewer #2 (Public Review):

      • A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

      • An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

      Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

      • An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

      • A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

    3. Reviewer #3 (Public Review):

      Compared to the pyramidal cells of the CA1 and CA3 regions of the hippocampus, and the granule cells of the dentate gyrus (DG), the computational role(s) of mossy cells of the DG have received much less attention over the years and are consequently not well understood. Mossy cells receive feedforward input from granule cells and feedback from CA3 cells. One significant factor is the compression of the large number of CA3 cells that input onto a much smaller population of mossy cells, which then send feedback connections to the granule cell layer. The present paper seeks to understand this compression in terms of neural coding, and asks whether the subthreshold activity of a small number of mossy cells can predict above chance levels the shapes of individual SWs produced by the CA3 cells. Using elegant multielectrode intracellular recordings of mossy cells, the authors use deep learning networks to show that they can train the network to "predict" the shape of a SW that preceded the intracellular activity of the mossy cells. Putatively, a single mossy cell can predict the shape of SWs above chance. These results are interesting, but there are some conceptual issues and questions about the statistical tests that must be addressed before the results can be considered convincing.

      Strengths<br /> (1) The paper uses technically challenging techniques to record from multiple mossy cells at the same time, while also recording SWs from the LFP of the CA3 layer. The data appear to be collected carefully and analyzed thoughtfully.<br /> (2) The question of how mossy cells process feedback input from CA3 is important to understand the role of this feedback pathway in hippocampal processing.<br /> (3) Given the concerns expressed below about proper statistical testing are resolved, the data appear supportive of the main conclusions of the authors and suggest that, to some degree, the much smaller population of mossy cells can conserve the information present in the larger population of CA3 cells, presumably by using a more compressed, dense population code.

      Weaknesses<br /> (4) Some of the statistical tests appear inappropriate because they treat each CA3 SW and associated Vm from a mossy cell as independent samples. This violates the assumptions of statistical tests such as the Kolmogorov-Smirnov tests of Figure 3C and Fig 3E. Although there is large variability among the SWs recorded and among the Vm's, they cannot be considered independent measurements if they derive from the same cell and same recording site of an individual animal. This becomes especially problematic when the number of dependent samples adds up to the tens of thousands, providing highly inflated numbers of samples that artificially reduce the p values. Techniques such as mixed-effects models are being increasingly used to factor out the effects of within cell and within animal correlations in the data. The authors need to do something similar to factor out these contributions in order to perform statistical tests, throughout the manuscript when this problem occurs.<br /> (5) A separate statistical problem occurs when comparing real data against a shuffled, surrogate data set. From the methods, I gather that Figure 3C combined data from 100 surrogate shuffles to compare to the real data. It is inappropriate to do a classic statistical test of data against such shuffles, because the number of points in the pooled surrogate data sets are not true samples from a population. It is a mathematical certainty that one can eventually drive a p value to < 0.05 just by increasing the number of shuffles sufficiently. Thus, the p value is determined by the number of computer shuffles allowed by the time and processing power of a computer, rather than by sampling real data from the population. Figures such as 4C and 5A are examples that test data against shuffle appropriately, as a single value is determined to be within or outside the 95% confidence interval of the shuffle, and this determination is not directly affected by the number of shuffles performed.<br /> (6) The last line of the Discussion states that this study provides "important insights into the information processing of neural circuits at the bottleneck layer," but it is not clear what these insights are. If the statistical problems are addressed appropriately, then the results do demonstrate that the information that is reflected in SWs can be reconstructed by cells in the MC bottleneck, but it is not certain what conceptual insights the authors have in mind. They should discuss more how these results further our understanding of the function of the feedback connection from CA3 to the mossy cells, discuss any limitations on their interpretation from recording LFPs rather than the single-unit ensemble activity (where the information is really encoded).<br /> 7) In Figure 1C, the maximum of the MC response on the first inset precedes the SW, and the onset of the Vm response may be simultaneous with SW. This would suggest that the SW did not drive the mossy cell, but this was a coincident event. How many SW-mossy cell recordings are like this? Do the authors have a technical reason to believe that these are events in which the mossy cell is driven by the CA3 cells active during the SW?

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript described a structure-guided approach to graft important antigenic loops of the neuraminidase to a homotypic but heterologous NA. This approach allows the generation of well-expressed and thermostable recombinant proteins with antigenic epitopes of choice to some extent. The loop-grafted NA was designated hybrid.

      Strengths:

      The hybrid NA appeared to be more structurally stable than the loop-donor protein while acquiring its antigenicity. This approach is of value when developing a subunit NA vaccine which is difficult to express. So that antigenic loops could be potentially grafted to a stable NA scaffold to transfer strain-specific antigenicity.

      Weaknesses:

      However, major revisions to better organize the text, and figure and make clarifications on a number of points, are needed. There are a few cases in which a later figure was described first, data in the figures were not sufficiently described, or where there were mismatched references to figures.

      More importantly, the hybrid proteins did not show any of the advantages over the loop-donor protein in the format of VLP vaccine in mouse studies, so it's not clear why such an approach is needed to begin with if the original protein is doing fine.

    2. Reviewer #2 (Public review):

      In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

      Major points

      (1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

      (2) The rationale regarding the PR8 hybrid is not well described and should be described better.

      (3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

      (4) Figure 5A and 7A: Negative controls are missing.

      (5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Wu et al. introduce a novel approach to reactivate the Muller glia cell cycle in the mouse retina by simultaneously reducing p27Kip1 and increasing cyclin D1 using a single AAV vector. The approach effectively promotes Muller glia proliferation and reprogramming without disrupting retinal structure or function. Interestingly, reactivation of the Muller glia cell cycle downregulates IFN pathway, which may contribute to the induced retinal regeneration. The results presented in this manuscript may offer a promising approach for developing Müller glia cell-mediated regenerative therapies for retinal diseases.

      Comments on revisions:

      The authors have revised the manuscript and addressed my concerns.

    2. Reviewer #2 (Public review):

      This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

      The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

    1. Reviewer #1 (Public review):

      Summary:

      Mehmet Mahsum Kaplan et al. demonstrate that Meis2 expression in neural crest-derived mesenchymal cells is crucial for whisker follicle (WF) development, as WF fails to develop in wnt1-Cre;Meis2 cKO mice. Advanced imaging techniques effectively support the idea that Meis2 is essential for proper WF development and that nerves, while affected in Meis2 cKO, are dispensable for WF development and not the primary cause of WF developmental failure. The study also reveals that although Meis2 significantly downregulates Foxd1 in the mesenchyme, this is not the main reason for WF development failure. The paper presents valuable data on the role of mesenchymal Meis2 in WF development. However, it is still not known what is the molecular mechanisms that link Meis2 to impact the epithelial compartment.

      Strengths:

      (1) The authors describe a novel molecular mechanism involving Mesenchymal Meis2 expression, which plays a crucial role in early WF development.<br /> (2) They employ multiple advanced imaging techniques to illustrate their findings beautifully.<br /> (3) The study clearly shows that nerves are not essential for WF development.

      Weaknesses:

      The paper lacks clarity on how Meis2 loss, along with the observed general reduction in proliferation and changes in extracellular matrix and cell adhesion, leads specifically to the loss of whisker follicles. Future studies addressing this gap, perhaps with methods enabling higher cell recovery or epithelial cell inclusion in the sequenced cells, could provide valuable insights into the specific roles of Meis2 in this context.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

      Strengths:

      The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

      Comments on revised version:

      In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

      In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

      Additional comments:

      The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

    1. Reviewer #1 (Public Review):

      Summary:

      In this work, the authors present a novel, multi-layer computational model of motor control to produce realistic walking behaviour of a Drosophila model in the presence of external perturbations and under sensory and motor delays. The novelty of their model of motor control is that it is modular, with divisions inspired by the fly nervous system, with one component based on deep learning while the rest are based on control theory. They show that their model can produce realistic walking trajectories. Given the mostly reasonable assumptions of their model, they convincingly show that the sensory and motor delays present in the fly nervous system are the maximum allowable for robustness to unexpected perturbations.

      Their fly model outputs torque at each joint in the leg, and their dynamics model translates these into movements, resulting in time-series trajectories of joint angles. Inspired by the anatomy of the fly nervous system, their fly model is a modular architecture that separates motor control at three levels of abstraction:<br /> (1) oscillator-based model of coupling of phase angles between legs,<br /> (2) generation of future joint-angle trajectories based on the current state and inputs for each leg (the trajectory generator), and<br /> (3) closed-loop control of the joint-angles using torques applied at every joint in the model (control and dynamics).

      These three levels of abstraction ensure coordination between the legs, future predictions of desired joint angles, and corrections to deviations from desired joint-angle trajectories. The parameters of the model are tuned in the absence of external perturbations using experimental data of joint angles of a tethered fly. A notable disconnect from reality is that the dynamics model used does not model the movement of the body and ground contacts as is the case in natural walking, nor the movement of a ball for a tethered fly, but instead something like legs moving in the air for a tethered fly.

      In order to validate the realism of the generated simulated walking trajectories, the authors compare various attributes of simulated to real tethered fly trajectories and show qualitative and quantitative similarities, including using a novel metric coined as Kinematic Similarity (KS). The KS score of a trajectory is a measure of the likelihood that the trajectory belongs to the distribution of real trajectories estimated from the experimental data. While such a metric is a useful tool to validate the quality of simulated data, there is some room for improvement in the actual computation of this score. For instance, the KS score is computed for any given time-window of walking simulation using a fraction of information from the joint-angle trajectories. It is unclear if the remaining information in joint-angle trajectories that are not used in the computation of the KS score can be ignored in the context of validating the realism of simulated walking trajectories.

      The authors validate simulated walking trajectories generated by the trained model under a range of sensorimotor delays and external perturbations. The trained model is shown to generate realistic joint-angle trajectories in the presence of external perturbations as long as the sensorimotor delays are constrained within a certain range. This range of sensorimotor delays is shown to be comparable to experimental measurements of sensorimotor delays, leading to the conclusion that the fly nervous system is just fast enough to be robust to perturbations.

      Strengths:

      This work presents a novel framework to simulate Drosophila walking in the presence of external perturbations and sensorimotor delay. Although the model makes some simplifying assumptions, it has sufficient complexity to generate new, testable hypotheses regarding motor control in Drosophila. The authors provide evidence for realistic simulated walking trajectories by comparing simulated trajectories generated by their trained model with experimental data using a novel metric proposed by the authors. The model proposes a crucial role in future predictions to ensure robust walking trajectories against external perturbations and motor delay. Realistic simulations under a range of prediction intervals, perturbations, and motor delays generating realistic walking trajectories support this claim. The modular architecture of the framework provides opportunities to make testable predictions regarding motor control in Drosophila. The work can be of interest to the Drosophila community interested in digitally simulating realistic models of Drosophila locomotion behaviors, as well as to experimentalists in generating testable hypotheses for novel discoveries regarding neural control of locomotion in Drosophila. Moreover, the work can be of broad interest to neuroethologists, serving as a benchmark in modelling animal locomotion in general.

      Weaknesses:

      As the authors acknowledge in their work, the control and dynamics model makes some simplifying assumptions about Drosophila physics/physiology in the context of walking. For instance, the model does not incorporate ground contact forces and inertial effects of the fly's body. It is not clear how these simplifying assumptions would affect some of the quantitative results derived by the authors. The range of tolerable values of sensorimotor delays that generate realistic walking trajectories is shown to be comparable with sensorimotor delays inferred from physiological measurements. It is unclear if this comparison is meaningful in the context of the model's simplifying assumptions. The authors propose a novel metric coined as Kinematic Similarity (KS) to distinguish realistic walking trajectories from unrealistic walking trajectories. Defining such an objective metric to evaluate the model's predictions is a useful exercise, and could potentially be applied to benchmark other computational animal models that are proposed in the future. However, the KS score proposed in this work is calculated using only the first two PCA modes that cumulatively account for less than 50% of the variance in the joint angles. It is not obvious that the information in the remaining PCA modes may not change the log-likelihood that occurs in the real walking data.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    2. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    1. Reviewer #1 (Public review):

      The authors introduces DIPx, a deep learning framework for predicting synergistic drug combinations for cancer treatment using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset. While the approach is innovative, I have following concerns and comments, and hopefully will improve the study's rigor and applicability, making it a more powerful tool in real clinical world.

      (1) In the abstract: "We trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set, while Test Set 2 contained combinations absent from the training set, thus indicating the model's ability to handle novel combinations". Test Set 1 comprises combinations already present in the training set, likely leading overfitting issue. The model might show inflated performance metrics on this test set due to prior exposure to these combinations, not accurately reflecting its true predictive power on unknown data, which is crucial for discovering new drug synergies. The testing approach reduces the generalizability of the model's findings to new, untested scenarios.

      (2) The model struggles with predicting synergies for drug combinations not included in its training data (showing only Spearman correlation 0.26 in Test Set 2). This limits its potential for discovering new therapeutic strategies. Utilizing techniques such as transfer learning or expanding the training dataset to encompass a wider range of drug pairs could help to address this issue.

      (3) The use of pan-cancer datasets, while offering broad applicability, may not be optimal for specific cancer subtypes with distinct biological mechanisms. Developing subtype-specific models or adjusting the current model to account for these differences could improve prediction accuracy for individual cancer types.

      (4) Line 127, "Since DIPx uses only molecular data, to make a fair comparison, we trained TAJI using only molecular features and referred to it as TAJI-M.". TAJI was designed to use both monotherapy drug-response and molecular data, and likely won't be able to reach maximum potential if removing monotherapy drug-response from the training model. It would be critical to use the same training datasets and then compare the performances. From the Figure 6 of TAJI's paper (Li et al., 2018, PMID: 30054332) , i.e., the mean Pearson correlation for breast cancer and lung cancer are around 0.5 - 0.6.

      The following 2 concerns had been include in the Discussion section which are great:

      (1) Training and validating the model using cell lines may not fully capture the heterogeneity and complexity of in vivo tumors. To increase clinical relevance, it would be beneficial to validate the model using primary tumor samples or patient-derived xenografts.

      (2) The Pathway Activation Score (PAS) is derived exclusively from primary target genes, potentially overlooking critical interactions involving non-primary targets. Including these secondary effects could enhance the model's predictive accuracy and comprehensiveness.

      Comments on revisions:

      The authors replied to my concerns but they did not address my comments/concerns. Especially for my concern #1: They trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set. Therefore, test Set 1 comprises combinations already present in the training set, likely leading overfitting issue but they claimed "There is no danger overfitting here" in their "Author Response" letter.

      All my other concerns are unchanged too.

    2. Reviewer #2 (Public review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

      In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

      (1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

    3. Reviewer #3 (Public review):

      Summary:

      Predicting how two different drugs act together by looking at their specific gene targets and pathways is crucial for understanding the biological significance of drug combinations. This study incorporates drug-specific pathway activation scores (PASs) to estimate synergy scores as one of the key advancements for synergy prediction. The new algorithm, Drug synergy Interaction Prediction (DIPx), developed in this study, uses gene expression, mutation profiles, and drug synergy data to train the model and predict synergy between two drugs. Comprehensive comparisons with another best-performing algorithm, TAIJI-M, highlight the potential of its capabilities.

      Strengths:

      DIPx uses target and driver genes to elucidate pathway activation scores (PASs) to predict drug synergy. This approach integrates gene expression, mutation profiles, and drug synergy data to capture information about the functional interactions between drug targets, thereby providing a potential biological explanation for the synergistic effects of combined drugs. DIPx's performance was tested using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset, especially in Test Set 1, where the Spearman correlation coefficient between predicted and observed drug synergy was 0.50 (95% CI: 0.47-0.53). DIPx's ability to handle novel combinations, as evidenced by its performance in Test Set 2, indicates its potential for predictions of new and untested drug combinations.

      Weaknesses:

      While the DIPx algorithm shows promise in predicting drug synergy based on pathway activation scores, it's essential to consider its limitations. One limitation is that the availability of training data for specific drug combinations may influence its predictive capability. Further testing and experimental validation of the predictions in future studies would be necessary to fully assess the algorithm's generalizability and robustness.

    1. Reviewer #1 (Public review):

      Summary:

      Jocher, Janssen, et al examine the robustness of comparative functional genomics studies in primates that make use of induced pluripotent stem cell-derived cells. Comparative studies in primates, especially amongst the great apes, are generally hindered by the very limited availability of samples, and iPSCs, which can be maintained in the laboratory indefinitely and defined into other cell types, have emerged as promising model systems because they allow the generation of data from tissues and cells that would otherwise be unobservable.

      Undirected differentiation of iPSCs into many cell types at once, using a method known as embryoid body differentiation, requires researchers to manually assign all cell types in the dataset so they can be correctly analysed. Typically, this is done using marker genes associated with a specific cell type. These are defined a priori, and have historically tended to be characterised in mice and humans and then employed to annotate other species. Jocher, Janssen, et al ask if the marker genes and features used to define a given cell type in one species are suitable for use in a second species, and then quantify the degree of usefulness of these markers. They find that genes that are informative and cell type specific in a given species are less valuable for cell type identification in other species, and that this value, or transferability, drops off as the evolutionary distance between species increases.

      This paper will help guide future comparative studies of gene expression in primates (and more broadly) as well as add to the growing literature on the broader challenges of selecting powerful and reliable marker genes for use in single-cell transcriptomics.

      Strengths:

      Marker gene selection and cell type annotation is a challenging problem in scRNA studies, and successful classification of cells often requires manual expert input. This can be hard to reproduce across studies, as, despite general agreement on the identity of many cell types, different methods for identifying marker genes will return different sets of genes. The rise of comparative functional genomics complicates this even further, as a robust marker gene in one species need not always be as useful in a different taxon. The finding that so many marker genes have poor transferability is striking, and by interrogating the assumption of transferability in a thorough and systematic fashion, this paper reminds us of the importance of systematically validating analytical choices. The focus on identifying how transferability varies across different types of marker genes (especially when comparing TFs to lncRNAs), and on exploring different methods to identify marker genes, also suggests additional criteria by which future researchers could select robust marker genes in their own data.

      The paper is built on a substantial amount of clearly reported and thoroughly considered data, including EBs and cells from four different primate species - humans, orangutans, and two macaque species. The authors go to great lengths to ensure the EBs are as comparable as possible across species, and take similar care with their computational analyses, always erring on the side of drawing conservative conclusions that are robustly supported by their data over more tenuously supported ones that could be impacted by data processing artefacts such as differences in mappability, etc. For example, I like the approach of using liftoff to robustly identify genes in non-human species that can be mapped to and compared across species confidently, rather than relying on the likely incomplete annotation of the non-human primate genomes. The authors also provide an interactive data visualisation website that allows users to explore the dataset in depth, examine expression patterns of their own favourite marker genes and perform the same kinds of analyses on their own data if desired, facilitating consistency between comparative primate studies.

      Weaknesses and recommendations:

      (1) Embryoid body generation is known to be highly variable from one replicate to the next for both technical and biological reasons, and the authors do their best to account for this, both by their testing of different ways of generating EBs, and by including multiple technical replicates/clones per species. However, there is still some variability that could be worth exploring in more depth. For example, the orangutan seems to have differentiated preferentially towards cardiac mesoderm whereas the other species seemed to prefer ectoderm fates, as shown in Figure 2C. Likewise, Supplementary Figure 2C suggests a significant unbalance in the contributions across replicates within a species, which is not surprising given the nature of EBs, while Supplementary Figure 6 suggests that despite including three different clones from a single rhesus macaque, most of the data came from a single clone. The manuscript would be strengthened by a more thorough exploration of the intra-species patterns of variability, especially for the taxa with multiple biological replicates, and how they impact the number of cell types detected across taxa, etc.

      The same holds for the temporal aspect of the data, which is not really discussed in depth despite being a strength of the design. Instead, days 8 and 16 are analysed jointly, without much attention being paid to the possible differences between them. Are EBs at day 16 more variable between species than at day 8? Is day 8 too soon to do these kinds of analyses? Are markers for earlier developmental progenitors better/more transferable than those for more derived cell types?

      (2) Closely tied to the point above, by necessity the authors collapse their data into seven fairly coarse cell types and then examine the performance of canonical marker genes (as well as those discovered de novo) across the species. However some of the clusters they use are somewhat broad, and so it is worth asking whether the lack of specificity exhibited by some marker genes and driving their conclusions is driven by inter-species heterogeneity within a given cluster.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

      Strengths:

      To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

      Weaknesses:

      However, several critical points need to be addressed.

      (1) Use of Liftoff for GTF Annotation

      The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

      (2) Transcript Filtering and Potential Biases

      The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

      (3) Data Integration with Harmony

      The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

    1. Reviewer #1 (Public review):

      Summary:

      This is an important and very well-presented set of experiments following up on prior work from the lab investigating knock-down (KD) of EMC10 in restoration of neuronal and cognitive deficits in 22q11.2 Del models, including now both human iPSCs and a mouse model in vivo now with ASOs.

      The valuable progress in this current manuscript is the development of ASOs, and the proof of efficacy in vivo in mouse of the ASO in knock-down of EMC10 and amelioration of in vivo behavioral phenotypes.

      The experiments include: iPSC studies demonstrating elevations of EMC10 in a solid collection of paired iPSC lines. These studies also provide evidence of manipulation of EMC10 by overexpression and inhibition of miRNAs that exist in the 22q11 interval. The iPSC studies also nicely demonstrate rescue of impairments with KD of EMC10 in neuronal arborization as well as KCl induced neuronal activity. The major in vivo contributions reflect impressive demonstration of efficacy of two ASOs in vivo on both KD of EMC10 in vivo and through improvement in behavioral abnormalities in the 22q11 mouse in a range of different behaviors, including social behavior and learning behaviors.

      Overall, there are many strengths reflected in this study, including in particular the synergy between in vitro studies in human cell models and in vivo studies in the well characterized mouse model. The experiments are generally rigorously performed and well powered, and nicely presented. The claims with regard to the mechanisms of EMC10 elevations and the importance of restoration of EMC10 expression to neuronal morphology and behavior are well supported by the data. The work may be further supported in future studies, by investigation of rescue by ASOs of circuit dysfunction in vivo or ex vivo through electrophysiology in the mouse model. Also, in future studies, investigation of the mechanism by which EMC10, an ER protein involved in protein processing, may function in the observed neuronal abnormalities; however, these studies are clearly for future investigations.

      The potential impact of the work is found in the potential value of the ASO approach to the treatment of 22q11, or the pre-clinical evidence that knock-down of this protein may lead to some amelioration of cognitive symptoms. Overall, a very convincing and complementary set of experiments to support EMC10 KD as a therapeutic strategy.

      Review of revision: The authors have addressed the questions from the prior review.

    1. Reviewer #2 (Public review):

      This manuscript by Yu et al. demonstrates that activation of caspase-3 is essential for synapse elimination by microglia, but not by astrocytes. This study also reveals that caspase-3 activation-mediated synapse elimination is required for retinogeniculate circuit refinement and eye-specific territories segregation in dLGN in an activity-dependent manner. Inhibition of synaptic activity increases caspase-3 activation and microglial phagocytosis, while caspase-3 deficiency blocks microglia-mediated synapse elimination and circuit refinement in the dLGN. The authors further demonstrate that caspase-3 activation mediates synapse loss in AD, loss of caspase-3 prevented synapse loss in AD mice. Overall, this study reveals that caspase-3 activation is an important mechanism underlying the selectivity of microglia-mediated synapse elimination during brain development and in neurodegenerative diseases.

      A previous study (Gyorffy B. et al., PNSA 2018) has shown that caspase-3 signal correlates with C1q tagging of synapses (mostly using in vitro approaches), which suggests that caspase-3 would be an underlying mechanism of microglial selection of synapses for removal. The current study provides convincing in vivo evidence demonstrating that caspase-3 activation is essential for microglial elimination of synapses during both brain development and neurodegeneration.

    1. Reviewer #2 (Public review):

      The authors investigated the similarity (or lack thereof) of neural dynamics while monkeys reached to and manipulated one of 4 objects in each trial, compared to observing similar movements performed by experimenters. They focused on mirror neurons (MNs) and rather convincingly showed that MNs dynamics are dissimilar during executing vs. observing actions. The manuscript has improved quite significantly compared to the previous version and I congratulate the authors for that. However, there are still a few points I would like to raise that I think will improve the manuscript scientifically and make it more pleasant to read.

      - I appreciate the nicely compiled literature review which provides the context for the manuscript.<br /> - Message: The takeaway message of the paper is inconsistent and changes throughout the paper. To me, the main takeaway is that observation and execution subspaces progress during the trial (Fig 4), and that they are distinct processes and rather dissimilar, as stated in #440-441, #634-635, etc. But the title of the paper implies the opposite. Some of the interpretations of the results (e.g., Fig 8) also imply similarity of dynamics.<br /> - Readability: I have many issues with the readability/organisation of the paper. Unfortunately, I still find the quality of data presentation low. Below I list a few points:<br /> (1) In 5 sessions out of 9, there are fewer than 20 neurons categorised as AE. This means this population is under-sampled in the data which makes applying any neural population techniques questionable. Moreover, the relevance of the AE analysis is also sometimes unclear: In Fig 4, the AE-related panels are just referred to once in the paper. Yet AE results are presented right next to the main results throughout the paper.<br /> (2) Figures are low resolution and pixelated. There are some faded horizontal and vertical lines in Fig1B that are barely visible. Moreover, it may be my personal preference, but I think Fig1 is more confusing than helpful. Although panel A shows some planes rotating, indicating time-varying dynamics, I couldn't understand what more panel B is trying to convey. The arrow of time is counterclockwise, but the planes progress clockwise (i > ii > iii). Similarly, panel C just seems to show some points being projected to orthogonal subspaces (even though later in the paper we'll see that observation and execution subspaces are not orthogonal), and the CCA subspace illustrated in the same high-d space, which mathematically may be inaccurate, as CCA projects the data to a new space.<br /> In Fig 2A, the objects are too small and pixelated as well. I suggest an overhaul of the figures to make the paper more accessible.<br /> (3) Clarity of the text: The manuscript text could be more concise, to the point, avoiding repetitions, self-consistent, and simply readable. To name a few issues: Single letter acronyms were used to refer to trial epochs (I/G/M/H). M alone has been re-defined 13 different times in the text as in: ...Movement (M)..., excluding every related figure. The acronym (I) refers to the instruction epoch, the high-d space in Fig 1, and panel I of some figures. The acronym MN for Mirror Neurons was defined 4 separate times in the text yet spelled out as Mirror Neuron more than 2 dozen times. CD is defined in the caption of Fig 3 and never used, despite condition-dependent being a common term in the text. Many sentences, e.g., "In contrast, throughout..." in #265-#269, and "To summarize,..." in #270-#275, are too long with difficult wording. To get the point from these sentences, I had to read them many times, and go back and forth between them and the figure. Rewriting such sentences makes the manuscript much more accessible.<br /> - Figure 3: It appears that the condition independent signal has been calculated by subtracting the average of the 4 neural trajectories in Fig 3A, corresponding to different objects. Whereas #133 suggests that it should be calculated by subtracting the average firing rate of different conditions. Assuming I got the methods right, dynamics being "knotted" (#234) after removing the condition independent signal could be because they are similar, so subtracting the condition independent signal leaves us with the noise component. This matters for the manuscript especially since this is the reason for performing the more sensitive instantaneous subspaces.<br /> - Decoding results: I appreciate that the authors improved the decoding results in this version of the manuscript. Now it is much more interesting. However oddly, it appears that only data from 1 monkey is shown. #370 says the results from the other 2 are similar. The decoding data from every monkey must be shown. If the results are similar, they must be at least in Supplements. Currently, only 1 session (out of 3) in the Observation condition seems to decode the object type. This effect, if consistent across animals and session, is very interesting on its own and challenges other claims in the paper.<br /> - Figure8: I reiterate the issue #7 in my previous review. I appreciate the authors clearing some methods, but my concern persists. As per line #839, spiking activity has been smoothed with a 50ms kernel. Thus, unless trial data is concatenated, I suspect the 100ms window used for this analysis is too short (small sample size), thus the correlation values (CCs) might be spurious. References cited in this section use a smaller smoothing kernel (30ms) and a much longer window (~450ms).<br /> Moreover, I don't know why the authors chose to show correlation values in 3D space! Values of Fig8C-red are impossible to know. Furthermore, the manuscript insists on CC values of the Hold period being high, which is probably correct. But I wonder why the focus on the Hold period? I think the most relevant epoch for analysing the MNs is the Movement where the actual action happens. Interestingly, in the movement epoch, the CC values are visibly low. The reason why Hold results are more important and why the CCs in Movement are so low should be clarified in the text. Especially, statements like that in #661 seem particularly unjustified.

    2. Reviewer #3 (Public review):

      In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

      Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

    3. Reviewer #4 (Public review):

      Summary:

      In this study, the authors explore the neural dynamics of mirror neurons in the premotor cortex, focusing on the relationship between neural activity during action execution and observation. The study presents a rich dataset from three monkeys, with recordings from two regions per monkey. The authors use a method to analyze instantaneous neural subspaces and track their temporal evolution. Consistent with prior literature, they report that execution and observation subspaces remain largely distinct throughout the trial. However, after applying canonical correlation analysis, they observe a notable alignment between execution and observation activities, suggesting the presence of shared neural codes. The study is well-designed, and the analyses are thoroughly documented, occasionally overly so in the main text. While most findings are compelling, I find the conclusions drawn from Figure 8 less convincing. Specifically, I am skeptical about the application of CCA in this context and the subsequent interpretations regarding execution-observation similarity, which is a central claim of the manuscript.

      • The authors cite Safaie et al. 2023 as a precedent for applying CCA to align neural population dynamics. However, in that study, CCA was used to align neural dynamics across different animals, a justifiable approach given that neural trajectories exist in separate neural state spaces for each animal. Here, CCA is applied to align execution and observation activities within the same neural state space of the same MNs. I find this application of CCA less well-justified, as it may overestimate execution-observation similarity.<br /> • The control conditions presented in Figures 8C and 8D are somewhat reassuring, as they show that the similarity introduced by CCA is not universally high. However, these controls appear to be limited to the Hold epoch. It remains unclear whether the same holds true for the Go and Movement epochs.<br /> • In Figure 5, the authors display low-dimensional representations of four objects across task epochs during execution (A) and observation (B). The diagonals of the matrices reveal clear differences between execution and observation configurations across all four epochs. The authors suggest using CCA to align these configurations; however, this alignment seems to require time-specific application of CCA for each epoch (as demonstrated in Figure 8 for the Hold epoch). The need for time-specific adjustments likely depends on the fact that execution and observation subspaces are continuously shifting over time (as authors show in Figure 4), but this approach appears to be a strained attempt to demonstrate similarity between execution and observation codes.<br /> • The authors themselves offer an alternative hypothesis (line 730): that "PM MN population activity during action observation, rather than representing movements made by another individual similar to one's own movements, instead may represent different movements one might execute oneself in response to those made by another individual". This interpretation appears more congruent with the data presented.<br /> • In the end, I am left with a sense of ambiguity: which analysis should be considered more reliable, the negligible correspondence between execution and observation activity depicted in Figure 7, or the considerable similarity shown in Figure 8? The authors should address this apparent contradiction and provide a clearer discussion to reconcile these findings.

    1. Reviewer #1 (Public review):

      Summary:

      From a forward genetic mosaic mutant screen using EMS, the authors identify mutations in glucosylceramide synthase (GlcT), a rate-limiting enzyme for glycosphingolipid (GSL) production, that result in EE tumors. Multiple genetic experiments strongly support the model that the mutant phenotype caused by GlcT loss is due to by failure of conversion of ceramide into glucosylceramide. Further genetic evidence suggests that Notch signaling is comprised in the ISC lineage and may affect the endocytosis of Delta. Loss of GlcT does not affect wing development or oogenesis, suggesting tissue-specific roles for GlcT. Finally, an increase in goblet cells in UGCG knockout mice, not previously reported, suggests a conserved role for GlcT in Notch signaling in intestinal cell lineage specification.

      Strengths:

      Overall, this is a well-written paper with multiple well-designed and executed genetic experiments that support a role for GlcT in Notch signaling in the fly and mammalian intestine. I do, however, have a few comments below.

      Weaknesses:

      (1) The authors bring up the intriguing idea that GlcT could be a way to link diet to cell fate choice. Unfortunately, there are no experiments to test this hypothesis.

      (2) Why do the authors think that UCCG knockout results in goblet cell excess and not in the other secretory cell types?

      (3) The authors should cite other EMS mutagenesis screens done in the fly intestine.

      (4) The absence of a phenotype using NRE-Gal4 is not convincing. This is because the delay in its expression could be after the requirement for the affected gene in the process being studied. In other words, sufficient knockdown of GlcT by RNA would not be achieved until after the relevant signaling between the EB and the ISC occurred. Dl-Gal4 is problematic as an ISC driver because Dl is expressed in the EEP.

      (5) The difference in Rab5 between control and GlcT-IR was not that significant. Furthermore, any changes could be secondary to increases in proliferation.

    2. Reviewer #2 (Public review):

      Summary:

      This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

      Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

      Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

      Strengths:

      The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

      The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

      Weaknesses:

      This study is not, however, without caveats and several specific conclusions are not fully convincing.

      First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

      Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

      Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

    3. Reviewer #3 (Public review):

      Summary:

      In this paper, Tang et al report the discovery of a Glycoslyceramide synthase gene, GlcT, which they found in a genetic screen for mutations that generate tumorous growth of stem cells in the gut of Drosophila. The screen was expertly done using a classic mutagenesis/mosaic method. Their initial characterization of the GlcT alleles, which generate endocrine tumors much like mutations in the Notch signaling pathway, is also very nice. Tang et al checked other enzymes in the glycosylceramide pathway and found that the loss of one gene just downstream of GlcT (Egh) gives similar phenotypes to GlcT, whereas three genes further downstream do not replicate the phenotype. Remarkably, dietary supplementation with a predicted GlcT/Egh product, Lactosyl-ceramide, was able to substantially rescue the GlcT mutant phenotype. Based on the phenotypic similarity of the GlcT and Notch phenotypes, the authors show that activated Notch is epistatic to GlcT mutations, suppressing the endocrine tumor phenotype and that GlcT mutant clones have reduced Notch signaling activity. Up to this point, the results are all clear, interesting, and significant. Tang et al then go on to investigate how GlcT mutations might affect Notch signaling, and present results suggesting that GlcT mutation might impair the normal endocytic trafficking of Delta, the Notch ligand. These results (Fig X-XX), unfortunately, are less than convincing; either more conclusive data should be brought to support the Delta trafficking model, or the authors should limit their conclusions regarding how GlcT loss impairs Notch signaling. Given the results shown, it's clear that GlcT affects EE cell differentiation, but whether this is via directly altering Dl/N signaling is not so clear, and other mechanisms could be involved. Overall the paper is an interesting, novel study, but it lacks somewhat in providing mechanistic insight. With conscientious revisions, this could be addressed. We list below specific points that Tang et al should consider as they revise their paper.

      Strengths:

      The genetic screen is excellent.

      The basic characterization of GlcT phenotypes is excellent, as is the downstream pathway analysis.

      Weaknesses:

      (1) Lines 147-149, Figure 2E: here, the study would benefit from quantitations of the effects of loss of brn, B4GalNAcTA, and a4GT1, even though they appear negative.

      (2) In Figure 3, it would be useful to quantify the effects of LacCer on proliferation. The suppression result is very nice, but only effects on Pros+ cell numbers are shown.

      (3) In Figure 4A/B we see less NRE-LacZ in GlcT mutant clones. Are the data points in Figure 4B per cell or per clone? Please note. Also, there are clearly a few NRE-LacZ+ cells in the mutant clone. How does this happen if GlcT is required for Dl/N signaling?

      (4) Lines 222-225, Figure 5AB: The authors use the NRE-Gal4ts driver to show that GlcT depletion in EBs has no effect. However, this driver is not activated until well into the process of EB commitment, and RNAi's take several days to work, and so the author's conclusion is "specifically required in ISCs" and not at all in EBs may be erroneous.

      (5) Figure 5C-F: These results relating to Delta endocytosis are not convincing. The data in Fig 5C are not clear and not quantitated, and the data in Figure 5F are so widely scattered that it seems these co-localizations are difficult to measure. The authors should either remove these data, improve them, or soften the conclusions taken from them. Moreover, it is unclear how the experiments tracing Delta internalization (Fig 5C) could actually work. This is because for this method to work, the anti-Dl antibody would have to pass through the visceral muscle before binding Dl on the ISC cell surface. To my knowledge, antibody transcytosis is not a common phenomenon.

      (6) It is unclear whether MacCer regulates Dl-Notch signaling by modifying Dl directly or by influencing the general endocytic recycling pathway. The authors say they observe increased Dl accumulation in Rab5+ early endosomes but not in Rab7+ late endosomes upon GlcT depletion, suggesting that the recycling endosome pathway, which retrieves Dl back to the cell surface, may be impaired by GlcT loss. To test this, the authors could examine whether recycling endosomes (marked by Rab4 and Rab11) are disrupted in GlcT mutants. Rab11 has been shown to be essential for recycling endosome function in fly ISCs.

      (7) It remains unclear whether Dl undergoes post-translational modification by MacCer in the fly gut. At a minimum, the authors should provide biochemical evidence (e.g., Western blot) to determine whether GlcT depletion alters the protein size of Dl.

      (8) It is unfortunate that GlcT doesn't affect Notch signaling in other organs on the fly. This brings into question the Delta trafficking model and the authors should note this. Also, the clonal marker in Figure 6C is not clear.

      (9) The authors state that loss of UGCG in the mouse small intestine results in a reduced ISC count. However, in Supplementary Figure C3, Ki67, a marker of ISC proliferation, is significantly increased in UGCG-CKO mice. This contradiction should be clarified. The authors might repeat this experiment using an alternative ISC marker, such as Lgr5.

    1. Reviewer #1 (Public review):

      Summary:

      The authors propose a transformer-based model for the prediction of condition - or tissue-specific alternative splicing and demonstrate its utility in the design of RNAs with desired splicing outcomes, which is a novel application. The model is compared to relevant existing approaches (Pangolin and SpliceAI) and the authors clearly demonstrate its advantage. Overall, a compelling method that is well thought out and evaluated.

      Strengths:

      (1) The model is well thought out: rather than modeling a cassette exon using a single generic deep learning model as has been done e.g. in SpliceAI and related work, the authors propose a modular architecture that focuses on different regions around a potential exon skipping event, which enables the model to learn representations that are specific to those regions. Because each component in the model focuses on a fixed length short sequence segment, the model can learn position-specific features. Another difference compared to Pangolin and SpliceAI which are focused on modeling individual splice junctions is the focus on modeling a complete alternative splicing event.

      (2) The model is evaluated in a rigorous way - it is compared to the most relevant state-of-the-art models, uses machine learning best practices, and an ablation study demonstrates the contribution of each component of the architecture.

      (3) Experimental work supports the computational predictions.

      (4) The authors use their model for sequence design to optimize splicing outcomes, which is a novel application.

      Weaknesses:

      No weaknesses were identified by this reviewer, but I have the following comments:

      (1) I would be curious to see evidence that the model is learning position-specific representations.

      (2) The transformer encoders in TrASPr model sequences with a rather limited sequence size of 200 bp; therefore, for long introns, the model will not have good coverage of the intronic sequence. This is not expected to be an issue for exons.

      (3) In the context of sequence design, creating a desired tissue- or condition-specific effect would likely require disrupting or creating motifs for splicing regulatory proteins. In your experiments for neuronal-specific Daam1 exon 16, have you seen evidence for that? Most of the edits are close to splice junctions, but a few are further away.

      (4) For sequence design, of tissue- or condition-specific effect in neuronal-specific Daam1 exon 16 the upstream exonic splice junction had the most sequence edits. Is that a general observation? How about the relative importance of the four transformer regions in TrASPr prediction performance?

      (5) The idea of lightweight transformer models is compelling, and is widely applicable. It has been used elsewhere. One paper that came to mind in the protein realm:<br /> Singh, Rohit, et al. "Learning the language of antibody hypervariability." Proceedings of the National Academy of Sciences 122.1 (2025): e2418918121.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

      For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

      TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

      In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

      Strengths:

      (1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

      (2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

      Weaknesses:

      (1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

      (2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

      (3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

      (4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

      (5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

      (6) L214, ablations of individual features are missing.

      (7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

      (8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

      (9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

      (10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

    1. Reviewer #1 (Public review):

      Summary

      Fleming et al. present the first, proteomics-based attempt to identify the possible mechanism of action of ALS-linked DNAJC7 molecular chaperone in pathology. Impressively, it is the first report of DNAJC7 interactome studies, using a suitable iPSC-derived lower motor neuron model. Using a co-immunoprecipitation approach the authors identified that the interactome of DNAJC7 is predominantly composed of proteins engaged in response to stress, but also that this interactome is enriched in RNA-binding proteins. The authors also created a DNAJC7 haploinsufficiency cellular model and show the resulting increased insolubility of HNRNPU protein which causes disruptions in its functionality as shown by analysis of its transcriptional targets. Finally, this study uses pharmacological agents to test the effect of decreased DNAJC7 expression on cell response to proteotoxic stress and finds evidence that DNAJC7 regulates the activation of Heat shock factor 1 (HSF1) protein upon stress conditions.

      Strengths

      (1)This study uses the best so far model to study the interactome and possible mechanism of action of DNAJC7 molecular chaperone in an iPSC-derived cellular model of motor neurons. Furthermore, the authors also looked into available transcriptome databases of ALS patient samples to further test whether their findings may yield relevance to pathology.

      (2) The extent to which the authors are explicit about the sample sizes, protocols, and statistical tests used throughout this manuscript, should be applauded. This will help the whole field in their efforts to reliably replicate the results in this study.

      Weaknesses

      (1) The most significant caveat of interactome experiments inherently comes from the method of choice. It is possible that by using the co-purification approach of DNAJC7 IP the resulting pool of binding partners is depleted in proteins that interact with DNAJC7 weakly or transiently. An alternative approach presumably more sensitive towards weaker binders could use the TurboID-based proximity-labeling method.

      (2) The authors mention in Results (and Figure 2D) that HNRNPA1 was identified as DNAJC7-interacting protein in their co-IP experiments, however, an identifier for this protein cannot be found in Figure 1C and Table S1 listing the proteomics results. Could the authors appropriately update Figure 1C and Table S1, or if HNRNPA1 wasn't really a hit then remove it from listed HNRNPs?

      (3) No further validation of DNAJC7-interacting proteins from the heat-shock protein (HSP) family. Current validation of mass spectrometry-identified proteins comes from IP-western blots with antibodies against HSPs. It would be interesting to further inspect possible interactions of these proteins by inspecting co-localization with immunocytochemistry.

      (4) Similarly, the observation of DNAJC7 haploinsufficiency causing an increase in HNRNPU insolubility could be also easily further confirmed by checking for the emergence of "puncta" under a fluorescence microscope, in addition to provided WB experiments from MN lysates.

      (5) I would like to recommend the authors to also provide with this manuscript a complete dataset (possibly in the form of a table, presented similarly as Table S1) resulting from experiments presented in Figures 2F and S2D. The information on upregulated and downregulated targets in their DNAJC7 haploinsufficiency model would be a valuable resource for the field and enable further investigations.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

      The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

      Strengths:

      The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

      This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

      Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

      Weaknesses:

      Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

      A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

      It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

      The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

      The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

    3. Reviewer #3 (Public review):

      Summary:

      Fleming et al sought to better understand DNAJC7's function in motor neurons as mutations in this gene have been associated with amyotrophic lateral sclerosis (ALS). The research question is relevant and important. The authors use an induced pluripotent stem cell (iPSC) line to derive motor neurons (iMNs) finding that DNAJC7 interacts with RNA-binding proteins (RBP) in wild-type cells and a truncated mutant DNAJC7[R156*] disrupts the RBP, hnRNPU, by promoting its accumulation into insoluble fractions. Given that DNAJC7 is predicted to regulate stress responses, the authors then find that DNAJC7[R156*] expression sensitizes the iMNs to proteosomal stress by disrupting the expression of the key heat stress response regulator, HSF1. These findings support that loss-of-function mutations in DNAJC7 will indeed sensitize motor neurons to proteotoxic stress, potentially driving ALS. The association with RBPs, which routinely are found to be disrupted in ALS, is of interest and warrants further study.

      Strengths:

      (1) The research question is relevant and important. The authors provide interesting data that DNAJC7 mutations impact two important features in ALS, the dysregulation of RNA binding proteins and the sensitivity of motor neurons to proteotoxic stress.

      (2) The authors provide solid data to support their findings and the assays are appropriate.

      Weaknesses:

      (1) The authors rely on a single iPSC line throughout the text, using the same line to make the mutation-carrying cells. iPSCs are highly variable and at minimum 3 lines, typically 5 lines, should be used to define consistent findings. This work would be greatly strengthened if 3 or more lines were used to confirm consistent effects. This is particularly concerning given that iPSCs were differentiated using growth factors versus genetic induction. Growth-factor-based differentiations are more variable.

      (2) The authors argue that HSF1 and its targets are downregulated in sporadic ALS and mutant C9orf72 ALS. The first concern is that these transcriptomics data were derived from cortical tissue which does not contain motor neurons (Pineda et al. 2024 Cell 187: 1971-1989.e1916). The second concern is that the inclusion of C9orf72 mutant tissue is not well justified as (1) this mutation is associated with an upregulation of HSF1 and its targets in patients (Mordes et al, Acta Neuropathol Commun 2018 6(1):55; Lee et al Neuron 2023 111(9):1381-1390) and (2) the C9orf72 mutation is associated with a ALS/FTD spectrum disorder defined by TDP-43 pathology. Disease mechanisms associated with this spectrum disorder may not overlap with traditional ALS which is typically defined by SOD1 pathology.

      (3) As a whole, the findings are mechanistically disjointed, and additional experiments or discussion would help to connect the dots a bit more.

    1. Reviewer #1 (Public review):

      Summary:

      The study shows that Zizyphi spinosi semen (ZSS), particularly its non-extracted simple crush powder, has significant therapeutic effects on neurodegenerative diseases. It removes Aβ, tau, and α-synuclein oligomers, restores synaptophysin levels, enhances BDNF expression and neurogenesis, and improves cognitive and motor functions in mouse AD, FTD, DLB, and PD models. Additionally, ZSS powder reduces DNA oxidation and cellular senescence in normal-aged mice, increases synaptophysin, BDNF, and neurogenesis, and enhances cognition to levels comparable to young mice.

      Weaknesses:

      (1) While the study demonstrates that ZSS has protective effects across a wide range of animal models, including AD, FTD, DLB, PD, and both young and aged mice, it is broad and lacks a detailed investigation into the underlying mechanisms. This is the most significant concern.

      (2) The authors highlight that the non-extracted simple crush powder of ZSS shows more substantial effects than its hot water extract and extraction residue. However, the manuscript provides very limited data comparing the effects of these three extracts.

      (3) The authors have not provided a rationale for the dosing concentrations used, nor have they tested the effects of the treatment in normal mice to verify its impact under physiological conditions.

      (4) Regarding the assessment of cognitive function in mice, the authors only utilized the Morris Water Maze (MWM) test, which includes a five-day spatial learning training phase followed by a probe trial. The authors focused solely on the learning phase. However, it is relevant to note that data from the learning phase primarily reflects the learning ability of the mice, while the probe trial is more indicative of memory. Therefore, it is essential that probe trial data be included for a more comprehensive analysis. A justification should be included to explain why the latency of 1st is about 50s not 60s.

      (5) The BDNF immunohistochemical staining in the manuscript appears to be non-specific.

      (6) The central pathological regions in PD are the substantia nigra and striatum. Please replace the staining results from the cortex and hippocampus with those from these regions in the PD model.

    2. Reviewer #2 (Public review):

      Summary:

      The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

      Strengths:

      The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

      Weaknesses:

      The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

    3. Reviewer #3 (Public review):

      ZSS has been widely used in Traditional Chinese Medicine as a sleep-promoting herb. This study tests the effects of ZSS powder and extracts on AD, PD, and aging, and broad protective effects were revealed in mice.

      However, this work did not include a mechanistic study or target data on ZSS were included, and PK data were also not involved. Mechanisms or targets and PK study are suggested. A human PK study is preferred over mice or rats. E.g. which main active ingredients and the concentration in plasma, in this context, to study the pharmacological mechanisms of ZSS.

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to provide imaging methods for users of the field of human layer-fMRI. This is an emerging field with 240 papers published so far. Different than implied in the manuscript, 3T is well represented among those papers. E.g. see the papers below that are not cited in the manuscript. Thus, the claim on the impact of developing 3T methodology for wider dissemination is not justified. Specifically, because some of the previous papers perform whole brain layer-fMRI (also at 3T) in more efficient, and more established procedures.

      The authors implemented a sequence with lots of nice features. Including their own SMS EPI, diffusion bipolar pulses, eye-saturation bands, and they built their own reconstruction around it. This is not trivial. Only a few labs around the world have this level of engineering expertise. I applaud this technical achievement. However, I doubt that any of this is the right tool for layer-fMRI, nor does it represent an advancement for the field. In the thermal noise dominated regime of sub-millimeter fMRI (especially at 3T) it is established to use 3D readouts over 2D (SMS) readouts. While it is not trivial to implement SMS, the vendor implementations (as well as the CMRR and MGH implementations) are most widely applied across the majority of current fMRI studies already. The author's work on this does not serve any previous shortcomings in the field.

      The mechanism to use bi-polar gradients to increase the localization specificity is doubtful to me. In my understanding, killing the intra-vascular BOLD should make it less specific. Also, the empirical data do not suggest a higher localization specificity to me.

      Embedding this work in the literature of previous methods is incomplete. Recent trends of vessel signal manipulation with ABC or VAPER are not mentioned. Comparisons with VASO are outdated and incorrect.

      The reproducibility of the methods and the result is doubtful (see below).

      I don't think that this manuscript is in the top 50% of the 240 layer-fmri papers out there.

      3T layer-fMRI papers that are not cited:

      Taso, M., Munsch, F., Zhao, L., Alsop, D.C., 2021. Regional and depth-dependence of cortical blood-flow assessed with high-resolution Arterial Spin Labeling (ASL). Journal of Cerebral Blood Flow and Metabolism. https://doi.org/10.1177/0271678X20982382

      Wu, P.Y., Chu, Y.H., Lin, J.F.L., Kuo, W.J., Lin, F.H., 2018. Feature-dependent intrinsic functional connectivity across cortical depths in the human auditory cortex. Scientific Reports 8, 1-14. https://doi.org/10.1038/s41598-018-31292-x

      Lifshits, S., Tomer, O., Shamir, I., Barazany, D., Tsarfaty, G., Rosset, S., Assaf, Y., 2018. Resolution considerations in imaging of the cortical layers. NeuroImage 164, 112-120. https://doi.org/10.1016/j.neuroimage.2017.02.086

      Puckett, A.M., Aquino, K.M., Robinson, P.A., Breakspear, M., Schira, M.M., 2016. The spatiotemporal hemodynamic response function for depth-dependent functional imaging of human cortex. NeuroImage 139, 240-248. https://doi.org/10.1016/j.neuroimage.2016.06.019

      Olman, C.A., Inati, S., Heeger, D.J., 2007. The effect of large veins on spatial localization with GE BOLD at 3 T: Displacement, not blurring. NeuroImage 34, 1126-1135. https://doi.org/10.1016/j.neuroimage.2006.08.045

      Ress, D., Glover, G.H., Liu, J., Wandell, B., 2007. Laminar profiles of functional activity in the human brain. NeuroImage 34, 74-84. https://doi.org/10.1016/j.neuroimage.2006.08.020

      Huber, L., Kronbichler, L., Stirnberg, R., Ehses, P., Stocker, T., Fernández-Cabello, S., Poser, B.A., Kronbichler, M., 2023. Evaluating the capabilities and challenges of layer-fMRI VASO at 3T. Aperture Neuro 3. https://doi.org/10.52294/001c.85117

      Scheeringa, R., Bonnefond, M., van Mourik, T., Jensen, O., Norris, D.G., Koopmans, P.J., 2022. Relating neural oscillations to laminar fMRI connectivity in visual cortex. Cerebral Cortex. https://doi.org/10.1093/cercor/bhac154

      Strengths:

      See above. The authors developed their own SMS sequence with many features. This is important to the field. And does not leave sequence development work to view isolated monopoly labs. This work democratises SMS.<br /> The questions addressed here are of high relevance to the field: getting tools with good sensitivity, user-friendly applicability, and locally specific brain activity mapping is an important topic in the field of layer-fMRI.

      Weaknesses:

      (1) I feel the authors need to justify why flow-crushing helps localization specificity. There is an entire family of recent papers that aims to achieve higher localization specificity by doing the exact opposite. Namely, MT or ABC fRMRI aims to increase the localization specificity by highlighting the intravascular BOLD by means of suppressing non-flowing tissue. To name a few:

      Priovoulos, N., de Oliveira, I.A.F., Poser, B.A., Norris, D.G., van der Zwaag, W., 2023. Combining arterial blood contrast with BOLD increases fMRI intracortical contrast. Human Brain Mapping hbm.26227. https://doi.org/10.1002/hbm.26227.

      Pfaffenrot, V., Koopmans, P.J., 2022. Magnetization Transfer weighted laminar fMRI with multi-echo FLASH. NeuroImage 119725. https://doi.org/10.1016/j.neuroimage.2022.119725

      Schulz, J., Fazal, Z., Metere, R., Marques, J.P., Norris, D.G., 2020. Arterial blood contrast ( ABC ) enabled by magnetization transfer ( MT ): a novel MRI technique for enhancing the measurement of brain activation changes. bioRxiv. https://doi.org/10.1101/2020.05.20.106666

      Based on this literature, it seems that the proposed method will make the vein problem worse, not better. The authors could make it clearer how they reason that making GE-BOLD signals more extra-vascular weighted should help to reduce large vein effects.

      The empirical evidence for the claim that flow crushing helps with the localization specificity should be made clearer. The response magnitude with and without flow crushing looks pretty much identical to me (see Fig, 6d).<br /> It's unclear to me what to look for in Fig. 5. I cannot discern any layer patterns in these maps. It's too noisy. The two maps of TE=43ms look like identical copies from each other. Maybe an editorial error?

      The authors discuss bipolar crushing with respect to SE-BOLD where it has been previously applied. For SE-BOLD at UHF, a substantial portion of the vein signal comes from the intravascular compartment. So I agree that for SE-BOLD, it makes sense to crush the intravascular signal. For GE-BOLD however, this reasoning does not hold. For GE-BOLD (even at 3T), most of the vein signal comes from extravascular dephasing around large unspecific veins and the bipolar crushing is not expected to help with this.

      (2) The bipolar crushing is limited to one single direction of flow. This introduces a lot of artificial variance across the cortical folding pattern. This is not mentioned in the manuscript. There is an entire family of papers that perform layer-fmri with black-blood imaging that solves this with a 3D contrast preparation (VAPER) that is applied across a longer time period, thus killing the blood signal while it flows across all directions of the vascular tree. Here, the signal cruising is happening with a 2D readout as a "snap-shot" crushing. This does not allow the blood to flow in multiple directions.<br /> VAPER also accounts for BOLD contaminations of larger draining veins by means of a tag-control sampling. The proposed approach here does not account for this contamination.

      Chai, Y., Li, L., Huber, L., Poser, B.A., Bandettini, P.A., 2020. Integrated VASO and perfusion contrast: A new tool for laminar functional MRI. NeuroImage 207, 116358. https://doi.org/10.1016/j.neuroimage.2019.116358

      Chai, Y., Liu, T.T., Marrett, S., Li, L., Khojandi, A., Handwerker, D.A., Alink, A., Muckli, L., Bandettini, P.A., 2021. Topographical and laminar distribution of audiovisual processing within human planum temporale. Progress in Neurobiology 102121. https://doi.org/10.1016/j.pneurobio.2021.102121

      If I would recommend anyone to perform layer-fMRI with blood crushing, it seems that VAPER is the superior approach. The authors could make it clearer why users might want to use the unidirectional crushing instead.

      (3) The comparison with VASO is misleading.<br /> The authors claim that previous VASO approaches were limited by TRs of 8.2s. The authors might be advised to check the latest literature of the last years.<br /> Koiso et al. has performed whole brain layer-fMRI VASO at 0.8mm at 3.9 seconds (with reliable activation) and 2.7 seconds (with unconvincing activation pattern, though), and 2.3 (without activation).<br /> Also, whole brain layer-fMRI BOLD at 0.5mm and 0.7mm has been previously performed by the Juelich group at TRs of 3.5s (their TR definition is 'fishy' though).

      Koiso, K., Müller, A.K., Akamatsu, K., Dresbach, S., Gulban, O.F., Goebel, R., Miyawaki, Y., Poser, B.A., Huber, L., 2023. Acquisition and processing methods of whole-brain layer-fMRI VASO and BOLD: The Kenshu dataset. Aperture Neuro 34. https://doi.org/10.1101/2022.08.19.504502

      Yun, S.D., Pais‐Roldán, P., Palomero‐Gallagher, N., Shah, N.J., 2022. Mapping of whole‐cerebrum resting‐state networks using ultra‐high resolution acquisition protocols. Human Brain Mapping. https://doi.org/10.1002/hbm.25855

      Pais-Roldan, P., Yun, S.D., Palomero-Gallagher, N., Shah, N.J., 2023. Cortical depth-dependent human fMRI of resting-state networks using EPIK. Front. Neurosci. 17, 1151544. https://doi.org/10.3389/fnins.2023.1151544

      The authors are correct that VASO is not advised as a turn-key method for lower brain areas, incl. Hippocampus and subcortex. However, the authors use this word of caution that is intended for inexperienced "users" as a statement that this cannot be performed. This statement is taken out of context. This statement is not from the academic literature. It's advice for the 40+ user base that want to perform layer-fMRI as a plug-and-play routine tool in neuroscience usage. In fact, sub-millimeter VASO is routinely being performed by MRI-physicists across all brain areas (including deep brain structures, hippocampus etc). E.g. see Koiso et al. and an overview lecture from a layer-fMRI workshop that I had recently attended: https://youtu.be/kzh-nWXd54s?si=hoIJjLLIxFUJ4g20&t=2401

      Thus, the authors could embed this phrasing into the context of their own method that they are proposing in the manuscript. E.g. the authors could state whether they think that their sequence has the potential to be disseminated across sites, considering that it requires slow offline reconstruction in Matlab?<br /> Do the authors think that the results shown in Fig. 6c are suggesting turn-key acquisition of a routine mapping tool? In my humble opinion it looks like random noise, with most of the activation outside the ROI (in white matter).

      (4) The repeatability of the results is questionable.<br /> The authors perform experiments about the robustness of the method (line 620). The corresponding results are not suggesting any robustness to me. In fact the layer profiles in Fig. 4c vs. Fig 4d are completely opposite. Location of peaks turn into locations of dips and vice versa.<br /> The methods are not described in enough detail to reproduce these results.<br /> The authors mention that their image reconstruction is done "using in-house MATLAB code" (line 634). They do not post a link to github, nor do they say if they share this code.

      It is not trivial to get good phase data for fMRI. The authors do not mention how they perform the respective coil-combination.<br /> No data are shared for reproduction of the analysis.

      (5) The application of NODRIC is not validated.<br /> Previous applications of NORDIC at 3T layer-fMRI have resulted in mixed success. When not adjusted for the right SNR regime it can result in artifactual reductions of beta scores, depending on the SNR across layers. The authors could validate their application of NORDIC and confirm that the average layer-profiles are unaffected by the application of NORDIC. Also, the NORDIC version should be explicitly mentioned in the manuscript.

      Akbari, A., Gati, J.S., Zeman, P., Liem, B., Menon, R.S., 2023. Layer Dependence of Monocular and Binocular Responses in Human Ocular Dominance Columns at 7T using VASO and BOLD (preprint). Neuroscience. https://doi.org/10.1101/2023.04.06.535924

      Knudsen, L., Guo, F., Huang, J., Blicher, J.U., Lund, T.E., Zhou, Y., Zhang, P., Yang, Y., 2023. The laminar pattern of proprioceptive activation in human primary motor cortex. bioRxiv. https://doi.org/10.1101/2023.10.29.564658

      Comments on revisions:

      Among all the concerns mentioned above, I think there is only one of the specific issues that was sufficiently addressed.<br /> The authors implemented a combination of three consecutive-dimensional flow crushers. Other concerns were not sufficiently addressed to change my confidence level of the study.<br /> - While the abstract is still focusing on the utility of using 3T, they do not give credit to early 3T layer-fMRI papers leading the way to larger coverage and connectivity applications.<br /> - While the author's choice of using custom SMS 2D readout is justified for them. I do not think that this very method will utilize widespread 3T whole brain connectivity experiments across the global 3T community. This lowers the impact of the paper.<br /> - The images in Fig. 5 are still suspiciously similar. To the level that the noise pattern outside the brain is identical across large parts of the maps with and without PR.<br /> - Maybe it's my ignorance, but I still do not agree why flow crushing focuses the local BOLD responses to small vessels.<br /> - While my feel of a misleading representation of the literature had been accompanied by explicit references, the authors claim that they cannot find them?!? Or claim that they are about something else (which they are not, in my viewpoint).<br /> Data and software are still not shared (not even example data, or nii data).

    2. Reviewer #2 (Public review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

      Strengths:

      The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

      That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

      The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

      The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

      I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

      Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

      The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

      Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

    3. Reviewer #3 (Public review):

      Summary:

      The authors are looking for a spatially specific functional brain response to visualise non-invasively with 3T (clinical field strength) MRI. They propose a velocity-nulled weighting to remove signal from draining veins in a submillimeter multiband acquisition.

      Strengths:

      - This manuscript addresses a real need in the cognitive neuroscience community interested in imaging responses in cortical layers in-vivo in humans.<br /> - An additional benefit is the proposed implementation at 3T, a widely available field strength.

      Weaknesses:

      - The comparison in Figure 4 for different b-values shows % signal changes. However, as the baseline signal changes with added diffusion weighting, this is rather uninformative. A plot of t-values against cortical depth would be more insightful.<br /> - Surprisingly, the %-signal change for a b-value of 0 is below 1% for 3/4 participants, even at the cortical surface. This raises some doubts about the task or ROI definition. A finger-tapping task should reliably engage the primary motor cortex, even at 3T, and even in individual participants.<br /> - The double peak patter in the BOLD weighted images in Figure 4 is unexpected given the existing literature on BOLD responses as a function of cortical depth.<br /> - Although I'd like to applaud the authors for their ambition with the connectivity analysis, the low significance threshold used in these maps (z=1,64) leads to concerns about the SNR of the underlying data.

      I remain unconvinced of the conclusion that the developed VN fMRI exhibited layer specificity - the double peak which is taken as a marker of specificity is not absent in the BOLD responses either, and overall BOLD and VN response profiles as a function of cortical depth are quite similar.

    1. Reviewer #1 (Public review):

      Summary:

      In this study, Millard and colleagues investigated if the analgesic effect of nicotine on pain sensitivity, assessed with two pain models, is mediated by Peak Alpha Frequency (PAF) recorded with resting state EEG. The authors found indeed that nicotine (4 mg, gum) reduced pain ratings during phasic heat pain but not cuff pressor algometry compared to placebo conditions. Nicotine also increased PAF (globally). However, mediation analysis revealed that the reduction in pain ratings elicited by the phasic heat pain after taking nicotine was not mediated by the changes in PAF. Also, the authors only partially replicated the correlation between PAF and pain sensitivity at baseline (before nicotine treatment). At the group-level no correlation was found, but an exploratory analysis showed that the negative correlation (lower PAF, higher pain sensitivity) was present in males but not in females. The authors discuss the lack of correlation.<br /> In general, the study is rigorous, methodology is sound and the paper is well written. Results are compelling and sufficiently discussed.

      Strengths:

      Strengths of this study are the pre-registration, proper sample size calculation and data analysis. But also the presence of the analgesic effect of nicotine and the change in PAF.

      Weaknesses:

      It would even be more convincing if they had manipulated PAF directly.

    2. Reviewer #2 (Public review):

      Summary:

      The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

      Strengths:

      I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

      Weaknesses:

      The weakness of the study revolves around two aspects:

      (1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

      (2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

      Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

    3. Reviewer #3 (Public review):

      In this manuscript, Millard et al. investigate the effects of nicotine on pain sensitivity and peak alpha frequency (PAF) in resting state EEG. To this end, they ran a randomized, double-blind, placebo-controlled experiment involving 62 healthy adults that received either 4 mg nicotine gum (n=29) or placebo (n=33). Prolonged heat and pressure were used as pain models. Resting state EEG and pain intensity (assessed with a visual analog scale) were measured before and after the intervention. Additionally, several covariates (sex at birth, depression and anxiety symptoms, stress, sleep quality, among others) were recorded. Data was analyzed using ANCOVA-equivalent two-wave latent change score models, as well as repeated measures analysis of variance. Results do not show experimentally relevant changes of PAF or pain intensity scores for neither of the prolonged pain models due to nicotine intake.

      The main strengths of the manuscript are its solid conceptual framework and the thorough experimental design. The researchers make a good case in the introduction and discussion for the need to further investigate the association of PAF and pain sensitivity. Furthermore, they proceed to carefully describe every aspect of the experiment in great detail, which is excellent for reproducibility purposes. Finally, they analyze the data from different and provide an extensive report of their results.

      There are relevant weaknesses to highlight. Firstly, authors preregistered the study and the analysis plan, but the preregistration does not contain an estimation of the expected effect sizes or the rationale for the selected the sample size. Furthermore, the authors interpret their results in a way that is not supported by the evidence (which is notorious in the abstract and the first paragraph of the discussion). Even though some of the differences are statistically significant (e.g., global PAF, pain intensity ratings during heat pain), these differences are far from being experimentally or clinically relevant. The effect sizes observed are not sufficiently large to consider that pain sensitivity was modulated by the nicotine intake, which puts into question all the answers to the research questions posed in the study. The authors attempt to nuance this throughout the discussion, but in a way that is not compatible with the main claims.

    1. Reviewer #1 (Public review):

      Summary:

      This work investigated the role of CXXC-finger protein 1 (CXXC1) in regulatory T cells. CXXC1-bound genomic regions largely overlap with Foxp3-bound regions and regions with H3K4me3 histone modifications in Treg cells. CXXC1 and Foxp3 interact with each other, as shown by co-immunoprecipitation. Mice with Treg-specific CXXC1 knockout (KO) succumb to lymphoproliferative diseases between 3 to 4 weeks of age, similar to Foxp3 KO mice. Although the immune suppression function of CXXC1 KO Treg is comparable to WT Treg in an in vitro assay, these KO Tregs failed to suppress autoimmune diseases such as EAE and colitis in Treg transfer models in vivo. This is partly due to the diminished survival of the KO Tregs after transfer. CXXC1 KO Tregs do not have an altered DNA methylation pattern; instead, they display weakened H3K4me3 modifications within the broad H3K4me3 domains, which contain a set of Treg signature genes. These results suggest that CXXC1 and Foxp3 collaborate to regulate Treg homeostasis and function by promoting Treg signature gene expression through maintaining H3K4me3 modification.

      Strengths:

      Epigenetic regulation of Treg cells has been a constantly evolving area of research. The current study revealed CXXC1 as a previously unidentified epigenetic regulator of Tregs. The strong phenotype of the knockout mouse supports the critical role CXXC1 plays in Treg cells. Mechanistically, the link between CXXC1 and the maintenance of broad H3K4me3 domains is also a novel finding.

      Weaknesses:

      The authors addressed the reviewer's critiques fully in the revised manuscript.

    2. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    3. Reviewer #3 (Public review):

      In the report entitled "CXXC-finger protein 1 associates with FOXP3 to stabilize homeostasis and suppressive functions of regulatory T cells", the authors demonstrated that Cxxc1-deletion in Treg cells leads to the development of severe inflammatory disease with impaired suppressive function. Mechanistically, CXXC1 interacts with Foxp3 and regulates the expression of key Treg signature genes by modulating H3K4me3 deposition. Their findings are interesting and significant.

      Comments on revisions:

      In the revised manuscript, the authors have responded well to all the concerns reviewers raised. The manuscript has further improved.

    1. Reviewer #1 (Public review):

      In this study, the authors developed a mathematical model to predict human biological ages using physiological traits. This model provides a way to identify environmental and genetic factors that impact aging and lifespan.

      Strength:

      (1) The topic addressed by the authors - human age predication using physiological traits - is an extremely interesting, important, and challenging question in the aging field. One of the biggest challenges is the lack of well-controlled data from a large number of humans. However, the authors took this challenge and tried their best to extract useful information from available data.<br /> (2) Some of the findings can provide valuable guidelines for future experimental design for human and animal studies. For example, it was found that this mathematical model can best predict age when all different organ and physiological systems are sampled. This finding makes scenes in general, but can be, and have been, neglected when people use molecular markers to predict age. Most of those studies have used only one molecular trait or different traits from one tissue.

      Weakness:

      (1) As I mentioned above, the Biobank data used here are not designed for this current study, so there are many limitations for model development using these data, e.g., missing data points and irrelevant measurements for aging. This is a common caveat for human studies and has been discussed by the authors.<br /> (2) There is no validation dataset to verify the proposed model. The authors suggested that human biological age can be predicted with a high accuracy using 12 simple physiological measurements. It will be super useful and convincing if another biobank dataset containing those 12 traits can be applied to the current model.

      Comments on revisions:

      In this revision, the authors improved the manuscript by adding discussion of two main weaknesses about human data limitation and model validation. My several other specific concerns and suggestions are all properly resolved.

    1. Reviewer #2 (Public review):

      The fledgling field of epitranscriptomics has encountered various technical roadblocks with implications as to the validity of early epitranscriptomics mapping data. As a prime example, the low specificity of (supposedly) modification-specific antibodies for the enrichment of modified RNAs, has been ignored for quite some time and is only now recognized for its dismal reproducibility (between different labs), which necessitates the development of alternative methods for modification detection. Furthermore, early attempts to map individual epitranscriptomes using sequencing-based techniques are largely characterized by the deliberate avoidance of orthogonal approaches aimed at confirming the existence of RNA modifications that have been originally identified.

      Improved methodology, the inclusion of various controls, and better mapping algorithms as well as the application of robust statistics for the identification of false-positive RNA modification calls have allowed revisiting original (seminal) publications whose early mapping data allowed making hyperbolic claims about the number, localization and importance of RNA modifications, especially in mRNA. Besides the existence of m6A in mRNA, the detectable incidence of RNA modifications in mRNAs has drastically dropped.

      As for m5C, the subject of the manuscript submitted by Zhou et al., its identification in mRNA goes back to Squires et al., 2012 reporting on >10.000 sites in mRNA of a human cancer cell line, followed by intermittent findings reporting on pretty much every number between 0 to > 100.000 m5C sites in different human cell-derived mRNA transcriptomes. The reason for such discrepancy is most likely of a technical nature. Importantly, all studies reporting on actual transcript numbers that were m5C-modified relied on RNA bisulfite sequencing, an NGS-based method, that can discriminate between methylated and non-methylated Cs after chemical deamination of C but not m5C. RNA bisulfite sequencing has a notoriously high background due to deamination artifacts, which occur largely due to incomplete denaturation of double-stranded regions (denaturing-resistant) of RNA molecules. Furthermore, m5C sites in mRNAs have now been mapped to regions that have not only sequence identity but also structural features of tRNAs. Various studies revealed that the highly conserved m5C RNA methyltransferases NSUN2 and NSUN6 do not only accept tRNAs but also other RNAs (including mRNAs) as methylation substrates, which in combination account for most of the RNA bisulfite-mapped m5C sites in human mRNA transcriptomes. Is m5C in mRNA only a result of the Star activity of tRNA or rRNA modification enzymes, or is their low stoichiometry biologically relevant?

      In light of the short-comings of existing tools to robustly determine m5C in transcriptomes, other methods, like DRAM-seq, aiming to map m5C independently of ex situ RNA treatment with chemicals, are needed to arrive at a more solid "ground state", from which it will be possible to state and test various hypotheses as to the biological function of m5C, especially in lowly abundant RNAs such as mRNA.

      Importantly, the identification of >10.000 sites containing m5C increases through DRAM-Seq, increases the number of potential m5C marks in human cancer cells from a couple of 100 (after rigorous post-hoc analysis of RNA bisulfite sequencing data) by orders of magnitude. This begs the question, whether or not the application of these editing tools results in editing artefacts overstating the number of actual m5C sites in the human cancer transcriptome.

      [Editors' note: earlier reviews have been provided here: https://doi.org/10.7554/eLife.98166.3.sa1; https://doi.org/10.7554/eLife.98166.2.sa1; https://doi.org/10.7554/eLife.98166.1.sa1]

    1. Reviewer #1 (Public review):

      Summary:

      Tamoxifen resistance is a common problem in partially ER-positive patients undergoing endocrine therapy, and this manuscript has important research significance as it is based on clinical practical issues. The manuscript discovered that the absence of FRMD8 in breast epithelial cells can promote the progression of breast cancer, thus proposing the hypothesis that FRMD8 affects tamoxifen resistance and validated this hypothesis through a series of experiments. The manuscript has certain theoretical reference value.

      Strengths:

      At present, research on the role of FRMD8 in breast cancer is very limited. This manuscript leverages the MMTV-Cre+;Frmd8fl/fl;PyMT mouse model to study the role of FRMD8 in tamoxifen resistance, and single-cell sequencing technology discovered the interaction between FRMD8 and ESR1. At the mechanistic level, this manuscript has demonstrated two ways in which FRMD8 affects ERα, providing some new insights into the development of ER-positive breast cancer in patients who are resistant to tamoxifen.

      Limitations:

      Whether FRMD8 can become a biomarker should be verified in large clinical samples or clinical data.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript presents a valuable finding on the impact of FRMD8 loss on tumor progression and the resistance to tamoxifen therapy. The author conducted systematic experiments to explore the role of FRMD8 in breast cancer and its potential regulatory mechanisms, confirming that FRMD8 could serve as a potential target to revere tamoxifen resistance.

      The research is logically coherent and persuasive. The results support their conclusions and have achieved the research objectives.

    1. Reviewer #1 (Public review):

      Summary:

      The article entitled "Pu.1/Spi1 dosage controls the turnover and maintenance of microglia in zebrafish and mammals" by Wu et al., identifies a role for the master myeloid developmental regulator Pu.1 in the maintenance of microglial populations in the adult. Using a non-homologous end joining knock-in strategy, the authors generated a pu.1 conditional allele in zebrafish, which reports wildtype expression of pu.1 with EGFP and truncated expression of pu.1 with DsRed after Cre-mediated recombination. When crossed to existing pu.1 and spi-b mutants, this approach allowed the authors to target a single allele for recombination and induce homozygous loss-of-function microglia in adults. This identified that although there is no short-term consequence to loss of pu.1, microglia lacking any functional copy of pu.1 are depleted over the course of months, even when spi-b is fully functional. The authors go on to identify reduced proliferation, increased cell death, and higher expression of tp53 in the pu.1 deficient microglia, as compared to the wild-type EGFP+ microglia. To extend these findings to mammals, the authors generated a conditional Pu.1 allele in mice and performed similar analyses, finding that loss of a single copy of Pu.1 resulted in similar long-term loss of Pu.1-deficient microglia. The conclusions of this paper are overall well supported by the data.

      Strengths:

      The genetic approaches here for visualizing the recombination status of an endogenous allele are very clever, and by comparing the turnover of wildtype and mutant cells in the same animal the authors can make very convincing arguments about the effect of chronic loss of pu.1. Likely this phenotype would be either very subtle or nonexistent without the point of comparison and competition with the wildtype cells.

      Using multiple species allows for more generalizable results, and shows conservation of the phenomena at play.

      The demonstration of changes to proliferation and cell death in concert with higher expression of tp53 is compelling evidence for the authors' argument.

      Weaknesses:

      This paper is very strong. It would benefit from further investigating the specific relationship between pu.1 and tp53 specifically. Does pu.1 interact with the tp53 locus? Specific molecular analysis of this interaction would strengthen the mechanistic findings.

    2. Reviewer #2 (Public review):

      Summary:

      In the presented work by Wu et al, the authors investigate the role of the transcription factor Pu.1 in the survival and maintenance of microglia, the tissue-resident macrophage population in the brain. To this end, they generated a sophisticated new conditional pu.1 allele in zebrafish using CRISPR-mediated genome editing which allows visual detection of expression of the mutant allele through a switch from GFP to dsRed after Cre-mediated recombination. Using EdU pulse-chase labelling, they first estimated the daily turnover rate of microglia in the adult zebrafish brain which was found to be higher than rates previously estimated for mice and humans. After conditional deletion of pu.1 in coro1a positive cells, they do not find a difference in microglia number at 2 and 8 days or 1-month post-injection of Tamoxifen. However, at 3 months post-injection, a strong decrease in mutant microglia could be detected. While no change in microglia number was detected at 1mpi, an increase in apoptotic cells and decreased proliferation as observed. RNA-seq analysis of WT and mutant microglia revealed an upregulation of tp53, which was shown to play a role in the depletion of pu.1 mutant microglia as deletion in tp53-/- mutants did not lead to a decrease in microglia number at 3mpi. Through analysis of microglia number in pU.1 mutants, the authors further show that the depletion of microglia in the conditional mutants is dependent on the presence of WT microglia. To show that the phenomenon is conserved between species, similar experiments were also performed in mice.

      This work expands on previous in vitro studies using primary human microglia. The majority of conclusions are well supported by the data, addition of controls and experimental details would strengthen the conclusions and rigor of the paper.

      Strengths:

      Generation of an elegantly designed conditional pu.1 allele in zebrafish that allows for the visual detection of expression of the knockout allele.

      The combination of analysis of pu.1 function in two model systems, zebrafish and mouse, strengthens the conclusions of the paper.

      Confirmation of the functional significance of the observed upregulation of tp53 in mutant microglia through double mutant analysis provides some mechanistic insight.

      Weaknesses:

      (1) The presented RNA-Seq analysis of mutant microglia is underpowered and details on how the data was analyzed are missing. Only 9-15 cells were analyzed in total (3 pools of 3-5 cells each). Further, the variability in relative gene expression of ccl35b.1, which was used as a quality control and inclusion criterion to define pools consisting of microglia, is extremely high (between ~4 and ~1600, Figure S7A).

      (2) The authors conclude that the reduction of microglia observed in the adult brain after cKO of pu.1 in the spi-b mutant background is due to apoptosis (Lines 213-215). However, they only provide evidence of apoptosis in 3-5 dpf embryos, a stage at which loss of pu.1 alone does lead to a complete loss of microglia (Figure 2E). A control of pu.1 KI/d839 mutants treated with 4-OHT should be added to show that this effect is indeed dependent on the loss of spi-b. In addition, experiments should be performed to show apoptosis in the adult brain after cKO of pu.1 in spi-b mutants as there seems to be a difference in the requirement of pu.1 in embryonic and adult stages.

      (3) The number of microglia after pu.1 knockout in zebrafish did only show a significant decrease 3 months after 4-OHT injection, whereas microglia were almost completely depleted already 7 days after injection in mice. This major difference is not discussed in the paper.

      (4) Data is represented as mean +/-.SEM. Instead of SEM, standard deviation should be shown in all graphs to show the variability of the data. This is especially important for all graphs where individual data points are not shown. It should also be stated in the figure legend if SEM or SD is shown.

    1. Reviewer #1 (Public review):

      Summary:

      It is well known that neurons in the medial prefrontal cortex (mPFC) are involved in higher cognitive functions such as executive planning, motivational processing, and internal state-mediated decision-making. These internal states often correlate with the emotional states of the brain. While several studies point to the role of mPFC in regulating behavior based on such emotional states, the diversity of information processing in its sub-populations remains a less explored territory. In this study, the authors try to address this gap by identifying and characterizing some of these sub-populations in mice using a combination of projection-specific imaging, function-based tagging of neurons, multiple behavioral assays, and ex-vivo patch clamp recordings.

      Strengths:

      The authors targeted mPFC projections to the nucleus accumbens (NAc) and basolateral amygdala (BLA). Using the open field task (OFT), the authors identified four relevant behavioral states as well as neurons active while the animal was in the center region ("center-ON neurons"). By characterizing single-unit activity and using dimensionality reduction, the authors show differentiated coding of behavioral events at both the projection and functional levels. They further substantiate this effect by showing higher sensitivity of mPFC-BLA center-ON neurons during time spent in the open arms of the elevated plus maze (EPM). The authors then pivoted to the three-chamber social interaction (SI) assay to show the different subsets of neurons encode preference for social stimulus over non-social. This reveals an interesting diversity in the function of these sub-populations on multiple levels. Lastly, the authors used the tube test as a manipulation of the anxiety state of mice and compared behavioral differences before/after the OFT and social interaction tasks. This experiment revealed that "losers" of the tube test spend less time in the center of the open field while "winners" show a stronger preference for the familiar mouse over the object. Using patch-clamp experiments, the authors also found that "winners" exhibit stronger synaptic transmission in the mPFC-NAc projection while "losers" exhibit stronger synaptic transmission in the mPFC-BLA projection. Given the popularity of the tube test assay in rank determination, this provides useful insights into possible effects on anxiety levels and synaptic plasticity. Overall, the many experiments performed by the authors reveal interesting differences in mPFC neurons relative to their involvement in high or low anxiety behaviors, social preference, and social rank.

      Weaknesses:

      The authors focused primarily on female mice without commenting on the effect that sex differences would have on their results. While the authors have identified relevant behavioral states across the various behavioral tasks, there is still a missing link between them and "emotional states" - the phrase used by them emphatically throughout the manuscript. The authors have neither provided adequate references to satisfy this gap nor shared any data pertaining to relevant readouts such as cortisol levels. Both the projection-specific recordings and patch-clamp experiments, including histology reports in the manuscript, would provide essential information for anyone trying to replicate the results, especially since it's known that sub-populations in the BLA and NAc can have vastly different functions. The population-level analysis in the manuscript requires more rigor to reduce bias and statistical controls for establishing the significance of their results. Lastly, the tube test is used as a manipulation of the "emotional state" in several of the experiments. While the tube test can cause a temporary spike in anxiety of the participating mice, it is not known to produce a sustained effect - unless there are additional interventions such as forced social defeat. Thus, additional controls for these experiments are essential to support claims based on changes in the emotional state of mice. Apart from the methodology, the manuscript could also be improved with the addition of clear scatter points in all the plots along with detailed measures of the statistical tests such as exact p values and size of groups being compared.

    2. Reviewer #2 (Public review):

      Summary:

      The goal of this proposal was to understand how two separate projection neurons from the medial prefrontal cortex, those innervating the basolateral amygdala (BLA ) and nucleus accumbens (NAc), contribute to the encoding of emotional behaviors. The authors record the activity of these different neuron classes across three different behavioral environments. They propose that, although both populations are involved in emotional behavior, the two populations have diverging activity patterns in certain contexts. A subset of projections to the NAc appears particularly important for social behavior. They then attempt to link these changes to the emotional state of the animal and changes in synaptic connectivity.

      Strengths:

      The behavioral data builds on previous studies of these projection neurons supporting distinct roles in behavior and extend upon previous work by looking at the heterogeneity within different projection neurons across contexts.

      Weaknesses:

      The diversity of neurons mediating these projections and their targeting within the BLA and NAc is not explored. These are not homogeneous structures and so one possibility is that some of the diversity within their findings may relate to targeting of different sub-structures within each region. The electrophysiological data have significant experimental confounds and more methodological information is required to support other conclusions related to these data.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript investigates the distinct contributions of mPFC→BLA and mPFC→NAc pathways in emotional regulation, with implications for understanding anxiety, exploration, and social preference behaviors. Using Ca2+ imaging, optogenetics, and patch-clamp recording, the authors demonstrate pathway-specific roles in encoding emotional states of opposite valence. They further identify subsets of neurons ("center-ON") with heightened activity under anxiety-inducing conditions. These findings challenge the traditional view of functional similarity between these pathways and provide valuable insights into neural circuit dynamics relevant to emotional disorders.

      The study is well-designed and addresses an important topic, but several methodological and interpretational issues require clarification to strengthen the conclusions.

      Weaknesses:

      Major Weaknesses:

      (1) The manuscript does not clearly and consistently specify the sex of the mice used for behavioral and imaging experiments. Given the known influence of sex on emotional behaviors and neural activity, this omission raises concerns about the generalizability of the findings. The authors should make clear throughout the manuscript whether male, female, or mixed-sex cohorts were used and provide a rationale for their choice. If only one sex was used, the potential limitations of this approach should be explicitly discussed.

      (2) Mice lacking "center-ON" neurons were excluded from analysis, yet the manuscript draws broad conclusions about the encoding of emotional states by mPFC pathways. It is critical to justify this exclusion and discuss how it may limit the generalizability of the findings. The inclusion of data or contextualization for animals without center-ON neurons would strengthen the interpretation.

      (3) The manuscript lacks baseline activity comparisons for mPFC→BLA and mPFC→NAc pathways across subjects. Providing baseline data would contextualize the observed activity changes during behavior testing and help rule out inter-individual variability as a confounding factor.

      (4) Extensive behavioral testing across multiple paradigms may introduce stress and fatigue in the animals, which could confound the induction of emotional states. The authors should describe the measures taken to minimize these effects (e.g., recovery periods, randomized testing order) and discuss their potential impact on the results.

      (5) Grooming is described as a "non-anxiety" behavior, which conflicts with its established role as a stress-relieving behavior that may indicate anxiety. This discrepancy requires clarification, as the distinction is central to the conclusions about the mPFC→BLA pathway's role in differentiating anxiety-related and non-anxiety behaviors.

      (6) While the study highlights pathway-specific neural activity, it lacks a cohesive integration of these findings with the behavioral data. Quantifying the overlap or decorrelation of neuronal activity patterns across tasks would solidify claims about the specialization of mPFC→NAc and mPFC→BLA pathways. Likewise, the discussion should be expanded to place these findings in light of prior studies that have probed the roles of these pathways in social/emotion/valence-related behaviors.

      Minor Weaknesses:

      (1) The manuscript does not explicitly state whether the same mice were used across all behavioral assays. This information is critical for evaluating the validity of group comparisons. Additionally, more detail on sample sizes per assay would improve the manuscript's transparency.

      (2) In Figure 2G, the difference between BLA and NAc activity during exploratory behaviors (sniffing) is difficult to discern. Adjusting the scale or reformatting the figure would better illustrate the findings.

      (3) While the characteristics of the first social stimulus (M1) are specified, there is no information about the second social stimulus (M2). This omission makes it difficult to fully interpret the findings from the three-chamber test.

      (4) The methods section lacks detailed information about statistical approaches and animal selection criteria. Explicitly outlining these procedures would improve reproducibility and clarity.

    1. Reviewer #1 (Public review):

      Summary:

      The authors in this study extensively investigate how telomere length (TL) regulates hTERT expression via non-telomeric binding of the telomere-associated protein TRF2. They conclusively show that TRF2 binding to long telomeres results in a reduction in its binding to the hTERT promoter. In contrast, short telomeres restore TRF2 binding in the hTERT promoter, recruiting repressor complexes like PRC2, and suppressing hTERT expression. The study presents several significant findings revealing a previously unknown mechanism of hTERT regulation by TRF2 in a TL-dependent manner

      Strengths:

      (1) A previously unknown mechanism linking telomere length and hTERT regulation through the non-telomeric TRF2 protein has been established strengthening the telomere biology understanding.

      (2) The authors used both cancer cell lines and iPSCs to showcase their hypothesis and multiple parameters to validate the role of TRF2 in hTERT regulation.

      (3) Comprehensive integration of the recent literature findings and implementation in the current study.

      (4) In vivo validation of the findings.

      (5) Rigorous controls and well-designed assays have been use.

      Weaknesses:

      (1) The authors should comment on the cell proliferation and morphology of the engineered cell lines with ST or LT.

      (2) Also, the entire study uses engineered cell lines, with artificially elongated or shortened telomeres that conclusively demonstrate the role of hTERT regulation by TRF2 in telomere-length dependent manner, but using ALT negative cell lines with naturally short telomere length vs those with long telomeres will give better perspective. Primary cells can also be used in this context.

      (3) The authors set up time-dependent telomere length changes by dox induction, which may differ from the gradual telomere attrition or elongation that occurs naturally during aging, disease progression, or therapy. This aspect should be explored.

      (4) How does the hTERT regulation by TRF2 in a TL-dependent manner affect the ETS binding on hTERT mutant promoter sites?

      (5) Stabilization of the G-quadruplex structures in ST and LT conditions along with the G4 disruption experimentation (demonstrated by the authors) will strengthen the hypothesis.

      (6) The telomere length and the telomerase activity are not very consistent (Figure 2A, and S1A, Figure 4B and S3). Please comment.

      (7) Please comment on the other telomere-associated proteins or regulatory pathways that might contribute to hTERT expression based on telomere length.

    2. Reviewer #2 (Public review):

      Summary:

      Telomeres are key genomic structures linked to everything from aging to cancer. These key structures at the end of chromosomes protect them from degradation during replication and rely on a complex made up of human telomerase RNA gene (hTERC) and human telomerase reverse transcriptase (hTERT). While hTERC is expressed in all cells, the amount of hTERT is tightly controlled. The main hypothesis being tested is whether telomere length itself could regulate the hTERT enzyme. The authors conducted several experiments with different methods to alter telomere length and measured the binding of key regulatory proteins to this gene. It was generally observed that the shortening of telomere length leads to the recruitment of factors that reduce hTERT expression and lengthening of telomeres has the opposite effect. To rule out direct chromatin looping between telomeres and hTERT as driving this effect artificial constructs were designed and inserted a significant distance away and similar results were obtained.

      Overall, the claims of telomere length-dependent regulation of hTERT are supported throughout the manuscript.

      Strengths:

      The paper has several important strengths. Firstly, it uses several methods and cell lines that consistently demonstrate the same directionality of the findings. Secondly, it builds on established findings in the field but still demonstrates how this mechanism is separate from that which has been observed. Specifically, designing and implementing luciferase assays in the CCR5 locus supports that direct chromatin looping isn't necessary to drive this effect with TRF2 binding. Another strength of this paper is that it has been built on a variety of other studies that have established principles such as G4-DNA in the hTERT locus and TRF2 binding to these G4 sites.

      Weaknesses:

      The largest technical weakness of the paper is that minimal replicates are used for each experiment. I understand that these kinds of experiments are quite costly, and many of the effects are quite large, however, experiments such as the flow cytometry or the IPSC telomere length and activity assays appear to be based on a single sample, and several are based upon two maximum three biological replicates. If samples were added the main effects would likely hold, and many of the assays using GAPDH as a control would result in significant differences between the groups. This unnecessarily weakens the strength of the claims.

      Another detail that weakens the confidence in the claims is that throughout the manuscript there are several examples of the control group with zero variance between any of the samples: e.g. Figure 2K, Figure 3N, and Figure 6G. It is my understanding that a delta delta method has been used for calculation (though no exact formula is reported and would assist in understanding). If this is the case, then an average of the control group would be used to calculate that fold change and variance would exist in the group. The only way I could understand those control group samples always set to 1 is if a tube of cells was divided into conditions and therefore normalized to the control group in each case. A clearer description in the figure legend and methods would be required if this is what was done and repeated measures ANOVA and other statistics should accompany this.

      A final technical weakness of the paper is the data in Figure 5 where the modified hTERT promoter was inserted upstream of the luciferase gene. Specifically, it is unclear why data was not directly compared between the constructs that could and could not form G4s to make this point. For this reason, the large variance in several samples, and minimal biological replicates, this data was the least convincing in the manuscript (though other papers from this laboratory and others support the claim, it is not convincing standalone data).

      The second largest weakness of the paper is formatting.

      When I initially read the paper without a careful reading of the methods, I thought that the authors did not have appropriate controls meaning that if a method is applied to lengthen, there should be one that is not lengthened, and when a method is applied to shorten, one which is not shortened should be analysed as well. In fact, this is what the authors have done with isogenic controls. However, by describing all samples as either telomere short or telomere long, while this simplifies the writing and the colour scheme, it makes it less clear that each experiment is performed relative to an unmodified. I would suggest putting the isogenic control in one colour, the artificially shortened in another, and the artificially lengthened in another.

      Similarly, the graphs, in general, should be consistent with labelling. Figure 2 was the most confusing. I would suggest one dotted line with cell lines above it, and then the method of either elongation or shortening below it. I.e. HT1080 above, hTERC overexpression below, MDAMB-231 above guanine terminal repeats below, like was done on the right. Figure 2 readability would also be improved by putting hTERT promoter GAPDH (-ve control) under each graph that uses this (Panel B and Panel C not just Panel C). All information is contained in the manuscript but one must currently flip between figure legends, methods, and figures to understand what was done and this reduces clarity for the reader.

    1. for - Christine Wamsler - Lund University - homepage - from - youtube - Mindfulness World Community - Awareness, Care and Sustainability for Our Earth - https://hyp.is/GCUJ1APHEfCcr_vvv3lAFw/www.youtube.com/watch?v=CTUc_0GroGM

      research areas - sustainable cities - collaborative governance - city-citizen collaboration - citizen participation - sustainability and wellbeing - sustainability transformation - inner development goals - inner transformation - inner transition - existential sustainability

    1. Reviewer #1 (Public review):

      Summary:

      This paper introduces a new class of machine learning models for capturing how likely a specific nucleotide in a rearranged IG gene is to undergo somatic hypermutation. These models modestly outperform existing state-of-the-art efforts, despite having fewer free parameters. A surprising finding is that models trained on all mutations from non-functional rearrangements give divergent results from those trained on only silent mutations from functional rearrangements.

      Strengths:

      (1) The new model structure is quite clever and will provide a powerful way to explore larger models.

      (2) Careful attention is paid to curating and processing large existing data sets.

      (3) The authors are to be commended for their efforts to communicate with the developers of previous models and use the strongest possible versions of those in their current evaluation.

      Weaknesses:

      (1) 10x/single cell data has a fairly different error profile compared to bulk data. A synonymous model should be built from the same `briney` dataset as the base model to validate the difference between the two types of training data.

      (3) The decision to test only kernels of 7, 9, and 11 is not described. The selection/optimization of embedding size is not explained. The filters listed in Table 1 are not defined.

    2. Reviewer #2 (Public review):

      This work offers an insightful contribution for researchers in computational biology, immunology, and machine learning. By employing a 3-mer embedding and CNN architecture, the authors demonstrate that it is possible to extend sequence context without exponentially increasing the model's complexity.

      Key findings include:

      (1) Efficiency and Performance: Thrifty CNNs outperform traditional 5-mer models and match the performance of significantly larger models like DeepSHM.

      (2) Neutral Mutation Data: A distinction is made between using synonymous mutations and out-of-frame sequences for model training, with evidence suggesting these methods capture different aspects of SHM, or different biases in the type of data.

      (3) Open Source Contributions: The release of a Python package and pre-trained models adds practical value for the community.

      However, readers should be aware of the limitations. The improvements over existing models are modest, and the work is constrained by the availability of high-quality out-of-frame sequence data. The study also highlights that more complex modeling techniques, like transformers, did not enhance predictive performance, which underscores the role of data availability in such studies.

    3. Reviewer #3 (Public review):

      Summary:

      Modeling and estimating sequence context biases during B cell somatic hypermutation is important for accurately modeling B cell evolution to better understand responses to infection and vaccination. Sung et al. introduce new statistical models that capture a wider sequence context of somatic hypermutation with a comparatively small number of additional parameters. They demonstrate their model's performance with rigorous testing across multiple subjects and datasets. Prior work has captured the mutation biases of fixed 3-, 5-, and 7-mers, but each of these expansions has significantly more parameters. The authors developed a machine-learning-based approach to learn these biases using wider contexts with comparatively few parameters.

      Strengths:

      Well-motivated and defined problem. Clever solution to expand nucleotide context. Complete separation of training and test data by using different subjects for training vs testing. Release of open-source tools and scripts for reproducibility.

      Weaknesses:

      This study could be improved with better descriptions of dataset sequencing technology, sequencing depth, etc but this is a minor weakness.

    1. Reviewer #1 (Public review):

      In this manuscript, Purzner and colleagues examine the role of Ezh2 in cerebellar development and tumorigenesis using animal models of SHH medulloblastoma (MB). While Ezh2 plays a relatively minor role in granule neuron development and SHH MB, the authors demonstrate that Ezh2 inhibition, when combined with enforced cell cycle exit, promotes MB cell differentiation and potentially reduces malignancy. Overall, this study is solid and provides valuable insights into Ezh2 regulation in cerebellar development and SHH-MB tumorigenesis.

      Strengths:

      The authors investigate the role of Ezh2 in granule neuronal differentiation during cerebellar development and medulloblastoma (MB) progression, integrating multi-omics for a comprehensive epigenetic analysis. The use of Ezh2 conditional knockout (cKO) mice and combination therapy with Ezh2 and CDK4/6 inhibitors shows a promising strategy to induce terminal differentiation in MB cells, with potential therapeutic implications. Additionally, analysis of human SHH-MB samples reveals that higher EZH2 expression correlates with worse survival, indicating the clinical relevance.

      Weaknesses:

      The study does not fully explore compensatory mechanisms of PRC2 given that the phenotype of Ezh2 conditional knockout (cKO) in GNP development and MB tumor formation is relatively mild.

    2. Reviewer #2 (Public review):

      Summary:

      This study used an unbiased approach to evaluate epigenetic dynamics during the differentiation of granule neuron precursors, the cell of origin for Shh-MB. These profiling findings led to the focus on H3K27me3 dynamics, which correlate with the remodeling of epigenetic landscape associated with neuronal differentiation gene activation.

      Strengths:

      Depletion of EZH2, an enzymatic subunit of PRC2, resulted in premature neuronal differentiation in the developing cerebellum.

      Weaknesses:

      Little information is shown about the specific genetic programs disrupted by EZH2 depletion. This is a crucial weakness as existing PRC2 inhibitors do not effectively cross the blood-brain barrier. Further studies are necessary to identify downstream targets of PRC2 that could be targeted to induce neuronal differentiation in MB cells.

    1. Reviewer #1 (Public review):

      Summary:

      This study provides valuable and comprehensive information about the SARS-CoV-2 seroprevalence during 2021 and 2022 in different regions of Bolivia. Moreover, data on immune responses against the SARS-CoV-2 variants based on neutralization tests denotes the presence of several virus variants circulating in the Bolivian population. Evidence for seroprevalence data provided by the authors is solid, across the study period, while data regarding variant circulation is limited to the early stages of the pandemic.

      Strengths:

      The major strength of this study is that it provided nationwide seroprevalence estimates from infection and/or vaccination based on antibodies against both spike and the nucleocapsid protein in a large representative sample of sera collected at two time points from all departments of Bolivia, gaining insight into COVID-19 epidemiology. On the other hand, data from virus neutralization assays inferred the circulation during the study period of four SARS-CoV-2 variants in the population. Overall, the study results provide an overview of the level of viral transmission and vaccination and insights into the spread across the country of SARS-CoV-2 variants.

      Weaknesses:

      The assessment of a Lambda variant that circulated in several neighboring countries (Peru, Chile, and Argentina), which had a significant impact on the COVID-19 pandemic in the region, may have strengthened the study to contrast Gamma spread. In addition, even though neutralizing antibodies can certainly reveal previous infections of SARSCOV2 variants in the population, it is of limited value to infer from this information some potential timing estimates of specific variant circulation, considering the heterogeneous effects that past infections, vaccinations, or a combination of both could have on the level of variant-specific neutralizing antibodies and/or their cross-neutralization capacity.

      An appraisal of whether the authors achieved their aims, and whether the results support their conclusions.

      The conclusions of this paper are well supported by data, particularly regarding seroprevalence that reliably reflects the epidemiology of COVID-19 in Bolivia, and seroprevalence trends in other low- and middle-income countries.

      A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community.

      Since this is the first study that has been conducted to assess indicators of immunity against SARS-CoV-2 in the population of Bolivia at a nationwide scale, seroprevalence data provided by geographic regions at two time points can be useful as a reference for potential retrospective global meta-analysis and to further explore and compare the risk factors for infection, variant distribution, and the impact on infection and vaccination, gaining deeper insights into understanding the evolution of the COVID-19 pandemic in Bolivia and in the region.

    2. Reviewer #3 (Public review):

      Summary:

      This study attempts to reconstruct the history of the COVID-19 epidemic, with its successive waves of viral variants from SARS-CoV-2 seroprevalence during 2021 and 2022 among blood donors in different regions of Bolivia. By using serological tests "specific" for the various variants the authors try to achieve a "colour" vision that is not provided by standard "black-and-white" serology.

      Strengths and Weaknesses:<br /> I am not an expert on the performance of SARS-CoV-2 serological tests, so may overlook certain weaknesses. Instead I tried to assess whether the authors, in this manuscript, have managed to substantiate their claims that "seroprevalence studies are a valuable adjunct to active surveillance because they allow analysis of the level of immunity of a population to a specific pathogen without the need for prospective testing" , and that "genomic surveillance and serology offer distinct yet complementary insights thus far." I think they succeeded, as they paint a credible and interesting history of the epidemic in Bolivia using (to me) novel methodology that certainly will stimulate extensive discussion, controversies, and follow-up studies (for which the authors might make some suggestions).

    1. Reviewer #1 (Public review):

      Summary:

      This study demonstrates the significant role of secretory leukocyte protease inhibitor (SLPI) in regulating B. burgdorferi-induced periarticular inflammation in mice. They found that SLPI-deficient mice showed significantly higher B. burgdorferi infection burden in ankle joints compared to wild-type controls. This increased infection was accompanied by infiltration of neutrophils and macrophages in periarticular tissues, suggesting SLPI's role in immune regulation. The authors strengthened their findings by demonstrating a direct interaction between SLPI and B. burgdorferi through BASEHIT library screening and FACS analysis. Further investigation of SLPI as a target could lead to valuable clinical applications.

      The conclusions of this paper are mostly well supported by data. And the authors were responsive to the reviewers' comments.

      Comments on revised version:

      The authors have thoroughly addressed the previous concerns and improved the manuscript. The revisions have strengthened both the conclusions. I have no additional suggestions for improvement and recommend this manuscript for publication.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

      Strengths:

      Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

      Weaknesses:

      (a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

      Comments on revised verson:

      Several of the points were addressed in the revised manuscript, but the following issues remain:

      Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

      Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

      Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

      Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

      Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

    3. Reviewer #3 (Public review):

      Summary:

      The authors investigated the role of secretory leukocyte protease inhibitors (SLPI) in developing Lyme disease in mice infected with Borrelia burgdorferi. Using a combination of histological, gene expression, and flow cytometry analyses, they demonstrated significantly higher bacterial burden and elevated neutrophil and macrophage infiltration in SLPI-deficient mouse ankle joints. Furthermore, they also showed direct interaction of SLPI with B. burgdorferi, which likely depletes the local environment of SLPI and causes excessive protease activity. These results overall suggest ankle tissue inflammation in B. burgdorferi-infected mice is driven by unchecked protease activity.

      Strengths:

      Utilizing a comprehensive suite of techniques, this is the first study showing the importance of anti-protease-protease balance in the development of periarticular joint inflammation in Lyme disease.

      Weaknesses:

      Due to the limited sample availability, the authors investigated the serum level of SLPI in both Lyme arthritis patients and patients with earlier disease manifestations. This limitation is thoroughly discussed in the manuscript.

      Comments on revised version:

      I thank the authors for considering my comments carefully.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, authors have tried to repurpose cipargamin (CIP), a known drug against Plasmodium and Toxoplasma against Babesia. They proved the efficacy of CIP on Babesia in nanomolar range. In silico analyses revealed the drug resistance mechanism through a single amino acid mutation at amino acid position 921 on the ATP4 gene of Babesia. Overall, the conclusions drawn by the authors are well justified by their data. I believe this study opens up a novel therapeutic strategy against babesiosis.

      Strengths:

      Authors have carried out a comprehensive study. All the experiments performed were carried out methodically and logically.

    2. Reviewer #3 (Public review):

      Summary:

      The authors aim to establish that cipargamin can be used for the treatment of infection caused by Babesia organisms.

      Strengths:

      The study provides strong evidence that cipargamin is effective against various Babesia species. In vitro growth assays were used to establish that cipargamin is effective against Babesia bovis and Babesia gibsoni. Infection of mice with Babesia microti demonstrated that cipargamin is as effective as the combination of atovaquone plus azithromycin. Cipargamin protected mice from lethal infection with Babesia rodhaini. Mutations that confer resistance to cipargamin were identified in the gene encoding ATP4, a P-type Na ATPase that is found in other apicomplexan parasites, thereby validating ATP4 as the target of cipargamin. A 7-day treatment of cipagarmin, when combined with a single dose of tafenoquine, was sufficient to eradicate Babesia microti in a mouse model of severe babesiosis caused by lack of adaptive immunity.

      Weaknesses:

      Cipargamin was tested in vivo at a single dose administered daily for 7 days. Despite the prospect of using cipargamin for the treatment of human babesiosis, there was no attempt to identify the lowest dose of cipagarmin that protects mice from Babesia microti infection. In the SCID mouse model, cipargamin was tested in combination with tafenoquine but not with atovaquone and/or azithromycin, although the latter combination is often used as first-line therapy for human babesiosis caused by Babesia microti.

    1. Reviewer #1 (Public review):

      Summary:

      As our understanding of the immune system increases it becomes clear that murine models of Immunity cannot always prove an accurate model system for human immunity. However, mechanistic studies in humans are necessarily limited. To bridge this gap many groups have worked on developing humanised mouse models in which human immune cells are introduced into mice allowing their fine manipulation. However, since human immune cells will attack murine tissues, it has proven complex to establish a human-like immune system in mice. To help address this Vecchione et al, have previously developed several models using human cell transfer into mice with or without human thymic fragments that allow negative selection of autoreactive cells. In this report they focus on the examination of the function of the B-helper CD4 T-cell subsets T-follicular helper (Tfh) and T-peripheral helper (Tph) cells. They demonstrate that these cells are able to drive both autoantibody production and can also induce B-cell independent autoimmunity.

      Strengths:

      A strength of this paper is that currently there is no well-established model for Tfh or Tph in HIS mice and that currently there is no clear murine Tph equivalent making new models for the study of this cell type of value. Equally, since many HIS mice struggle to maintain effective follicular structures Tfh models in HIS mice are not well established giving additional value to this model.

      Weaknesses:

      A weakness of the paper is that the models seem to lack a clear ability to generate germinal centres in which Tfh may exert some of their key functions. In some cases, the definition of Tph-like does not seem to differentiate well between Tph and highly activated CD4 T-cells in general, partly since the literature around these cells has not fully resolved this point.

    2. Reviewer #2 (Public review):

      Summary:

      Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to use humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

      In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

      Strengths:

      (1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debateble, these description is valuable knowledge for this field of research.

      (2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

      Weaknesses:

      (1) In this manuscript, such as Fig. 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

      The authors added the data about FOXP3 expression among Tfh/Tph cells in the revised manuscript. This improved our data interpretation.

      (2) The definition of "Disease" discussed after Fig. 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

      The authors appropriately modified the manuscript and provided sufficient information about the definition of diseases.

      (3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Fig. 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

      The authors correctly cited their previous findings about the TCR repertoire variation. This strengthened the discussion of this study.

    1. Reviewer #1 (Public review):

      This paper by Ionescu et al. applies novel brain connectivity measures based on fMRI and serotonin PET both at baseline and following ecstasy use in rats. There are multiple strengths to this manuscript. First, the use of connectivity measures using temporal correlations of 11C-DASB PET, especially when combined with resting state fMRI, is highly novel and powerful. The effects of ecstasy on molecular connectivity of the serotonin network and salience network are also quite intriguing.

      The authors discussed their use of high-dose (1.3%) isolfurane in the context of a recent consensus paper on rat fMRI (Grandjean et al., "A Consensus Protocol for Functional Connectivity Analysis in the Rat Brain.") which found that medetomidine combined with low dose isoflurane provided optimal control of physiology and fMRI signal. The authors acknowledge their suboptimal anaesthetic regimen, which was chosen before the publication of the consensus paper. This likely explains, in part, why fMRI ICs in figure 2A appear fairly restricted.

      The PET ICs appear less bilateral than the fMRI ICs, which the authors attribute to lower SNR.

    2. Reviewer #2 (Public review):

      Summary:

      The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

      Strengths:

      Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

      Provides relevant information on the multivariate organization of serotoninergic system in the brain.

      Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

      Comments on revisions:

      I thank the authors for carefully addressing my comments and in particular for the interesting insights added to the discussion.

      I have just one last remark pertaining to the point of the sample size: rats undergoing the MDMA acute challenge constitute a relatively small sample (N=11); I feel there is a certain risk the results presented might not be particularly replicable. Could the authors prove the stability of their (main) results by randomly iterating the individuals included in their sample (e.g. via permutation tests)? Alternatively, including at least a justification of the sample size in the context of the available evidence would be valuable.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript aimed to study the role of Rudhira (also known as Breast Carcinoma Amplified Sequence 3), an endothelium-restricted microtubules-associated protein, in regulating of TGFβ signaling. The authors demonstrate that Rudhira is a critical signaling modulator for TGFβ signaling by releasing Smad2/3 from cytoskeletal microtubules and how that Rudhira is a Smad2/3 target gene. Taken together, the authors provide a model of how Rudhira contributes to TGFβ signaling activity to stabilize the microtubules, which is essential for vascular development.

      Strengths:

      The study used different methods and techniques to achieve aims and support conclusions, such as Gene Ontology analysis, functional analysis in culture, immunostaining analysis, and proximity ligation assay. This study provides unappreciated additional layer of TGFβ signaling activity regulation after ligand-receptor interaction.

      Weaknesses:

      (1) It is unclear how current findings provide a better understanding of Rudhira KO mice, which the authors published some years ago.

      (2) Why do they use HEK cells instead of SVEC cells in Fig 2 and 4 experiments?

      (3) A model shown in Fig 5E needs improvement to grasp their findings easily.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide a compelling method for characterizing communication within brain networks. The study engages important, biologically pertinent, concerns related to the balance of dynamics and structure in assessing the focal points of brain communication. The methods are clear, and seem broadly applicable, although they require some forethought about data and modeling choices.

      Strengths:

      The study is well-developed, providing overall clear exposition of relevant methods, as well as in-depth validation of the key network structural and dynamical assumptions. The questions and concerns raised in reading the text were always answered in time, with straightforward figures and supplemental materials.

      Weaknesses:

      In earlier drafts of the work, the narrative structure at times conflicts with the interpretability, however, this was greatly improved during revisions. The only remaining limitation for broad applicability lies in the full observability required in the current paradigm, however, the authors point at avenues for relaxing this assumption, which could be fruitful next steps for researchers aiming to deploy this work to EM or two-photon based datasets.

    1. Reviewer #1 (Public review):

      Summary:

      The paper addresses the problem of optimising the mapping of serum antibody responses against a known antigen. It uses the croEM analysis of polyclonal Fabs to antibody genes, with the ultimate aim of getting complete and accurate antibody sequences. The method, commonly termed EMPEM, is becoming increasingly used to understand responses in convalescent sera and optimisation of the workflows and provision of openly available tools is of genuine value to a growing number of people.

      The authors do not address the experimental aspects of the methods and do not present novel computational tools, rather they use a series of established computational methods to provide workflows that simplify the interpretation of the EM map in terms of the sequences of dominant antibodies.

      Strengths:

      The paper is well-written and clearly argued. The tests constructed seem appropriate and fair and demonstrate that the workflow works pretty well. For a small subset (~17%) of the EMPEM maps analysed the workflow was able to get convincing assignments of the V-genes.

    2. Reviewer #2 (Public review):

      In this manuscript, the authors seek to demonstrate that it is possible to sequence antibody variable domains from cryoEM reconstructions in combination with bottom-up LC-MSMS. In particular, they extract de novo sequences from single particle-cryo-EM-derived maps of antibodies using the "deep-learning tool ModelAngelo", which are run through the program Stitch to try to select the top scoring V-gene and construct a placeholder sequence for the CDR3 of both the heavy and light chain of the antibody under investigation. These reconstructed variable domains are then used as templates to guide the assembly of de novo peptides from LC-MS/MS data to improve the accuracy of the candidate sequence.

      Using this approach the authors claim to have demonstrated that "cryoEM reconstructions of monoclonal antigen-antibody complexes may contain sufficient information to accurately narrow down candidate V-genes and that this can be integrated with proteomics data to improve the accuracy of candidate sequences".

    1. Reviewer #2 (Public review):

      Summary:

      Mehta et al., in constructing E. coli strains unable to synthesize polyamines, noted that strains deficient in putrescine synthesis showed decreased movement on semisolid agar. They show that strains incapable of synthesizing putrescine have decreased expression of Type I pilin and, hence, decreased ability to perform pilin-dependent surface motility.

      Strengths:

      The authors characterize the specific polyamine pathways that are important for this phenomenon. RNAseq provides a detailed overview of gene expression in the strain lacking putrescine. They rule out potential effects of pilin phase variation on the phenotype. The data suggest homeostatic control of polyamine synthesis and metabolic changes in response to putrescine.

      Weaknesses:

      The authors do not, in the end, uncover the molecular details of pilin expression per se, but that would require significantly more analyses and data; the mechanisms of pilin regulation are complicated and still not completely understood.

    2. Reviewer #3 (Public review):

      Summary:

      This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

      Strengths:

      The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

      Weakness:

      The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

    1. Reviewer #1 (Public review):

      Summary:

      In this interesting and original paper, the authors examine the effect that heat stress can have on the ability of bacterial cells to evade infection by lytic bacteriophages. Briefly, the authors show that heat stress increases the tolerance of Klebsiella pneumoniae to infection by the lytic phage Kp11. They also argue that this increased tolerance facilitates the evolution of genetically encoded resistance to the phage. In addition, they show that heat can reduce the efficacy of phage therapy. Moreover, they define a likely mechanistic reason for both tolerance and genetically encoded resistance. Both lead to a reorganization of the bacterial cell envelope, which reduces the likelihood that phage can successfully inject their DNA.

      Strengths:

      I found large parts of this paper well-written and clearly presented. I also found many of the experiments simple yet compelling. For example, the experiments described in Figure 3 clearly show that prior heat exposure can affect the efficacy of phage therapy. In addition, the experiments shown in Figures 4 and 6 clearly demonstrate the likely mechanistic cause of this effect. The conceptual Figure 7 is clear and illustrates the main ideas well. I think this paper would work even without its central claim, namely that tolerance facilitates the evolution of resistance. The reason is that the effect of environmental stressors on stress tolerance has to my knowledge so far only been shown for drug tolerance, not for tolerance to an antagonistic species.

      Weaknesses:

      I did not detect any weaknesses that would require a major reorganization of the paper, or that may require crucial new experiments. However, the paper needs some work in clarifying specific and central conclusions that the authors draw. More specifically, it needs to improve the connection between what is shown in some figures, how these figures are described in the caption, and how they are discussed in the main text. This is especially glaring with respect to the central claim of the paper from the title, namely that tolerance facilitates the evolution of resistance. I am sympathetic to that claim, especially because this has been shown elsewhere, not for phage resistance but for antibiotic resistance. However, in the description of the results, this is perhaps the weakest aspect of the paper, so I'm a bit mystified as to why the authors focus on this claim. As I mentioned above, the paper could stand on its own even without this claim.

      More specific examples where clarification is needed:

      (1) A key figure of the paper seems to be Figure 2D, yet it was one of the most confusing figures. This results from a mismatch between the accompanying text starting on line 92 and the figure itself. The first thing that the reader notices in the figure itself is the huge discrepancy between the number of viable colonies in the absence of phage infection at the two-hour time point. Yet this observation is not even mentioned in the main text. The exclusive focus of the main text seems to be on the right-hand side of the figure, labeled "+Phage". It is from this right-hand panel that the authors seem to conclude that heat stress facilitates the evolution of resistance. I find this confusing, because there is no difference between the heat-treated and non-treated cells in survivorship, and it is not clear from this data that survivorship is caused by resistance, not by tolerance/persistence. (The difference between tolerance and resistance has only been shown in the independent experiments of Figure 1B.) Figure 2F supports the resistance claim, but it is not one of the strongest experiments of the paper, because the author simply only used "turbidity" as an indicator of resistance. In addition, the authors performed the experiments described therein at small population sizes to avoid the presence of resistance mutations. But how do we know that the turbidity they describe does not result from persisters?

      I see three possibilities to address these issues. First, perhaps this is all a matter of explaining and motivating this particular experiment better. Second, the central claim of the paper may require additional experiments. For example, is it possible to block heat induced tolerance through specific mutations, and show that phage resistance does not evolve as rapidly if tolerance is blocked? A third possibility is to tone down the claim of the paper, and make it about heat tolerance rather than the evolution of heat resistance.

      A minor but general point here is that in Figure 2D and in other figures, the labels "-phage" and "+phage" do not facilitate understanding, because they suggest that cells in the "-phage" treatment have not been exposed to phage at all, but that is not the case. They have survived previous phage treatment and are then replated on media lacking phage.

      (2) Another figure with a mismatch between text and visual materials is Figure 5, specifically Figures 5B-F. The figure is about two different mutants, and it is not even mentioned in the text how these mutants were identified, for example in different or the same replicate populations. What is more, the two mutants are not discussed at all in the main text. That is, the text, starting on line 221 discusses these experiments as if there was only one mutant. This is especially striking as the two mutants behave very differently, as, for example, in Figure 5C. Implicitly, the text talks about the mutant ending in "...C2", and not the one ending in "...C1". To add to the confusion, the text states that the (C2) mutant shows a change in the pspA gene, but in Figure 5f, it is the other (undiscussed) mutant that has a mutation in this gene. Only pspA is discussed further, so what about the other mutants? More generally, it is hard to believe that these were the only mutants that occurred in the genome during experimental evolution. It would be useful to give the reader a 2-3 sentence summary of the genetic diversity that experimental evolution generated.

    2. Reviewer #2 (Public review):

      Summary:

      An initial screening of pretreatment with different stress treatments of K. pneumoniae allowed the identification of heat stress as a protection factor against the infection of the lytic phage Kp11. Then experiments prove that this is mediated not by an increase of phage-resistant bacteria but due to an increase in phage transient tolerant population, which the authors identified as bacteriophage persistence in analogy to antibiotic persistence. Then they proved that phage persistence mediated by heat shock enhanced the evolution of bacterial resistance against the phage. The same trait was observed using other lytic phages, their combinations, and two clinical strains, as well as E. coli and two T phages, hence the phenomenon may be widespread in enterobacteria.

      Next, the elucidation of heat-induced phage persistence was done, determining that phage adsorption was not affected but phage DNA internalization was impaired by the heat pretreatment, likely due to alterations in the bacterial envelope, including the downregulation of envelope proteins and of LPS; furthermore, heat treated bacteria were less sensitive to polymyxins due to the decrease in LPS.

      Finally, cyclic exposure to heat stress allowed the isolation of a mutant that was both resistant to heat treatment, polymyxins, and lytic phage, that mutant had alterations in PspA protein that allowed a gain of function and that promoted the reduction of capsule production and loss of its structure; nevertheless this mutant was severely impaired in immune evasion as it was easily cleared from mice blood, evidencing the tradeoffs between phage/heat and antibiotic resistance and the ability to counteract the immune response.

      Strengths:

      The experimental design and the sequence in which they are presented are ideal for the understanding of their study and the conclusions are supported by the findings, also the discussion points out the relevance of their work particularly in the effectiveness of phage therapy, and allows the design of strategies to improve their effectiveness.

      Weaknesses:

      In its present form, it lacks the incorporation of some relevant previous work that explored the role of heat stress in phage susceptibility, antibiotic susceptibility, tradeoffs between phage resistance and resistance against other kinds of stress, virulence, etc., and the fact that exposure to lytic phages induces antibiotic persistence.

    3. Reviewer #3 (Public review):

      PspA, a key regulator in the phage shock protein system, functions as part of the envelope stress response system in bacteria, preventing membrane depolarization and ensuring the envelope stability. This protein has been associated in the Quorum Sensing network and biofilm formation. (Moscoso M., Garcia E., Lopez R. 2006. Biofilm formation by Streptococcus pneumoniae: role of choline, extracellular DNA, and capsular polysaccharide in microbial accretion. J. Bacteriol. 188:7785-7795; Vidal JE, Ludewick HP, Kunkel RM, Zähner D, Klugman KP. The LuxS-dependent quorum-sensing system regulates early biofilm formation by Streptococcus pneumoniae strain D39. Infect Immun. 2011 Oct;79(10):4050-60.)

      It is interesting and very well-developed.

      (1) Could the authors develop experiments about the relationship between Quorum Sensing and this protein?

      (2) It would be interesting to analyze the link to phage infection and heat stress in relation to Quorum. The authors could study QS regulators or AI2 molecules.

      (3) Include the proteins or genes in a table or figure from lytic phage Kp11 (GenBank: ON148528.1).

    1. Reviewer #1 (Public review):

      This manuscript presents an interesting exploration of the potential activation mechanisms of DLK following axonal injury. While the experiments are beautifully conducted and the data are solid, I feel that there is insufficient evidence to fully support the conclusions made by the authors.

      In this manuscript, the authors exclusively use the puc-lacZ reporter to determine the activation of DLK. This reporter has been shown to be induced when DLK is activated. However, there is insufficient evidence to confirm that the absence of reporter activation necessarily indicates that DLK is inactive. As with many MAP kinase pathways, the DLK pathway can be locally or globally activated in neurons, and the level of DLK activation may depend on the strength of the stimulation. This reporter might only reflect strong DLK activation and may not be turned on if DLK is weakly activated.

      As noted by the authors, DLK has been implicated in both axon regeneration and degeneration. Following axotomy, DLK activation can lead to the degeneration of distal axons, where synapses are located. This raises an important question: how is DLK activated in distal axons? The authors might consider discussing the significance of this "synapse connection-dependent" DLK activation in the broader context of DLK function and activation mechanisms.

    2. Reviewer #2 (Public review):

      Summary:

      The authors study a panel of sparsely labeled neuronal lines in Drosophila that each form multiple synapses. Critically, each axonal branch can be injured without affecting the others, allowing the authors to differentiate between injuries that affect all axonal branches versus those that do not, creating spared branches. This is a highly powerful model. Axonal injuries are known to cause Wnd (mammalian DLK)-dependent retrograde signals to the cell body, culminating in a transcriptional response. This work identifies a fascinating new phenomenon that this injury response is not all-or-none. If even a single branch remains uninjured, the injury signal is not activated in the cell body. The authors rule out that this could be due to changes in the abundance of Wnd (perhaps if incrementally activated at each injured branch) by Wnd, Hiw's known negative regulator. Thus there is both a yet-undiscovered mechanism to regulate Wnd signaling, and more broadly a mechanism by which the neuron can integrate the degree of injury it has sustained. It will now be important to tease apart the mechanism(s) of this fascinating phenomenon. But even absent a clear mechanism, this is a new biology that will inform the interpretation of injury signaling studies across species.

      Strengths:

      - A conceptually beautiful series of experiments that reveal a fascinating new phenomenon is described, with clear implications (as the authors discuss in their Discussion) for injury signaling in mammals.<br /> - Suggests a new mode of Wnd regulation, independent of Hiw.

      Weaknesses:

      -The use of a somatic transcriptional reporter for Wnd activity is powerful, however, the reporter indicates whether the transcriptional response was activated, not whether the injury signal was received. It remains possible that Wnd is still activated in the case of a spared branch, but that this activation is either local within the axons (impossible determine in the absence of a local reporter) or that the retrograde signal was indeed generated but it was somehow insufficient to activate transcription when it entered the cell body. This is more of a mechanistic detail (and likely an extreme technical challenge to assess) and should not detract from the overall importance of the study

      -That the protective effect of a spared branch is independent of Hiw, the known negative regulator of Wnd, is fascinating. But this leaves open a key question: what is the signal?

      Comments on revisions:

      I appreciate your discussion about the potential bi-modal regulation of the puckered transcriptional reporter and think that readers would benefit from a short discussion of this.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript seeks to understand how nerve injury-induced signaling to the nucleus is influenced, and it establishes a new location where these principles can be studied. By identifying and mapping specific bifurcated neuronal innervations in the Drosophila larvae, and using laser axotomy to localize the injury, the authors find that sparing a branch of a complex muscular innervation is enough to impair Wallenda-puc (analogous to DLK-JNK-cJun) signaling that is known to promote regeneration. It is only when all connections to the target are disconnected that cJun-transcriptional activation occurs.

      Overall, this is a thorough and well-performed investigation of the mechanism of spared-branch influence on axon injury signaling. The findings on control of wnd are important because this is a very widely used injury signaling pathway across species and injury models. The authors present detailed and carefully executed experiments to support their conclusions. Their effort to identify the control mechanism is admirable and will be of aid to the field as they continue to try to understand how to promote better regeneration of axons.

      Strengths:

      The paper does a very comprehensive job of investigating this phenomenon at multiple locations and through both pinpoint laser injury as well as larger crush models. They identify a non-hiw based restraint mechanism of the wnd-puc signaling axis that presumably is originating from the spared terminal. They also present a large list of tests they performed to identify the actual restraint mechanism from the spared branch, which has ruled out many of the most likely explanations. This is an extremely important set of information to report, to guide future investigators in this and other model organisms on mechanisms by which regeneration signaling is controlled (or not).

      Weaknesses:

      While there are many questions raised by these results that are not answered here, including the pathways upstream and downstream of DLK and how the binary switch control of DLK/puc signaling is executed, the model built in this manuscript is valuable to future work going after these important questions.

      Because the conclusions of the paper are focused on a single (albeit well validated) reporter in different types of motor neurons, it is hard to determine whether the mechanism of spared branch inhibition of regeneration requires wnd-puc (DLK/cJun) signaling, or whether this is a binary/threshold response in all contexts (for example, sensory axons or interneurons). However, the author points out in the response that there are sensory neuron examples where a spared connection does not block DLK activation. As such, it may not be a universal mechanism but could provide a model for better understanding of DLK control across different contexts.

      Comments on revisions:

      The new panels in Figure 1E do not have Y-axis labels. (mean puc-lacZ intensity?)

    1. Reviewer #1 (Public review):

      Summary:

      The authors of this study set out to find RNA binding proteins in the CNS in cell-type specific sequencing data and discover that the cardiomyopathy-associated protein RBM20 is selectively expressed in olfactory bulb glutamatergic neurons and PV+ GABAergic neurons. They make an HA-tagged RBM20 allele to perform CLIP-seq to identify RBM20 binding sites and find direct targets of RBM20 in olfactory bulb glutmatergic neurons. In these neurons, RBM20 binds intronic regions. RBM20 has previously been implicated in splicing, but when they selectively knockout RBM20 in glutamatergic neurons they do not see changes in splicing, but they do see changes in RNA abundance, especially of long genes with many introns, which are enriched for synapse-associated functions. These data show that RBM20 has important functions in gene regulation in neurons, which was previously unknown, and they suggest it acts through a mechanism distinct from what has been studied before in cardiomyocytes.

      Strengths:

      The study finds expression of the cardiomyopathy-associated RNA binding protein RBM20 in specific neurons in the brain, opening new windows into its potential functions there.

      The study uses CLIP-seq to identify RBM20 binding RNAs in olfactory bulb neurons.

      Conditional knockout of RBM20 in glutamatergic or PV neurons allows the authors to detect mRNA expression that is regulated by RBM20.

      The data include substantial controls and quality control information to support the rigor of the findings.

      Weaknesses:

      The authors do not fully identify the mechanism by which RBM20 acts to regulate RNA expression in neurons, though they do provide data suggesting that neuronal RBM20 does not regulate alternate splicing in neurons, which is an interesting contrast to its proposed mechanism of function in cardiomyocytes. Discovery of the RNA regulatory functions of RBM20 in neurons is left as a question for future studies.

      The study does not identify functional consequences of the RNA changes in the conditional knockout cells, so this is also a question for the future.

    2. Reviewer #2 (Public review):

      Summary:

      The group around Prof. Scheiffele has made seminal discoveries reg. alternative splicing that is reflected by a current ERC advanced grant and landmark papers in eLife (2015), Science (2016), and Nature Neuroscience (2019). Recently, the group investigated proteins that contain an RRM motif in the mouse cortex. One of them, termed RBM20, was originally thought be muscle-specific and involved in alternative splicing in cardiomyocytes. However, upon close inspection, RBP20 is expressed in a particular set of interneurons (PV positive cells of the somatosensory cortex) in the cortex as well as in mitral cells of the olfactory bulb (OB). Importantly, they used CLIP to identify targets in the OB and heart. Next and quite importantly, they generated a knock-in mouse line with a His-biotin acceptor peptide and a HA epitope to perform specific biochemistry. Not surprisingly, this allowed them to specifically identify transcripts with long introns, however, most of the intronic binding sites were very distant to the splice sites. Closer GO term inspection revealed that RBM20 specifically regulates synapse-related transcripts. In order to get in vivo insight into its function in the brain, the authors generated both global as well as conditional KO mice. Surprisingly, there were no significant differences in in RBM20 PV interneurons, however, 409 transcripts were deregulated in in OB glutamatergic neurons. Here, CLIP sites were mostly found to be very distant from differentially expressed exons. Furthermore, loss-of-function RBM20 primarily yields loss of transcripts, whereas upregulation appears to be indirect. Together, these results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Strengths:

      The quality of the data and the figures is high, impressive and convincing. The reported results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Weaknesses:

      In their revised manuscript, the authors significantly improved the intro and results section, which is now much better suited for the general public and allows better to follow the logic of the experiments. Also, the discussion has now been expanded doing better justice to the importance of the findings presented.

      In my opinion, the revised manuscript clearly improved and represents a timely and important study, which provides major new insight into the expression and possible function of RBM20 in tissues outside of muscle.

    3. Reviewer #3 (Public review):

      Summary:

      The authors identified RBM20 expression in neural tissues using cell type-specific transcriptomic analysis. This discovery was further validated through in vitro and in vivo approaches, including RNA fluorescent in situ hybridization (FISH), open-source datasets, immunostaining, western blotting, and gene-edited RBM20 knockout (KO) mice. CLIP-seq and RiboTRAP data demonstrated that RBM20 regulates common targets in both neural and cardiac tissues, while also modulating tissue-specific targets. Furthermore, the study revealed that neuronal RBM20 governs long pre-mRNAs encoding synaptic proteins.

      Strengths:

      • Utilization of a large dataset combined with experimental evidence to identify and validate RBM20 expression in neural tissues.<br /> • Global and tissue-specific RBM20 KO mouse models provide robust support for RBM20 localization and expression.<br /> • Employing heart tissue as a control highlights the unique findings in neural tissues.

      Weaknesses:

      • Lack of physiological functional studies to explore RBM20's role in neural tissues.<br /> • Data quality requires improvement for stronger conclusions.

      Comments on revisions:

      The authors have effectively addressed most of my concerns, which has significantly improved the quality and reliability of the data. While sufficient functional data were not provided, the current findings offer valuable and novel insights into the expression of RBM20 in neurons. I have no further concerns.

    1. Reviewer #1 (Public review):

      Summary:

      The aim of this paper is to develop a simple method to quantify fluctuations in the partitioning of cellular elements. In particular, they propose a flow-cytometry-based method coupled with a simple mathematical theory as an alternative to conventional imaging-based approaches.

      Strengths:

      The approach they develop is simple to understand and its use with flow-cytometry measurements is clearly explained. Understanding how the fluctuations in the cytoplasm partition vary for different kinds of cells is particularly interesting.

      Weaknesses:

      The theory only considers fluctuations due to cellular division events. This seems a large weakness because it is well known that fluctuations in cellular components are largely affected by various intrinsic and extrinsic sources of noise and only under particular conditions does partitioning noise become the dominant source of noise.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present a combined experimental and theoretical workflow to study partitioning noise arising during cell division. Such quantifications usually require time-lapse experiments, which are limited in throughput. To bypass these limitations, the authors propose to use flow-cytometry measurements instead and analyse them using a theoretical model of partitioning noise. The problem considered by the authors is relevant and the idea to use statistical models in combination with flow cytometry to boost statistical power is elegant. The authors demonstrate their approach using experimental flow cytometry measurements and validate their results using time-lapse microscopy. However, while I appreciate the overall goal and motivation of this work, I was not entirely convinced by the strength of this contribution. The approach focuses on a quite specific case, where the dynamics of the labelled component depend purely on partitioning. As such it seems incompatible with studying the partitioning noise of endogenous components that exhibit production/turnover. The description of the methods was partly hard to follow and should be improved. In addition, I have several technical comments, which I hope will be helpful to the authors.

      Comments:

      (1) In the theoretical model, copy numbers are considered to be conserved across generations. As a consequence, concentrations will decrease over generations due to dilution. While this consideration seems plausible for the considered experimental system, it seems incompatible with components that exhibit production and turnover dynamics. I am therefore wondering about the applicability/scope of the presented approach and to what extent it can be used to study partitioning noise for endogenous components. As presented, the approach seems to be limited to a fairly small class of experiments/situations.

      (2) Similar to the previous comment, I am wondering what would happen in situations where the generations could not be as clearly identified as in the presented experimental system (e.g., due to variability in cell-cycle length/stage). In this case, it seems to be challenging to identify generations using a Gaussian Mixture Model. Can the authors comment on how to deal with such situations? In the abstract, the authors motivate their work by arguing that detecting cell divisions from microscopy is difficult, but doesn't their flow cytometry-based approach have a similar problem?

      (3) I could not find any formal definition of division asymmetry. Since this is the most important quantity of this paper, it should be defined clearly.

      (4) The description of the model is unclear/imprecise in several parts. For instance, it seems to me that the index "i" does not really refer to a cell in the population, but rather a subpopulation of cells that has undergone a certain number of divisions. Furthermore, why is the argument of Equation 11 suddenly the fraction f as opposed to the component number? I strongly recommend carefully rewriting and streamlining the model description and clearly defining all quantities and how they relate to each other.

      (5) Similarly, I was not able to follow the logic of Section D. I recommend carefully rewriting this section to make the rationale, logic, and conclusions clear to the reader.

      (6) Much theoretical work has been done recently to couple cell-cycle variability to intracellular dynamics. While the authors neglect the latter for simplicity, it would be important to further discuss these approaches and why their simplified model is suitable for their particular experiments.

      (7) In the discussion the authors note that the microscopy-based estimates may lead to an overestimation of the fluctuations due to limited statistics. I could not follow that reasoning. Due to the gating in the flow cytometry measurements, I could imagine that the resulting populations are more stringently selected as compared to microscopy. Could that also be an explanation? More generally, it would be interesting to see how robust the results are in terms of different gating diameters.

      (8) It would be helpful to show flow cytometry plots including the identified subpopulations for all cell lines, currently, they are shown only for HCT116 cells. More generally, very little raw data is shown.

      (9) The title of the manuscript could be tailored more to the considered problem. At the moment it is very generic.

    1. Reviewer #1 (Public review):

      Summary:

      This study was motivated by the general claim that delayed development of cognitive control can be beneficial for learning, and investigated this claim in the specific domain of conceptual development. A comprehensive set of computational model simulations showed that delaying the onset of semantic control produces faster learning with only minimal effects on conceptual abstraction. The simulations also showed that control was most effective at intermediate levels between modality-specific "spokes" and the multimodal "hub". A meta-analysis of developmental data was consistent with the claim of delayed onset of semantic control: young children show substantially better semantic knowledge than the ability to constrain that knowledge to a specific task at hand.

      Strengths:

      The computational modelling is based on a very well-established model of semantic cognition, which means that the simulations allow exploring the specific issues under investigation here in the context of a model that accounts for a very large set of semantic cognition phenomena. The simulations are comprehensive - manipulating different parameters of the model provides important insights into how (and why) it works.

      In addition to simulations exploring delayed maturation, there is an exploration of where semantic control is most effective, yielding the interesting result that control is most effective when it targets intermediate levels of semantic processing. To my knowledge, this is a novel finding and a concrete prediction for future testing.

      The meta-analysis is designed in a very clever way that allows extracting evidence of semantic control from a large body of prior work. The results are quite clear and compelling in showing that semantic knowledge is acquired before children are able to use task demands to constrain the use of that knowledge.

      Weaknesses:

      Computational models of cognition inherently require simplification in order to focus on the mechanisms under investigation. However, it is also important to keep these simplifications in mind because they limit the generality of the inferences that can be made from the simulation results. Two aspects are important in this context:

      (1) The multimodal structure was orthogonal to the surface similarity structure of the concepts to be learned. It is certainly true that multimodal structure does not perfectly mirror surface similarity, but closely related things tend to be perceptually similar. There are exceptions (whales, penguins, etc.), but they are *exceptional*, not typical. It may be that the somewhat extreme dissociation of multimodal and surface similarity structures creates demands that are not faced in natural conceptual development.

      (2) Much of the benefit of delayed semantic control seems to be because the model is not penalised for activating task-irrelevant features. This blurs the distinction between being aware of a feature and making a response based on that feature. A full model that also includes a response layer could become a lot more complicated and more difficult to understand, so maybe there is an advantage to using a simpler architecture.

      In addition, there is a bit of a misalignment between the model simulations and the meta-analysis. In the model, there are distinct modality-specific "spokes" and control is required in order to focus on modality/spoke in a task-appropriate way. The meta-analysis does not compare a task-defined selection of a modality; it compares the selection of taxonomic vs thematic relations, both of which are multimodal. One way to resolve this is to say that taxonomic and thematic relations are also represented in distinct sub-systems of semantic knowledge and semantic control is needed to select between them in a task-appropriate way.

      This is particularly relevant to the inference at the bottom of p. 38: "taxonomic and thematic relationships ...[are]... both being encoded within the same system of representation", which seems in direct contradiction to the present results, or at least to the logic of combining these simulations with this meta-analysis. The simulations are based on semantic control being used to select/constrain the correct distinct sub-system (modality-specific spoke); the meta-analysis is based on semantic control being used to select/constrain the correct relationship type. If these two things are analogous in some way, then the relationship type has to be something like a distinct sub-system.

    2. Reviewer #2 (Public review):

      Summary:

      This paper investigates the idea that the protracted maturation of the prefrontal cortex - often viewed as a developmental limitation - may actually confer advantages for conceptual learning in children. The authors focus on semantic control processes, which govern the context-sensitive application of conceptual knowledge, and are closely associated with late-developing regions of the prefrontal cortex.

      Drawing on a computational model, the paper formally tests whether delayed maturation of semantic control promotes the acquisition of conceptual knowledge. The simulations demonstrate that when semantic control and anatomical connectivity mature later, conceptual learning is accelerated without compromising the integrity of the learned representations. Notably, the benefit is most apparent when control connections target intermediate layers in the computational model, suggesting a nuanced interplay between control processes and the underlying conceptual network.

      To validate these computational insights in a human developmental context, the authors conduct a meta-analysis of the classic triadic matching task - a paradigm where participants decide which of two choices best matches a reference concept based on either taxonomic or thematic relations. Critically, when these relations conflict, semantic control is required to select the context-appropriate match. Results indicate that context-sensitive semantic control develops more slowly than basic conceptual knowledge, showing marked improvements between 3 and 6 years of age.

      Overall, the paper argues that the delayed development of prefrontal cortex-based control processes allows for a period of less constrained learning, ultimately enhancing conceptual acquisition. The findings challenge the traditional view of late PFC maturation as solely disadvantageous and instead position it as an adaptive feature for building robust conceptual frameworks in early childhood.

      Strengths:

      (1) Novel Theoretical Contribution<br /> The paper offers a compelling, counterintuitive argument that a developmental lag in the maturation of control processes might be beneficial for semantic learning. This stands in contrast to the conventional framing of late prefrontal cortex (PFC) development as purely disadvantageous (e.g., a "necessary but unfortunate" constraint).

      (2) Well-Grounded Computational Approach<br /> The authors propose a neural network model that is both theoretically driven (hub-and-spoke framework) and systematically tested under various conditions (different timelines for control onset, and different connectivity patterns). Their simulations replicate and extend previous findings about how insulating the multimodal hub from direct control inputs helps preserve abstract conceptual representations.

      (3) Neuro-anatomical basis<br /> The paper connects its computational claims to empirical neuroanatomy, particularly the lack of direct structural connectivity between ventral ATL (the "hub") and the PFC in humans. This lends biological plausibility to the argument that control signals likely reach the ATL via intermediate regions (e.g., posterior temporal cortex).

      (4) Meta-Analysis of Triadic Match-to-Sample<br /> The authors leverage decades of developmental data on conceptual matching tasks, reframing them in terms of semantic control vs. semantic representation. Their analysis nicely illustrates that children can identify semantic relationships (taxonomic or thematic) at age 2 if the task does not require them to select between conflicting semantic relations. In contrast, the ability to choose a task-relevant relation only emerges more robustly in 3-6 years. This developmental pattern aligns with the computational model's predictions.

      Weaknesses:

      The contribution of the paper might be considered rather specialist, and might not appeal to a broad public, which should be typical of a generalist journal. Moreover, the scope of the model is fairly narrow - its relatively small, controlled training environment raises questions about scalability to more naturalistic, high-dimensional data. Finally, the meta-analysis does not test directly the model predictions in terms of specific outcomes of the task, error patterns, or model fit, but only the developmental pattern which was an already observed phenomenon that in part motivated the hypothesis and the model itself.

    1. Reviewer #1 (Public review):

      Summary:

      Pavel et al. analyzed a cohort of atrial fibrillation (AF) patients from the University of Illinois at Chicago, identifying TTN truncating variants (TTNtvs) and TTN missense variants (TTNmvs). They reported a rare TTN missense variant (T32756I) associated with adverse clinical outcomes in AF patients. To investigate its functional significance, the authors modeled the TTN-T32756I variant using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). They demonstrated that mutant cells exhibit aberrant contractility, increased activity of the cardiac potassium channel KCNQ1 (Kv7.1), and dysregulated calcium homeostasis. Interestingly, these effects occurred without compromising sarcomeric integrity. The study further identified increased binding of the titin-binding protein Four-and-a-Half Lim domains 2 (FHL2) with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I iPSC-aCMs.

      Strengths:

      This work has translational potential, suggesting that targeting KCNQ1 or FHL2 could represent a novel therapeutic strategy for improving cardiac function. The findings may also have broader implications for treating patients with rare, disease-causing variants in sarcomeric proteins and underscore the importance of integrating genomic analysis with experimental evidence to advance AF research and precision medicine.

      Weaknesses:

      (1) Variant Identification: It is unclear how the TTN missense variant (T32756I) was identified using REVEL, as none of the patients' parents reportedly carried the mutation or exhibited AF symptoms. Are there other TTN variants identified in the three patients carrying TTN-T32756I? Clarification on this point is necessary.

      (2) Patient-Specific iPSC Lines: Since the TTN-T32756I variant was modeled using only one healthy iPSC line, it is unclear whether patient-specific iPSC-derived atrial cardiomyocytes would exhibit similar AF-related phenotypes. This limitation should be addressed.

      (3) Hypertension as a Confounding Factor: The three patients carrying TTN-T32756I also have hypertension. Could the hypertension associated with this variant contribute secondarily to AF? The authors should discuss or rule out this possibility.

      (4) FHL2 and KCNQ1-KCNE1 Interaction: Immunostaining data demonstrating the colocalization of FHL2 with the KCNQ1-KCNE1 (MinK) complex in TTN-T32756I iPSC-aCMs are needed to strengthen the mechanistic findings.

      (5) Functional Characterization of FHL2-KCNQ1-KCNE1 Interaction: Additional functional assays are necessary to characterize the interaction between FHL2 and the KCNQ1-KCNE1 complex in TTN-T32756I iPSC-aCMs to further validate the proposed mechanism.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present data from a single-center cohort of African-American and Hispanic/Latinx individuals with atrial fibrillation (AF). This study provides insight into the incidences and clinical impact of missense variants in the Titin (TTN) gene in this population. In addition, the authors identified a single amino acid TTN missense variant (TTN-T32756I) that was further studied using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). These studies demonstrated that the Four-and-a-Half Lim domains 2 (FHL2), has increased binding with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I-iPSC-aCMs, enhancing the slow delayed rectifier potassium current (Iks) and is a potential mechanism for atrial fibrillation. Finally, the authors demonstrate that suppression of FHL2 could normalize the Iks current.

      Strengths:

      The strengths of this manuscript/study are listed below:

      (1) This study includes a previously underrepresented population in the study of the genetic and mechanistic basis of AF.<br /> (2) The authors utilize current state-of-the-art methods to investigate the pathogenicity of a specific TTN missense variant identified in this underrepresented patient population.<br /> (3) The findings of this study identify a potential therapeutic for treating atrial fibrillation.

      Weaknesses:

      (1) The authors do not include a non-AF group when evaluating the incidence and clinical significance of TTN missense variants in AF patients.

      (2) The authors do not provide evidence that TTN-T32756I-iPSC-aCMs are arrhythmogenic only that there is an increase in the Iks current and associated action potential changes. More specifically, the authors report "compared to the WT, TTN-T32756I-iPSC-aCMs exhibited increased arrhythmic frequency" yet is it is unclear what they are referring to by "arrhythmic frequency".

      (3) There seem to be discrepancies regarding the impact of the TTN-T32756I variant on mechanical function. Specifically, the authors report "both reduced contraction and abnormal relaxation in TTN-T32756I-iPSC-aCMs" yet, separately report "the contraction amplitude of the mutant was also increased . . . suggesting an increased contractile force by the TTN-T32756I-iPSC-aCMs and TTN-T32756I-iPSC-CMs exhibited similar calcium transient amplitudes as the WT."

    3. Reviewer #3 (Public review):

      Summary:

      The authors describe the abnormal contractile function and cellular electrophysiology in an iPSC model of atrial myocytes with a titin missense variant. They provide contractility data by sarcomere length imaging, calcium imaging, and voltage clamp of the repolarizing current iKs. While each of the findings is separately interesting, the paper comes across as too descriptive because there is no merging of the data to support a cohesive mechanistic story/statement, especially from the electrophysiological standpoint. There is definitely not enough support for the title "A Titin Missense Variant Causes Atrial Fibrillation", since there is no strong causative evidence at all. There is some interesting clinical data regarding the variant of interest and its association with HF hospitalization, which may lead to future important discoveries regarding atrial fibrillation.

      Strengths:

      The manuscript is well written and there is a wide range of experimental techniques to probe this atrial fibrillation model.

      Weaknesses:

      (1) While the clinical data is interesting, it is extremely important to rule out heart failure with preserved EF as a confounder. HFpEF leads to AF due to increased atrial remodeling, so the fact that patients with this missense variant have increased HF hospitalizations does not necessarily directly support the variant as causative of AF. It could be that the variant is actually associated directly with HFpEF instead, and this needs to be addressed and corrected in the analyses.

      (2) All of the contractility and electrophysiologic data should be done with pacing at the same rate in both control and missense variant groups, to control for the effect of cycle length on APD and calcium loading. A claim of shorter APD cannot be claimed when the firing rate of one set of cells is much faster than the other, since shorter APD is to be expected with a faster rate. Similarly, contractility is affected by diastolic interval because of the influence of SR calcium content on the myocyte power stroke. So the cells need to be paced at the same rate in the IonOptix for any direct comparison of contractility. The authors should familiarize themselves with the concept of electrical restitution.

      (3) It is interesting that the firing rate of the myocytes is faster with the missense variant. This should lead to a hypothesis and investigation of abnormal automaticity or triggered activity, which may also explain the increased contractility since all these mechanisms are related to the calcium clock and calcium loading of the SR. See #2 above for suggestions on how to adequately probe calcium handling. Such an investigation into impulse initiation mechanisms would be very powerful in supporting the primary statement of the paper since these are actual mechanisms thought to cause AF.

      (4) The claim of shortened APD without correcting for cycle length is problematic. However, the general concept of linking shortened APD in isolated cells alone to AF causation is more problematic. To have a setup for reentry, there must be a gradient of APD from short to long, and this can only be demonstrated at the tissue level, not really at the cellular level, so reentry should not be invoked here. If shortened APD is demonstrated with correction of the cycle length problem, restitution curves can be made showing APD shortening at different cycle lengths. If restitution is abnormal (i.e. the APD does not shorten normally in relation to the diastolic interval), this may lead to triggered activity which is an arrhythmogenic mechanism. This would also tie in well with the finding of abnormally elevated iKs current since iKs is a repolarizing current directly responsible for restitution.

    1. Reviewer #1 (Public review):

      Polymers of orthophosphate of varying lengths are abundant in prokaryotes and some eukaryotes where they regulate many cellular functions. Though they exist in metazoans, few tools exist to study their function. This study documents the development of tools to extract, measure, and deplete inorganic polyphosphates in *Drosophila*. Using these tools, the authors show:

      (1) that polyP levels are negligible in embryos and larvae of all stages while they are feeding. They remain high in pupae but their levels drop in adults.

      (2) that many cells in tissues such as the salivary glands, oocytes, haemocytes, imaginal discs, optic lobe, muscle, and crop, have polyP that is either cytoplasmic or nuclear (within the nucleolus).

      (3) that polyP is necessary in plasmatocytes for blood clotting in Drosophila.

      (4) that ployP controls the timing of eclosion.

      The tools developed in the study are innovative, well-designed, tested, and well-documented. I enjoyed reading about them and I appreciate that the authors have gone looking for the functional role of polyP in flies, which hasn't been demonstrated before. The documentation of polyP in cells is convincing as its role in plasmatocytes in clotting. Its control of eclosion timing, however, could result from non-specific effects of expressing an exogenous protein in all cells of an animal. The RNAseq experiments and their associated analyses on polyP-depleted animals and controls have not been discussed in sufficient detail. In its current form, the data look to be extremely variable between replicates and I'm therefore unsure of how the differentially regulated genes were identified.

      It is interesting that no kinases and phosphatases have been identified in flies. Is it possible that flies are utilising the polyP from their gut microbiota? It would be interesting to see if these signatures go away in axenic animals.

    2. Reviewer #2 (Public review):

      Summary:

      The authors of this paper note that although polyphosphate (polyP) is found throughout biology, the biological roles of polyP have been under-explored, especially in multicellular organisms. The authors created transgenic Drosophila that expressed a yeast enzyme that degrades polyP, targeting the enzyme to different subcellular compartments (cytosol, mitochondria, ER, and nucleus, terming these altered flies Cyto-FLYX, Mito-FLYX, etc.). The authors show the localization of polyP in various wild-type fruit fly cell types and demonstrate that the targeting vectors did indeed result in the expression of the polyP degrading enzyme in the cells of the flies. They then go on to examine the effects of polyP depletion using just one of these targeting systems (the Cyto-FLYX). The primary findings from the depletion of cytosolic polyP levels in these flies are that it accelerates eclosion and also appears to participate in hemolymph clotting. Perhaps surprisingly, the flies seemed otherwise healthy and appeared to have little other noticeable defects. The authors use transcriptomics to try to identify pathways altered by the cyto-FLYX construct degrading cytosolic polyP, and it seems likely that their findings in this regard will provide avenues for future investigation. And finally, although the authors found that eclosion is accelerated in pupae of Drosophila expressing the Cyto-FLYX construct, the reason why this happens remains unexplained.

      Strengths:

      The authors capitalize on the work of other investigators who had previously shown that expression of recombinant yeast exopolyphosphatase could be targeted to specific subcellular compartments to locally deplete polyP, and they also use a recombinant polyP binding protein (PPBD) developed by others to localize polyP. They combine this with the considerable power of Drosophila genetics to explore the roles of polyP by depleting it in specific compartments and cell types to tease out novel biological roles for polyP in a whole organism. This is a substantial advance.

      Weaknesses:

      Page 4 of the Results (paragraph 1): I'm a bit concerned about the specificity of PPBD as a probe for polyP. The authors show that the fusion partner (GST) isn't responsible for the signal, but I don't think they directly demonstrate that PPBD is binding only to polyP. Could it also bind to other anionic substances? A useful control might be to digest the permeabilized cells and tissues with polyphosphatase prior to PPBD staining and show that the staining is lost.

      In the hemolymph clotting experiments, the authors collected 2 ul of hemolymph and then added 1 ul of their test substance (water or a polyP solution). They state that they added either 0.8 or 1.6 nmol polyP in these experiments (the description in the Results differs from that of the Methods). I calculate this will give a polyP concentration of 0.3 or 0.6 mM. This is an extraordinarily high polyP concentration and is much in excess of the polyP concentrations used in most of the experiments testing the effects of polyP on clotting of mammalian plasma. Why did the authors choose this high polyP concentration? Did they try lower concentrations? It seems possible that too high a polyP concentration would actually have less clotting activity than the optimal polyP concentration.

    3. Reviewer #3 (Public review):

      Summary:

      Sarkar, Bhandari, Jaiswal, and colleagues establish a suite of quantitative and genetic tools to use Drosophila melanogaster as a model metazoan organism to study polyphosphate (polyP) biology. By adapting biochemical approaches for use in D. melanogaster, they identify a window of increased polyP levels during development. Using genetic tools, they find that depleting polyP from the cytoplasm alters the timing of metamorphosis, accelerating eclosion. By adapting subcellular imaging approaches for D. melanogaster, they observe polyP in the nucleolus of several cell types. They further demonstrate that polyP localizes to cytoplasmic puncta in hemocytes, and further that depleting polyP from the cytoplasm of hemocytes impairs hemolymph clotting. Together, these findings establish D. melanogaster as a tractable system for advancing our understanding of polyP in metazoans.

      Strengths:

      (1) The FLYX system, combining cell type and compartment-specific expression of ScPpx1, provides a powerful tool for the polyP community.

      (2) The finding that cytoplasmic polyP levels change during development and affect the timing of metamorphosis is an exciting first step in understanding the role of polyP in metazoan development, and possible polyP-related diseases.

      (3) Given the significant existing body of work implicating polyP in the human blood clotting cascade, this study provides compelling evidence that polyP has an ancient role in clotting in metazoans.

      Limitations:

      (1) While the authors demonstrate that HA-ScPpx1 protein localizes to the target organelles in the various FLYX constructs, the capacity of these constructs to deplete polyP from the different cellular compartments is not shown. This is an important control to both demonstrate that the GTS-PPBD labeling protocol works, and also to establish the efficacy of compartment-specific depletion. While not necessary to do this for all the constructs, it would be helpful to do this for the cyto-FLYX and nuc-FLYX.

      (2) The cell biological data in this study clearly indicates that polyP is enriched in the nucleolus in multiple cell types, consistent with recent findings from other labs, and also that polyP affects gene expression during development. Given that the authors also generate the Nuc-FLYX construct to deplete polyP from the nucleus, it is surprising that they test how depleting cytoplasmic but not nuclear polyP affects development. However, providing these tools is a service to the community, and testing the phenotypic consequences of all the FLYX constructs may arguably be beyond the scope of this first study.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript uses a diverse isolate collection of Streptococcus pneumoniae from hospital patients in the Netherlands to understand the population-level genetic basis of growth rate variation in this pathogen, which is a key determinant of S. pneumoniae within-host fitness. Previous efforts have studied this phenomenon in strain-specific comparisons, which can lack the statistical power and scope of population-level studies. The authors collected a rigorous set of in vitro growth data for each S. pneumoniae isolate and subsequently paired growth curve analysis with whole-genome analyses to identify how phylogenetics, serotype, and specific genetic loci influence in vitro growth. While there were noticeable correlations between capsular serotype and phylogeny with growth metrics, they did not identify specific loci associated with altered in vitro growth, suggesting that these phenotypes are controlled by the collective effect of the entire genetic background of a strain. This is an important finding that lays the foundation for additional, more highly-powered studies that capture more S. pneumoniae genetic diversity to identify these genetic contributions.

      Strengths:

      (1) The authors were able to completely control the experimental and genetic analyses to ensure all isolates underwent the same analysis pipeline to enhance the rigor of their findings.

      (2) The isolate collection captures an appreciable amount of S. pneumoniae diversity and, importantly, enables disentangling the contributions of the capsule and phylogenetic background to growth rates.

      (3) This study provides a population-level, rather than strain-specific, view of how genetic background influences the growth rate in S. pneumoniae. This is an advance over previous studies that have only looked at smaller sets of strains.

      (4) The methods used are well-detailed and robust to allow replication and extension of these analyses. Moreover, the manuscript is very well written and includes a thoughtful and thorough discussion of the strengths and limitations of the current study.

      Weaknesses:

      (1) As acknowledged by the authors, the genetic diversity and sample size of this newly collected isolate set are still limited relative to the known global diversity of S. pneumoniae, which evidently limits the power to detect loci with smaller/combinatorial contributions to growth rate (and ultimately infection).

      (2) The in vitro growth data is limited to a single type of rich growth medium, which may not fully reflect the nutritional and/or selective pressures present in the host.

      (3) The current study does not use genetic manipulation or in vitro/in vivo infection models to experimentally test whether alteration of growth rates as observed in this study is linked to virulence or successful infection. The availability of a naturally diverse collection with phylogenetic and serotype combinations already identified as interesting by the authors provides a strong rationale for wet-lab studies of these phenotypes.

    2. Reviewer #2 (Public review):

      Summary:

      The study by Chaguza et al. presents a novel perspective on pneumococcal growth kinetics, suggesting that the overall genetic background of Streptococcus pneumoniae, rather than specific loci, plays a more dominant role in determining growth dynamics. Through a genome-wide association study (GWAS) approach, the authors propose a shift in how we understand growth regulation, differing from earlier findings that pinpointed individual genes, such as wchA or cpsE, as key regulators of growth kinetics. This study highlights the importance of considering the cumulative impact of the entire genetic background rather than focusing solely on individual genetic loci.

      The study emphasizes the cumulative effects of genetic variants, each contributing small individual impacts, as the key drivers of pneumococcal growth. This polygenic model moves away from the traditional focus on single-gene influences. Through rigorous statistical analyses, the authors persuasively advocate for a more holistic approach to understanding bacterial growth regulation, highlighting the complex interplay of genetic factors across the entire genome. Their findings open new avenues for investigating the intricate mechanisms underlying bacterial growth and adaptation, providing fresh insights into bacterial pathogenesis.

      Strengths:

      This study exemplifies a holistic approach to unraveling key factors in bacterial pathogenesis. By analyzing a large dataset of whole-genome sequences and employing robust statistical methodologies, the authors provide strong evidence to support their main findings. Which is a leap forward from previous studies focused on a relatively smaller number of strains. Their integration of genome-wide association studies (GWAS) highlights the cumulative, polygenic influences on pneumococcal growth kinetics, challenging the traditional focus on individual loci. This comprehensive strategy not only advances our understanding of bacterial growth regulation but also establishes a foundation for future research into the genetic underpinnings of bacterial pathogenesis and adaptation. The amount of data generated and corresponding approaches to analyze the data are impressive as well as convincing. The figures are convincing and comprehensible too.

      Weaknesses:

      Despite the strong outcomes of the GWAS approach, this study leaves room for differing interpretations. A key point of contention lies in the title, which initially gives the impression that the research addresses growth kinetics under both in vitro and in vivo conditions. However, the study is limited to in vitro growth kinetics, with the assumption that these findings are equally applicable to in vivo scenarios-a premise that is not universally valid. To more accurately reflect the study's scope and avoid potential misrepresentation, the title should explicitly specify "in vitro" growth kinetics. This clarification would better align the title with the study's actual focus and findings.

      This study suggests that the entire genetic background significantly influences bacterial growth kinetics. However, to transform these predictions into established facts, extensive experimental validation is necessary. This would involve "bench experiments" focusing on generating and studying mutant variants of serotypes or strains with diverse genomic variations, such as targeted deletions. The growth phenotypes of these mutants should be analyzed, complemented by complementation assays to confirm the specific roles of the deleted regions. These efforts would provide critical empirical evidence to support the findings from the GWAS approach and enhance understanding of the genetic basis of bacterial growth kinetics.

      In the discussion section, the authors state that "the influence of serotype appeared to be higher than the genetic background for the average growth rate" (lines 296-298). Alongside references 13-15, this emphasizes the important role of capsular variability, which is a key determinant of serotypes, in influencing growth kinetics. However, this raises the question: why isn't a specific locus like cps, which is central to capsule biogenesis, considered a strong influencer of growth kinetics in this study?

      One plausible explanation could be the absence of "elevated signals" for cps in the GWAS analysis. GWAS relies on identifying loci with statistically significant associations to phenotypes. The lack of such signals for cps may indicate that its contribution, while biologically important, does not stand out genome-wide. This might be due to the polygenic nature of growth kinetics, where the overall genetic background exerts a cumulative effect, potentially diluting the apparent influence of individual loci like cps in statistical analyses.

    3. Reviewer #3 (Public review):

      This study provides insights into the growth kinetics of a diverse collection of Streptococcus pneumoniae, identifying capsule and lineage differences. It was not able to identify any specific loci from the genome-wide association studies (GWAS) that were associated with the growth features. It does provide a useful study linking phenotypic data with large-scale genomic population data. The methods for the large part were appropriately written in sufficient detail, and data analysis was performed with rigour. The interpretation of the results was supported by the data, although some additional explanation of the significance of e.g. ancestral state reconstruction would be useful. Efforts were made to make the underlying data fully accessible to the readers although some of the supplementary material could be formatted and explained a bit better.

    1. Reviewer #1 (Public review):

      Summary:

      This work integrates two timepoints from the Adolescent Brain Cognitive Development (ABCD) Study to understand how neuroimaging, genetic, and environmental data contribute to the predictive power of mental health variables in predicting cognition in a large early adolescent sample. Their multimodal and multivariate prediction framework involves a novel opportunistic stacking model to handle complex types of information to predict variables that are important in understanding mental health-cognitive performance associations.

      Strengths:

      The authors are commended for incorporating and directly comparing the contribution of multiple imaging modalities (task fMRI, resting state fMRI, diffusion MRI, structural MRI), neurodevelopmental markers, environmental factors, and polygenic risk scores in a novel multivariate framework (via opportunistic stacking), as well as interpreting mental health-cognition associations with latent factors derived from partial least squares. The authors also use a large well-characterized and diverse cohort of adolescents from the ABCD Study. The paper is also strengthened by commonality analyses to understand the shared and unique contribution of different categories of factors (e.g., neuroimaging vs mental health vs polygenic scores vs sociodemographic and adverse developmental events) in explaining variance in cognitive performance

      Weaknesses:

      The paper is framed with an over-reliance on the RDoC framework in the introduction, despite deviations from the RDoC framework in the methods. The field is also learning more about RDoC's limitations when mapping cognitive performance to biology. The authors also focus on a single general factor of cognition as the core outcome of interest as opposed to different domains of cognition. The authors could consider predicting mental health rather than cognition. Using mental health as a predictor could be limited by the included 9-11 year age range at baseline (where many mental health concerns are likely to be low or not well captured), as well as the nature of how the data was collected, i.e., either by self-report or from parent/caregiver report.

    2. Reviewer #2 (Public review):

      Summary:

      This paper by Wang et al. uses rich brain, behaviour, and genetics data from the ABCD cohort to ask how well cognitive abilities can be predicted from mental-health-related measures, and how brain and genetics influence that prediction. They obtain an out-of-sample correlation of 0.4, with neuroimaging (in particular task fMRI) proving the key mediator. Polygenic scores contributed less.

      Strengths:

      This paper is characterized by the intelligent use of a superb sample (ABCD) alongside strong statistical learning methods and a clear set of questions. The outcome - the moderate level of prediction between the brain, cognition, genetics, and mental health - is interesting. Particularly important is the dissection of which features best mediate that prediction and how developmental and lifestyle factors play a role.

      Weaknesses:

      There are relatively few weaknesses to this paper. It has already undergone review at a different journal, and the authors clearly took the original set of comments into account in revising their paper. Overall, while the ABCD sample is superb for the questions asked, it would have been highly informative to extend the analyses to datasets containing more participants with neurological/psychiatric diagnoses (e.g. HBN, POND) or extend it into adolescent/early adult onset psychopathology cohorts. But it is fair enough that the authors want to leave that for future work.

      In terms of more practical concerns, much of the paper relies on comparing r or R2 measures between different tests. These are always presented as point estimates without uncertainty. There would be some value, I think, in incorporating uncertainty from repeated sampling to better understand the improvements/differences between the reported correlations.

      The focus on mental health in a largely normative sample leads to the predictions being largely based on the normal range. It would be interesting to subsample the data and ask how well the extremes are predicted.

      A minor query - why are only cortical features shown in Figure 3?

    1. Reviewer #1 (Public review):

      Summary:

      The current study by Xing et al. establishes the methodology (machine vision and gaze pose estimation) and behavioral apparatus for examining social interactions between pairs of marmoset monkeys. Their results enable unrestrained social interactions under more rigorous conditions with detailed quantification of position and gaze. It has been difficult to study social interactions using artificial stimuli, as opposed to genuine interactions between unrestrained animals. This study makes an important contribution for studying social neuroscience within a laboratory setting that will be valuable to the field.

      Strengths:

      Marmosets are an ideal species for studying primate social interactions due to their prosocial behavior and the ease of group housing within laboratory environments. They also predominantly orient their gaze through head movements during social monitoring. Recent advances in machine vision pose estimation set the stage for estimating 3D gaze position in marmosets but require additional innovation beyond DeepLabCut or equivalent methods. A six-point facial frame is designed to accurately fit marmoset head gaze. A key assumption in the study is that head gaze is a reliable indicator of the marmoset's gaze direction, which will also depend on the eye position. Overall, this assumption has been well supported by recent studies in head-free marmosets. Thus the current work introduces an important methodology for leveraging machine vision to track head gaze and demonstrates its utility for use with interacting marmoset dyads as a first step in that study.

      Weaknesses:

      One weakness that should be easily addressed is that no data is provided to directly assess how accurate the estimated head gaze is based on calibrations of the animals, for example, when they are looking at discrete locations like faces or video on a monitor. This would be useful to get an upper bound on how accurate the 3D gaze vector is estimated to be, for planned use in other studies. Although the accuracy appears sufficient for the current results, it would be difficult to know if it could be applied in other contexts where more precision might be necessary.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes novel technique development and experiments to track the social gaze of marmosets. The authors used video tracking of multiple cameras in pairs of marmosets to infer head orientation and gaze and then studied gaze direction as a function of distance between animals, relationships, and social conditions/stimuli.

      Strengths:

      Overall the work is interesting and well done. It addresses an area of growing interest in animal social behavior, an area that has largely been dominated by research in rodents and other non-primate species. In particular, this work addresses something that is uniquely primate (perhaps not unique, but not studied much in other laboratory model organisms), which is that primates, like humans, look at each other, and this gaze is an important social cue of their interactions. As such, the presented work is an important advance and addition to the literature that will allow more sophisticated quantification of animal behaviors. I am particularly enthusiastic with how the authors approach the cone of uncertainty in gaze, which can be both due to some error in head orientation measurements as well as variable eye position.

      Weaknesses:

      There are a few technical points in need of clarification, both in terms of the robustness of the gaze estimate, and possible confounds by gaze to non-face targets which may have relevance but are not discussed. These are relatively minor, and more suggestions than anything else.

    1. Reviewer #1 (Public review):

      The current manuscript by Bendeker et al. (2024) presents a new platform, MorphoCellSorter, for performing population wide microglial morphological analyses. This method adds to the many programs/platforms available to determine characteristics of microglial morphology; however, MorphoCellSorter is unique in that it uses Andrew's plotting to rank populations of cells together (in control and experimental groups) and present "big picture" views of how entire populations of microglia alter under different conditions. In their ranking system, Bendeker et al. (2024) use PCA to determine which of the morphological characteristics most define microglial populations, avoiding user subjective biases to determine these parameters. Compared to "expert" evaluators, MorphoCellSorter appears to perform consistently and accurately, including in different types of tissue preservation methods and in live cells, a key feature of the program. In addition, the researchers point out that this platform can be used across a wide array of imaging techniques and most microscopes that are available in a basic research lab. There are minor concerns about the platform's utility in analyzing embryonic microglia and primary microglial cultures, but overall, this platform will be another useful tool for microglial researchers to consider using in future studies. Furthermore, the method of morphological assessment aligns with the current direction of the field in identifying microglial cells in more nuanced ways.

      In their current revision, the authors have done an excellent job responding to concerns and have updated the manuscript accordingly.

    2. Reviewer #2 (Public review):

      The authors introduce MorphCellSorter, an open-source tool available on GitHub, designed for automated morphometric analysis of microglia. Current understanding suggests that microglia represent a heterogeneous population, especially in non-steady adult states, better characterized as a continuum rather than distinct cell groups.

      This tool was developed to classify microglia along this continuum. Using stained brain sections and microscope imaging, individual microglia are binarized and processed with MorphCellSorter, which categorizes them based on 20 morphological parameters. Notably, the tool is versatile, as it can be applied to both fluorescent and brightfield brain sections, as demonstrated by the authors. Additionally, it has been tested across various setups (both fixed and live tissues) and biological contexts (including embryonic stages, Alzheimer's disease models, stroke, and primary cell cultures), showcasing its versatility and adaptability. Overall, the study is well-conceived and could have some value in the field.

      Numerous similar tools already exist, and the number is likely to grow, especially with advancements in AI. These tools have limited scientific utility as they provide descriptive rather than informative outputs. Microglial morphology varies due to external influences (such as developmental stages and injuries), but the significance of these variations remains largely hypothetical.

    1. Reviewer #1 (Public review):

      Summary:

      This paper shows that the synthetic opioid fentanyl induces respiratory depression in rodents. This effect is revised by the opioid receptor antagonist naloxone, as expected. Unexpectedly, the peripherally restricted opioid receptor antagonist naloxone methiodide also blocks fentanyl-induced respiratory depression.

      Strengths:

      The paper reports compelling physiology data supporting the induction of respiratory distress in fentanyl-treated animals. Evidence suggesting that naloxone methiodide reverses this respiratory depression is compelling. This is further supported by pharmacokinetic data suggesting that naloxone methiodide does not penetrate into the brain, nor is it metabolized into brain-penetrant naloxone.

      Weaknesses:

      The paper would be further strengthened by establishing the functional significance of the altered neural activity detected in the nTS (as measured by cFos and GcAMP/photometry) in the context of opioid-induced respiratory depression.

    2. Reviewer #2 (Public review):

      Summary:

      In this article, Ruyle and colleagues assessed the contribution of central and peripheral mu opioid receptors in mediating fentanyl-induced respiratory depression using both nalaxone and nalaxone methiodide, which does not cross the blood brain barrier. Both compounds prevented and reversed fentanyl-induced respiratory depression to a comparable degree. The advantage of peripheral treatments is that they circumvent the withdrawal-like effects of nalaxone. Moreover, neurons located in the nucleus of the solitary tract are no longer activated by fentanyl when nalaxone methiodide is administered, suggesting that these responses are mediated by peripheral mu opioid receptors. The results delineate a role for peripheral mu opioid receptors in fentanyl-derived respiratory depression and identify a potentially advantageous approach to treating overdoses without inflicting withdrawal on the patients.

      Strengths:

      The strengths of the article include the intravenous delivery of all compounds, which increases the translational value of the article. The authors address both prevention and reversal of fentanyl-derived respiratory depression. The experimental design and data interpretation are rigorous and appropriate controls were used in the study. Multiple doses were screened in the study and the approaches were multipronged. The authors demonstrated activation of NTS cells using multiple techniques and the study links peripheral activation of mu opioid receptors to central activation of NTS cells. Both males and females were used in the experiments. The authors demonstrate the peripheral restriction of nalaxone methiodide.

      Weaknesses:

      Nalaxone is already broadly used to prevent overdoses from opioids so in some respects, the effects reported here are somewhat incremental.

      Comments on the latest version:

      I think the authors have adequately addressed previous critiques and I don't have any additional comments.

    3. Reviewer #3 (Public review):

      Summary

      This manuscript outlines a series of very exciting and game-changing experiments examining the role of peripheral MORs in OIRD. The authors outline experiments that demonstrate a peripherally restricted MOR antagonist (NLX Methiodide) can rescue fentanyl-induced respiratory depression and this effect coincides with a lack of conditioned place aversion. This approach would be a massive boon to the OUD community, as there are a multitude of clinical reports showing that naloxone rescue post fentanyl over-intoxication is more aversive than the potential loss-of-life to the individuals involved. This important study reframes our understanding of successful overdose rescue with a potential for reduced aversive withdrawal effects.

      Strengths:

      Strengths include the plethora of approaches arriving at the same general conclusion, the inclusion of both sexes, and the result that a peripheral approach for OIRD rescue may side-step severe negative withdrawal symptoms of traditional NLX rescue.

      Weaknesses:

      All weaknesses were addressed.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript co-authored by Pál Barzó et al is very clear and very well written, demonstrating the electrophysiological and morphological properties of the human cortical layer 2/3 pyramidal cells across a wide age range, from age 1 month to 85 years using whole-cell patch clamp. To my knowledge, this is the first study that look at the cross-age differences biophysical and morphological properties of human cortical pyramidal cells. The community will also appreciate the significant effort involved in recording data from 485 cells, given the challenges associated with collecting data from human tissue. Understanding the electrophysiological properties of individual cells, which are essential for brain function, is crucial for comprehending human cortical circuits. I think this research enhances our knowledge of how biophysical properties change over time in the human cortex. I also think that by building models of human single cells at different ages using these data, we can develop more accurate representations of brain function. This, in turn, provides valuable insights into human cortical circuits and function and helps in predicting changes in biophysical properties in both health and disease.

      Strengths:

      The strength of this work lies in demonstrating how the electrophysiological and morphological features of human cortical layer 2/3 pyramidal cells change with age, offering crucial insights into brain function throughout life.

      Comments on revisions:

      Thanks to the authors for addressing my comments and providing greater clarity in the methodology. The analysis is much clearer now. I also appreciate their additional data analysis, particularly on morphology, which strengthens the paper.

    2. Reviewer #2 (Public review):

      Summary:

      In this study, Barzo and colleagues aim to establish an appraisal for the development of basal electrophysiology of human layer 2/3 pyramidal cells across life and compare their morphological features at the same ages.

      Strengths:

      The authors have generates recordings from an impressive array of patient samples, allowing them to directly compare the same electrophysiological features as a function of age and other biological features. These data are extremely robust and well organised.

      The authors group patient ages into developmentally organised bins, which are elaborated on in supplementary analysis - exemplifying the importance of determining early postnatal development on human neuron function

      Weaknesses:

      The author's use of (perhaps) arbitrary categorisation of spine morphology could limit the full usefulness of these data.

      Overall, the authors achieve their aims by assessing the physiological and morphological properties of human L2/3 pyramidal neurons across life. Their findings have extremely important ramifications for our understanding of human brain development and implications for how different neuronal properties may influence life and disease associated with neurological conditions.

      Comments on revisions:

      Overall, the authors have satisfied my concerns. I fully appreciate their candour with their data and the potential limitations. I especially appreciate their supplementary data inclusions which I believe truly strengthen their conclusions and are a valuable resource for the field,

      I agree whole-heartedly with the authors assertion that it is perhaps better to use the most sophisticated equipment, not always being most appropriate. However, statistical rigour should still be standard. As such, my one remaining concern relates to inappropriate replicate choice of spine morphology data in figure 6. I commend the authors inclusion of additional reconstructions and morphology data from further cells in this data set. However, to me, these still represent data from 3 cells and 1 patient/age - as to the best of my interpretation. I feel it would be more helpful to plot cell averages +/- SD for each cell - even if side-by-side with data from all spines. Likewise, it is unclear what statistical test was performed on these data and did it take into account the fact that these values are a) from 3 technical replicates per group, or b) that many of the data sets consist of many zero-values (would a categorical test be more appropriate?).

    3. Reviewer #3 (Public review):

      Summary:

      To understand the specificity of age-dependent changes in the human neocortex, this paper investigated the electrophysiological and morphological characteristics of pyramidal cells in a wide age range from infants to the elderly.

      The results show that some electrophysiological characteristics change with age, particularly in early childhood. In contrast, the larger morphological structures, such as the spatial extent and branching frequency of dendrites, remained largely stable from infancy to old age. On the other hand, the shape of dendritic spines is considered immature in infancy, i.e., the proportion of mushroom-shaped spines increases with age.

      Strengths:

      Whole-cell recordings and intracellular staining of pyramidal cells in defined areas of the human neocortex allowed the authors to compare quantitative parameters of electrophysiological and morphological properties between finely divided age groups.

      They succeeded in finding symmetrical changes specific to both infants and the elderly, and asymmetrical changes specific to either infants or the elderly. The similarity of pyramidal cell characteristics between areas is unexpected.

      Weaknesses:

      Human L2/3 pyramidal cells are thought to be heterogeneous, as L2/3 has expanded to a high degree during the evolution from rodents to humans. However, the diversity (subtyping) is not revealed in this paper.

      Comments on revisions:

      I believe that the current version has been sufficiently revised based on my comments.

    1. Reviewer #1 (Public Review):

      Summary:

      Shi and colleagues report the use of modified Cre lines in which the coding region of Cre is disrupted by rox-STOP-rox or lox-STOP-lox sequences to prevent the expression of functional protein in the absence of Dre or Cre activity, respectively. The main purpose of these tools is to enable intersectional or tamoxifen-induced Cre activity with minimal or no leaky activity from the second, Cre-expressing allele. It is a nice study but lacks some functional data required to determine how useful these alleles will be in practice, especially in comparison with the figure line that stimulated their creation.

      Strengths:

      The new tools can reduce Cre leak in vivo.

      Weaknesses:

      (1) Activity of R26-loxCre line. As the authors point out, the greatest value of this approach is to accomplish a more complete Cre-mediated gene deletion using CreER transgenes that are combined with low-efficiency floxed alleles using their R26-loxCre line that is similar to the iSure Cre reported by Benedito and colleagues. The data in Figure 5 show strong activity at the Confetti locus, but the design of the newly reported R26-loxCre line lacks a WPRE sequence that was included in the iSure-Cre line to drive very robust protein expression. Thus while the line appears to have minimal leak, as the design would predict, the question of how much of a deletion increase is obtained over simple use of the CreER transgene alone is a key question for use by investigators. This is further addressed in Figure 6 where it is compared with Alb-CreER alone to recombine the Ctnnb1 floxed allele. They demonstrate that recombination frequency is clearly improved, but the western blot in Figure 6E does not look like there was a large amount of remaining b-catenin to remove. These data are certainly promising, but the most valuable experiment for such a new tool would be a head-to-head comparison with iSure (or the latest iSure version from the Benedito lab) using the same CreER and target floxed allele. At the very least a comparision of Cre protein expression between the two lines using identical CreER activators is needed.

      (2) In vivo analysis of mCre activities. Why did the authors not use the same driver to compare mCre 1, 4, 7, and 10? The study in Figure 2 uses Alb-roxCre for 1 and 7 and Cdh5-roxCre for 4 and 10, with clearly different levels of activity driven by the two alleles in vivo. Thus whether mCre1 is really better than mCre4 or 10 is not clear.

      (3) Technical details are lacking. The authors provide little specific information regarding the precise way that the new alleles were generated, i.e. exactly what nucleotide sites were used and what the sequence of the introduced transgenes is. Such valuable information must be gleaned from schematic diagrams that are insufficient to fully explain the approach.

    2. Reviewer #2 (Public Review):

      Summary:

      This work presents new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      Strengths:

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells, and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      Weaknesses:

      The scenario where the lines would demonstrate their full potential compared to existing models has not been tested. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. Therefore, a demonstration of the efficient deletion of multiple floxed alleles in a mosaic fashion would be a valuable addition.

      In addition, a drawback of this line is the constitutive expression of Cre. When combined with the confetti line, the reporter cassette will continue flipping, potentially leading to misleading lineage tracing results. Constitutive expression of Cre is also associated with toxicity, as discussed by the authors in the introduction. These drawbacks should be acknowledged.

    3. Reviewer #3 (Public Review):

      Summary:

      The authors report a new version of the iSuRe-Cre approach, which was originally developed by Rui Benedito's group in Spain (https://doi.org/10.1038/s41467-019-10239-4). Shi et al claim that their approach shows reduced leakiness compared to the iSuRe-Cre line. Shi et al elaborate strongly about the leakiness of iSuRe-Cre mice, although leakiness is rather minor according to the original publication and the senior author of the study wrote in a review a few years ago that there is no leakiness (https://doi.org/10.1016/j.jbc.2021.100509). Furthermore, a new R26-roxCre-tdT mouse line was established after extensive testing, which enables efficient expression of the Cre recombinase after activation of the Dre recombinase.

      Strengths:

      The authors carefully evaluated the efficiency and leakiness of the new strains and demonstrated the applicability by marking peri-central hepatocytes in an intersectional genetics approach, amongst others. I can only find very few weaknesses in the paper, which represents the result of an enormous effort. Carefully conducted technical studies have considerable value. However, I would have preferred to see a study, which uses the wonderful new tools to address a major biological question, rather than a primarily technical report, which describes the ongoing efforts to further improve Cre and Dre recombinase-mediated recombination.

      Weaknesses:

      Very high levels of Cre expression may cause toxic effects as previously reported for the hearts of Myh6-Cre mice. Thus, it seems sensible to test for unspecific toxic effects, which may be done by bulk RNA-seq analysis, cell viability, and cell proliferation assays. It should also be analyzed whether the combination of R26-roxCre-tdT with the Tnni3-Dre allele causes cardiac dysfunction, although such dysfunctions should be apparent from potential changes in gene expression.

      The R26-GFP or R26-tdT reporters, Alb-roxCre1-tdT, Cdh5-roxCre4-tdT, Alb-roxCre7-GFP, and Cdh5-roxCre10-GFP demonstrate no leakiness without Dre-rox recombination (Figure S1-S2). Is there any leakiness when the inducible DreER allele is introduced but no tamoxifen treatment is applied? This should be documented. The same also applies to loxCre mice.

      The enhanced efficiency of loxCre and roxCre systems holds promise for reducing the necessary tamoxifen dosage, potentially reducing toxicity and side effects. In Figure 6, the author demonstrates an enhanced recombination efficiency of loxCre mice, which makes it possible to achieve efficient deletion of Ctnnb1 with a single dose of tamoxifen, whereas a conventional driver (Alb-CreER) requires five dosages. It would be very helpful to include a dose-response curve for determining the minimum dosage required in Alb-CreER; R26-loxCre-tdT; Ctnnb1flox/flox mice for efficient recombination.

      In the liver panel of Figure 4F, tdT signals do not seem to colocalize with the VE-cad signals, which is odd. Is there any compelling explanation?

      The authors claim that "virtually all tdT+ endothelial cells simultaneously expressed YFP/mCFP" (right panel of Figure 5D). Well, it seems that the abundance of tdT is much lower compared to YFP/mCFP. If the recombination of R26-Confetti was mainly triggered by R26-loxCre-tdT, the expression of tdT and YFP/mCFP should be comparable. This should be clarified.

      In several cases, the authors seem to have mixed up "R26-roxCre-tdT" with "R26-loxCre-tdT". There are errors in #251 and #256. Furthermore, in the passage from line #278 to #301. In the lines #297 and #300 it should probably read "Alb-CreER; R26-loxCre-tdT;Ctnnb1flox/flox"" rather than "Alb-CreER;R26-tdT2;Ctnnb1flox/flox".

    1. Reviewer #3 (Public review):

      Summary:

      The authors are interested in the relative importance of PRL versus GH and their interactive signaling in breast cancer. After examining GHR-PRLR interactions in response to ligands, they suggest that a reduction in cell surface GHR in response to PRL may be a mechanism whereby PRL can sometimes be protective against breast cancer.

      Strengths:

      The strengths of the study include the interesting question being addressed and the application of multiple complementary techniques, including dSTORM, which is technically very challenging, especially when using double labeling. Thus, dSTORM is used to analyze co-clustering of GHR and PRLR, and, in response to PRL, rapid internalization of GHR and increased cell surface PRLR. Conclusions from Proximity ligation assays are that some GHR and PRLR are within 40 nm (≈ 4 plasma membranes) of each other and that upon ligand stimulation, they move apart. Intact receptor knockin and knockout approaches and receptor constructs without the Jak2 binding domain demonstrate a) a requirement for the PRLR for there to be PRL- driven internalization of GHR, and b) that Jak2-PRLR interactions are necessary for stability of the GHR-PRLR colocalizations.

      Weaknesses:

      Although improved over the first version, the manuscript still suffers from a lack of detail, which in places makes it difficult to evaluate the data and would make it very difficult for the results to be replicated by others.

      Comments on revised version:

      Points for improvement of the manuscript:

      (1) There is still insufficient detail about the proximity ligation assay. For example, PLAs that use reagents from Sigma (as now reported) require primary antibodies from two different species and yet both the anti-PRLR and anti-GHR used for dSTORM were mouse monoclonals. On line 356 it says that the ECD antibodies were used for microscopy and the PLA is microscopy. Were instead the ICD antibodies used for the PLA? If so, how do we know that one or more of the proteins in the very strong "non-specific" bands seen on Figure 5A are not what is being localized? Could you do a Western blot of just cell membrane proteins? There needs to be further clarity/explanation.

      (2) Although the manuscript now shows a Western blot using the antibodies against intracellular regions of the receptor, a full Western blot is not provided for the antibodies against the S2 extracellular domain used for the dSTORM. While I haven't checked the papers showing characterization of the anti-GHR, I did re-check reference 70, which the authors say shows full characterization of the PRLR antibody, and this does not show a full Western (only portions of gels). How do we know that this antibody is not recognizing some other cell surface molecule, the surface expression of which increases upon stimulation of the cells with PRL? Is there only one band when blotting whole cell extracts with either the GHR or PRLR ECD antibodies so we can be sure of specificity? Figure S2 helps some, but these are different cells and the relative expression of the PRLR versus some other potential cell surface protein in these engineered cells may well be completely different.

    1. Joint Public Review:

      The Lee et al. study has been revised in response to reviewer comments. It presents a valuable investigation into the role of the Hippo signaling pathway (specifically wts-1/LATS and yap) in age-dependent neurodegeneration and microtubule dynamics in C. elegans TRNs. The authors convincingly demonstrated that disruption of wts-1/LATS leads to age-associated neuronal abnormalities and enhanced microtubule stabilization, with a genetic link to yap. While the study was praised for its well-conducted and well-controlled approaches, reviewers raised concerns about the specificity of the Hippo pathway's effects to TRNs, the correlation of Hpo signaling decline in TRNs with age, and the mechanistic link between Hpo-mediated gene expression and microtubule regulation. The authors addressed the TRN specificity by suggesting the unique microtubule structure of these neurons might contribute to their susceptibility. They acknowledged the difficulty in detecting Hpo signaling decline specifically in aged TRNs but noted increased YAP-1 nuclear localization in other tissues. Importantly, the authors provided evidence suggesting that YAP-TEAD-mediated transcriptional regulation is responsible for neuronal degeneration, as loss of yap-1 or egl-44 restored the wts-1 mutant phenotype. However, the specific transcriptional targets of YAP-1 regulating microtubule stability remain unidentified, representing a key limitation. The authors also discussed the possibility of non-cell-autonomous effects of YAP-1 and offered explanations for the seemingly moderate impairment of the touch response despite structural damage. Finally, they attributed the shorter lifespan of wts-1 and wts-1; yap-1 mutants to roles of wts-1 beyond TRNs and potential synergistic effects of yap-1. Overall, the study provides significant insights into the Hippo pathway's role in neuronal aging and microtubule dynamics, while acknowledging remaining mechanistic gaps.

    1. Reviewer #1 (Public review):

      Summary:

      Summary of what author's were trying to achieve: In the manuscript by Hoisington et al., the authors utilized a novel conditional neuronal prosap2-interacting protein 1 (Prosapip1) knockout mouse to delineate the effects of both neuronal and dorsal hippocampal (dHP)-specific knockout of Prosapip1 impacts biochemical and electrophysiological neuroadaptations within the dHP that may mediate behaviors associated with this brain region.

      Strengths:

      (1) Methodological Strengths

      a) The generation and use of a conditional neuronal knockout of Prosapip1 is a strength. These mice will be useful for anyone interested in studying or comparing and contrasting the effects of loss of Prosapip1 in different brain regions or in non-neuronal tissues.<br /> b) The use of biochemical, electrophysiological, and behavioral approaches are a strength. By providing data across multiple domains, a picture begins to emerge about the mechanistic role for Prosapip1. While questions still remain, the use of the 3 domains is a strength.<br /> c) The use of both global, constitutive neuronal loss of Prosapip1 and postnatal dHP-specific knockout of Prosapip1 help support and validate the behavioral conclusions.

      (2) Strengths of the results

      a) It is interesting that loss of Prosapip1 leads to specific alterations in the expression of GluN2B and PSD95 but not GluA1 or GluN2A in a post homogenization fraction that the author's term a "synaptic" fraction. Therefore, these results suggest protein-specific modulation of glutamatergic receptors within a "synaptic" fraction.<br /> b) The electrophysiological data demonstrate an NMDAR-dependent alteration in measures of hippocampal synaptic plasticity, including long-term potentiation (LTP) and NMDAR input/output. These data correspond with the biochemical data demonstrating a biochemical effect on GluN2B localization. Therefore, the conclusion that loss of Prosapip1 influences NMDAR function is well supported.<br /> c) The behavioral data suggest deficits in memory in particular novel object recognition and spatial memory, in the Prosapip1 knockout mice. These data are strongly bolstered by both the pan neuronal knockout and the dHP Cre transduction.

      The authors highlight potential future studies to further the understanding of Prosapip1.

    2. Reviewer #2 (Public review):

      The authors provide valuable findings characterizing a Prosapip1 conditional knockout mouse and the effects of knockout on hippocampal excitatory transmission, NMDAR transmission, and several learning behaviors. Furthermore, the authors selectively and conditionally knockout Prosapip1 in the dorsal hippocampus and show that it is required for the same spatial learning and memory assessed in the conditional knockout mice. The study uncovers how Prosapip1 is involved PSD organization and is a functional and critical player in dorsal Hippocampal LTP via its interaction with GluN2B subunits. The study is well controlled, detailed, and data in the paper match the conclusions.

      Comments on revisions:

      The authors have addressed all concerns.

    1. Reviewer #1 (Public review):

      Summary:

      This study addresses the issue of rapid skill learning and whether individual sequence elements (here: finger presses) are differentially represented in human MEG data. The authors use a decoding approach to classify individual finger elements, and accomplish an accuracy of around 94%. A relevant finding is that the neural representations of individual finger elements dynamically change over the course of learning. This would be highly relevant for any attempts to develop better brain machine interfaces - one now can decode individual elements within a sequence with high precision, but these representations are not static but develop over the course of learning.

      Strengths:

      The work follows a large body of work from the same group on the behavioural and neural foundations of sequence learning. The behavioural task is well established a neatly designed to allow for tracking learning and how individual sequence elements contribute. The inclusion of short offline rest periods between learning epochs has been influential because it has revealed that a lot, if not most of the gains in behaviour (ie speed of finger movements) occur in these so-called micro-offline rest periods.

      The authors use a range of new decoding techniques, and exhaustively interrogate their data in different ways, using different decoding approaches. Regardless of the approach, impressively high decoding accuracies are observed, but when using a hybrid approach that combines the MEG data in different ways, the authors observe decoding accuracies of individual sequence elements from the MEG data of up to 94%.

      Weaknesses:

      A formal analysis and quantification of how head movement may have contributed to the results should be included in the paper or supplemental material. The type of correlated head movements coming from vigorous key presses aren't necessarily visible to the naked eye, and even if arms etc are restricted, this will not preclude shoulder, neck or head movement necessarily; if ICA was conducted, for example, the authors are in the position to show the components that relate to such movement; but eye-balling the data would not seem sufficient. The related issue of eye movements is addressed via classifier analysis. A formal analysis which directly accounts for finger/eye movements in the same analysis as the main result (ie any variance related to these factors) should be presented.

      This reviewer recommends inclusion of a formal analysis that the intra-vs inter parcels are indeed completely independent. For example, the authors state that the inter-parcel features reflect "lower spatially resolved whole-brain activity patterns or global brain dynamics". A formal quantitative demonstration that the signals indeed show "complete independence" (as claimed by the authors) and are orthogonal would be helpful

    2. Reviewer #2 (Public review):

      Summary:

      The current paper consists of two parts. The first part is the rigorous feature optimization of the MEG signal to decode individual finger identity performed in a sequence (4-1-3-2-4; 1~4 corresponds to little~index fingers of the left hand). By optimizing various parameters for the MEG signal, in terms of (i) reconstructed source activity in voxel- and parcel-level resolution and their combination, (ii) frequency bands, and (iii) time window relative to press onset for each finger movement, as well as the choice of decoders, the resultant "hybrid decoder" achieved extremely high decoding accuracy (~95%). This part seems driven almost by pure engineering interest in gaining as high decoding accuracy as possible.<br /> In the second part of the paper, armed with the successful 'hybrid decoder,' the authors asked more scientific questions about how neural representation of individual finger movement that is embedded in a sequence, changes during a very early period of skill learning and whether and how such representational change can predict skill learning. They assessed the difference in MEG feature patterns between the first and the last press 4 in sequence 41324 at each training trial and found that the pattern differentiation progressively increased over the course of early learning trials. Additionally, they found that this pattern differentiation specifically occurred during the rest period rather than during the practice trial. With a significant correlation between the trial-by-trial profile of this pattern differentiation and that for accumulation of offline learning, the authors argue that such "contextualization" of finger movement in a sequence (e.g., what-where association) underlies the early improvement of sequential skill. This is an important and timely topic for the field of motor learning and beyond.

      Strengths:

      Each part has its own strength. For the first part, the use of temporally rich neural information (MEG signal) has a significant advantage over previous studies testing sequential representations using fMRI. This allowed the authors to examine the earliest period (= the first few minutes of training) of skill learning with finer temporal resolution. Through the optimization of MEG feature extraction, the current study achieved extremely high decoding accuracy (approx. 94%) compared to previous works. For the second part, the finding of the early "contextualization" of the finger movement in a sequence and its correlation to early (offline) skill improvement is interesting and important. The comparison between "online" and "offline" pattern distance is a neat idea.

      Weaknesses:

      Despite the strengths raised, the specific goal for each part of the current paper, i.e., achieving high decoding accuracy and answering the scientific question of early skill learning, seems not to harmonize with each other very well. In short, the current approach, which is solely optimized for achieving high decoding accuracy, does not provide enough support and interpretability for the paper's interesting scientific claim. This reminds me of the accuracy-explainability tradeoff in machine learning studies (e.g., Linardatos et al., 2020). More details follow.

      There are a number of different neural processes occurring before and after a key press, such as planning of upcoming movement and ahead around premotor/parietal cortices, motor command generation in primary motor cortex, sensory feedback related processes in sensory cortices, and performance monitoring/evaluation around the prefrontal area. Some of these may show learning-dependent change and others may not.

      Given the use of whole-brain MEG features with a wide time window (up to ~200 ms after each key press) under the situation of 3~4 Hz (i.e., 250~330 ms press interval) typing speed, these different processes in different brain regions could have contributed to the expression of the "contextualization," making it difficult to interpret what really contributed to the "contextualization" and whether it is learning related. Critically, the majority of data used for decoder training has the chance of such potential overlap of signal, as the typing speed almost reached a plateau already at the end of the 11th trial and stayed until the 36th trial. Thus, the decoder could have relied on such overlapping features related to the future presses. If that is the case, a gradual increase in "contextualization" (pattern separation) during earlier trials makes sense, simply because the temporal overlap of the MEG feature was insufficient for the earlier trials due to slower typing speed.

      Several direct ways to address the above concern, at the cost of decoding accuracy to some degree, would be either using the shorter temporal window for the MEG feature or training the model with the early learning period data only (trials 1 through 11) to see if the main results are unaffected would be some example.

    3. Reviewer #3 (Public review):

      Summary:

      One goal of this paper is to introduce a new approach for highly accurate decoding of finger movements from human magnetoencephalography data via dimension reduction of a "multi-scale, hybrid" feature space. Following this decoding approach, the authors aim to show that early skill learning involves "contextualization" of the neural coding of individual movements, relative to their position in a sequence of consecutive movements. Furthermore, they aim to show that this "contextualization" develops primarily during short rest periods interspersed with skill training, and correlates with a performance metric which the authors interpret as an indicator of offline learning.

      Strengths:

      A strength of the paper is the innovative decoding approach, which achieves impressive decoding accuracies via dimension reduction of a "multi-scale, hybrid space". This hybrid-space approach follows the neurobiologically plausible idea of concurrent distribution of neural coding across local circuits as well as large-scale networks. A further strength of the study is the large number of tested dimension reduction techniques and classifiers.

      Weaknesses:

      A clear weakness of the paper lies in the authors' conclusions regarding "contextualization". Several potential confounds, which partly arise from the experimental design (mainly the use of a single sequence) and which are described below, question the neurobiological implications proposed by the authors, and provide a simpler explanation of the results. Furthermore, the paper follows the assumption that short breaks result in offline skill learning, while recent evidence, described below, casts doubt on this assumption.

      Specifically:<br /> The authors interpret the ordinal position information captured by their decoding approach as a reflection of neural coding dedicated to the local context of a movement (Figure 4). One way to dissociate ordinal position information from information about the moving effectors is to train a classifier on one sequence, and test the classifier on other sequences that require the same movements, but in different positions (Kornysheva et al., Neuron 2019). In the present study, however, participants trained to repeat a single sequence (4-1-3-2-4). As a result, ordinal position information is potentially confounded by the fixed finger transitions around each of the two critical positions (first and fifth press). Across consecutive correct sequences, the first keypress in a given sequence was always preceded by a movement of the index finger (=last movement of the preceding sequence), and followed by a little finger movement. The last keypress, on the other hand, was always preceded by a ring finger movement, and followed by an index finger movement (=first movement of the next sequence). Figure 4 - supplement 2 shows that finger identity can be decoded with high accuracy (>70%) across a large time window around the time of the keypress, up to at least {plus minus}100 ms (and likely beyond, given that decoding accuracy is still high at the boundaries of the window depicted in that figure). This time window approaches the keypress transition times in this study. Given that distinct finger transitions characterized the first and fifth keypress, the classifier could thus rely on persistent (or "lingering") information from the preceding finger movement, and/or "preparatory" information about the subsequent finger movement, in order to dissociate the first and fifth keypress. Currently, the manuscript provides little evidence that the context information captured by the decoding approach is more than a by-product of temporally extended, and therefore overlapping, but independent neural representations of consecutive keypresses that are executed in close temporal proximity - rather than a neural representation dedicated to context.<br /> During the review process, the authors pointed out that a "mixing" of temporally overlapping information from consecutive keypresses, as described above, should result in systematic misclassifications and therefore be detectable in the confusion matrices in Figures 3C and 4B, which indeed do not provide any evidence that consecutive keypresses are systematically confused. However, such absence of evidence (of systematic misclassification) should be interpreted with caution, and, of course, provides no evidence of absence. The authors also pointed out that such "mixing" would hamper the discriminability of the two ordinal positions of the index finger, given that "ordinal position 5" is systematically followed by "ordinal position 1". This is a valid point which, however, cannot rule out that "contextualization" nevertheless reflects the described "mixing".

      During the review process, the authors responded to my concern that training of a single sequence introduces the potential confound of "mixing" described above, which could have been avoided by training on several sequences, as in Kornysheva et al. (Neuron 2019), by arguing that Day 2 in their study did include control sequences. However, the authors' findings regarding these control sequences are fundamentally different from the findings in Kornysheva et al. (2019), and do not provide any indication of effector-independent ordinal information in the described contextualization - but, actually, the contrary. In Kornysehva et al. (Neuron 2019), ordinal, or positional, information refers purely to the rank of a movement in a sequence. In line with the idea of competitive queuing, Kornysheva et al. (2019) have shown that humans prepare for a motor sequence via a simultaneous representation of several of the upcoming movements, weighted by their rank in the sequence. Importantly, they could show that this gradient carries information that is largely devoid of information about the order of specific effectors involved in a sequence, or their timing, in line with competitive queuing. They showed this by training a classifier to discriminate between the five consecutive movements that constituted one specific sequence of finger movements (five classes: 1st, 2nd, 3rd, 4th, 5th movement in the sequence) and then testing whether that classifier could identify the rank (1st, 2nd, 3rd, etc) of movements in another sequence, in which the fingers moved in a different order, and with different timings. Importantly, this approach demonstrated that the graded representations observed during preparation were largely maintained after this cross-decoding, indicating that the sequence was represented via ordinal position information that was largely devoid of information about the specific effectors or timings involved in sequence execution. This result differs completely from the findings in the current manuscript. Dash et al. report a drop in detected ordinal position information (degree of contextualization in figure 5C) when testing for contextualization in their novel, untrained sequences on Day 2, indicating that context and ordinal information as defined in Dash et al. is not at all devoid of information about the specific effectors involved in a sequence. In this regard, a main concern in my public review, as well as the second reviewer's public review, is that Dash et al. cannot tell apart, by design, whether there is truly contextualization in the neural representation of a sequence (which they claim), or whether their results regarding "contextualization" are explained by what they call "mixing" in their author response, i.e., an overlap of representations of consecutive movements, as suggested as an alternative explanation by Reviewer 2 and myself.

      Such temporal overlap of consecutive, independent finger representations may also account for the dynamics of "ordinal coding"/"contextualization", i.e., the increase in 2-class decoding accuracy, across Day 1 (Figure 4C). As learning progresses, both tapping speed and the consistency of keypress transition times increase (Figure 1), i.e., consecutive keypresses are closer in time, and more consistently so. As a result, information related to a given keypress is increasingly overlapping in time with information related to the preceding and subsequent keypresses. The authors seem to argue that their regression analysis in Figure 5 - figure supplement 3 speaks against any influence of tapping speed on "ordinal coding" (even though that argument is not made explicitly in the manuscript). However, Figure 5 - figure supplement 3 shows inter-individual differences in a between-subject analysis (across trials, as in panel A, or separately for each trial, as in panel B), and, therefore, says little about the within-subject dynamics of "ordinal coding" across the experiment. A regression of trial-by-trial "ordinal coding" on trial-by-trial tapping speed (either within-subject, or at a group-level, after averaging across subjects) could address this issue. Given the highly similar dynamics of "ordinal coding" on the one hand (Figure 4C), and tapping speed on the other hand (Figure 1B), I would expect a strong relationship between the two in the suggested within-subject (or group-level) regression. Furthermore, learning should increase the number of (consecutively) correct sequences, and, thus, the consistency of finger transitions. Therefore, the increase in 2-class decoding accuracy may simply reflect an increasing overlap in time of increasingly consistent information from consecutive keypresses, which allows the classifier to dissociate the first and fifth keypress more reliably as learning progresses, simply based on the characteristic finger transitions associated with each. In other words, given that the physical context of a given keypress changes as learning progresses - keypresses move closer together in time, and are more consistently correct - it seems problematic to conclude that the mental representation of that context changes. To draw that conclusion, the physical context should remain stable (or any changes to the physcial context should be controlled for).

      A similar difference in physical context may explain why neural representation distances ("differentiation") differ between rest and practice (Figure 5). The authors define "offline differentiation" by comparing the hybrid space features of the last index finger movement of a trial (ordinal position 5) and the first index finger movement of the next trial (ordinal position 1). However, the latter is not only the first movement in the sequence, but also the very first movement in that trial (at least in trials that started with a correct sequence), i.e., not preceded by any recent movement. In contrast, the last index finger of the last correct sequence in the preceding trial includes the characteristic finger transition from the fourth to the fifth movement. Thus, there is more overlapping information arising from the consistent, neighbouring keypresses for the last index finger movement, compared to the first index finger movement of the next trial. A strong difference (larger neural representation distance) between these two movements is, therefore, not surprising, given the task design, and this difference is also expected to increase with learning, given the increase in tapping speed, and the consequent stronger overlap in representations for consecutive keypresses. Furthermore, initiating a new sequence involves pre-planning, while ongoing practice relies on online planning (Ariani et al., eNeuro 2021), i.e., two mental operations that are dissociable at the level of neural representation (Ariani et al., bioRxiv 2023).

      A further complication in interpreting the results stems from the visual feedback that participants received during the task. Each keypress generated an asterisk shown above the string on the screen. It is not clear why the authors introduced this complicating visual feedback in their task, besides consistency with their previous studies. The resulting systematic link between the pattern of visual stimulation (the number of asterisks on the screen) and the ordinal position of a keypress makes the interpretation of "contextual information" that differentiates between ordinal positions difficult. During the review process, the authors reported a confusion matrix from a classification of asterisks position based on eye tracking data recorded during the task, and concluded that the classifier performed at chance level and gaze was, thus, apparently not biased by the visual stimulation. However, the confusion matrix showed a huge bias that was difficult to interpret (a very strong tendency to predict one of the five asterisk positions, despite chance-level performance). Without including additional information for this analysis (or simply the gaze position as a function of the number of astersisk on the screen) in the manuscript, this important control anaylsis cannot be properly assessed, and is not available to the public.

      The authors report a significant correlation between "offline differentiation" and cumulative micro-offline gains. However, this does not address the question whether there is a trial-by-trial relation between the degree of "contextualization" and the amount of micro-offline gains - i.e., the question whether performance changes (micro-offline gains) are less pronounced across rest periods for which the change in "contextualization" is relatively low. The single-subject correlation between contextualization changes "during" rest and micro-offline gains (Figure 5 - figure supplement 4) addresses this question, however, the critical statistical test (are correlation coefficients significantly different from zero) is not included. Given the displayed distribution, it seems unlikely that correlation coefficients are significantly above zero.

      The authors follow the assumption that micro-offline gains reflect offline learning. However, there is no compelling evidence in the literature, and no evidence in the present manuscript, that micro-offline gains (during any training phase) reflect offline learning. Instead, emerging evidence in the literature indicates that they do not (Das et al., bioRxiv 2024), and instead reflect transient performance benefits when participants train with breaks, compared to participants who train without breaks, however, these benefits vanish within seconds after training if both groups of participants perform under comparable conditions (Das et al., bioRxiv 2024). During the review process, the authors argued that differences in the design between Das et al. (2024) on the one hand (Experiments 1 and 2), and the study by Bönstrup et al. (2019) on the other hand, may have prevented Das et al. (2024) from finding the assumed (lasting) learning benefit by micro-offline consolidation. However, the Supplementary Material of Das et al. (2024) includes an experiment (Experiment S1) whose design closely follows the early learning phase of Bönstrup et al. (2019), and which, nevertheless, demonstrates that there is no lasting benefit of taking breaks for the acquired skill level, despite the presence of micro-offline gains.

      Along these lines, the authors' claim, based on Bönstrup et al. 2020, that "retroactive interference immediately following practice periods reduces micro-offline learning", is not supported by that very reference. Citing Bönstrup et al. (2020), "Regarding early learning dynamics (trials 1-5), we found no differences in microscale learning parameters (micro-online/offline) or total early learning between both interference groups." That is, contrary to Dash et al.'s current claim, Bönstrup et al. (2020) did not find any retroactive interference effect on the specific behavioral readout (micro-offline gains) that the authors assume to reflect consolidation.

      The authors conclude that performance improves, and representation manifolds differentiate, "during" rest periods (see, e.g., abstract). However, micro-offline gains (as well as offline contextualization) are computed from data obtained during practice, not rest, and may, thus, just as well reflect a change that occurs "online", e.g., at the very onset of practice (like pre-planning) or throughout practice (like fatigue, or reactive inhibition). That is, the definition of micro-offline gains (as well as offline contextualization) conflates online and "offline" processes. This becomes strikingly clear in the recent Nature paper by Griffin et al. (2025), who computed micro-offline gains as the difference in average performance across the first five sequences in a practice period (a block, in their terminology) and the last five sequences in the previous practice period. Averaging across sequences in this way minimises the chance to detect online performance changes, and inflates changes in performance "offline". The problem that "offline" gains (or contextualization) is actually computed from data entirely generated online, and therefore subject to processes that occur online, is inherent in the very definition of micro-offline gains, whether, or not, they computed from averaged performance.

      A simple control analysis based on shuffled class labels could lend further support to the authors' complex decoding approach. As a control analysis that completely rules out any source of overfitting, the authors could test the decoder after shuffling class labels. Following such shuffling, decoding accuracies should drop to chance-level for all decoding approaches, including the optimized decoder. This would also provide an estimate of actual chance-level performance (which is informative over and beyond the theoretical chance level). During the review process, the authors reported this analysis to the reviewers. Given that readers may consider following the presented decoding approach in their own work, it would have been important to include that control analysis in the manuscript to convince readers of its validity.

      Furthermore, the authors' approach to cortical parcellation raises questions regarding the information carried by varying dipole orientations within a parcel (which currently seems to be ignored?) and the implementation of the mean-flipping method (given that there are two dimensions - space and time - it is unclear what the authors refer to when they talk about the sign of the "average source", line 477).

    1. Reviewer #1 (Public review):

      Summary:

      In this work, the authors investigate the functional difference between the most commonly expressed form of PTH, and a novel point mutation in PTH identified in a patient with chronic hypocalcemia and hyperphosphatemia. The value of this mutant form of PTH as a potential anabolic agent for bone is investigated alongside PTH(1-84), which is a current anabolic therapy. The authors have achieved the aims of the study.

      Strengths:

      The work is novel, as it describes the function of a novel, naturally occurring, variant of PTH in terms of its ability to dimerise, to lead to cAMP activation, to increase serum calcium, and its pharmacological action compared to normal PTH.

      Comments on revisions: No further recommendations for revisions. Acceptable as the paper stands.

      [Editors' note: the original reviews are here, https://doi.org/10.7554/eLife.97579.1.sa1]

    1. Reviewer #1 (Public review):

      Summary:

      In this paper, the authors have performed an antigenic assay for human seasonal N1 neuraminidase using antigens and mouse sera from 2009-2020 (with one avian N1 antigen). This shows two distinct antigen groups. There is poorer reactivity with sera from 2009-2012 against antigens from 2015-2019, and poorer reactivity with sera from 2015-2020 against antigens from 2009-2013. There is a long branch separating these two groups. However, 321 and 423 are the only two positions that are consistently different between the two groups. Therefore these are the most likely cause of these antigenic differences.

      Strengths:

      (1) A sensible rationale was given for the choice of sera, in terms of the genetic diversity.

      (2) There were two independent batches of one of the antigens used for generating sera, which demonstrated the level of heterogeneity in the experimental process.

      (3) Replicate of the Wisconsin/588/2019 antigen (as H1 and H6) is another useful measure of heterogeneity.

      (4) The presentation of the data, e.g. Figure 2, clearly shows two main antigenic groups.

      (5) The most modern sera are more recent than other related papers, which demonstrates that has been no major antigenic change.

      Weaknesses:

      (1) Issues with experimental methods<br /> As I am not an experimentalist, I cannot comment fully on the experimental methods. However, I note that BALB/c mice sera were used, whereas outbred ferret sera are typically used in influenza antigenic characterisation, so the antigenic difference observed may not be relevant in humans. Similarly, the mice were immunised with an artificial NA immunogen where the typical approach would be to infect the ferret with live virus intra-nasally.

      (2) Five mice sera were generated per immunogen and then pooled, but data was not presented that demonstrated these sera were sufficiently homogenous that this approach is valid.

      (3) There were no homologous antigens for most of the sera. This makes the responses difficult to interpret as the homologous titre is often used to assess the overall reactivity of a serum. The sequence of the antigens used is not described, which again makes it difficult to interpret the results.

      (4) To be able to untangle the effects of the individual substitutions at 321, 386, and 432, it would have been useful to have included the naturally occurring variants at these positions, or to have generated mutants at these positions. Gao et al clearly show an antigenic difference with ferret sera correlated separately with N386K and I321V/K432E.

      (5) The challenge experiments in Gao et al showed that NI titre was not a good correlate of protection, so that limits the interpretation of these results.

      Issues with the computational methods

      (6) The NAI titres were normalised using the ELISA results, and the motivation for this is not explained. It would be nice to see the raw values.

      (7) It is not clear what value the random forest analysis adds here, given that positions 321 and 432 are the only two that consistently differ between the two groups.

      (8) As with the previous N2 paper, the metric for antigenic distance (the root mean square of the difference between the titres for two sera) is not one that would be consistent when different sera are included. More usual metrics of distance are Archetti-Horsfall, fold down from homologous, or fold down from maximum.

      (9) Antigenic cartography of these data is fraught. I wonder whether 2 dimensions are required for what seems like a 1-dimensional antigenic difference - certainly, the antigens, excluding the H5N1, are in a line. The map may be skewed by the high reactivity Brisbane/18 antigen. It is not clear if the column bases (normalisation factors for calculating antigenic distance) have been adjusted to account for the lack of homologous antigens. It is typical to present antigenic maps with a 1:1 x:y ratio.

      Issues with interpretation

      (10) Figure 2 shows the NAI titres split into two groups for the antigens, however, A/Brisbane is an outlier in the second antigenic group with high reactivity.

      (11) Following Gao et al, I think you can claim that it is more likely that the antigenic change is due to K432E than I321V, based on a comparison of the amino acid change.

      Appraisal:

      Taking into account the limitations of the experimental techniques (which I appreciate are due to resource constraints), this paper meets its aim of measuring the antigenic relationships between 2009-2020 seasonal N1s, showing that there were two main groups. The authors discovered that the difference between the two antigenic groups was likely attributable to positions 321 and 432, as these were the only two positions that were consistently different between the two groups. They came to this finding by using a random forest model, but other simpler methods could have been used.

      Impact:

      This paper contributes to the growing literature on the potential benefit of NA in the influenza vaccine.

    2. Reviewer #2 (Public review):

      Summary:

      In this study, Catani et al. have immunized mice with 17 recombinant N1 neuraminidases (NAs) from human isolates circulating between 2009-2020 to investigate antigenic diversity. NA inhibition (NAI) titers revealed two groups that were antigenically and phylogenetically distinct. Machine learning was used to estimate the antigenic distances between the N1 NAs and mutations at residues K432E and I321V were identified as key determinants of N1 NA antigenicity.

      Strengths:

      Observation of mutations associated with N1 antigenic drift.

      Weaknesses:

      Validation that K432E and I321V are responsible for antigenic drift was not determined in a background strain with native K432 and I321 or the restitution of antibody binding by reversion to K432 and I321 in strains that evaded sera.

    1. Reviewer #1 (Public review):

      Summary:

      Shi and colleagues report the use of modified Cre lines in which the coding region of Cre is disrupted by rox-STOP-rox or lox-STOP-lox sequences to prevent the expression of functional protein in the absence of Dre or Cre activity, respectively. The main purpose of these tools is to enable intersectional or tamoxifen-induced Cre activity with minimal or no leaky activity from the second, Cre-expressing allele. It is a nice study but lacks some functional data required to determine how useful these alleles will be in practice, especially in comparison with the figure line that stimulated their creation.

      Strengths:

      The new tools can reduce Cre leak in vivo.

      Comments on revisions:

      The major improvement in my mind is the inclusion of Supp Fig 7 where the authors compare their loxCre to iSureCre. The discussion is somewhat improved, but still fails to discuss significant issues such as Cre toxicity in detail. As noted by most reviewers, without a biological question the paper is entirely a technical description of a a couple of new tools. However, I do feel that these tools will be of use to the field.

    2. Reviewer #2 (Public review):

      This work present new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      The study and the new models have also some limitations. The demonstration of efficient deletion of multiple floxed alleles in a mosaic fashion, a scenario where the lines would demonstrate their full potential compared to existing models, has not been tested in the current study. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. In addition, as discussed by the authors, a limitation of this line is the constitutive expression of Cre, which is associated with toxicity in some cases.

    3. Reviewer #3 (Public review):

      Shi et al describe a new set of tools to facilitate Cre or Dre-recombinase-mediated recombination in mice. The strategies are not completely novel but have been pursued previously by the lab, which is world-leading in this field, and by others. The authors report a new version of the iSuRe-Cre approach, which was originally developed by Rui Benedito's group in Spain. Shi et al describe that their approach shows reduced leakiness compared to the iSuRe-Cre line. Furthermore, a new R26-roxCre-tdT mouse line was established after extensive testing, which enables efficient expression of the Cre recombinase after activation of the Dre recombinase. The authors carefully evaluated efficiency and leakiness of the new line and demonstrated the applicability by marking peri-central hepatocytes in an intersectional genetics approach. The paper represents the result of enormous, carefully executed efforts. Although I would have preferred to see a study, which uses the wonderful new tools to address a major biological question, carefully conducted technical studies have a considerable value for the scientific community, justifying publication.

      It seems very likely that the new mouse lines generated in this study will enhance the precision of genetic manipulation in distinct cell types and greatly facilitate future work in numerous laboratories. The authors expertly have eradicated weaknesses from the initial submission. One minor issue remains. The authors did not investigate potential toxic effects that might be caused by high level expression of a combination of "foreign" genes such as recombinases and fluorescence reporters. The authors refer to published studies about toxic effects, speculating that they can only be prevented by removing recombinases in an additional step. Although this is a valid argument, I would have appreciated to see an assessment of putative toxic effects by RNA-sequencing, since different combinations of recombinases and fluorescence reporters sometimes can generate unexpected effects. However, this minor issue does not compromise the value of this important study.

    1. Reviewer #1 (Public review):

      Summary:

      In this article, Chunharas and colleagues compared the representational differences of orientation information during a sensory task and a working memory task. By reanalyzing data from a previous fMRI study and applying representational similarity analysis (RSA), they observed that orientation information was represented differently in the two tasks: during visual perception, orientation representation resembled the veridical model, which captures the known naturalistic statistics of orientation information; whereas during visual working memory, a categorical model, which assumes different psychological distances between orientations, better explained the data, particularly in more anterior retinotopic regions. The authors suggest fundamental differences in the representational geometry of visual perception and working memory along the human retinotopic cortex.

      Strengths:

      Examining the differences in representational geometry between perception and working memory has important implications for the understanding of the nature of working memory. This study presents a carefully-executed reanalysis of previous data to address this question. The authors developed a novel method (model construction combined with RSA) to examine the representational geometry of orientation information under different tasks, and the control analyses provide rich, convincing support for their claims.

      Weaknesses:

      Although the control analyses are convincing, I still have alternative explanations for some of the results. I'm also concerned about the low sample size (n = 6 in the fMRI experiment). Overall, I think additional analyses may help to further clarify the issues and strengthen the claims.

      (1) The central claim of the current study is that orientation information is represented in a veridical manner during the sensory task, and in a categorical manner during working memory. However, In the sensory task, a third type of representational geometry was observed, especially in brain regions from V3AB and beyond. These regions showed a symmetric pattern in which oblique orientations (45 and 135 degrees) appeared more similar to each other. In fact, a similar pattern can even be found in V1-V3, although the effect looked weaker. The authors raised two possible explanations for this in the discussion, one being that participants might have used verbal labels (e.g., diagonal) for both orientations, and the other being a lack of attention to orientation. Either way, this suggests that a veridical model may not be the best fit for these ROIs. How would this symmetric model explain the sensory data, in comparison to the veridical model?

      (2) If the symmetric model also explains the sensory data well, I wonder whether this result challenges the authors' central claim, or instead suggests that the sensory task is not ideal for the purpose of the study. One way to address this issue might be to use the sample period of the working memory task as the perception task, as some other studies have been doing (e.g., Kwak & Curtis, 2022). This epoch of data might function as a stronger version of the attention task as the authors discussed in the discussion. What would the representational geometry look like in the sample period? I would also like to note that the current analyses used 5.6-13.6 s after stimulus onset for the memory task, which I think may reflect a mix of sample- and delay-related activity.

      (3) When comparing the veridical and categorical models, it is important to first show the significance of each model before making comparisons. For instance, was the veridical model significant in different ROIs in the memory task? And was either model significant in IPS1-3 in the two tasks? I'm asking about this because the two models appear to be both significant in the memory task, whereas only the veridical model was significant in the sensory task (with overall lower correlation coefficients than the categorical model in the memory task).

      (4) The current study has a low sample size of six participants. With such a small sample, it would be helpful to show results from individual participants. For example, I appreciate that Figures 2D and 3C showed individual data points, but additionally showing the representational geometry plot (i.e., Figure 1C) for each subject could better illustrate the robustness of the effect. Alternatively, the original paper from which the fMRI data were drawn actually had two fMRI experiments with similar task designs. I wonder if the authors could replicate these patterns using data from the second experiment with seven participants. This might provide even stronger support for the current findings with a more reasonable sample size.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors examined the representational geometry of orientation representations during visual perception and working memory along the visual hierarchy. Using representational similarity analysis, they found that similarity was relatively evenly distributed among all orientations during perception, while higher around oblique orientations during WM. There were some noticeable differences along the visual hierarchy. IPS showed the most pronounced oblique orientation preferences during WM but no clear patterns during perception, likely due to the different task demands for the WM orientation task and the perception contrast discrimination task. The authors proposed two models to capture the differences. The veridical model estimated the representational geometry in perception by assuming an efficient coding framework, while the categorical model estimated the pattern in WM using psychological distances to measure the differences among orientations (including estimates from a separate psychophysical study performed outside the scanner). Therefore, I think this work is valuable and advances our understanding of the transition from perception to memory.

      Strengths:

      The use of RSA to identify representational biases goes beyond simply relying on response patterns and helps identify how representational formats change from perception to WM. The study nicely leverages ideas about efficient coding to explain perceptual representations that are more veridical, while leaning on ideas about abstractions of percepts that are more categorical-psychological in nature (but see (1) below). Moreover, the match between memory biases of orientation and the patterns estimated with RSA were compelling (but see (2) below). I found the analyses showing how RSA and decoding (eg, cross-generalization) are associated and how/why they may differ to be particularly interesting.

      Weaknesses:

      (1) The idea that later visual maps (ie, IPS0) encode perceptions of orientation in a veridical form and then in a categorical form during WM is an attractive idea. However, the support is somewhat weakened by a few issues. The RSA plots in Figure 1C for IPS0 appear to show a similar pattern, but just of lower amplitude during perception. But in the model fits either for orientation statistics or estimated from the psychophysics task, the Veridical model fits best for perception and the Categorical model fits best for memory in IPS0. By my eye, the modeled RSMs in Figures 2 & 3 do not look like the observed ones in Figure 1C. Those modeled RSMs look way more categorical than the observed IPS0. They look like something in between.

      (2) My biggest concern is the omission of the in-scanner behavioral data. Yes, on the one hand, they used the N=17 outside the scanner psychophysics dataset for the analyses in Figure 3. On the other hand, they do not even mention the behavioral data collected in the scanner along with the BOLD data. Those data had clear oblique effects if I recall correctly. Why use the data from the psychophysics experiment? Also, perhaps a missed opportunity; I wonder if the Veridical/Categorical models fit a single subject's RSA data matches that subject's behavioral biases. That would really be compelling if found.

      The data were collected (reanalysis of published study) without consideration for the aims of the current study, and are therefore not optimized to test their goals. The biggest issue is that "The distractors are really distracting me." I'm somewhat concerned about how the distractors may have impacted the results. I honestly did not notice that the authors were using delay periods that had 11s of distractor stimuli until way into the paper. On the one hand, the "patterns" of the model fits across the ROIs appear to be qualitatively similar. That's good if you want to pool data like the authors did. But, while the authors state on line 350 "..we also confirmed that the presence of distractors during the delay did not impact the pattern of results in the memory task (Supplementary Figure 5)." When looking at Supplementary Figure 5, I noticed that there are a couple of exceptions to this. In the Gratings distractor data, V1 shows a better fit to the Veridical model, while V4 and IPS0 shows no better fit to either model. And in the Noise distractor data, neither model fits better for any ROI. At first glance, I was concerned, but then looking at the No distractor data, the pattern is identical to that of the combined data. Thus, this can be seen as a glass half full/empty issue as almost all of the ROIs show a similar pattern, but still it would concern me if I were leading this study. This gets me to my key question, why even use the distractor trials at all, where the interpretation can get dicey? For instance, the authors have shown in this exact data that the impact of distraction affects the fidelity of representations differently along the visual hierarchy (Rademaker, 2019), consistent with several other studies (eg., Bettencourt & Xu, 2016; Lorenc, 2018; Hallenbeck et al., 2022) and with one of the author's preprints (Rademaker & Serences, 2024). My guess is that without the full dataset, some of the RSA analyses are underpowered. If that is the case, I'm fine with it, but it might be nice to state that.

    1. Reviewer #1 (Public review):

      Summary:

      This work tried to map the synaptic connectivity between the inputs and outputs of the song premotor nucleus, HVC in zebra finches to understand how sensory (auditory) to motor circuits interact to coordinate song production and learning. The authors optimized the optogenetic technique via AAV to manipulate auditory inputs from a specific auditory area one-by-one and recorded synaptic activity from a neuron with whole-cell recording from slice preparation with identification of the projection area by retrograde neuronal tracing. This thorough and detailed analysis provides compelling evidence of synaptic connections between 4 major auditory inputs (3 forebrain and 1 thalamic region) within three projection neurons in the HVC; all areas give monosynaptic excitatory inputs and polysynaptic inhibitory inputs, but proportions of projection to each projection neuron varied. They also find specific reciprocal connections between mMAN and Av. Taken together the authors provide the map of the synaptic connection between intercortical sensory to motor areas which is suggested to be involved in zebra finch song production and learning.

      Strengths:

      The authors optimized optogenetic tools with eGtACR1 by using AAV which allow them to manipulate synaptic inputs in a projection-specific manner in zebra finches. They also identify HVC cell types based on projection area. With their technical advance and thorough experiments, they provided detailed map synaptic connections.

      Weaknesses:

      As it is the study in brain slice, the functional implication of synaptic connectivity is limited. Especially as all the experiments were done in the adult preparation, there could be a gap in discussing the functions of developmental song learning.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes synaptic connectivity in the Songbird cortex's four main classes of sensory neuron afferents onto three known classes of projection neurons of the pre-motor cortical region HVC. HVC is a region associated with the generation of learned bird songs. Investigators here use all male zebra finches to examine the functional anatomy of this region using patch clamp methods combined with optogenetic activation of select neuronal groups.

      Strengths:

      The quality of the recordings is extremely high and the quantity of data is on a very significant scale, this will certainly aid the field.

      Weaknesses:

      The authors could make the figures a little easier to navigate. Most of the figures use actual anatomical images but it would be nice to have this linked with a zebra finch atlas in more of a cartoon format that accompanied each fluro image. Additionally, for the most part, figures showing the labeling lack scale bar values (in um). These should be added not just shown in the legends.

      The authors could make it clear in the abstract that this is all male zebra finches - perhaps this is obvious given the bird song focus, but it should be stated. The number of recordings from each neuron class and the overall number of birds employed should be clearly stated in the methods (this is in the figures, but it should say n=birds or cells as appropriate).

      The authors should consider sharing the actual electrophysiology records as data.

    3. Reviewer #3 (Public review):

      Nucleus HVC is critical both for song production as well as learning and arguably, sitting at the top of the song control system, is the most critical node in this circuit receiving a multitude of inputs and sending precisely timed commands that determine the temporal structure of song. The complexity of this structure and its underlying organization seem to become more apparent with each experimental manipulation, and yet our understanding of the underlying circuit organization remains relatively poorly understood. In this study, Trusel and Roberts use classic whole-cell patch clamp techniques in brain slices coupled with optogenetic stimulation of select inputs to provide a careful characterization and quantification of synaptic inputs into HVC. By identifying individual projection neurons using retrograde tracer injections combined with pharmacological manipulations, they classify monosynaptic inputs onto each of the three main classes of glutamatergic projection neurons in HVC (RA-, Area X- and Av-projecting neurons). This study is remarkable in the amount of information that it generates, and the tremendous labor involved for each experiment, from the expression of opsins in each of the target inputs (Uva, NIf, mMAN, and Av), the retrograde labelling of each type of projection neuron, and ultimately the optical stimulation of infected axons while recording from identified projection neurons. Taken together, this study makes an important contribution to increasing our identification, and ultimately understanding, of the basic synaptic elements that make up the circuit organization of HVC, and how external inputs, which we know to be critical for song production and learning, contribute to the intrinsic computations within this critic circuit.

      This study is impressive in its scope, rigorous in its implementation, and thoughtful regarding its limitations. The manuscript is well-written, and I appreciate the clarity with which the authors use our latest understanding of the evolutionary origins of this circuit to place these studies within a larger context and their relevance to the study of vocal control, including human speech. My comments are minor and primarily about legibility, clarification of certain manipulations, and organization of some of the summary figures.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Shao et al. investigate the contribution of different cortical areas to working memory maintenance and control processes, an important topic involving different ideas about how the human brain represents and uses information when no longer available to sensory systems. In two fMRI experiments, they demonstrate that human frontal cortex (area sPCS) represents stimulus (orientation) information both during typical maintenance, but even more so when a categorical response demand is present. That is, when participants have to apply an added level of decision control to the WM stimulus, sPCS areas encode stimulus information more than conditions without this added demand. These effects are then expanded upon using multi-area neural network models, recapitulating the empirical gradient of memory vs control effects from visual to parietal and frontal cortices. Multiple experiments and analysis frameworks provide support for the authors' conclusions, and control experiments and analysis are provided to help interpret and isolate the frontal cortex effect of interest. While some alternative explanations/theories may explain the roles of frontal cortex in this study and experiments, important additional analyses have been added that help ensure a strong level of support for these results and interpretations.

      Strengths:

      - The authors use an interesting and clever task design across two fMRI experiments that is able to parse out contributions of WM maintenance alone along with categorical, rule-based decisions. Importantly, the second experiments only uses one fixed rule, providing both an internal replication of Experiment 1's effects and extending them to a different situation when rule switching effects are not involved across mini-blocks.

      - The reported analyses using both inverted encoding models (IEM) and decoders (SVM) demonstrate the stimulus reconstruction effects across different methods, which may be sensitive to different aspects of the relationship between patterns of brain activity and the experimental stimuli.

      - Linking the multivariate activity patterns to memory behavior is critical in thinking about the potential differential roles of cortical areas in sub-serving successful working memory. Figure 3's nicely shows a similar interaction to that of Figure 2 in the role of sPCS in the categorization vs. maintenance tasks. This is an important contribution to the field when we consider how a distributed set of interacting cortical areas support successful working memory behavior.

      - The cross-decoding analysis in Figure 4 is a clever and interesting way to parse out how stimulus and rule/category information may be intertwined, which would have been one of the foremost potential questions or analyses requested by careful readers.

      - Additional ROI analyses in more anterior regions of the PFC help to contextualize the main effects of interest in the sPCS (and no effect in the inferior frontal areas, which are also retinotopic, adds specificity). And, more explanation for how motor areas or preparation are likely not involved strengthens the takeaways of the study (M1 control analysis).

      - Quantitative link via RDM-style analyses between the RNNs constructed and fMRI data.

      Weaknesses:

      - In the given tasks, multiple types of information codes may be present, and more detail on this possibility could always be added analytically or in discussion. However, the authors have added beneficial support to this comparison in this version of the manuscript.

      - The space of possible RNN architectures and their biological feasibility could always be explored more, but links between the fMRI and RNN data provide a good foundation for this work moving forward.

    2. Reviewer #2 (Public review):

      Summary:

      The author provide evidence that helps resolve long-standing questions about the differential involvement of frontal and posterior cortex in working memory. They show that whereas early visual cortex shows stronger decoding of memory content in a memorization task vs a more complex categorization task, frontal cortex shows stronger decoding during categorization tasks than memorization tasks. They find that task-optimized RNNs trained to reproduce the memorized orientations show some similarities in neural decoding to people. Together, this paper presents interesting evidence for differential responsibilities of brain areas in working memory.

      Strengths:

      This paper was overall strong. It had a well-designed task, best-practice decoding methods, and careful control analyses. The neural network modeling adds additional insight into the potential computational roles of different regions.

      Weaknesses:

      Few. The RNN-fMRI correspondence could be a little more comprehensive, but the paper contributes a compelling set of empirical findings and interpretations that can inform future research.

    1. Reviewer #1 (Public review):

      Here, the authors propose that changes in m6A levels may be predictable via a simple model that is based exclusively on mRNA metabolic events. Under this model, m6A mRNAs are "passive" victims of RNA metabolic events with no "active" regulatory events needed to modulate their levels by m6A writers, readers, or erasers; looking at changes in RNA transcription, RNA export, and RNA degradation dynamics is enough to explain how m6A levels change over time.

      The relevance of this study is extremely high at this stage of the epitranscriptome field. This compelling paper is in line with more and more recent studies showing how m6A is a constitutive mark reflecting overall RNA redistribution events. At the same time, it reminds every reader to carefully evaluate changes in m6A levels if observed in their experimental setup. It highlights the importance of performing extensive evaluations on how much RNA metabolic events could explain an observed m6A change.

    2. Reviewer #2 (Public review):

      Dierks et al. investigate the impact of m6A RNA modifications on the mRNA life cycle, exploring the links between transcription, cytoplasmic RNA degradation and subcellular RNA localization. Using transcriptome-wide data and mechanistic modelling of RNA metabolism, the authors demonstrate that a simplified model of m6A primarily affecting cytoplasmic RNA stability is sufficient to explain the nuclear-cytoplasmic distribution of methylated RNAs and the dynamic changes in m6A levels upon perturbation. Based on multiple lines of evidence, they propose that passive mechanisms based on the restricted decay of methylated transcripts in the cytoplasm play a primary role in shaping condition-specific m6A patterns and m6A dynamics. The authors support their hypothesis with multiple large-scale datasets and targeted perturbation experiments. Overall, the authors present compelling evidence for their model which has the potential to explain and consolidate previous observations on different m6A functions, including m6A-mediated RNA export.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript works with a hypothesis where the overall m6A methylation levels in cells is influenced by mRNA metabolism (sub-cellular localization and decay). The basic assumption is that m6A causes Mrna decay and this happens in the cytoplasm. They go on to experimentally test their model to confirm its predictions. This is confirmed by sub-cellular fractionation experiments which shows high m6A levels in the nuclear RNA. Nuclear localized RNAs have higher methylation. Using a heat shock model, they demonstrate that RNAs with increased nuclear localization or transcription, are methylated at higher levels. Their overall argument is that changes in m6A levels is rather determined by passive processes that are influenced by RNA processing/metabolism. However, it should be considered that erasers have their roles under specific environments (early embryos or germline) and are not modelled by the cell culture systems used here.

      Strengths:

      This is a thought-provoking series of experiments that challenge the idea that active mechanisms of recruitment or erasure are major determinants for m6A distribution and levels.

      Comments on revisions:

      The authors have done a good job with the revision.