[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.

Gene→Variant (gene-first): 1956:G719X 1956:L858R

Genes: 1956

Variants: G719X L858R

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.

Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

Genes: 2322

Variants: D835 D835Y F691

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

Genes: 2322

Variants: D835Y F691 F691 L F691I

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

Genes: 2322

Variants: D835Y F691 L/I

[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.

Gene→Variant (gene-first): 1956:L858R 1956:T790M

Genes: 1956

Variants: L858R T790M

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage discusses how the K27M mutation contributes to tumorigenesis in DIPGs, indicating its role in tumor development and progression. Diagnostic: The K27M mutation is associated with the diagnosis of DIPGs, as it helps guide diagnosis and targeted therapies in these tumors.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional

Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.

Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

Genes: 673 1956 324

Variants: L597V L858 L858R V855 V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:L858R 324:V855A

Genes: 1956 324

Variants: L858R V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.

Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

Genes: 2065 324

Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).

Gene→Variant (gene-first): 7298:rs3786362

Genes: 7298

Variants: rs3786362

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.

Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

Genes: 2260

Variants: c.1681G>A c.1966A>G p.K656E p.V561M

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

Genes: 3417 673

Variants: p.R132H p.V600E

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.

Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

Genes: 3845

Variants: A146T G12C G12D G13D Q61H

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.

Gene→Variant (gene-first): 2064:p.L755P

Genes: 2064

Variants: p.L755P

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

Genes: 2064

Variants: c.2262_2264delinsTCC p.(L755P)

[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.

Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

Genes: 79728

Variants: c.2514+1G>C c.3114-1G>A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

Genes: 2232 367 1387 10514 10499

Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.

Gene→Variant (gene-first): 9611:M886I

Genes: 9611

Variants: M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.

Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

Genes: 367 1387 10514

Variants: H874Y M749I Q798E

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.

Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

Genes: 2908 10499

Variants: I672 I672T R629 R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.

Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

Genes: 2232 367

Variants: G142V L57Q P390L P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.

Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

Genes: 367 10499

Variants: P390L R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.

Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

Genes: 10499 367

Variants: D879G H874Y Q919R T877A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

Evidence Type(s): Predisposing, Functional

Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.

Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

Genes: 367 9611

Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.

Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

Genes: 367 9611 1387 10514

Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

Genes: 367 9611

Variants: K910R M886 M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.

Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

Genes: 597 367 2908 10499

Variants: A586V A587S I672T R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

Genes: 2232 367

Variants: G142V G524D M523V M537V P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.

Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

Genes: 367 10514

Variants: P269S P390L P514S S515G

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.

Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 207 367 2232 9611

Variants: D221H D528G E198G P269S P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).

Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 1387 207 367 2232 9611

Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.

Gene→Variant (gene-first): 367:G166S 367:M537R

Genes: 367

Variants: G166S M537R

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.

Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

Genes: 2908 10499

Variants: I672 R629 T575

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Functional

Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.

Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

Genes: 1387 207 367 2232 10514

Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

Genes: 596

Variants: E152 E152A G101V V101

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.

Gene→Variant (gene-first): 596:G101V

Genes: 596

Variants: G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

Genes: 596

Variants: E152 E152A G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the role of E152 in venetoclax affinity, indicating a correlation with response or sensitivity to the therapy.

Gene→Variant (gene-first): 596:E152

Genes: 596

Variants: E152

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.

Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

Genes: 596

Variants: F104C F104L G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.

Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

Genes: 596

Variants: F104 F104L L104

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

Genes: 596

Variants: E152 G101 G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 596:F104

Genes: 596

Variants: F104

[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage describes a missense point mutation (Trp557Gly) identified in the KIT gene associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Diagnostic: The variant Trp557Gly is mentioned in the context of identifying and characterizing the tumors associated with neurofibromatosis type 1, suggesting its role in defining the disease subtype.

Gene→Variant (gene-first): 3815:Trp557Gly

Genes: 3815

Variants: Trp557Gly

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Functional

Justification: Diagnostic: The passage discusses the identification of rare germline variants (V37M, R181H) in patients with B-ALL, indicating their association with the disease. Functional: Luciferase assays performed on the variants showed no significant changes in transcriptional repression activity compared to WT ETV6, indicating an assessment of their molecular function.

Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

Genes: 2120

Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The detection of different localization patterns for the mutants P214L, R369Q, and R399C also suggests alterations in their molecular or biochemical function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the mutations L349P, N385fs, P214L, R369Q, and R399C impair the transcriptional repression function of ETV6, indicating that these variants alter molecular function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the L349P and N385fs mutations are predicted to alter the molecular function of the ETV6 protein, including conformational changes and truncation that affect DNA interaction.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs

Genes: 2120

Variants: L349P N385fs

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of a heterozygous deletion in ETV6 that is associated with the diagnosis of acute lymphoblastic leukemia (ALL) in the proband, indicating its role in defining the disease. Oncogenic: The variant N385fs is described as leading to a truncation of the ETV6 protein, which is implicated in tumor development, specifically in the context of acute lymphoblastic leukemia (ALL).

Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

Genes: 2120

Variants: N385fs c.1153-5_1153_1delAACAG

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Predisposing, Oncogenic

Justification: Diagnostic: The variant 415 T>C is associated with thrombocytopenia and leukemia, as it was identified in all affected family members and absent in unaffected individuals, indicating its role in defining the disease. Predisposing: The passage describes the variant as being present in affected individuals and absent in unaffected individuals, suggesting it confers inherited risk for developing the disease, although it does not explicitly state that it is germline. Oncogenic: The variant is described in the context of leukemia, indicating its potential role in tumor development or progression, particularly as it is a missense mutation in a gene associated with leukemia.

Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

Genes: 10320 2120

Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

[Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predisposing, Functional

Justification: Predisposing: The passage discusses inherited mutations in ETV6 that confer susceptibility to acute leukemia, indicating a germline origin and inherited risk for developing the disease. Functional: The passage describes how the ETV6 mutations (L349P and N385fs) alter the protein's localization and its ability to regulate gene expression, demonstrating a change in molecular function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs

Genes: 2120

Variants: L349P N385fs

[Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predisposing, Oncogenic, Functional

Justification: Predisposing: The passage describes a germline ETV6 p. L349P mutation identified in a kindred affected by thrombocytopenia and ALL, indicating an inherited risk for developing the disease. Oncogenic: The ETV6 p. N385fs mutation was found in leukemic cells and is associated with the deletion of wild type ETV6, suggesting its contribution to tumor development in the context of leukemia. Functional: The enforced expression of the ETV6 mutants showed impaired nuclear localization and a significantly reduced ability to regulate the transcription of ETV6 target genes, indicating an alteration in molecular function.

Gene→Variant (gene-first): 2120:p. L349P 2120:p. N385fs

Genes: 2120

Variants: p. L349P p. N385fs

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the T790M mutation as a mechanism of resistance to the EGFR inhibitor osimertinib, indicating its correlation with treatment response. Oncogenic: The T790M mutation is described as contributing to resistance in patients treated with EGFR inhibitors, suggesting its role in tumor progression.

Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

Genes: 1956

Variants: G719S L858R L861Q T790M

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses overall survival (OS) outcomes associated with the L858R variant, indicating that it correlates with disease outcome independent of therapy. Diagnostic: The mention of the type of EGFR mutation, including L858R, being associated with overall survival suggests its role in classifying or defining disease outcomes.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Prognostic

Justification: Predictive: The passage discusses the proportion of patients receiving first-line targeted therapy based on the presence of the L858R mutation, indicating a correlation with treatment response. Prognostic: The median overall survival (OS) for patients with the L858R mutation is reported, demonstrating its correlation with disease outcome independent of therapy.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses overall survival (OS) in patients with the L858R variant, indicating a correlation between this variant and disease outcome, independent of therapy. Diagnostic: The mention of distinct survival patterns observed in different EGFR mutation subclasses, including L858R, suggests that this variant is used to classify or define a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the prevalence of EGFR mutations, including L858R and L861X, in patients at initial diagnosis, indicating their association with the disease and their use in defining the mutation status of patients. Oncogenic: The variants L858R and L861X are described as actionable mutations within the context of EGFR, suggesting their role in tumor development or progression.

Gene→Variant (gene-first): 1956:L858R 1956:L861X

Genes: 1956

Variants: L858R L861X

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the impact of the insertions on the catalytic Gln61 might be stronger, indicating an alteration in molecular function related to GTP hydrolysis.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the HRAS p.G12V variant alters the signaling capability by affecting GTP hydrolysis and inducing phosphorylation of ERK and AKT, indicating a change in molecular function. Oncogenic: The HRAS p.G12V variant is implicated in inducing signaling pathways that are associated with tumor development, as evidenced by the increased levels of phosphorylated ERK and AKT in the transfected cells.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the classical oncogenic variant KRAS p.G12V in the context of its effect on GTP hydrolysis, indicating its role in tumor development or progression. Functional: The passage describes how the variant KRAS p.G12V affects the biochemical function of GTP hydrolysis, demonstrating its impact on molecular activity in the presence of RAS-GAP.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the p.G12V variant alters the intrinsic GTP hydrolysis rates, indicating a change in molecular function related to protein activity. Oncogenic: The p.G12V variant is described as a classical oncogenic variant, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression. Functional: The passage discusses how KRAS p.G12V alters the intrinsic dissociation rate of mGppNHp compared to wild type, indicating a change in molecular function.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the impact of the p.Q61L variant on nucleotide exchange, effector binding, and GTP hydrolysis, indicating that it alters molecular or biochemical function. Oncogenic: The p.Q61L variant is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 4893:p.Q61L

Genes: 4893

Variants: p.Q61L

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the insertions around Gln61 likely alter the molecular interactions and functions of the protein, particularly affecting GTP hydrolysis and interactions with GEFs and GAPs.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses mutations in RAS genes, including p.G12A, p.G13H, and p.Q22K, which are described as classical oncogenic mutations that affect tumor development and progression. Functional: The passage indicates that the p.Q22K mutation is associated with increased GTP loading, suggesting that it alters molecular function related to protein activity.

Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

Genes: 3845

Variants: p.G12A p.G13H p.Q22K

[Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, and this is validated by the success of RAF and MEK inhibitors in clinical trials, indicating a correlation with treatment response. Oncogenic: The passage discusses oncogenic mutations in B-RAF, specifically the B-RAFV600E mutation, which is implicated in tumor development and progression in malignant melanomas.

Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

Genes: 673

Variants: B-RAFV600E serine/threonine

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how several variants, including K131, R168G, G130R, and others, alter the molecular function of RAD51C by disrupting the ATP-binding site and influencing RAD51C activity, as demonstrated in HDR assays. Oncogenic: The passage indicates that the variants are deleterious and influence RAD51C function, which is relevant to tumor development or progression, particularly in the context of HDR assays.

Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu

Genes: 5889 5892

Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how various RAD51C variants affect the ability to form protein complexes involved in DNA damage repair, indicating that these variants alter molecular function. Oncogenic: The mention of deleterious variants that lose the ability to form complexes suggests a role in tumor development or progression, as these variants are associated with impaired DNA repair mechanisms.

Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

Genes: 5889 5892

Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how RAD51C variants alter cell proliferation and the formation of RAD51 foci in response to ionizing radiation, indicating changes in molecular function related to DNA damage signaling and repair. Oncogenic: The variants are implicated in a proliferation defect and disruption of homologous recombination (HR) repair, suggesting their role in tumor development or progression.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the L138F variant alters HDR activity in different cell lines, indicating a change in molecular function. Predictive: The passage mentions the sensitivity of variants, including L138F, to cisplatin and olaparib, suggesting a correlation with response to these therapies.

Gene→Variant (gene-first): 5889:L138F

Genes: 5889

Variants: L138F

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the sensitivity of specific RAD51C variants (G130R, K131I, T132R, Q133E, and G302V) to olaparib, indicating a correlation with response to therapy. Functional: The passage describes the introduction of RAD51C variants into a cell line and assesses their effects on homologous recombination repair (HDR), indicating that these variants alter molecular function.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how RAD51C missense variants alter RAD51 foci formation in response to DNA damage, indicating a change in molecular function related to DNA repair mechanisms. Predictive: The mention of "drug response findings" suggests that the variants may correlate with sensitivity or resistance to a specific therapy, indicating predictive evidence.

Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu

Genes: 5889 5888

Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the influence of RAD51C missense variants on the response to cisplatin and olaparib, indicating a correlation between the variants and treatment sensitivity. Functional: The passage describes how the variants affect IC50 values in the HDR assay, suggesting that they alter molecular function related to drug response.

Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg

Genes: 5889

Variants: E94K G306R p.Glu94Lys p.Gly306Arg

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the influence of missense mutations on RAD51C HR DNA repair activity, indicating that the variants alter molecular function as assessed by HDR activity in a cell-based assay. Oncogenic: The mention of deleterious variants categorized based on their impact on HDR activity suggests that these somatic variants contribute to tumor development or progression through their effects on DNA repair mechanisms.

Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala

Genes: 5889

Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the treatment of ruxolitinib and its effects on the phosphorylation level of STAT3 in tumors with the JAK1 S703I mutation, indicating a correlation with treatment response. Oncogenic: The mention of the JAK1 S703I mutation in the context of tumor models suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutation to the JAK1/2 inhibitor ruxolitinib, indicating a correlation with treatment response. Oncogenic: The passage suggests that the JAK1S703I mutation may play a critical role in tumorigenesis, indicating its contribution to tumor development.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the anti-tumor activity of ruxolitinib in a model with the JAK1 S703I mutation, indicating a correlation with response to therapy. Oncogenic: The mention of the JAK1 S703I mutation in the context of a PDX model suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the transformation ability of JAK1 mutations, specifically noting that JAK1S703I and JAK1S729C are capable of continual proliferation in the absence of IL-3, indicating their contribution to tumor development or progression. Functional: The passage mentions that JAK1S703I activates the JAK-STAT signaling pathway, which indicates an alteration in molecular function related to the variant.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the introduction of JAK1 mutations, including E483D, S703I, and S729C, alters the expression levels of phosphorylated JAK1 and STAT proteins, indicating a change in molecular function. Oncogenic: The passage mentions that JAK1S729C is a known and recurrent activating mutation, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the S703I mutation is an activating mutation of the JAK1 gene and was found in tumors, suggesting it contributes to tumor development or progression. Functional: The S703I mutation is described as potentially causing disruption of auto-inhibition of the JAK1 kinase, indicating an alteration in molecular or biochemical function.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how NRG1 levels increase after androgen deprivation therapy (ADT) and suggests that these elevated levels are sufficient to promote resistance to ADT, indicating a correlation with treatment response. Oncogenic: The mention of NRG1 promoting resistance to ADT implies a role in tumor development or progression, which aligns with the definition of an oncogenic variant.

Gene→Variant (gene-first): 8850:S7C

Genes: 8850

Variants: S7C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage discusses the detection of NRG1 expression in patients with localized prostate cancer, indicating its potential role in classifying or defining the disease based on the presence or absence of NRG1 staining. Predictive: The analysis includes a comparison of NRG1 expression in patients who received neoadjuvant ADT versus those who were hormonally intact, suggesting a correlation with treatment response.

Gene→Variant (gene-first): 3084:S6 8850:S7

Genes: 3084 8850

Variants: S6 S7

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:S2 3084:S6C

Genes: 1956 3084

Variants: S2 S6C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses resistance-promoting activity and its correlation with HER3 phosphorylation, indicating a relationship with response or resistance to therapy. Functional: The passage describes how the variant affects HER3 phosphorylation activity, suggesting an alteration in molecular function related to resistance-promoting activity.

Gene→Variant (gene-first): 5979:Q8

Genes: 5979

Variants: Q8

[Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the somatic mutations Y641F and Y646F in the EZH2 gene contribute to tumor development, specifically leading to high-penetrance lymphoma and melanoma in a mouse model. Functional: The variant Ezh2Y641F is shown to alter molecular function by increasing global H3K27 trimethylation and causing a redistribution of this mark, which affects transcription at various loci.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F

[Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the impact of FGFR3 kinase domain variants on drug responses and highlights the distinct changes in efficacy of inhibitors based on specific activating mutations, indicating a correlation with treatment response. Oncogenic: The mention of FGFR3 variants as drivers in diverse tumors suggests that these somatic mutations contribute to tumor development or progression.

Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G

Genes: 2261

Variants: K650E N540K R669G

[Paragraph-level] PMCID: PMC4378307 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that KRAS mutation, specifically G12D, is associated with a poor prognosis in progression-free survival (PFS), demonstrating its role as an independent negative prognostic factor. Diagnostic: The mention of KRAS mutations, including G12D, being associated with specific outcomes in patients suggests that these mutations can be used to classify or define disease subtypes.

Gene→Variant (gene-first): 3845:G12D

Genes: 3845

Variants: G12D

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20

Evidence Type(s): Diagnostic, Prognostic, Predictive, Oncogenic

Justification: Diagnostic: The passage discusses the frequencies of MAP2K1 variants in CRC patients and their association with specific tumor characteristics, indicating their role in defining or classifying the disease. Prognostic: The variants are correlated with worse disease/progression-free survival, suggesting they have prognostic implications independent of therapy. Predictive: The passage mentions that MAP2K1 mutations are associated with de novo and acquired resistance to anti-EGFR MoAbs, indicating a predictive relationship with therapy response. Oncogenic: The variants are described as contributing to a gain of function of the MEK1 protein, which is indicative of their role in tumor development or progression.

Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the response of patients to cetuximab-based first-line therapy, specifically noting that patient P4, who carries the FBXW7 variant c.1268G>T; p.Gly423Val, had a complete response to this therapy. Diagnostic: The mention of the FBXW7 variant in the context of patient P4's treatment response suggests that it may be used to classify or define the patient's disease or treatment outcome.

Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val

Genes: 55294

Variants: c.1268G>T p.Gly423Val

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage indicates that two missense mutations are associated with patients having a shorter progression-free survival (PFS), suggesting a correlation with disease outcome. Oncogenic: The FBXW7 p.Arg505Cys mutation is reported to lead to loss of function of the protein and has been associated with several cancer types, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn

Genes: 55294 1956 673

Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13

Evidence Type(s): Oncogenic, Prognostic

Justification: Oncogenic: The variants in NF1 are described as contributing to tumor development by leading to a loss of function and increased activation of the RAS signaling pathway, indicating their role in oncogenesis. Prognostic: The passage provides progression-free survival (PFS) times for the patients with the variants, suggesting a correlation between the variants and disease outcome.

Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter

Genes: 4763

Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The variant c.169A>G results in an amino acid substitution (p.Lys57Glu) that is associated with a gain of function of the MEK1 protein, indicating an alteration in molecular function. Oncogenic: The variant is discussed in the context of its role in the MAP2K1 gene, which is known to contribute to tumor development or progression, suggesting its oncogenic potential.

Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the KRAS variant (c.183A>T; p.Gln61His) identified in tumor tissue, indicating its role in tumor development or progression as it is associated with a specific patient's tumor.

Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His

Genes: 3845

Variants: c.183A>T p.Gln61His

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of specific variants in patients and their association with APC and TP53 mutations, indicating their role in defining or classifying the disease context. Oncogenic: The variants mentioned are associated with tumors, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.

Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG

Genes: 7157 324

Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses mutations identified in patients who progressed on repotrectinib treatment, suggesting a potential role of these variants in acquired resistance to the therapy. Functional: The passage indicates that further studies are necessary to investigate the functional role of the mutations, implying that these variants may alter molecular or biochemical functions related to resistance mechanisms.

Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q

Genes: 1050 7157 896 2064 5925

Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the clinical activity of repotrectinib in a patient with the G2032R mutation, indicating a response to therapy, which aligns with predictive evidence. Diagnostic: The G2032R mutation is identified in the context of a ROS1-rearranged patient, suggesting its role in defining the patient's disease subtype.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of the ROS1-G2032R mutation to various therapies, specifically mentioning the effectiveness of cabozantinib and repotrectinib in inhibiting growth, which correlates with treatment response. Oncogenic: The ROS1-G2032R mutation is implicated in tumor growth, as indicated by the investigation of its effects in Ba/F3 cells and the context of progression on crizotinib treatment, suggesting its role in tumor development.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that repotrectinib is effective against crizotinib-resistant ROS1 G2032R, suggesting a correlation between the variant and response to therapy.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the detection of DNMT3A exon 23 mutations in AML patients, indicating that these mutations are associated with the disease, which supports their use in defining or confirming the disease. Oncogenic: The mention of DNMT3A mutations in AML patients suggests that these somatic variants contribute to tumor development or progression, as they are identified in a cancer context.

Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S

Genes: 1788

Variants: R882 R882C R882H R882P W893 W893S

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:T790M 673:V600E

Genes: 1956 673

Variants: T790M V600E

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that the variant c.3082+811A TTTTAACA > GGTTTGAT is found in all GI cancer samples, suggesting its association with the disease. Oncogenic: The presence of the variant in GI cancer samples implies a potential role in tumor development or progression, as it is discussed in the context of mutations in cancer.

Gene→Variant (gene-first): 7157:c.3082+811A TTTTAACA > GGTTTGAT

Genes: 7157

Variants: c.3082+811A TTTTAACA > GGTTTGAT

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 4916:p.982_1028del47

Genes: 4916

Variants: p.982_1028del47

[Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of KRAS mutations, specifically mentioning that the majority occur in codon 12 with G12C being the most common, indicating its association with lung cancer subtypes. Oncogenic: The mention of KRAS mutations, including G12C, in the context of lung adenocarcinoma suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 3845:G12C

Genes: 3845

Variants: G12C

[Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The variant L1196Q is associated with the development of resistance to ALK inhibitors, and its identification guided the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Oncogenic: The passage indicates that the L1196Q mutation is a secondary mutation that developed in the context of drug resistance, suggesting it contributes to tumor progression and the development of resistance to therapy.

Gene→Variant (gene-first): 238:L1196Q

Genes: 238

Variants: L1196Q

[Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Prognostic, Oncogenic

Justification: Diagnostic: K27M-H3.3 mutation defines clinically and biologically distinct subgroups in DIPG, indicating its use in classifying the disease. Prognostic: K27M-H3.3 is universally associated with short survival in DIPG, while patients wild-type for H3.3 show improved survival, indicating its correlation with disease outcome. Oncogenic: The K27M-H3.3 mutation contributes to tumor development or progression in pediatric glioblastomas, as indicated by its prevalence in DIPG and association with specific copy number changes.

Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M

Genes: 3021

Variants: G34V G34V/R K27M

[Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses heterozygous somatic mutations in IDH1, specifically the R132H variant, and its association with tumorigenesis in gliomas, indicating that this variant contributes to tumor development or progression. Functional: The passage mentions that mutations in IDH1, including R132H, cause loss of normal enzyme function and gain-of-function, leading to the accumulation of D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC3100313 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of heterozygous mutations of IDH1, specifically the c.395G>A variant, in glioblastomas, indicating its association with this disease subtype. Oncogenic: The presence of the IDH1 mutation (p.R132H) in glioblastomas suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 728294:R132 79944:arginine to histidine 728294:c.395G>A 3417:p.R132H

Genes: 728294 79944 3417

Variants: R132 arginine to histidine c.395G>A p.R132H

[Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Oncogenic, Functional

Justification: Diagnostic: The passage discusses the identification of the AKT1 (E17K) mutation in various cancer types, indicating its association with melanoma and suggesting its role in defining the presence of this mutation in cancer specimens. Oncogenic: The passage states that the AKT1 E17K mutation is an activating mutation that contributes to tumor development, as evidenced by its identification in melanoma specimens and cell lines, indicating its role in cancer progression. Functional: The passage mentions that the AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, demonstrating a change in molecular function related to the variant.

Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K

Genes: 207

Variants: AKT1 (E17K E17K

[Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the lysine-to-methionine mutation at lysine 27 (H3K27M) contributes to tumor development and progression in diffuse midline gliomas, indicating its role as a somatic variant in cancer. Functional: The variant alters molecular function by affecting the levels of proteins in the SWI/SNF complex and influencing chromatin modifications, demonstrating its impact on biochemical processes within the tumor cells.

Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine

Genes: 3021 55193

Variants: lysine 27 lysine-to-methionine

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses various mutations, including Y1230H, D1288N L1195I, and L1195V, which are described as secondary mutations associated with MET TKI resistance, indicating a correlation with treatment response. Oncogenic: The mention of mutations contributing to resistance against targeted therapies suggests that these variants may play a role in tumor development or progression, particularly in the context of lung cancer.

Gene→Variant (gene-first): 79811:D1288N L1195I 79811:L1195V 79811:Y1230H 2064:c.1899-936_1946+520del

Genes: 79811 2064

Variants: D1288N L1195I L1195V Y1230H c.1899-936_1946+520del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the presence of the EGFR L858R variant in a patient with advanced LUAD and its association with resistance to osimertinib, indicating a correlation with treatment response. Oncogenic: The mention of the EGFR L858R variant and its role in the context of advanced LUAD suggests that it contributes to tumor development or progression, particularly as it is associated with resistance mechanisms.

Gene→Variant (gene-first): 2064:D769Y 2064:L755S 1956:L858R 2064:c.1899-32_1909del

Genes: 2064 1956

Variants: D769Y L755S L858R c.1899-32_1909del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage discusses the detection of ERBB2 variants in patients, indicating their association with specific cases, which supports their use in defining or classifying a disease subtype. Predictive: The mention of the novel variant ERBB2 c.1899-2A>G being detected after treatment suggests a potential correlation with treatment response, indicating its relevance in predicting therapy outcomes.

Gene→Variant (gene-first): 2064:c.1899-2A>G 2064:c.1899-880_1946+761del

Genes: 2064

Variants: c.1899-2A>G c.1899-880_1946+761del

[Paragraph-level] PMCID: PMC5111006 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the homozygous CHEK2 variant p.R474C was contributory to familial cancer, and the inactivation of CHEK2 in mice led to cancers in multiple organs, suggesting a role in tumor development. Functional: The variant p.R474C alters the tertiary structure of the CHK2 protein by disrupting a salt bridge, and subsequent analysis showed that it was unstable and scarcely activated, indicating a change in molecular function.

Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

Genes: 11200

Variants: p.R474 p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 18

Evidence Type(s): Diagnostic, Predisposing

Justification: Diagnostic: The passage states that the variants are recorded as disease-associated variants, indicating their use in defining or classifying diseases such as diabetes, carotid intima media thickness, and oligospermia. Predisposing: The variants mentioned are associated with inherited conditions, suggesting they confer an inherited risk for developing diseases, although the germline nature is implied rather than explicitly stated.

Gene→Variant (gene-first): 440822:rs11703684 6289:rs2468844 3767:rs5215 3767:rs5219 6833:rs757110

Genes: 440822 6289 3767 6833

Variants: rs11703684 rs2468844 rs5215 rs5219 rs757110

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predisposing, Diagnostic

Justification: Predisposing: The passage discusses variants in hereditary loci, specifically mentioning TP53 and BRCA2, which are associated with inherited cancer syndromes, indicating a potential inherited risk for developing disease. Diagnostic: The passage mentions the classification of variants as "Benign" or of "Uncertain significance," which relates to their use in defining or classifying disease risk or status.

Gene→Variant (gene-first): 7157:p.P72R 675:p.V2466A 7157:rs1042522 2956:rs1042821 4072:rs1126497 675:rs169547 5395:rs1805323 5395:rs2228006 4436:rs2303424

Genes: 7157 675 2956 4072 5395 4436

Variants: p.P72R p.V2466A rs1042522 rs1042821 rs1126497 rs169547 rs1805323 rs2228006 rs2303424

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the p.R474C variant alters the molecular function of the CHK2 protein, demonstrating that it is poorly expressed and activated by DNA damage compared to the wild-type protein. Oncogenic: The context implies that the p.R474C variant contributes to tumor development or progression by affecting the function of a cell cycle checkpoint regulator, which is critical in the context of cancer biology.

Gene→Variant (gene-first): 11200:p.R474C

Genes: 11200

Variants: p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the p.R474C variant affects the activation of the CHK2 protein in response to DNA damage, suggesting an alteration in its molecular function.

Gene→Variant (gene-first): 11200:p.R474C

Genes: 11200

Variants: p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variant p.R210 and its substitution p.R210Q relate to the structure and potential function of the protein, indicating that p.R210Q is not likely to affect the function and structure of the protein.

Gene→Variant (gene-first): 2217:p.R210 2217:p.R210Q

Genes: 2217

Variants: p.R210 p.R210Q

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variant p.R474C alters the salt bridge formation and is likely to make the protein unstable, indicating an alteration in molecular function. Oncogenic: The variant p.R474C is described as "disease causing" and likely interferes with protein function, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

Genes: 11200

Variants: p.R474 p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variant p.R474 in CHEK2 was analyzed for its effect on protein function based on evolutionary conservation, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 11200:p.R474

Genes: 11200

Variants: p.R474

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the presence of the L858R mutation in the context of lung cancer, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC6333965 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions that PIK3CA E545K and CDKN2A R58X are potentially targetable alterations, indicating their association with specific tumor characteristics or responses, which aligns with diagnostic evidence. Oncogenic: The variants PIK3CA E545K and CDKN2A R58X are described as potentially targetable alterations, suggesting their role in tumor development or progression, which supports oncogenic evidence.

Gene→Variant (gene-first): 5290:E545K 1029:R58X

Genes: 5290 1029

Variants: E545K R58X

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 14

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency and types of mutations observed in human ccRCC, indicating that these mutations are associated with the disease, thus providing evidence for their role in defining or classifying the disease. Oncogenic: The passage describes mutations in primary cilium-related genes that contribute to the formation of ccRCC precursor lesions in mice, indicating that these somatic variants play a role in tumor development.

Gene→Variant (gene-first): 7428:A>G 7428:C>A 7428:C>T 7428:G>A 7428:G>T 7428:T>C

Genes: 7428

Variants: A>G C>A C>T G>A G>T T>C

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the deletion of Trp53 in mice and its contribution to tumor development, as evidenced by the increased incidence and earlier onset of tumors in VhlDelta/DeltaTrp53Delta/DeltaRb1Delta/Delta mice compared to other genotypes. Functional: The deletion of Trp53 is described in the context of its role in the p53/G1-S network, indicating that it alters the molecular function related to cell cycle control and tumorigenesis.

Gene→Variant (gene-first): 7428:Trp53 deletion

Genes: 7428

Variants: Trp53 deletion

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 15

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of cells expressing K-RasG12D to specific therapies, indicating a correlation between the variant and response to treatment with MEK and PI3K inhibitors. Oncogenic: The mention of K-RasG12D in the context of transformed Ba/F3 cells suggests that this somatic variant contributes to tumor development or progression, as it is involved in cytokine-independent growth.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the ability of mutant K-Ras proteins to bind to effectors in vitro, indicating that the variants alter molecular interactions, specifically the binding to FLAG-p110alpha. Oncogenic: The mention of K-RasG12D and the other mutant variants in the context of their binding interactions suggests that these somatic variants contribute to tumor development or progression through their altered functional properties.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D 5290:Y64G

Genes: 5295 3845 5290

Variants: A66dup K-RasG12D Y64G

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the K-RasG12D variant alters the levels of pERK and pAkt, indicating a change in molecular function related to signaling pathways. Oncogenic: The K-RasG12D variant is implicated in modulating effector pathway activation, which suggests its role in tumor development or progression.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the K-RasG12D variant and tandem duplication mutants transform Ba/F3 cells to cytokine-independent growth, indicating their role in tumor development or progression. Functional: The passage mentions that Ba/F3 cells expressing K-RasG12D and the tandem duplication mutants had elevated levels of Ras-GTP, suggesting that these variants alter molecular function related to Ras signaling.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants K-RasG60_A66dup and K-RasE62_A66dup alter the biochemical properties of K-Ras, specifically their GTPase activity and response to GAP stimulation, indicating a change in molecular function. Oncogenic: The variants are described in the context of their role in accumulating in the active GTP conformation and exhibiting impaired GTPase activity, which suggests their contribution to tumor development or progression.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variant Glutamine 61 (Q61) may alter protein-protein interactions and the structural dynamics of Ras, indicating a change in molecular function due to the predicted effects of switch 2 insertions. Oncogenic: The analysis suggests that the alterations in the Ras protein structure, particularly involving Q61, may contribute to the GTP conformation of Ras, which is associated with tumor development and progression.

Gene→Variant (gene-first): 3845:Glutamine 61 3845:Q61

Genes: 3845

Variants: Glutamine 61 Q61

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the K-RasG12D variant induces cytokine-independent colony formation and contributes to abnormal growth patterns in hematopoietic progenitor cells, indicating its role in tumor development. Functional: The variant K-RasG12D alters the growth response of progenitor cells to GM-CSF, demonstrating a change in molecular function related to colony formation.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes a partial duplication of the K-Ras gene that is associated with juvenile myelomonocytic leukaemia (JMML), indicating that the variant contributes to tumor development or progression. Functional: The immunoblot analysis shows that the variant alters the molecular function of K-Ras, as evidenced by the detection of a band with reduced electrophoretic mobility compared to normal Ras protein, indicating a change in protein behavior.

Gene→Variant (gene-first): 3845:c.178_198dup 3845:c.184_198dup

Genes: 3845

Variants: c.178_198dup c.184_198dup

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effects of combination therapies on cell proliferation in osimertinib-resistant cell lines, indicating a relationship between the presence of the T790M mutation and the response to therapy, specifically mentioning osimertinib and naquotinib. Oncogenic: The T790M mutation is maintained in the osimertinib-resistant RPC-9/OsiR cells, suggesting its role in tumor development or progression, particularly in the context of resistance to therapy.

Gene→Variant (gene-first): 1956:C797S 1956:T790M

Genes: 1956

Variants: C797S T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses gefitinib-resistant lung adenocarcinoma cell lines harboring the EGFR exon 19del and T790M mutations, indicating a correlation with resistance to therapy, specifically gefitinib. Oncogenic: The mention of the EGFR exon 19del and T790M mutations in the context of gefitinib resistance suggests that these somatic variants contribute to tumor development or progression in lung adenocarcinoma.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage discusses the role of the EGFR exon 19del variant in the development of a resistant cell line, indicating that this somatic variant contributes to tumor progression and resistance mechanisms in lung cancer cells. Predictive: The passage mentions that the combination of EGFR-TKIs and MET inhibitors showed an excellent inhibitory effect on cell proliferation in the resistant cell line, suggesting a correlation between the variant and response to therapy.

Gene→Variant (gene-first): 1956:19del

Genes: 1956

Variants: 19del

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the acquired EGFR C797S mutation in the context of resistance to osimertinib, indicating that this variant correlates with resistance to a specific therapy. Oncogenic: The C797S mutation is described as contributing to resistance in cell lines, suggesting its role in tumor progression or development in the context of EGFR-TKI treatment.

Gene→Variant (gene-first): 1956:C797S

Genes: 1956

Variants: C797S

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the establishment of naquotinib-resistant lung cancer cells and mentions the effectiveness of naquotinib in inhibiting cell proliferation, indicating a correlation between the variants (19del and T790M) and resistance to therapy. Oncogenic: The presence of the T790M mutation in acquired gefitinib-resistant cells suggests that it contributes to tumor development or progression, as it is associated with resistance mechanisms in lung cancer.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the correlation between the FGFR3 S249C variant and the response to treatment with FGFR TKIs, indicating that patients with this mutation exhibited partial or complete responses, which aligns with predictive evidence. Oncogenic: The FGFR3 S249C variant is described as the most frequent mutation of FGFR3, suggesting its role in tumor development or progression, which supports its classification as oncogenic.

Gene→Variant (gene-first): 2261:S249C

Genes: 2261

Variants: S249C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 21

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the mutations E545K, E542K, and H1047R are described as "oncogenic mutations," suggesting they contribute to tumor development or progression.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047R

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage discusses the transforming activities of FGFR3 S249C compound mutations, indicating that these mutations contribute to tumor development or progression as demonstrated by their evaluation in 3T3 and Ba/F3 cells. Predictive: The passage mentions the sensitivity to E7090 and erdafitinib in relation to the mutations, indicating a correlation with treatment response, which aligns with predictive evidence.

Gene→Variant (gene-first): 2261:K650E 2261:K650M 2261:S249C 2261:Y373C

Genes: 2261

Variants: K650E K650M S249C Y373C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effectiveness of E7090 and erdafitinib in treating tumors with specific variants, indicating a correlation between the variants and the response to these therapies. Oncogenic: The variants are described in the context of tumor growth and response to treatment, suggesting that they contribute to tumor development or progression.

Gene→Variant (gene-first): 2261:K650M 2261:K650N 2260:N546K 2263:N549K 2261:R248C

Genes: 2261 2260 2263

Variants: K650M K650N N546K N549K R248C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the response of FGFR3 variants K650M and K650N to FGFR TKIs, indicating their sensitivity to specific therapies, which aligns with predictive evidence. Functional: The passage describes the alteration of phosphorylation status of the FGFR3 variants K650M and K650N in response to treatment, indicating a change in molecular function due to the variants.

Gene→Variant (gene-first): 2261:K650M 2261:K650N

Genes: 2261

Variants: K650M K650N

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 13

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity and resistance of FGFR variants, including N546K and N549D/K, to FGFR inhibitors, indicating a correlation with response to therapy. Oncogenic: The passage mentions that KRAS G12V is part of a cluster composed mainly of oncogenic variants, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 3845:G12V 2260:N546K 2263:N549D/K

Genes: 3845 2260 2263

Variants: G12V N546K N549D/K

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses how different missense variants at specific amino acid positions in FGFR2 and FGFR3 correlate with varying drug sensitivities to FGFR inhibitors, indicating a relationship between the variants and treatment response.

Gene→Variant (gene-first): 2263:K656 2263:K656E/M 2263:N549 2263:N549D/H

Genes: 2263

Variants: K656 K656E/M N549 N549D/H

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the drug sensitivity of FGFR variants in response to various targeted therapies, indicating that certain variants are sensitive or resistant to specific inhibitors, which aligns with predictive evidence. Oncogenic: The context of transformed FGFR variants suggests that these somatic mutations contribute to tumor development or progression, particularly as they are assessed for their response to targeted therapies.

Gene→Variant (gene-first): 2264:N535K 2260:N546K 2263:N549D/K 2263:V550L

Genes: 2264 2260 2263

Variants: N535K N546K N549D/K V550L

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the evaluation of mRNA and protein expression levels of the R248H variant, indicating that it alters protein expression compared to oncogenic variants, which relates to its molecular function. Oncogenic: The passage implies that the R248H variant is classified as a non-oncogenic variant, contrasting it with oncogenic variants, suggesting its role in tumor development or progression is not supported.

Gene→Variant (gene-first): 1956:R248H

Genes: 1956

Variants: R248H

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 7

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the transforming potential of various FGFR variants, indicating that certain mutations contribute to tumor development or progression, as evidenced by their significant transforming activities in assays.

Gene→Variant (gene-first): 2261:G370C 2261:G380E/R 2261:K650E/M 2263:K659E 2263:N549H 2261:R248C 2261:S249C 6867:S342F 2261:S371C 2263:W290C 2261:Y373C

Genes: 2261 2263 6867

Variants: G370C G380E/R K650E/M K659E N549H R248C S249C S342F S371C W290C Y373C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The V550L mutation in FGFR4 is mentioned in the context of rhabdomyosarcoma, suggesting its contribution to tumor development.

Gene→Variant (gene-first): 2260:K656E 2260:N546K 2261:S249C 2263:S252W 2263:V550L

Genes: 2260 2261 2263

Variants: K656E N546K S249C S252W V550L

[Paragraph-level] PMCID: PMC8203843 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that IDH1 R132H is associated with sensitivity to PARP inhibitors, which correlates the variant with a specific therapy response.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC8255005 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the resistance of FLT3 mutations, specifically F691L, to FLT3 inhibitors and highlights the efficacy of KX2-391 in overcoming this resistance, indicating a correlation with treatment response. Oncogenic: The FLT3 mutations, including D835 and F691, are described as contributing to tumor development and progression in acute myeloid leukemia (AML), which supports their classification as oncogenic variants.

Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691 2322:F691L

Genes: 2322

Variants: D835 D835Y F691 F691L

[Paragraph-level] PMCID: PMC7785563 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that 90% of the cases harbored IDH1-R132H mutations, which are associated with conventional supratentorial IDH-mutant astrocytomas, suggesting a role in defining or classifying the disease. Oncogenic: The presence of IDH1-R132H mutations in the tumors suggests that this somatic variant contributes to tumor development or progression, as it is commonly found in a specific type of cancer.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC10527017 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the resistance of HP breast cancers to the pan-HER tyrosine kinase inhibitor, neratinib, and the effectiveness of combining neratinib with trastuzumab deruxtecan and CDK4/6 inhibitors, indicating a correlation with treatment response. Oncogenic: The study involves genetically engineered mice with the HER2V777L mutation, showing accelerated tumor formation and increased invasion, which supports the notion that this somatic variant contributes to tumor development and progression.

Gene→Variant (gene-first): 2064:V777L

Genes: 2064

Variants: V777L

[Paragraph-level] PMCID: PMC4821611 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses ALK mutations (p.C1156Y and p.G1269A) in the context of crizotinib resistance, indicating a correlation between these variants and resistance to the therapy. Oncogenic: The ALK mutations are described as being detected in post-treatment tumor samples, suggesting their contribution to tumor development or progression in the context of crizotinib resistance.

Gene→Variant (gene-first): 238:p.C1156Y 238:p.G1269A

Genes: 238

Variants: p.C1156Y p.G1269A

[Paragraph-level] PMCID: PMC4821611 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic