10,000 Matching Annotations
  1. Apr 2025
    1. Reviewer #2 (Public review):

      Summary:

      In this work the authors show that dopaminergic neurons (DANs) from the DL1 cluster in Drosophila larvae are required for the formation of aversive memories. DL1 DANs complement pPAM cluster neurons which are required for the formation of attractive memories. This shows the compartmentalized network organization of how an insect learning center (the mushroom body) encodes memory by integrating olfactory stimuli with aversive or attractive teaching signals. Interestingly, the authors found that the 4 main dopaminergic DL1 neurons act partially redundant, and that single cell ablation did not result in aversive memory defects. However, ablation or silencing of a specific DL1 subset (DAN-f1,g1) resulted in reduced salt aversion learning, which was specific to salt but no other aversive teaching stimuli tested. Importantly, activation of these DANs using an optogenetic approach was also sufficient to induce aversive learning in the presence of high salt. Together with the functional imaging of salt and fructose responses of the individual DANs and the implemented connectome analysis of sensory (and other) inputs to DL1/pPAM DANs this represents a very comprehensive study linking the structural, functional and behavioral role of DL1 DANs. This provides fundamental insight into the function of a simple yet efficiently organized learning center which displays highly conserved features of integrating teaching signals with other sensory cues via dopaminergic signaling.

      Strengths:

      This is a very careful, precise and meticulous study identifying the main larval DANs involved in aversive learning using high salt as a teaching signal. This is highly interesting because it allows to define the cellular substrates and pathways of aversive learning down to the single cell level in a system without much redundancy. It therefore sets the basis to conduct even more sophisticated experiments and together with the neat connectome analysis opens the possibility to unravel different sensory processing pathways within the DL1 cluster and integration with the higher order circuit elements (Kenyon cells and MBONs). The authors' claims are well substantiated by the data and balanced, putting their data in the appropriate context. The authors also implemented neat pathway analyses using the larval connectome data to its full advantage, thus providing network pathways that contribute towards explaining the obtained results.

      Weaknesses:

      Previous comments were fully addressed by the authors.

    1. Reviewer #2 (Public Review):

      Summary:

      In this work, Yuasa et al. aimed to study the spatial resolution of modulations in alpha frequency oscillations (~10Hz) within the human occipital lobe. Specifically, the authors examined the receptive field (RF) tuning properties of alpha oscillations, using retinotopic mapping and invasive electroencephalogram (iEEG) recordings. The authors employ established approaches for population RF mapping, together with a careful approach to isolating and dissociating overlapping, but distinct, activities in the frequency domain. Whereby, the authors dissociate genuine changes in alpha oscillation amplitude from other superimposed changes occurring over a broadband range of the power spectrum. Together, the authors used this approach to test how spatially tuned estimated RFs were when based on alpha range activity, vs. broadband activities (focused on 70-180Hz). Consistent with a large body of work, the authors report clear evidence of spatially precise RFs based on changes in alpha range activity. However, the size of these RFs were far larger than those reliably estimated using broadband range activity at the same recording site. Overall, the work reflects a rigorous approach to a previously examined question, for which improved characterization leads to improved consistency in findings and some advance of prior work.

      Strengths:

      Overall, the authors take a careful and well-motivated approach to data analyses. The authors successfully test a clear question with a rigorous approach and provide strong supportive findings. Firstly, well-established methods are used for modeling population RFs. Secondly, the authors employ contemporary methods for dissociating unique changes in alpha power from superimposed and concomitant broadband frequency range changes. This is an important confound in estimating changes in alpha power not employed in prior studies. The authors show this approach produces more consistent and robust findings than standard band-filtering approaches. As noted below, this approach may also account for more subtle differences when compared to prior work studying similar effects.

      Original Weaknesses:

      - Theoretical framing: The authors frame their study as testing between two alternative views on the organization, and putative functions, of occipital alpha oscillations: i) alpha oscillation amplitude reflects broad shifts in arousal state, with large spatial coherence and uniformity across cortex; ii) alpha oscillation amplitude reflects more specific perceptual processes and can be modulated at local spatial scales. However, in the introduction this framing seems mostly focused on comparing some of the first observations of alpha with more contemporary observations. Therefore, I read their introduction to more reflect the progress in studying alpha oscillations from Berger's initial observations to the present. I am not aware of a modern alternative in the literature that posits alpha to lack spatially specific modulations. I also note this framing isn't particularly returned to in the discussion. A second important variable here is the spatial scale of measurement. It follows that EEG based studies will capture changes in alpha activity up to the limits of spatial resolution of the method (i.e. limited in ability to map RFs). This methodological distinction isn't as clearly mentioned in the introduction, but is part of the author's motivation. Finally, as noted below, there are several studies in the literature specifically addressing the authors question, but they are not discussed in the introduction.

      - Prior studies: There are important findings in the literature preceding the author's work that are not sufficiently highlighted or cited. In general terms, the spatio-temporal properties of the EEG/iEEG spectrum are well known (i.e. that changes in high frequency activity are more focal than changes in lower frequencies). Therefore, the observations of spatially larger RFs for alpha activities is highly predicted. Specifically, prior work has examined the impact of using different frequency ranges to estimate RF properties, for example ECoG studies in the macaque by Takura et al. NeuroImage (2016) [PubMed: 26363347], as well as prior ECoG work by the author's team of collaborators (Harvey et al., NeuroImage (2013) [PubMed: 23085107]), as well as more recent findings from other groups (Luo et al., (2022) BioRxiv: https://doi.org/10.1101/2022.08.28.505627). Also, a related literature exists for invasively examining RF mapping in the time-voltage domain, which provides some insight into the author's findings (as this signal will be dominated by low-frequency effects). The authors should provide a more modern framing of our current understanding of the spatial organization of the EEG/iEEG spectrum, including prior studies examining these properties within the context of visual cortex and RF mapping. Finally, I do note that the author's approach to these questions do reflect an important test of prior findings, via an improved approach to RF characterization and iEEG frequency isolation, which suggests some important differences with prior work.

      - Statistical testing: The authors employ many important controls in their processing of data. However, for many results there is only a qualitative description or summary metric. It appears very little statistical testing was performed to establish reported differences. Related to this point, the iEEG data is highly nested, with multiple electrodes (observations) coming from each subject, how was this nesting addressed to avoid bias?

      [Editors' note: the authors have addressed the original concerns.]

    1. Reviewer #2 (Public review):

      In the present manuscript, Golf et al. investigate the consequences of astrocyte-specific deletion of Neuroligin (Nlgn) family cell adhesion proteins on synapse structure and function in the brain. Decades of prior research had shown that Neuroligins mediate their effects at synapses through their role in the postsynaptic compartment of neurons and their transsynaptic interaction with presynaptic Neurexins. More recently, it was proposed for the first time that Neuroligins expressed by astrocytes can also bind to presynaptic Neurexins to regulate synaptogenesis (Stogsdill et al. 2017, Nature). However, several aspects of the model proposed by Stogsdill et al. on astrocytic Neuroligin function conflict with prior evidence on the role of Neuroligins at synapses, prompting Golf et al. to further investigate astrocytic Neuroligin function in the current study. Using postnatal conditional deletion of Nlgn1-3 specifically from astrocytes in mice, Golf et al. show that virtually no changes in the expression of synaptic proteins or in the properties of synaptic transmission at either excitatory or inhibitory synapses are observed. Moreover, no alterations in the morphology of astrocytes themselves were found. To further extend this finding, the authors additionally analyzed human neurons co-cultured with mouse glia lacking expression of Nlgn1-4. No difference in excitatory synaptic transmission was observed between neurons cultured in the present of wildtype vs. Nlgn1-4 conditional knockout glia. The authors conclude that while Neuroligins are indeed expressed in astrocytes and are hence likely to play some role there, this role does not include any direct consequences on synaptic structure and function, in direct contrast to the model proposed by Stogsdill et al.

      Overall, this is a strong study that addresses a fundamental and highly relevant question in the field of synaptic neuroscience. Neuroligins are not only key regulators of synaptic function, they have also been linked to numerous psychiatric and neurodevelopmental disorders, highlighting the need to precisely define their mechanisms of action. The authors take a wide range of approaches to convincingly demonstrate that under their experimental conditions, Nlgn1-3 are efficiently deleted from astrocytes in vivo, and that this deletion does not lead to major alterations in the levels of synaptic proteins or in synaptic transmission at excitatory or inhibitory synapses, or in the morphology of astrocytes. While the co-culture experiments are somewhat more difficult to interpret due to lack of a control for the effect of wildtype mouse astrocytes on human neurons, they are also consistent with the notion that deletion of Nlgn1-4 from astrocytes has no consequences for the function of excitatory synapses. Together, the data from this study provide compelling and important evidence that, whatever the role of astrocytic Neuroligins may be, they do not contribute substantially to synapse formation or function under the conditions investigated.

    1. Reviewer #2 (Public review):

      This study by Tardiff, Kang & Gold seeks to i) develop a normative account of how observers should adapt their decision-making across environments with different levels of correlation between successive pairs of observations, and ii) assess whether human decisions in such environments are consistent with this normative model. The authors first demonstrate that, in the range of environments under consideration here, an observer with full knowledge of the generative statistics should take both the magnitude and sign of the underlying correlation into account when assigning weight in their decisions to new observations: stronger negative correlations should translate into stronger weighting (due to the greater information furnished by an anticorrelated generative source), while stronger positive correlations should translate into weaker weighting (due to the greater redundancy of information provided by a positively correlated generative source). The authors then report an empirical study in which human participants performed a perceptual decision-making task requiring accumulation of information provided by pairs of perceptual samples, under different levels of pairwise correlation. They describe a nuanced pattern of results with effects of correlation being largely restricted to response times and not choice accuracy, which could be captured through fits of their normative model (in this implementation, an extension of the well-known drift diffusion model) to the participants' behaviour while allowing for mis-estimation of the underlying correlations. An intriguing result is that the observed pattern of behavioural effects is best explained by a model in which observers marginally underestimated the level of correlation between the generative sources, and that this bias affects behaviour through effects on stimulus encoding that then shape how the evidence furnished by each stimulus sample is weighted in decision formation.

      As the authors point out in their very well-written paper, appropriate weighting of information gathered in correlated environments has important consequences for real-world decision-making. Yet, while this function has been well studied for 'high-level' (e.g. economic) decisions, how we account for correlations when making simple perceptual decisions on well-controlled behavioural tasks has not been investigated. As such, this study addresses an important and timely question that will be of broad interest to psychologists and neuroscientists. The computational approach to arrive at normative principles for evidence weighting across environments with different levels of correlation is elegant, makes strong connections with prior work in different decision-making contexts, and should serve as a valuable reference point for future studies in this domain. The empirical study is well designed and executed, and the modelling approach applied to these data showcases an impressively deep understanding of relationships between different parameters of the drift diffusion model and its novel application to this setting. Another strength of the study is that it is preregistered.

      In my view, any major weaknesses of the study have been well addressed by the authors during review. An outstanding question that arises from the current work and remains unanswered here is around the (normative?) origin of the correlation underestimates, and the present work lays a strong foundation from which to pursue this question in the future.

    1. Reviewer #2 (Public review):

      Summary:

      The authors aimed to elucidate the role of Ctla-4 in maintaining intestinal immune homeostasis by using a novel Ctla-4-deficient zebrafish model. This study addresses the challenge of linking CTLA-4 to inflammatory bowel disease (IBD) due to the early lethality of CTLA-4 knockout mice. Four lines of evidence were shown to show that Ctla-4-deficient zebrafish exhibited hallmarks of IBD in mammals: 1) impaired epithelial integrity and infiltration of inflammatory cells; 2) enrichment of inflammation-related pathways and the imbalance between pro- and anti-inflammatory cytokines; 3) abnormal composition of immune cell populations; and 4) reduced diversity and altered microbiota composition. By employing various molecular and cellular analyses, the authors established ctla-4-deficient zebrafish as a convincing model of human IBD.

      Strengths:

      The characterization of the mutant phenotype is very thorough, from anatomical to histological and molecular levels. The finding effectively established ctla-4 mutants as a novel zebrafish model for investigating human IBD. Evidence from the histopathological and transcriptome analysis was very strong and supports a severe interruption of immune system homeostasis in the zebrafish intestine. Additional characterization using sCtla-4-Ig further probed the molecular mechanism of the inflammatory response, and provided a potential treatment plan for targeting Ctla-4 in IBD models.

      Weaknesses:

      To probe the molecular mechanism of Ctla-4, the authors used a spectrum of antibodies that target Ctla-4 or its receptors. The phenotype assayed was lymphocyte proliferation, while it was the composition rather than number of immune cells that was observed to be different in the scRNASeq assay. Although sCtla-4 has an effect of alleviating the IBD-like phenotypes, I found this explanation a bit oversimplified.

      Comments on revised version:

      The authors have sufficiently addressed all my concerns and I don't have further suggestions.

    1. Reviewer #2 (Public review):

      Summary:

      Chakravarty et al. propose a 'synchronized framework' for studying perceptual decision-making (DM) across species -namely humans, rats, and mice. Although all species shared hallmarks of evidence accumulation, the results highlighted species-specific differences. Humans were the slowest and most accurate, rats optimized the speed-accuracy tradeoff to maximize the reward rate and mice were the fastest but least accurate. In addition, while humans were better fit by a classic DDM with fixed bounds, rodents were better fit by a DDM with collapsing bounds. While comparing behavioral strategies in evidence accumulation tasks across species is an important and timely question, some of the presented differences across species lack a clear interpretation and could be simply caused by differences in the task design. There is important information and analyses missing about the DDM and the other models used, which lowers the confidence and enthusiasm about the results.

      Strengths:

      The comparison of behavior across species, including humans and commonly used laboratory species like rats and mice, is a fundamental step in neuroscience to establish more informed links between animal experiments and human cognition. In this work, Chakravarty et al. analyze and model the behavior of three species during the same evidence accumulation task. They draw conclusions about the different strategies used in each case.

      Weaknesses:

      Novelty:<br /> While quite relevant, some parts of the work presented are more novel than others. That EA drives choice behavior and these choices can be described with a DDM have been shown before (see e.g. (Kane et al. 2023; Brunton et al. in 2013; Pinto et al 2018)). The novelty here mostly lies in the comparison of three species in the same task and in fitting the same exact model (close quantitative comparison of behavioral strategies). However, some of the differences lack a clear interpretation. For instance, the values of some of the DDM fitted parameters between the three species are not ordered "as expected" (e.g. non-decision time or DDM BIC). Other comparison results completely lack an explanation (e.g. rats' RT are near optimal while humans and mice are not). The aspect that I found most novel and exciting is the application of HMMs to each of the species. However, this part comes at the end of the paper and has been done without sufficient depth. There is almost no explanation for the results. I would suggest the authors bring up this part and move back to other aspects which are, in my opinion, less novel or interpretable (e.g. results around the optimality of RT).

      Task design:<br /> Since there is no fixation, the response time (RT) reflects both the evidence integration time plus the motor time (stimuli are played until a response is given). This design makes it hard to compare RTs between species. While humans just had to press a button, rodents had to move their whole bodies from a central port to a side port. When comparing rats and mice, their difference in size relative to port distance could explain different RTs. This could for example explain the large difference in non-decision time (ndt) in Figure 3F between mice and rats. Are the measurements of the rat and the mouse boxes comparable? The authors should explain this difference more openly and discuss its implications when interpreting the results. The Methods should also provide information about the distance between ports for each species. I also strongly recommend including a few videos of rats and mice performing the task to have a sense of the movements involved in the task in each species.

      (1) DDM

      Goodness of fit:<br /> The authors conclude that the three species use an accumulation of evidence strategy because they can fit a DDM. However, there is little information about the goodness of these fits. They only show the RT distributions for one example subject (too small to distinguish whether the fit of the histograms is good or not). We suggest they make a figure showing in more detail the match of the RT distributions across subjects (e.g. they can compare RT quartiles for data and model for the entire group of subjects). Then they provide BIC which is a measure that depends on the number of trials. Were the number of trials matched across subjects/species? Could the authors provide a measure independent of the number of trials (e.g. cross-validated log-likelihood per trial)? Moreover, is this BIC computed only on the RTs, mouse responses, or both?

      Overparameterization:<br /> The authors chose to include as DDM parameters the variability of the initial offset, the variability in non-decision time, and the variability of the drift rate. Having so many parameters with just one stimulus condition (80:20 ratio of flashes) may lead to unidentifiability problems as recognized previously (e.g. see M. Jones (2021) here osf.io/preprints/psyarxiv/gja3u). Their parameter recovery Supplementary Figure 3 shows that at least two of these variability parameters can not be recovered. I also couldn't find the values of these parameters for the fitted DDM. So I was wondering the extent to which adding these parameters improves the fits and is overall necessary.

      Tachometric curves:<br /> The authors show increasing tachometric curves (i.e. Accuracy vs RT) and use this finding as proof of accumulation. They fit these curves using a GAAM with little justification or detail (in fact the GAAM seems to over-fit the data a bit). The authors do not say, however, that the other model used, i.e. the DDM, may not reproduce these increasing tachometric curves because "in its basic form", the DDM gives flat tachometric curves. Does the DDM fitted to the individual RT and choice data capture the monotonic increase observed in the tachometric curves?

      Correct vs Error trials:<br /> In a similar line, the authors do not test the fitted DDM separately in correct vs error trials, which is a classical distinction that most DDMs can't capture. It would be good to know if: (1) the RT in the data of correct vs error responses are similar (quantified in panel Figure 2B because in 2E it is not clear) and (2) the same trend between correct and error RTs are observed in the fitted DDMs.

      Urgency model:<br /> It is not clear how the urgency model used works. The authors cite Ditterich (2006), but in that paper, the urgency signal was applied to a race model with two decision variables: the urgency signal "accelerated" both DVs equally and sped up the race without favoring one DV versus the other. In a one-dimensional DDM, it is not clear where the urgency is applied. We assume it is applied in the direction of the stimulus, but then it is unclear how the urgency knows about the stimulus, which is what the DDM is trying to estimate in the first place. The authors should explain this model in greater detail and try to resolve this question.

      Despite finding differences between species, the analyses seem mostly exploratory instead of hypothesis-driven. There is little justification for why differences in some DDM parameters across species would be expected.

      (2) GLM and HMM

      The GLM fits show nicely that humans, rats, and mice weigh differently the total provided evidence (Figures 6C-D). This may be because the internal noise in the accumulation of evidence is higher but also it could simply be because animals do not weigh the evidence that is presented when they are already moving towards the side ports. A parsimonious alternative to the "more noisy" species is simply that they only consider the first part of the stimulus. Extending the GLM to capture the differential weighting of each sequential sample (what is called the Psychophysical kernel, PK) should be straightforward and would provide a more fair comparison between species (i.e. perhaps the slope of the psychometric curves is not that different, once evidence is weighted in each species with its corresponding PK.

      Choice Bias:<br /> Panel 3G (DDM starting point) shows that both rats and mice are slightly but systematically biased to the Left (x0 < 0.5). Panel 6D "Bias" seems to be showing the absolute value of the GLM bias parameter. It would be nice to (i) show the signed GLM bias parameter. (ii) Compare that the biases computed in the DDM and GLM are comparable across species and subjects; it looks like from the GLM they are comparable in magnitude across species whereas the in DDM they weren't (mice had a much bigger |x0| in the DDM), (iii) explain (or at least comment) on why animals show a systematic bias to one side.

    1. Reviewer #2 (Public review):

      Summary:

      This is an excellent paper that demonstrates Computational Modeling at its best. The authors propose a mechanism to provide flexibility to learn new information while preserving stability in neural networks by combining structural plasticity and synaptic plasticity.

      Strengths:

      An intriguing idea, that is well embedded in experimental data.

      The problem posed is real, the model uses data to be designed and implemented yet adds to the data novel and useful insight. The project proposes a parsimonious explanation for why neurogenesis can be better than classical plasticity and how stability versus flexibility can be solved with this approach.

      Weaknesses:

      No weaknesses were identified by this reviewer.

    1. Reviewer #2 (Public review):

      Summary:

      Shrews go through winter by shrinking their brain and most organs, then regrow them in the spring. The gene expression changes underlying this unusual brain size plasticity were unknown. Here, the authors looked for potential adaptations underlying this trait by looking at differential expression in the hypothalamus. They found enrichments for DE in genes related to the blood brain barrier and calcium signaling, as well as used comparative data to look at gene expression differences that are unique in shrews. This study leverages a fascinating organismal trait to understand plasticity and what might be driving it at the level of gene expression. This manuscript also lays the groundwork for further developing this interesting system.

      Strengths:

      One strength is that the authors used OU models to look for adaptation in gene expression. The authors also added cell culture work to bolster their findings.

      Comments on revised version:

      I think that the authors have made a strong revision. No other comments.

    1. Reviewer #2 (Public review):

      Summary:

      This valuable work aims to infer, from microbiome data, microbial species interaction patterns associated with healthy and unhealthy human gut microbiomes. Using solid techniques from statistical physics, the authors propose that healthy and unhealthy microbiome interaction patterns substantially differ. Unhealthy microbiomes are closer to instability and single-strain dominance; whereas healthy microbiomes showcase near-neutral dynamics, mostly driven by demographic noise and immigration.

      Strengths:

      A well-written article, relatively easy to follow and transparent despite the high degree of technicality of the underlying theory. The authors provide a powerful inferring procedure, which bypasses the issue of having only compositional data.

      Weaknesses:

      (1) This sentence in the introduction seems key to me: "Focusing on single species properties as species abundance distribution (SAD), fail to characterise altered states of microbiome." Yet it is not explained what is meant by 'fail', and thus what the proposed approach 'solves'.

      (2) Lack of validation, following arbitrary modelling choices made (symmetry of interactions, weak-interaction limit, uniform carrying capacity).<br /> Inconsistent interpretation of instability. Here, instability is associated with the transition to the marginal phase, which becomes chaotic when interaction symmetry is broken. But as the authors acknowledge, the weak interaction limit does not reproduce fat-tailed abundance distributions found in data. On the other hand, strong interaction regimes, where chaos prevails, tend to do so (Mallmin et al, PNAS 2024). Thus, the nature of the instability towards which unhealthy microbiomes approach is unclear.

      (3) Three technical points about the methodology and interpretation.<br /> a) How can order parameters h and q0 can be inferred, if in the compositional data they are fixed by definition?<br /> b) How is it possible that weaker interaction variance is associated with approach to instability, when the opposite is usually true?<br /> c) Having an idea of what the empirical data compares to the theoretical fits would be valuable.

      Implications:

      As the authors say, this is a proof of concept. They point at limits and ways to go forward, in particular pointing at ways in which species abundance distributions could be better reproduced by the predicted dynamical models. One implication that is missing, in my opinion, is the interpretability of the results, and what this work achieves that was missing from other approaches (see weaknesses section above): what do we learn from the fact that changes in microbial interactions characterise healthy from unhealthy microbiota? For instance, what does this mean for medical research?

    1. Reviewer #2 (Public review):

      Summary:

      This study shows that transcription factor Sp1 is required for correct ventral vs. dorsal targeting of limb-innervating LMC motor neurons using mouse and chick as model systems. In a wild-type embryo, lateral LMC axons specifically target dorsal muscles while medial LMC axons target ventral muscles. The authors convincingly show that this specificity is lost when Sp1 is knocked down or knocked out - axons of both lateral and medial LMC motor neurons project to both dorsal and ventral muscles in mutant conditions. The authors then conduct RNA-seq and ChIP experiments to show that Sp1 loss of function disrupts Ephrin-Epha receptor signaling pathway genes. These molecules are known to provide attractive or repulsive cues to guide LMC axons to their targets. The authors show that attraction/repulsion properties of medial and lateral LMC axons to specific Ephrin/Epha molecules are in fact disrupted in Sp1 mutants using ex vivo explant studies. Finally, the authors show that behaviors like coordinated movement and grip strength are also affected in Sp1 mutant mice. This study convincingly shows that Sp1 is important for correct circuit wiring of LMC neurons, and moves the field forward by elucidating a new level of transcriptional regulation required in this process. However, the claims made by the authors that the mode of Sp1-mediated regulation is through cis-attenuation of Epha activity is not well supported. These and additional strengths and weaknesses in approach and in data interpretation are discussed below.

      Strengths:

      (1) The study convincingly shows that wildtype levels of Sp1 are necessary for LMC axon targeting specificity. The combination of the following approaches is a strength:<br /> a) Both loss of function and gain of function experiments are performed for Sp1 and show complementary effects on the axon targeting phenotype.<br /> b) Retrograde labeling of LMC neurons from dorsal and ventral muscles shows that Sp1 mutants clearly lose the specificity of LMC axon targeting.<br /> c) The authors also use explant experiments to show that both loss of Sp1 and gain of Sp1 show clear changes in attraction and repulsion to specific ephrin and epha receptor molecules.<br /> d) The Sp1 loss and gain of function experiments are well controlled to show that the changes in axon wiring observed are not due to cell death, cell fate switches, or due to unequal numbers of medial and lateral LMC neurons being labeled in the experiments.

      (2) It is also convincing that Sp1 requires cofactors p300 and CBP for its function. In the absence of these cofactors, the gain of function phenotypes of Sp1 are subdued.

      Weaknesses:

      (1) The robustness of RNAseq and ChIP experiments is difficult to judge as methods are not described. For example, it is unclear if RNAseq is performed on purified motor neurons or on whole spinal cords. This is an important consideration as Sp1 is a broadly expressed protein.

      (2) The authors state that expression of Ephrin A5 and Ephrin B2 is reduced based on RNAseq data, however, it is not shown that this reduction occurs specifically in LMC neurons.

      (3) The authors show Sp1 ChIP peaks at Ephrin B2 promoter, but nothing is mentioned about peaks at Eprin A5 or other types of signaling molecules like Sema7a, which are also differentially expressed in Sp1 mutants. There is also no mention of the correlation between changes in gene expression seen in RNAseq data and the binding profile of Sp1 seen in ChIP data, which could help establish the robustness of these datasets.

      (4) The authors conclude that Sp1 functions by activating Ephrin A5 in medial LMC and Ephrin B2 in lateral LMC. The argument, as I understand it, is that this activation leads to cis attenuation of their respective Epha receptors and therefore targeting the correct muscle. Though none of the data presented go against this hypothesis, this hypothesis is also not fully supported. Specifically:<br /> a) It would be important to know that modulation of Sp1 expression leads to changes in EphrinA5 and B2 in LMC lateral/medial neurons.<br /> b) It would also be important to show that none of the other changes caused by Sp1 are responsible for axon mistargeting by performing rescue experiments with Ephrin A5 and Ephrin B2.<br /> c) To make the most convincing case, experiments showing increased or decreased cis-binding of Ephrin molecules with Epha receptors would be necessary. This study would still be compelling without this last experiment, but the language in the abstract would need to be modulated.

      (5) All behavior experiments are done in a pan-neuronal knockout of Sp1. As Sp1 is broadly expressed in neurons, a statement describing whether and why the authors think the phenotypes arise from Sp1's function in LMC motor neurons would be helpful. Experimentally, rescue experiments in which Sp1 is restored in LMC neurons or motor neurons would also make this claim more convincing.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents findings that indicate a role in controlling Drosophila heart rate for a conserved miRNA (miR-238 in flies). Further, the manuscript localizes the relevant tissue for the function of this miRNA to a subset of neurons that are heavily involved in circadian regulation, thus presenting an interesting mechanistic link between the circadian system and heart rate. Either ubiquitous knockout or ubiquitous overexpression negatively impacts several aspects of heart performance, with a pronounced effect on heart rate. Interestingly, knockdowns in the heart itself are innocuous, but knockdown in LNvS neurons recapitulates the effect on heart rate. Authors use bioinformatics to identify the clockwork orange (cwo) gene as a potential target and validate that cwo expression is reduced when miR-238 is knocked down in LNvS neurons in vivo and also validate that cwo is regulated by miR-238 in cell culture luciferase assays. Exercise shows a modest ability to restore normal cwo expression and a trend toward an effect on survival, but shows a much stronger rescue of the heart rate phenotype.

      Strengths:

      Evidence is strong for the effect of miR-238 in pdf-positive neurons on the control of heart rate and for cwo as a downstream effector of miR-238.

      Work to identify specific targets of miR-283 is well-done and successfully identified a key downstream regulator in cwo.

      The potential mechanism using miR-238 to link circadian neurons to heart rate regulation is novel and exciting.

      Weaknesses:

      The evidence that this is related to normal aging is rather weak, and the effect of exercise on the observed parameters is small and not necessarily working through the miR-238/cwo mechanism.

      The authors seem to be conflating two hypotheses in their interpretations. Is miR-283 working through circadian mechanisms or age-related mechanisms? While it is true that aging tends to reduce heart rate, I don't think that means that any intervention that reduces heart rate is causing "senescence". Similarly, reduced survival in miR-283 knockdown flies does not prove that miR-283 promotes healthy aging per se, just that miR-283 is required for health regardless of age.

      Survival reduction is quite modest which does not necessarily support the idea that the bradycardia is causing major health issues or premature senescence for the flies. The interpretation of the longevity experiments throughout the manuscript seems overstated.

      The study would benefit greatly from a direct test of the author's proposed pathway for exercise to improve bradycardia.

      The statement in the discussion "inducing endurance exercise of anti gravity climbing in flies with miR-283 knockdown in LNvs can improve bradyarrhythmic features by decreasing brain miR-283 expression" is not fully supported by data in the paper. There is an association there, but it cannot be said to be the full cause (or even required) without doing more experiments

      The summary figure includes both data-supported mechanistic relationships and mechanisms that are inferred or assumed.

    1. Reviewer #2 (Public review):

      Summary:

      The goal of the study was to uncover the mechanisms mediating tactile-context-dependent locomotion modulation in C. elegans, which represents an interesting model of behavioral plasticity. Starting from a candidate genetic screen focusing on guanylate cyclase (GCY) mutants, the authors identified the AFD-specific gcy-18 gene as essential for tactile-context-dependent locomotion modulation. AFD is primarily characterized as a thermo-sensory neuron. However, key thermosensory transduction genes and the sensory ending structure of AFD were shown here to be dispensable for tactile-context locomotion modulation. AFD actuates tactile-context locomotion modulation via the cell-autonomous actions of GCY-18 and the CNG-3 cyclic nucleotide-gated channel, and via AFD's connection with AIB interneurons through electrical synapses. This represents a potentially relevant synaptic connection linking AFD to the mechanosensory-behavior circuit.

      Strengths:

      (1) The fact that AFD mediates tactile-context locomotion modulation is new, rather surprising, and interesting.

      (2) The authors have combined a very clever microfluidic-based behavioral assay with a large set of genetic manipulations to dissect the molecular and cellular pathways involved. Rescue experiments with single-copy transgenes are very convincing.

      (3) The study is very clearly written, and figures are nicely illustrated with diagrams that effectively convey the authors' interpretation.

      Weaknesses:

      (1) Whereas GCY-18 in AFD and the AFD-AIB synaptic connection clearly play a role in tactile-context locomotion modulation, whether and how they actually modulate the mechanosensory circuit and/or locomotion circuit remains unclear. The possibility of non-synaptic communication linking mechanosensory neurons and AFD (in either direction) was not explored. Thus, in the end, we have not learned much about what GCY-18 and the AFD-AIB module are doing to actuate tactile context-dependent locomotion modulation.

      (2) The authors only focused on speed readout, and we don't know if the many behavioral parameters that are modulated by tactile context are also under the control of AFD-mediated modulation.

      (3) The AFD-AIB gap junction reconstruction experiment was conducted in an innexin double mutant background, in which the whole nervous system's functioning might be severely impaired, and its results should be interpreted with this limitation in mind.

    1. Reviewer #2 (Public review):

      Summary:

      This study presents a valuable characterization of the effects of intracranial theta-burst stimulation of the basolateral amygdala on single units spiking activity in several areas in the human brain, associated with memory processing. It is written clearly and concisely, allowing readers to fully understand the analysis used.

      The authors used a visual recognition memory task previously employed by their group to characterize the effects of basolateral amygdala stimulation upon memory consolidation (Inman et al, 2018). This current report is an interesting analysis to complement the results reported in the 2018 paper.

      Strengths:

      Rare combination of human neurophysiology and behavior -<br /> The type of experiment performed in the manuscript, which contains both neurophysiological data, behavior, and a deep brain stimulation intervention (DBS), is incredibly rare, takes many years to accomplish with tight collaboration between clinical and research teams. Our understanding of spiking dynamics of human neurons is very limited, and this report is an important piece in the puzzle that allows DBS to be used in future interventions that will benefit patients' health.

      Multiple brain areas included -<br /> It's important to note that the report analyzes brain areas with which the Amygdala has extensive connections (Fig. 1A) - Hippocampus, OFC, Amygdala, ACC. It seems that neurons in all these areas were modulated by the stimulation, except the ACC, in which firing rates were so low, that only a handful of neurons were included in the analysis. This is an important demonstration that low amplitude stimulation (even when reduced to 0.5mA) can travel far and wide across the human brain.

      The experiment is cleverly designed to tease apart responses due to visual stimuli (image presentation) and electrical stimulation. Authors suggest that the units modulated by stimulation are largely distinct from those responsive to image offset during trials without stimulation. The subpopulation that responds strongly also tends to have a higher baseline of firing rate. It's important to add that the chosen modulation index is more likely to be significant in neurons with higher firing rates.

      Weaknesses:

      Readers can benefit from understanding with more details the locations chosen for stimulation - in light of previous studies that found differences between effects based on proximity to white matter (For example - PMID 32446925, Mohan et al, Brain Stimul. 2020 and PMID 33279717 Mankin et al Brain Stimul. 2021).

    1. Reviewer #2 (Public review):

      Summary:

      This study from the CenGEN consortium addresses several limitations of single-cell RNA (scRNA) and bulk RNA sequencing in C. elegans with a focus on cells in the nervous system. scRNA datasets can give very specific expression profiles, but detecting rare and non-polyA transcripts is difficult. In contrast, bulk RNA sequencing on isolated cells can be sequenced to high depth to identify rare and non-polyA transcripts but frequently suffers from RNA contamination from other cell types. In this study, the authors generate a comprehensive set of bulk RNA datasets from 53 individual neurons isolated by fluorescence-activated cell sorting (FACS). The authors combine these datasets with a previously published scRNA dataset (Taylor et al., 2021) to develop a novel method, called LittleBites, to estimate and subtract contamination from the bulk RNA data. The authors validate the method by comparing detected transcripts against gold-standard datasets on neuron-specific and non-neuronal transcripts. The authors generate an "integrated" list of protein-coding expression profiles for the 53 neuron sub-types, with fewer but higher confidence genes compared to expression profiles based only on scRNA. Also, the authors identify putative novel pan-neuronal and cell-type specific non-coding RNAs based on the bulk RNA data. LittleBites should be generally useful for extracting higher confidence data from bulk RNA-seq data in organisms where extensive scRNA datasets are available. The additional confidence in neuron-specific expression and non-coding RNA expands the already great utility of the neuronal expression reference atlas generated by the CenGEN consortium.

      Strengths:

      The study generates and analyzes a very comprehensive set of bulk RNA datasets from individual fluorescently tagged transgenic strains. These datasets are technically challenging to generate and significantly expand our knowledge of gene expression, particularly in cells that were poorly represented in the initial scRNA-seq datasets. Additionally, all transgenic strains are made available as a resource from the Caenorhabditis Elegans Genetics Center (CGC).

      The study uses the authors' extensive experience with neuronal expression to benchmark their method for reducing contamination utilizing a set of gold-standard validated neuronal and non-neuronal genes. These gold-standard genes will be helpful for benchmarking any C. elegans gene expression study.

      Weaknesses:

      The bulk RNA-seq data collected by the authors has high levels of contamination and, in some cases, is based on very few cells. The methodology to remove contamination partly makes up for this shortcoming, but the high background levels of contaminating RNA in the FACS-isolated neurons limit the confidence in cell-specific transcripts.

      The study does not experimentally validate any of the refined gene expression predictions, which was one of the main strengths of the initial CenGEN publication (Taylor et al, 2021). No validation experiments (e.g., fluorescence reporters or single molecule FISH) were performed for protein-coding or non-coding genes, which makes it difficult for the reader to assess how much gene predictions are improved, other than for the gold standard set, which may have specific characteristics (e.g., bias toward high expression as they were primarily identified in fluorescence reporter experiments).

      The study notes that bulk RNA-seq data, in contrast to scRNA-seq data, can be used to identify which isoforms are expressed in a given cell. However, no analysis or genome browser tracks were supplied in the study to take advantage of this important information. For the community, isoform-specific expression could guide the design of cell-specific expression constructs or for predictive modeling of gene expression based on machine learning.

    1. Reviewer #2 (Public review):

      Summary:

      This study provides valuable context for ongoing research on the role of dopamine in memory and locomotion. DANs have been a fascinating area of study due to their complexity, and this work dissects specific DANs, exploring their roles in different memory-related behaviors while offering some explanations. The discussions provided by the authors effectively situates the study in the broader field of learning, memory, DAN circuitry and behavioral computation in insect brains. The study achieves what it sets out to and it does so unequivocally. The experiments were elegantly designed, leaving little room for doubt in the study's claims. However, the study lacks context regarding the molecular pathways underlying these results. While it strengthens current knowledge by providing robust evidence, it does little to explore the molecular mechanisms behind these effects.

      Strengths:

      (1) Experiment design is one of the strengths of this study. The experiments are thorough and cover the length and breadth of the core findings of the study. Although a lot of work has already been done in studying the role of dopamine in memory and locomotion, the dissection of the functions of distinct DANs in larvae has been done meticulously with well-structured experiments.<br /> (2) This study fits quite nicely into the puzzle of memory, especially in the context of Dopamine. Previous studies in *Drosophila* adults have shown the opposing roles of DANs in locomotion depending on the context of DAN activation. This study drives that point home for larvae, providing conclusive evidence in that regard.<br /> (3) The use of clear figures and simple language is one of the strengths of this paper. The figures are comprehensive, complete and manage to narrate the story by themselves. The flow of information is smooth. The simple and effective language used maintains scientific rigor while remaining accessible to those new to the field. A pleasant read.

      Weaknesses:<br /> (1) The authors have done a great job at structuring the figures. But some main figures would benefit from including the controls instead of placing them in supplementary.<br /> (2) The paper would benefit from a deeper discussion regarding molecular mechanisms underlying their results. It would be interesting to see what the authors think about different Dopamine receptors and how they relate to the findings of this paper.<br /> (3) Throughout the paper, the authors have been clear and comprehensive, but in some cases, further explanation of their choices were missing. For example, the choice to compare bending and tail velocity over other parameters within the same clusters is unclear.

    1. Reviewer #2 (Public review):

      Summary:

      The authors aimed to develop a novel and efficient method for SV detection, utilizing data from the 1000 Genomes Project (1KGP) for modeling and calibration. This method was subsequently validated using UK population data and applied to identify structural variants associated with specific disease phenotypes.

      Strengths:

      Third-generation single-molecule sequencing data offers several advantages over traditional high-throughput sequencing methods, particularly due to its long-read lengths, which provide valuable insights into significant forms of genomic variation. The authors have developed an efficient method for detecting structural variations and optimizing the utilization of genomic data. We hope that this method will continue to be refined, enabling researchers to more effectively leverage long-read data, high-throughput data, or even a synergistic combination of both.

      Weaknesses:

      Although this research contributes to our ability to more effectively utilize long-length and high-throughput data, there are some key issues that need to be addressed in terms of analyzing the specific results as well as writing the article.

    1. Reviewer #3 (Public review):

      Summary:

      The goal of this study was to carry out an in-depth granular and unbiased phenotyping of peripheral blood circulating Tfh specific to two malaria vaccine candidates, PfSEA-1A and PfGARP, and correlate these with age (children vs adults) and protection from malaria (antibody titers against Plasmodium antigens.) Authors further attempted to identify any specific differences of the Tfh responses to these two distinct malaria antigens.

      Strengths:

      The authors had access to peripheral blood samples from children and adults living in a malaria-endemic region of Kenya. The authors studied these samples using in vitro restimulation in the presence of specific malaria antigens. Authors generated a very rich data set from these valuable samples using cutting-edge spectral flow cytometry and a 21-plex panel that included a variety of surface markers, cytokines and transcription factors.

      Update following first revision (R1) of the manuscript:

      The authors have made a great effort to comprehensively address comments raised by the reviewers. In particular, clearly showing expression of ICOS and Bcl6 on CXCR5+ cells greatly strengthens the case for defining these cells as Tfh-like circulatory lymphocytes (cTfh).

      Weaknesses:

      Update following first revision (R1) of the manuscript:

      Unfortunately, my main concern remains. As it stands, the study is not really on antigen-specific T cells, but rather on the overall CD4 T cell compartment plus or minus antigenic stimulation. Although authors used an in vitro restimulation strategy with malaria antigens, they do not focus on cells de-novo expressing activation markers as a result of restimulation, neither they use tetramers to detect antigen-specific T cells. Moreover, their data shows that the number of CXCR5+ CD4 T cells de-novo expressing activation markers and/or cytokines as a result of their in vitro restimulation is negligible, even when using a prototypic superantigen (SEB).

      Thus, no antigen-specific CXCR5+ CD4 T cells could be analysed with the data that the authors provide in this manuscript.

    1. Reviewer #2 (Public review):

      Summary:

      Kapoor et. al. investigated the role of the mycobacterial protein Wag31 in lipid and peptidoglycan synthesis and sought to delineate the role of the N- and C- terminal domains of Wag31. They demonstrated that modulating Wag31 levels influences lipid homeostasis in M. smegmatis and cardiolipin (CL) localisation in cells. Wag31 was found to preferentially bind CL-containing liposomes, and deleting the N-terminus of the protein significantly decreased this interaction. Novel interactions between Wag31 and proteins involved in lipid metabolism and cell wall synthesis were identified, suggesting that Wag31 recruits proteins to the intracellular membrane domain by direct interaction.

      Strengths:

      (1) The importance of Wag31 in maintaining lipid homeostasis is supported by several lines of evidence.<br /> (2) The interaction between Wag31 and cardiolipin, and the role of the N-terminus in this interaction was convincingly demonstrated.

      Weakness:

      (1) Interactome analysis with truncated versions of the proteins could not be performed in M. smegmatis due to protein instability.

    1. Reviewer #2 (Public review):

      Summary:

      In this work, Degutis and colleagues addressed an interesting issue related to the concurrent coding of sensory percepts and visual working memory contents in visual cortices. They used generalization analyses to test whether working memory representations change over time, diverge from sensory percepts, and vary across distraction conditions. Temporal generalization analysis demonstrated that off-diagonal decoding accuracies were lower than on-diagonal decoding accuracies, regardless of the presence of intervening distractions, implying that working memory representations can change over time. They further showed that the coding space for working memory contents showed subtle but statistically significant changes over time, potentially explaining the impaired off-diagonal decoding performance. The neural coding of sensory distractions instead remained largely stable. Generalization analyses between target and distractor codes showed overlaps but were not identical. Cross-condition decodings had lower accuracies compared to within-condition decodings. Finally, within-condition decoding revealed more reliable working memory representations in the condition with intervening random noises compared to cross-condition decoding using a trained classifier on data from the no-distraction condition, indicating a change in the VWM format between the noise distractor and no-distractor trials.

      Strengths:

      This paper demonstrates a clever use of generalization analysis to show changes in the neural codes of working memory contents across time and distraction conditions. It provides some insights into the differences between representations of working memory and sensory percepts, and how they can potentially coexist in overlapping brain regions.

      Comments on revisions:

      I appreciate the authors' efforts in addressing my previous concerns. The inclusion of additional analyses and data has strengthened the paper. I have no further concerns.

    1. Reviewer #2 (Public review):

      The study by Deganutti and co-workers is a methodological report on an adaptive sampling approach, multiple walker supervised molecular dynamics (mwSuMD), which represents an improved version of the previous SuMD.<br /> Case-studies concern complex conformational transitions in a number of G protein Coupled Receptors (GPCRs) involving long time-scale motions such as binding-unbinding and collective motions of domains or portions. GPCRs are specialized GEFs (guanine nucleotide exchange factors) of heterotrimeric Gα proteins of the Ras GTPase superfamily. They constitute the largest superfamily of membrane proteins and are of central biomedical relevance as privileged targets of currently marketed drugs.<br /> MwSuMD was exploited to address:

      a) binding and unbinding of the arginine-vasopressin (AVP) cyclic peptide agonist to the V2 vasopressin receptor (V2R);<br /> b) molecular recognition of the β2-adrenergic receptor (β2-AR) and heterotrimeric GDP-bound Gs protein;<br /> c) molecular recognition of the A1-adenosine receptor (A1R) and palmotoylated and geranylgeranylated membrane-anchored heterotrimeric GDP-bound Gi protein;<br /> d) the whole process of GDP release from membrane-anchored heterotrimeric Gs following interaction with the glucagon-like peptide 1 receptor (GLP1R), converted to the active state following interaction with the orthosteric non-peptide agonist danuglipron.

      The revised version has improved clarity and rigor compared to the original also thanks to the reduction in the number of complex case studies treated superficially.<br /> The mwSuMD method is solid and valuable, has wide applicability and is compatible with the most world-widely used MD engines. It may be of interest to the computational structural biology community.<br /> The huge amount of high-resolution data on GPCRs makes those systems suitable, although challenging, for method validation and development.<br /> While the approach is less energy-biased than other enhanced sampling methods, knowledge, at the atomic detail, of binding sites/interfaces and conformational states is needed to define the supervised metrics, the higher the resolution of such metrics is the more accurate the outcome is expected to be. Definition of the metrics is a user- and system-dependent process.

    1. Reviewer #2 (Public review):

      Zeeshan et al. investigate the function of the protein SUN1, a proposed nuclear envelope protein linking nuclear and cytoplasmic cytoskeleton, during the rapid male gametogenesis of the rodent malaria parasite Plasmodium berghei. They reveal that SUN1 localises to the nuclear envelope (NE) in male and female gametes and show that the male NE has unexpectedly high dynamics during the rapid process of gametogenesis. Using expansion microscopy, the authors find that SUN1 is enriched at the neck of the bipartite MTOC that links the intranuclear spindle to the basal bodies of the cytoplasmic axonemes. Upon deletion of SUN1, the basal bodies of the eight axonemes fail to segregate, no spindle is formed, and emerging gametes are anucleated, leading to a complete block in transmission. By interactomics the authors identify a divergent allantoicase-like protein, ALLAN, as a main interaction partner of SUN1 and further show that ALLAN deletion largely phenocopies the effect of SUN1.

      Overall, the authors use an extensive array of fluorescence and electron microscopy techniques as well as interactomics to convincingly demonstrate that SUN1 and ALLAN play a role in maintaining the structural integrity of the bipartite MTOC during the rapid rounds of endomitosis in male gametogenesis.

      Two suggestions for improvement of the work remain:

      (1) Lipidomic analysis of WT and SUN1-knockout gametocytes before and after activation resulted in only minor changes in some lipid species. Without statistical analysis, it remains unclear if these changes are statistically significant and not rather due to expected biological variability. While the authors clearly toned down their conclusions in the revised manuscript, some phrasings in the results and the discussion still suggest that gametocyte activation and/or SUN1-knockout affects lipid composition. Similarly, some phrases suggest that SUN1 is responsible for the observed loops and folds in the NE and that SUN1 KO affects the NE dynamics. Currently, I do not think that the data supports these statements.

      (2) It is interesting to note that ALLAN has a much more specific localisation to basal bodies than SUN1, which is located to the entire nuclear envelope. Knock out of ALLAN also exhibits a milder (but still striking) phenotype than knockout of SUN1. These observations suggest that SUN1 has additional roles in male gametogenesis besides its interaction with ALLAN, which could be discussed a bit more.

      This study uses extensive microscopy and genetics to characterise an unusual SUN1-ALLAN complex, thus providing new insights into the molecular events during Plasmodium male gametogenesis, especially how the intranuclear events (spindle formation and mitosis) are linked to the cytoplasmic separation of the axonemes. The characterisation of the mutants reveals an interesting phenotype, showing that SUN1 and ALLAN are localised to and maintain the neck region of the bipartite MTOC. The authors here confirm and expand the previous knowledge about SUN1 in P. berghei, adding more detail to its localisation and dynamics, and further characterise the interaction partner ALLAN. Given the evolutionary divergence of Plasmodium, these results are interesting not only for parasitologists, but also for more general cell biologists.

    1. Reviewer #2 (Public review):

      Summary:

      The authors used rats to determine the receptor for a food-related perception (kokumi) that has been characterized in humans. They employ a combination of behavioral, electrophysiological, and immunohistochemical results to support their conclusion that ornithine-mediated kokumi effects are mediated by the GPRC6A receptor. They complemented the rat data with some human psychophysical data. I find the results intriguing, but believe that the authors overinterpret their data.

      Strengths:

      The authors provide compelling evidence that ornithine enhances the palatability of several chemical stimuli (i.e., IMP, MSG, MPG, Intralipos, sucrose, NaCl, quinine). Ornithine also increases CT nerve responses to MSG. Additionally, the authors provide evidence that the effects of ornithine are mediated by GPRC6A, a G-protein-coupled receptor family C group 6 subtype A, and that this receptor is expressed primarily in fungiform taste buds. Taken together, these results indicate that ornithine enhances the palatability of multiple taste stimuli in rats, and that the enhancement is mediated, at least in part, within fungiform taste buds. This finding could stand on its own. The question of whether ornithine produces these effects by eliciting kokumi-like perceptions (see below) should be presented as speculation in the Discussion section.

      Weaknesses:

      I am still unconvinced that the measurements in rats reflect the "kokumi" taste percept described in humans. The authors conducted long-term preference tests, 10-min avidity tests and whole chorda tympani (CT) nerve recordings. None of these procedures specifically model features of "kokumi" perception in humans, which (according to the authors) include increasing "intensity of whole complex tastes (rich flavor with complex tastes), mouthfulness (spread of taste and flavor throughout the oral cavity), and persistence of taste (lingering flavor)." While it may be possible to develop behavioral assays in rats (or mice) that effectively model kokumi taste perception in humans, the authors have not made any effort to do so. As a result, I do not think that the rat data provide support for the main conclusion of the study--that "ornithine is a kokumi substance and GPRC6A is a novel kokumi receptor."

      Why are the authors hypothesizing that the primary impacts of ornithine are on the peripheral taste system? While the CT recordings provide support for peripheral taste enhancement, they do not rule out the possibility of additional central enhancement. Indeed, based on the definition of human kokumi described above, it is likely that the effects of kokumi stimuli in humans are mediated at least in part by the central flavor system.

      The authors include (in the supplemental data section) a pilot study that examined the impact of ornithine on variety of subjective measures of flavor perception in humans. The presence of this pilot study within the larger rat study does not really make sense. If the human studies are so important, as the authors state, then why did the authors relegate them to the supplemental data section? Usually one places background and negative findings in this section of a paper. Accordingly, I recommend that the human data be published in a separate article.

    1. Reviewer #2 (Public review):

      Summary:

      Consensus-independent component analysis and closely related methods have previously been used to reveal components of transcriptomic data which are not captured by principal component or gene-gene coexpression analyses.

      Here, the authors asked whether applying consensus-independent component analysis (c-ICA) to published high-grade serous ovarian cancer (HGSOC) microarray-based transcriptomes would reveal subtle transcriptional patterns which are not captured by existing molecular omics classifications of HGSOC.

      Statistical associations of these (hitherto masked) transcriptional components with prognostic outcomes in HGSOC would lead to additional insights into underlying mechanisms and, coupled with corroborating evidence from spatial transcriptomics, are proposed for further investigation.

      This approach is complementary to existing transcriptomics classifications of HGSOC.

      The authors have previously applied the same approach in colorectal carcinoma (for example, Knapen et al. (2024) Commun. Med).

      Strengths:

      Overall, this study describes a solid data-driven description of c-ICA-derived transcriptional components that the authors identified in HGSOC microarray transcriptomics data, supported by detailed methods and supplementary documentation.

      The biological interpretation of transcriptional components is convincing based on (data-driven) permutation analysis and a suite of analyses of association with copy-number, gene sets, and prognostic outcomes.<br /> The resulting annotated transcriptional components have been made available in a searchable online format.

      For the highlighted transcriptional component which has been annotated as related to synaptic signalling, the detection of the transcriptional component among 11 published spatial transcriptomics samples from ovarian cancers is compelling and supports the need for further mechanistic follow-up.

      Further comments:

      This revised version includes a suite of comparisons between the c-ICA-derived components and existing published transcriptomic/genomic-based classifications of ovarian cancers. Newly described components will require experimental validation, as acknowledged by the authors.

      Here, the authors primarily interpret the c-ICA transcriptional components as a deconvolution of bulk transcriptomics due to the presence of cells from tumour cells and the tumour microenvironment.<br /> In this revised version, the authors additionally investigate their TC scores in single cells from a published HGSOC single-cell RNAseq dataset, highlighting examples of TC scores within and between cell types.

      c-ICA is not explicitly a deconvolution method with respect to cell types: the transcriptional components do not necessarily correspond to distinct cell types, and may reflect differential dysregulation within a cell type. This application of c-ICA for the purpose of data-driven deconvolution of cell populations is distinct from other deconvolution methods which explicitly use a prior cell signature matrix.

    1. Reviewer #2 (Public review):

      Summary:

      While the phylogenetic position of Acoels (and Xenacoelomorpha) remains still debated, investigations of various representative species are critical to understanding their overall biology.

      Hofstenia is an Acoels species that can be maintained in laboratory conditions and for which several critical techniques are available. The current manuscript provides a comprehensive and widely descriptive investigation of the productive system of Hofstenia miamia.

      Strengths:

      (1) Xenacoelomorpha is a wide group of animals comprising three major clades and several hundred species, yet they are widely understudied. A comprehensive state-of-the-art analysis on the reprodutive system of Hofstenia as representative is thus highly relevant.

      (2) The investigations are overall very thorough, well documented, and nicely visualised in an array of figures. In some way, I particularly enjoyed seeing data displayed in a visually appealing quantitative or semi-quantitative fashion.

      (3) The data provided is diverse and rich. For instance, the behavioral investigations open up new avenues for further in-depth projects.

      Weaknesses:

      While the analyses are extensive, they appear in some way a little uni-dimensional. For instance the two markers used were characterized in a recent scRNAseq data-set of the Srivastava lab. One might have expected slightly deeper molecular analyses. Along the same line, particularly the modes of spermatogenesis or oogenesis have not been further analysed, nor the proposed mode of sperm-storage.

    1. Reviewer #2 (Public review):

      Summary:

      The authors recently uncovered a novel nested gene, Aff3ir, and this work sets out to study its function in endothelial cells further. Based on differences in expression correlating with areas of altered shear stress, they investigate a role for the isoform Aff3ir-ORF2 in endothelial activation and development of atherosclerosis downstream of disturbed shear stress. Using a knockout mouse model and in vivo overexpression experiments, they demonstrate a strong potential for Aff3ir-ORF2 to alleviate atherosclerosis. They find that Aff3ir-ORF2 interacts with the pro-inflammatory transcription factor IRF5 and retains it in the cytoplasm, hence preventing upregulation of inflammation-associated genes. The data expands our knowledge of IRF5 regulation which could be relevant to researchers studying various inflammatory diseases as well as adding to our understand of atherosclerosis development.

      Strengths:

      The in vivo data is convincing using immunofluorescence staining to assess AFF3ir-ORF2 expression, a knockout mouse model, overexpression and knockdown studies and rescue experiments in combination with two atherosclerotic models to demonstrate that Aff3ir-ORF2 can lessen atherosclerotic plaque formation in ApoE-/- mice.

      Weaknesses:

      The effect on atherosclerosis is clear and there is sufficient evidence to conclude that this is the result of reduced endothelial cell activation. However, other cell types such as smooth muscle cells or macrophages could be contributing to the effects observed. The mouse model is a global knockout and the shRNA knockdowns (Fig. 5) and overexpression data in Figure 2 are not cell type-specific. Only the overexpression construct in Figure 6 uses an ICAM-2 promoter construct, which drives expression in endothelial cells, though leaky expression of this promoter has been reported in the literature.

      The in vitro experiments are solidly executed, but most experiments are performed in mouse embryonic fibroblasts (MEFs) and results extrapolated to endothelial cell responses. However, several key experiments are repeated in HUVEC, thereby making a solid case that Aff3ir-ORF2 can regulate IRF5 in both MEFs and HUVEC. It is important to note that the sequence of AFF3ir-ORF2 is not conserved in humans and lacks an initiation codon, hence the regulatory pathway is not conserved. However, the overexpression studies in HUVEC suggest that mouse AFF3ir-ORF2 can also regulate human IRF5 and hence the mechanism retains relevance for possible human health interventions.

      Overall, the paper succeeds in demonstrating a link between Aff3ir-ORF2 and atherosclerosis. The study shows a functional interaction between Aff3ir-ORF2 and IRF5 in embryonic fibroblasts, but makes a solid case that this mechanism is relevant for atherosclerosis development via endothelial cell activation.

    1. Reviewer #2 (Public review):

      This is an interesting and important work from Shihabeddin et al, to identify master regulators for rod photoreceptor regenerations in a zebrafish model of Retinitis Pigmentosa. Building on their scRNA-seq data, Shihabeddin et al dissected the progenitor cell types and performed trajectory analyses to predict transcription factors that apparently drive the progenitor proliferation and differentiation into rod photoreceptors. Their analyses predicted e2f1, e2f2, and e2f3 as critical drivers of progenitor proliferation, Prdm1a as a driver of rod photoreceptor differentiation, and SP1 as a driver of rod photoreceptor maturation. Genetic experiments provide clear support for the roles of e2fs in progenitor proliferation. It's also apparent from Figure 8 that prdm1 knockdown appears to cause a decrease in rhodopsin expression. By colocalizing BrdU and Retp1, the authors inferred that the apparent "new rods" (which exhibit mixed BrdU and Retp1 signal) are decreased with prdm1, providing further support. Overall I found the work to be interesting, rigorous, and informative for the community.

      I have a few suggestions for the authors to consider:

      (1) Perhaps the authors can consider explaining why the Prdm1a knock-down cells would have a higher Retp1 signal per cell in Fig 9B. Is this a representative picture? This appears to contradict Figure 8's conclusion, although I could tell that the number of Retp1+ cells in the ONL appears to be lower.

      (2) The authors noted "Surprisingly, the knockdown of prdm1a resulted in a significantly higher number of rhodopsin-positive cells in the INL (p=0.0293)", while it appears in Figure 9B, 9C that the difference is 2 cells vs 0 in a rightly broader field. It seems to be too strong of a statement for this effect.

      (3) It appears to this reviewer that the proteomic data didn't reveal much in line with the overall hypothesis or the mechanism, and it's unclear why the authors went for proteomics rather than bulk RNA-seq or ChIP-seq for a transcription factor knock-down experiment. Overall this is a minor point.

    1. Reviewer #2 (Public review):

      Summary:

      In the manuscript, the authors seek to discover putative gene regulatory interactions underlying the lineage bifurcation process of neural progenitor cells in the embryonic mouse anterior brainstem into GABAergic and glutamatergic neuronal subtypes. The authors analyze single-cell RNA-seq and single-cell ATAC-seq datasets derived from the ventral rhombomere 1 of embryonic mouse brainstems to annotate cell types and make predictions or where TFs bind upstream and downstream of the effector TFs using computational methods. They add data on the genomic distributions of some of the key transcription factors and layer these onto the single-cell data to get a sense of the transcriptional dynamics.

      Strengths:

      The authors use a well-defined fate decision point from brainstem progenitors that can make two very different kinds of neurons. They already know the key TFs for selecting the neuronal type from genetic studies, so they focus their gene regulatory analysis squarely on the mechanisms that are immediately upstream and downstream of these key factors. The authors use a combination of single-cell and bulk sequencing data, prediction and validation, and computation.

      Weaknesses:

      The study generates a lot of data about transcription factor binding sites, both predicted and validated, but the data are substantially descriptive. It remains challenging to understand how the integration of all these different TFs works together to switch terminal programs on and off.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript the authors were providing a proof of concept that they can identify and mutate a cholesterol-binding site of a high-interest class B receptor, the GLP-1R, and functionally characterize the impact of this mutation on receptor behavior in the membrane and downstream signaling with the intent that similar methods can be useful to optimize small molecules that as ligands or allosteric modulators of GLP-1R can improve the therapeutic tools targeting this signaling system.

      Strengths:

      The majority of results on receptor behavior are elucidated in INS-1 cells expressing the wt or mutant GLP-1R, with one experiment translating the findings to primary mouse beta-cells. I think this paper lays a very strong foundation to characterize this mutation and does a good job discussing how complex cholesterol-receptor interactions can be (ie lower cholesterol binding to V229A GLP-1R, yet increased segregation to lipid rafts). Table 1 and Figure 9 are very beneficial to summarize the findings. The lower interaction with cholesterol and lower membrane diffusion in V229A GLP-1R resembles the reduced diffusion of wt GLP-1R with simv-induced cholesterol reductions, by presumably decreasing the cholesterol available to interact with wt GLP-1R. The effects of this mutation are not due to differences in Ex-4:recepotor affinity. I think this paper will be of interest to many physiologists who may not be familiar with many of the techniques used in this paper and the authors largely do a good job explaining the goals of using each method in the results section. While not necessary for this paper, a comparison of islet cholesterol content after this cholesterol diet vs the more typical 60% HFD used in obesity research would be beneficial for GLP-1 physiology research broadly to take these findings into consideration with model choice.

      Weaknesses:

      There are no obvious weaknesses in this manuscript and overall, I believe the authors achieved their aims and have demonstrated the importance of cholesterol interactions on GLP-1R functioning in beta-cells.

      Certainly many follow-up experiments are possible from these initial findings and of primary interest is how this mutation affects insulin homeostasis in vivo under different physiological conditions. One of the biggest pathologies in insulin homeostasis in obesity/t2d is an elevation of baseline insulin release (as modeled in Fig 1E) that renders the fold-change in glucose stimulated insulin levels lower and physiologically less effective. Future work by the authors may determine the effects of the GLP-1R V229A mutation on insulin secretion responses under diet-induced metabolic stress conditions. Furthermore, the authors may additionally investigate if V229A would have the same impact in a different cell type, especially in neurons, with implications in the regulation of satiation, gut motility, and especially nausea, which are of high translational interest.

      The comparison is drawn in the discussion between this mutation and ex4-phe1 to have biased agonism towards Gs over beta-arrestin signaling. Ex4-phe1 lowered pica behavior (a proxy for nausea) in the authors previously co-authored paper on ex4-phe1 (PMID 29686402) and drawing a parallel for this mutation or modification of cholesterol binding to potentially mitigate nausea is a novel direction.

    1. Reviewer #2 (Public review):

      Summary:

      In this work, Walker and collaborators study the evolution of hepatitis C virus (HCV) in a cohort of 14 subjects with recent HCV infections. They focus in particular on the interplay between HCV and the immune system, including the accumulation of mutations in CD8+ T cell epitopes to evade immunity. Using a computational method to estimate the fitness effects of HCV mutations, they find that intrinsic viral fitness declines as the virus mutates to escape T cell responses. In long-term infections, they found that viral fitness can rebound later in infection as HCV accumulates additional mutations.

      Strengths:

      This work is especially interesting for several reasons. Individuals who developed chronic infections were followed over fairly long times and, in most cases, samples of the viral population were obtained frequently. At the same time, the authors also measured CD8+ T cell and antibody responses to infection. The analysis of HCV evolution focused not only on variation within particular CD8+ T cell epitopes, but also the surrounding proteins. Overall, this work is notable for integrating information about HCV sequence evolution, host immune responses, and computational metrics of fitness and sequence variation. The evidence presented by the authors supports the main conclusions of the paper described above.

      Weaknesses:

      After revision, this paper has no outstanding weaknesses. Points where further investigation is needed have been clearly identified.

    1. Reviewer #2 (Public review):

      Summary

      The manuscript presents valuable findings, particularly in the crystal structure of the Sld3CBD-Cdc45 interaction and the identification of additional sequences involved in their binding. The modeling of the Sld7-Sld3CBD-CDC45 subcomplex is novel, and the results provide insights into potential conformational changes that occur upon interaction. Although the single-stranded DNA binding data from Sld3 of different species is a minor weakness, the experiments support a model in which the release of Sld3 from the complex may be promoted by its binding to origin single-stranded DNA exposed by the helicase.

      Strengths

      • The Sld3CBD-Cdc45 structure is a novel contribution, revealing critical residues involved in the interaction.<br /> • The model structures generated from the crystal data are well presented and provide valuable insights into the interaction sequences between Sld3 and Cdc45.<br /> • The experiments testing the requirements for interaction sequences are thorough and conducted well, with clear figures supporting the conclusions.<br /> • The conformational changes observed in Sld3 and Cdc45 upon binding are interesting and enhance our understanding of the interaction.<br /> • The modeling of the Sld7-Sld3CBD-CDC45 subcomplex is a new and valuable addition to the field.<br /> • The proposed model of Sld3 release from the complex through binding to single stranded DNA at the origin is intriguing.

      Weaknesses

      • The section on the binding of Sld3 complexes to origin single-stranded DNA is somewhat weakened by the use of Sld3 proteins from different species. The comparisons between Sld3-CBD, Sld3CBD-Cdc45, and Sld7-Sld3CBD-Cdc45 involve complexes from different species, limiting the comparisons' value.<br /> • Although the study reveals that Sld3 binds to different residues of Cdc45 than those previously shown to bind Mcm or GINS, the data in the paper do not shed any additional light on how GINS and Sld3 binding to Cdc45 or Mcms. would affect each other. Other previous research has suggested that the binding of GINS and Sld3 to Mcm or Cdc45 may be mutually exclusive. The authors acknowledge that a structural investigation of Sld3, Sld7, Cdc45, and MCM during the stage of GINS recruitment will be a significant goal for future research.

    1. Reviewer #2 (Public review):

      Summary:

      This work investigates the roles of TANGO2 orthologs in different model systems and suggests bioenergetic dysfunction and oxidative stress (and not heme metabolism) as crucial pathways in TANGO2 deficiency disorders (TDD). Specifically, studies in C. elegans showed that the lack of TANGO2 ortholog activity (i) does not provide a survival benefit upon toxic heme exposure; (ii) results in a series of defects related to energy levels (reduced pharyngeal pumping, lawn avoidance, poor motility, and low brood size); (iii) reduces the fluorescence of the heme analog ZnMP in the intestine. Furthermore, upon oxidative stress, one TANGO2 ortholog, hrg-9, is upregulated compared to control conditions. Additional studies on yeast and zebrafish models failed to replicate prior findings on heme distribution and muscle integrity.

      These findings have a clear therapeutic impact, as TDD currently has no cure but only symptom-managing treatments. Identifying the correct pathway to correct the disease is pivotal to finding a cure.

      Although compelling, the authors' primary claim is based on indirect evidence that only hints toward it. Unfortunately, I do not see any direct and convincing evidence linking TANGO2 orthologs to bioenergetic and oxidative stress pathways.

      Strengths:

      (1) The study refutes and extends previous findings, highlighting new aspects of TANGO2's roles in cell physiology.

      (2) The use of different model systems to address the main research questions is useful.

      (3) The results suggest a broader impact than previously described, somewhat supporting the novelty of the study.

      Weaknesses:

      (1) The manuscript is written mainly as a criticism of a previously published paper. Although reproducibility in science is an issue that needs to be acknowledged, a manuscript should focus on the new data and the experiments that can better prove and strengthen the new claims.

      (2) The current presentation of the logic of the study and its results does not help the authors deliver their message, although they possess great potential.

      (3) The study is missing experiments to link hrg-9 and hrg-10 more directly to bioenergetic and oxidative stress pathways.

    1. Reviewer #2 (Public review):

      Summary:

      The Activity-by-Contact (ABC) model is a relatively widespread model of enhancer-gene regulation. This model leverages CRISPRi data to predict whether a gene is regulated by a given enhancer. To make this possible, this model accounts for the activity of an enhancer and its contact frequency with a target promoter in order to produce an "ABC score". However, while quantitative in its ability to predict enhancer-promoter regulation, this model is mostly phenomenological and does not commit to specific molecular mechanisms.

      In this manuscript, the authors formalize the molecular and mathematical assumptions made by the ABC model. Specifically, they demonstrate a basic set of assumptions that can be made to arrive at the ABC model's mathematical structure. The resulting default model (basically, a null model) places particular emphasis on the requirement that gene activation and enhancer-gene communication must be independent and at a steady state. The authors leverage and extend a graph-based formalism they have previously spearheaded to show the generality of their conclusions with respect to different molecular realizations of the process by which enhancers interact with their promoters.

      Previously published works have found that specific models of how multiple enhancers communicate with the same gene can result in additive mRNA production rates. Here, the authors demonstrate that steady-state mRNA levels are additive regardless of the specific Markovian model for how any individual enhancer communicates with the gene, as long as the model follows the basic assumptions of their default model.

      By coarse-graining, both gene activation and enhancer-gene communication to simple two-state models, the authors then clearly demonstrate that the mathematical structure of the ABC model emerges. This mathematical structure implies that the ABC score summed over all the enhancers regulating a given gene must equal 1. However, experimental measurements show values ranging from 0 to 3. The authors show that, in order to explain these experimental deviations with respect to the theory, at least one of the assumptions of the default model must be broken. They demonstrate that either invoking enhancer cooperativity in mRNA production rates or breaking the assumption that individual enhancers communicate with the gene independently can explain existing experimental data.

      Strengths:

      By demonstrating that the mathematical structure of the ABC model emerges from a set of basic assumptions including the independence of gene activation and enhancer-gene communication, the authors succeeded in their aim to put the ABC model on a formal and molecular footing. Since some experimental results do not agree with the ABC model, the authors importantly demonstrated which assumptions of the model can be broken to explain such data. The theoretical work in this manuscript is written in a reasonably accessible manner that features how a graph theory-based approach to modeling biochemical networks can result in general statements about biological phenomena.

      Weaknesses:

      While the authors discuss a number of experimental techniques that can be used to test the validity of their model, a more specific discussion of proposed experiments could have strengthened the impact of the paper by providing explicit opportunities for dialogue with experimentalists.

    1. Reviewer #2 (Public review):

      Summary:

      This study profiles the genome-wide distribution of DNA methylation using methylation capture sequencing in four stages of male germ cells: Thy1+ (undifferentiated spermatogonia), Kit+ (differentiated spermatogonia), pachytene spermatocytes, and round spermatids. These analyses revealed site-specific loss of DNA methylation in pachytene cells compared with differentiating spermatogonia. Integrated analysis using published datasets indicates that hypomethylated sites correlate with nucleosome retention sites and bivalent histone methylation sites in sperm.

      Strengths:

      The methyl-seq approach provides a comprehensive profile of DNA methylation in male germ cells. The concept that DNA hypomethylation in meiotic cells precedes histone modification and histone retention in sperm is interesting.

      Weaknesses:

      (1) In the title, the word "presets" should be changed to "precedes" or "correlates with". Preset means a causal relationship, which is not the case. This needs to be changed throughout the manuscript. For example, in the abstract, "predetermine" needs to be changed to "precede".

      (2) The statement that "Based on these results, we propose that meiosis is a process of epigenetic reprogramming that sets up embryonic gene regulation" (lines 94-95) is a speculation that in the opinion of this reviewer should be removed from the text. It is too broad and not supported by the data presented.

      (3) Figure 1B: details are missing. How many cells were analyzed/used? How many times was this experiment done [(The number of experiments (n)]? Were the changes statistically significant (Lines 109-111)?

      (4) Figure 1A and Figure 1D: These seem to be contradictory. According to Figure 1D, leptotene/zygotene spermatocytes show bright 5mC staining. However, the diagram in 1A shows delayed recovery of DNA methylation. The authors should clarify this. It appears that 5mC was high in Kit+ spermatogonia and leptotene/zygotene spermatocytes, and then decreased in pachytene spermatocytes.

      (5) L121-122: Statement: These results suggest that 5mC levels change dynamically during spermatogenesis before and after the transient reduction of DNA methylation in the premeiotic S phase. In order to make this claim about the premeiotic S phase, I suggest performing 5mC staining in premeiotic S phase cells, which can be pulse-labelled with BrdU or cite a reference if available.

    1. Reviewer #2 (Public review):

      Summary:

      This important study by Turner et al. examines the functional role of a sparse but unique population of neurons in the cortex that express Nitric oxide synthase (Nos1). To do this, they pharmacologically ablate these neurons in the focal region of whisker-related primary somatosensory (S1) cortex using a saponin-substance P conjugate. Using widefield and 2-photon microscopy, as well as field recordings, they examine the impact of this cell-specific lesion on blood flow dynamics and neuronal population activity. Locally within the S1 cortex, they find changes in neural activity patterns, decreased delta band power, and reduced sensory-evoked changes in blood flow (specifically eliminating the sustained blood flow change after stimulation). Surprisingly, given the tiny fraction of cortical neurons removed by the lesion, they also find far-reaching effects on neural activity patterns and blood volume oscillations between the cerebral hemispheres.

      Strengths:

      This was a technically challenging study and the experiments were executed in an expert manner. The manuscript was well written and I appreciated the cartoon summary diagrams included in each figure. The analysis was rigorous and appropriate. Their discovery that Nos1 neurons can have far-reaching effects on blood flow dynamics and neural activity is quite novel and surprising (to me at least) and should seed many follow-up, mechanistic experiments to explain this phenomenon. The conclusions were justified by the convincing data presented.

      Weaknesses:

      I did not find any major flaws in the study. I have noted some potential issues with the authors' characterization of the lesion and its extent. The authors may want to re-analyse some of their data to further strengthen their conclusions. Lastly, some methodological information was missing, which should be addressed.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present an interesting paper where they test the antagonistic pleiotropy theory. Based on this theory they hypothesize that genetic variants associated with later onset of age at menarche and age at first birth may have a positive effect on a multitude of health outcomes later in life, such as epigenetic aging and prevalence of chronic diseases. Using a mendelian randomization and colocalization approach, the authors show that SNPs associated with later age at menarche are associated with delayed aging measurements, such as slower epigenetic aging and reduced facial aging and a lower risk of chronic diseases, such as type 2 diabetes and hypertension. Moreover, they identify 128 fertility-related SNPs that associate with age-related outcomes and they identified BMI as a mediating factor for disease risk, discussing this finding in the context of evolutionary theory.

      Strengths:

      The major strength of this manuscript is that it addresses the antagonistic pleiotropy theory in aging. Aging theories are not frequently empirically tested although this is highly necessary. The work is therefore relevant for the aging field as well as beyond this field, as the antagonistic pleiotropy theory addresses the link between fitness (early life health and reproduction) and aging.

      The authors addressed the remarks on the previous version very well. Addressing the two points below would further increase the quality of the manuscript.

      (1) In the previous version the authors mentioned that their results are also consistent with the disposable soma theory: "These results are also consistent with the disposable soma theory that suggests aging as an outcome tradeoff between an organism's investment in reproduction and somatic maintenance and repair."

      Although the antagonistic pleiotropy and disposable soma theories describe different mechanisms, both provide frameworks for understanding how genes linked to fertility influence health. The antagonistic pleiotropy theory posits that genes enhancing fertility early in life may have detrimental effects later. In contrast, the disposable soma theory suggests that energy allocation involves a trade-off, where investment in fertility comes at the expense of somatic maintenance, potentially leading to poorer health in later life.

      To strengthen the manuscript, a discussion section should be added to clarify the overlap and distinctions between these two evolutionary theories and suggest directions for future research in disentangling their specific mechanisms.

      (2) In response to the question why the authors did not include age at menopause in addition to the already included age at first child and age at menarche the following explanation was provided: "Our manuscript focuses on the antagonistic pleiotropy theory, which posits that inherent trade-off in natural selection, where genes beneficial for early survival and reproduction (like menarche and childbirth) may have costly consequences later. So, we only included age at menarche and age at first childbirth as exposures in our research."

      It remains, however, unclear why genes beneficial for early survival and reproduction would be reflected only in age at menarche and age at first childbirth, but not in age at menopause. While age at menarche marks the onset of fertility, age at menopause signifies its end. Since evolutionary selection acts directly until reproduction is no longer possible (though indirect evolutionary pressures persist beyond this point), the inclusion of additional fertility-related measures could have strengthened the analysis. A more detailed justification for focusing exclusively on age at menarche and first childbirth would enhance the clarity and rigor of the manuscript.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by Hathaway et al. describes a set of elegant behavioral experiments designed to understand which aspects of cue-reward contingencies drive risky choice behavior. The authors developed several clever variants of the well-established rodent gambling task (also developed by this group) to understand how audiovisual cues alter learning, choice behavior, and risk. Computational and sophisticated statistical approaches were used to provide evidence that: (1) audiovisual cues drive risky choice if they are paired with rewards and decrease risk if only paired with loss, (2) pairing cues with rewards reduces learning from punishment, and (3) differences in risk-taking seem to be present early on in training.

      Strengths:

      The paper is well-written, the experiments are well-designed, and the results are highly interesting, particularly for understanding how cues can motivate and invigorate normal and abnormal behavior.

      Weaknesses:

      Additional support and evidence are needed for the claims made by the authors. Some of the statements are inconsistent with the data and/or analyses or are only weakly supportive of the claims.

    1. Reviewer #2 (Public review):

      Summary:

      This work addresses the question of whether artificial deep neural network models of the brain could be improved by incorporating top-down feedback, inspired by the architecture of the neocortex.

      In line with known biological features of cortical top-down feedback, the authors model such feedback connections with both, a typical driving effect and a purely modulatory effect on the activation of units in the network.

      To assess the functional impact of these top-down connections, they compare different architectures of feedforward and feedback connections in a model that mimics the ventral visual and auditory pathways in the cortex on an audiovisual integration task.

      Notably, one architecture is inspired by human anatomical data, where higher visual and auditory layers possess modulatory top-down connections to all lower-level layers of the same modality, and visual areas provide feedforward input to auditory layers, whereas auditory areas provide modulatory feedback to visual areas.

      First, the authors find that this brain-like architecture imparts the models with a light visual bias similar to what is seen in human data, which is the opposite in a reversed architecture, where auditory areas provide a feedforward drive to the visual areas.

      Second, they find that, in their model, modulatory feedback should be complemented by a driving component to enable effective audiovisual integration, similar to what is observed in neural data.

      Last, they find that the brain-like architecture with modulatory feedback learns a bit faster in some audiovisual switching tasks compared to a feedforward-only model.

      Overall, the study shows some possible functional implications when adding feedback connections in a deep artificial neural network that mimics some functional aspects of visual perception in humans.

      Strengths:

      The study contains innovative ideas, such as incorporating an anatomically inspired architecture into a deep ANN, and comparing its impact on a relevant task to alternative architectures.

      Moreover, the simplicity of the model allows it to draw conclusions on how features of the architecture and functional aspects of the top-down feedback affect the performance of the network.

      This could be a helpful resource for future studies of the impact of top-down connections in deep artificial neural network models of the neocortex.

      Weaknesses:

      Overall, the study appears to be a bit premature, as several parts need to be worked out more to support the claims of the paper and to increase its impact.

      First, the functional implication of modulatory feedback is not really clear. The "only feedforward" model (is a drive-only model meant?) attains the same performance as the composite model (with modulatory feedback) on virtually all tasks tested, it just takes a bit longer to learn for some tasks, but then is also faster at others. It even reproduces the visual bias on the audiovisual switching task. Therefore, the claims "Altogether, our results demonstrate that the distinction between feedforward and feedback inputs has clear computational implications, and that ANN models of the brain should therefore consider top-down feedback as an important biological feature." and "More broadly, our work supports the conclusion that both the cellular neurophysiology and structure of feed-back inputs have critical functional implications that need to be considered by computational models of brain function" are not sufficiently supported by the results of the study. Moreover, the latter points would require showing that this model describes neural data better, e.g., by comparing representations in the model with and without top-down feedback to recorded neural activity.

      Second, the analyses are not supported by supplementary material, hence it is difficult to evaluate parts of the claims. For example, it would be helpful to investigate the impact of the process time after which the output is taken for evaluation of the model. This is especially important because in recurrent and feedback models the convergence should be checked, and if the network does not converge, then it should be discussed why at which point in time the network is evaluated.

      Third, the descriptions of the models in the methods are hard to understand, i.e., parameters are not described and equations are explained by referring to multiple other studies. Since the implications of the results heavily rely on the model, a more detailed description of the model seems necessary.

      Lastly, the discussion and testable predictions are not very well worked out and need more details. For example, the point "This represents another testable prediction flowing from our study, which could be studied in humans by examining the optical flow (Pines et al., 2023) between auditory and visual regions during an audiovisual task" needs to be made more precise to be useful as a prediction. What did the model predict in terms of "optic flow", how can modulatory from simple driving effect be distinguished, etc.

    1. Reviewer #2 (Public review):

      In this manuscript, the authors present an approach to correct GRIN lens aberrations, which primarily cause a decrease in signal-to-noise ratio (SNR), particularly in the lateral regions of the field-of-view (FOV), thereby limiting the usable FOV. The authors propose to mitigate these aberrations by designing and fabricating aspherical corrective lenses using ray trace simulations and two-photon lithography, respectively; the corrective lenses are then mounted on the back aperture of the GRIN lens.

      This approach was previously demonstrated by the same lab for GRIN lenses shorter than 4.1 mm (Antonini et al., eLife, 2020). In the current work, the authors extend their method to a new class of GRIN lenses with lengths exceeding 6 mm, enabling access to deeper brain regions as most ventral region of the mouse brain. Specifically, they designed and characterized corrective lenses for GRIN lenses measuring 6.4 mm and 8.8 mm in length. Finally, they applied these corrected long micro-endoscopes to perform high-precision calcium signal recordings in the olfactory cortex.

      Compared with alternative approaches using adaptive optics, the main strength of this method is that it does not require hardware or software modifications, nor does it limit the system's temporal resolution. The manuscript is well-written, the data are clearly presented, and the experiments convincingly demonstrate the advantages of the corrective lenses.

      The implementation of these long corrected micro-endoscopes, demonstrated here for deep imaging in the mouse olfactory bulb, will also enable deep imaging in larger mammals such as rats or marmosets.

      Comments on revisions:

      The authors have clearly addressed all my comments.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors aimed to explore the role of climbing fibers (CFs) in cerebellar learning, with a focus on optokinetic reflex (OKR) adaptation. Their goal was to understand how CF activity influences memory acquisition, memory consolidation, and memory retrieval by optogenetically suppressing CF inputs at various stages of the learning process.

      Strengths:

      The study addresses a significant question in the cerebellar field by focusing on the specific role of CFs in adaptive learning. The authors use optogenetic tools to manipulate CF activity. This provides a direct method to test the causal relationship between CF activity and learning outcomes.

      Weaknesses:

      Despite shedding light on the potential role of CFs in cerebellar learning, the study is hampered by significant methodological issues that question the validity of its conclusions. The absence of detailed evidence on the effectiveness of CF suppression and concerns over tissue damage from optogenetic stimulation weakens the argument that CFs are not essential for memory consolidation. These challenges make it difficult to confirm whether the study's objectives were fully met or if the findings conclusively support the authors' claims. The research commendably attempts to unravel the temporal involvement of CFs in learning but also underscores the difficulties in pinpointing specific neural mechanisms that underlie the phases of learning. Addressing these methodological issues, investigating other signals that might instruct consolidation, and understanding CFs' broader impact on various learning behaviors are crucial steps for future studies.

      [Editors' note: we have included the original concerns, which the Reviewing Editor agrees with. Methodological concerns remain after revisions.]

    1. Reviewer #2 (Public review):

      Summary:

      Nagarajan et al. investigate the role of the anterior cingulate cortex (ACC) in vocal development of infant marmoset monkeys using lesions in this brain area. Many previous studies show that ACC plays an important role in volitional and emotion-driven vocal behavior in mammals. The experiments Nagarajan et al. performed strengthen the long-standing hypothesis that ACC influences the development of social-vocal behavior in non-human primates. Furthermore, their anatomical studies support the idea of cortical structures exerting cognitive control over subcortical networks for innate vocalization, and thus, enabling mammals to perform flexible social-vocal communication.

      Strengths:

      Many invasive behavioral studies in monkeys often use 2-3 animals. The authors used a sufficiently high number of animals for their experiments. This increases the power of their conclusions.

      The study also investigates the impact of ACC lesions on downstream areas important for innate vocal production. This adds further evidence to the role of ACC on influencing these subcortical regions during vocal development and vocal behavior in general.

      Weaknesses:

      The study only provides data up to the 6th week after birth. Given the plasticity of the cortex, it would be interesting to see if these impairments in vocal behavior persist throughout adulthood or if the lesioned marmosets will recover their social-vocal behavior compared to the control animals. The authors give a reasonable explanation for why they did not provide this data.

      Even though this study focuses entirely on the development of social vocalizations, providing data about altered social non-vocal behaviors that accompany ACC lesions is missing. This data can provide further insights and generate new hypothesis about the exact role of ACC in social-vocal development. For example, do these marmosets behave differently towards their conspecifics or family members and vice versa, and is this an alternate cause for the observed changes in social-vocal development? Unfortunately, the authors are unable to provide that data. Hopefully, this will be the goal of future studies.

    1. Reviewer #2 (Public review):

      Summary:

      It is generally believed that higher-order areas in the prefrontal cortex guide selection during working memory and attention through signals that selectively recruiting neuronal populations in sensory areas that encode the relevant feature. In this work, Parto-Dezfouli and colleagues tested how these prefrontal signals influence activity in visual area V4 using a spatial working memory task. They recorded neuronal activity from visual area V4 and found that information about visual features at the behaviorally relevant part of space during the memory period is carried in a spatially selective manner in the timing of spikes relative to a beta oscillation (phase coding) rather than in the average firing rate (rate code). The authors further tested whether there is a causal link between prefrontal input and the phase encoding of visual information during the memory period. They found that indeed inactivation of the frontal eye fields, a prefrontal area known to send spatial signal to V4, decreased beta oscillatory activity in V4 and information about the visual features. The authors went one step further to develop a neural model that replicated the experimental findings and suggested that changes in the average firing rate of individual neurons might be a result of small changes in the exact beta oscillation frequency within V4. These data provide important new insights on the possible mechanisms through which top-down signals can influence activity in hierarchically lower sensory areas and can therefore have a significant impact on the Systems, Cognitive and Computational Neuroscience fields.

      Strengths:

      This is a well-written paper with a well-thought-out experimental design. The authors used a smart variation of the memory-guided saccade task to assess how information about the visual features of stimuli is encoded during the memory period. By using a grating of various contrasts and orientations as the background the authors ensured that bottom-up visual input would drive responses in visual area V4 in the delay period, something that is not commonly done in experimental settings in the same task. Moreover, one of the major strengths of the study is the use of different approaches including analysis of electrophysiological data using advanced computational methods of analysis, manipulation of activity through inactivation of prefrontal cortex to establish causality of top-down signals on local activity signatures (beta oscillations, spike locking and information carried) as well as computational neuronal modeling. This has helped extend an observation into a possible mechanism well supported by the results.

      Weaknesses:

      Although the authors provide support for their conclusions from different approaches, a few conceptual gaps make it harder for the reader to appreciate the mechanisms that lead to the observed results and evaluate whether and how these may apply to other cases of top-down control. The fact that the visual features under study were behaviorally irrelevant make it difficult to appreciate the relevance of the finding and its relation to top-down spatial attention mechanisms that involve similar/overlapping circuits. In the same vein, the use of the memory-guided saccade task has certain disadvantages in the context of this study. Although delay activity is interpreted as memory activity by the authors, it is in principle possible that it reflects preparation for the upcoming saccade, spatial attention (particularly since there is a stimulus in the RF) etc. This could potentially change the conclusion and perspective.

      Moreover, encoding of the two visual features that are manipulated in the context of the study (contrast and orientation) seems to be affected differently in certain cases, which leaves a reader wondering about the source of this variability.

      Finally, although the study provides evidence in favor of a role of FEF in influencing phase coding of visual features in V4 in beta frequencies, important analysis that could have revealed the long-range mechanisms of such an effect including the analysis of intra-FEF and interareal (FEF-V4) neuronal interactions is missing from this paper

    1. Reviewer #2 (Public review):

      Summary:

      While selective attention is a crucial ability of human beings, previous studies on selective attention are primarily conducted in a strictly controlled context, leaving a notable gap in underlying the complexity and dynamic nature of selective attention in a naturalistic context. This issue is particularly important for classroom learning in individuals with ADHD, as selecting the target and ignoring the distractions are pretty difficult for them but are the pre-requirement of effective learning. The authors of this study have addressed this challenge using a well-motivated study. I believe the findings of this study will be a nice addition to the fields both cognitive neuroscience and educational neuroscience.

      Strengths:

      To achieve the purpose of setting up a naturalistic context, the authors have based their study on a novel Virtual Reality platform. This is clever as it is usually difficult to perform such a study in the real classroom. Moreover, various techniques such as brain imaging, eye-tracking and physiological measurement are combined to collect multi-level data. They found that, different from the controls, individuals with ADHD had higher neural responses to the irrelevant rather than the target sounds, reduced speech tracking of the teacher. Additionally, the power of alpha-oscillations and frequency of gaze-shifts away from the teacher are found to be associated with the ADHD symptoms. These results provide new insights into the mechanism of selective attention among ADHD populations.

      Weaknesses:

      It is worth noting that nowadays there has been some studies trying to do so in the real classroom, and thus the authors should acknowledge the difference between the virtual and real classroom context and foresee the potential future changes.<br /> The approach of combining multi-level data owns advantage to obtain reliable results, but also raises significant difficult for the readers to understand the main results.

      - An appraisal of whether the authors achieved their aims, and whether the results support their conclusions.

      As expected, individuals with ADHD showed anomalous pattern of neural responses, and eye-tracking pattern, compared to the controls. But there are also some similarities between groups such as amount of time paying attention to teachers, etc. In general, their conclusions are supported.

      - A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community.

      The findings are an extension of previous efforts in understanding selective attention in the naturalistic context. The findings of this study are particularly helpful in inspiring teacher's practice and advancing the research of educational neuroscience. This study demonstrates, again, that it is important to understand the complexity of cognitive process in the naturalistic context.

      Comments on revisions:

      The authors have appropriately responded to my concerns. I do not have other comments. I do hope to see more data and results from the authors in future.

    1. Reviewer #2 (Public review):

      Summary:

      This study employed voltage imaging in the CA1 region of the mouse hippocampus during the exploration of a novel environment. The authors report synchronous activity, involving almost half of the imaged neurons, occurred during periods of immobility. These events did not correlate with SWRs, but instead, occurred during theta oscillations and were phased locked to the trough of theta. Moreover, pairs of neurons with high synchronization tended to display non-overlapping place fields, leading the authors to suggest these events may play a role in binding a distributed representation of the context.

      Strengths:

      Technically this is an impressive study, using an emerging approach that allows single cell resolution voltage imaging in animals, that while head-fixed, can move through a real environment. The paper is written clearly and suggests novel observations about population level activity in CA1.

      Comments on revisions:

      I have no further major requests and thank the authors for the additional data and analyses.

    1. Reviewer #2 (Public review):

      Summary:

      The basal ganglia is often understood within a reinforcement learning (RL) framework, where dopamine neurons convey a reward prediction error which modulates cortico-striatal connections onto spiny projection neurons (SPNS) in the striatum. However, current models of plasticity rules are inconsistent with learning in a reinforcement learning framework.

      This paper proposes a new model that describes how distinct learning rules in direct and indirect pathway striatal neurons allows them to implement reinforcement learning models. It proposes that two distinct component of striatal activity affect action selection and learning. They show that the proposed implementation allows learning in simple tasks and is consistent with experimental data from calcium imaging data in direct and indirect SPNs in freely moving mouse.

      Strengths:

      Despite the success of reward prediction errors at characterizing the responses of dopamine neurons as the temporal difference error within an RL framework, the implementation of RL algorithms in the rest of the basal ganglia has been unclear. A key missing aspect has been the lack of a RL implementation that is consistent with the distinction of direct- and indirect SPNs. This paper proposes a new model that is able to learn successfully in simple RL tasks and explains recent experimental results.

      The author shows that their proposed model, unlike previous implementations, this model can perform well in RL tasks. The new model allows them to make experimental predictions. They test some of these predictions and show that the dynamics of dSPNs and iSPNs correspond to model predictions.

      More generally, this new model can be used to understand striatal dynamics across direct and indirect SPNs in future experiments.

      Weaknesses:

      The authors could characterize better the reliability of their experimental predictions and the description of the parameters of some of the simulations

      The authors propose some ideas about how the specificity of the striatal efferent inputs but should highlight better that this is a key feature of the model whose anatomical implementation has yet to be resolved.

      Comments on revisions:

      I thank the authors for their response to public and private reviews and for the clarifications and changes to the manuscript which have strengthened it. I understand the inability to implement some of the proposed additional simulation due to authors having left academia and the request for a version of record.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Goyal et al demonstrate that the assembly of proteins with polyphosphate into either condensates or aggregates can reveal information on the initial protein ensemble. They show that, unlike DNA, polyphosphate is able to effectively discriminate against initial protein ensembles with different conformational heterogeneity, structure, and compactness. The authors further show that the protein native ensemble is vital on whether polyphosphate induces phase separation or aggregation, whereas DNA induces a similar outcome regardless of the initial protein ensemble. This work provides a way to improve our mechanistic understanding of how conformational transitions of proteins may regulate or drive LLPS condensate and aggregate assemblies within biological systems.

      Strengths:

      This is a thoroughly conducted study that provides an alternative route for inducing phase separation that is more informative on the initial protein ensemble involved. This is particularly useful and a complementary means to investigate the role played by protein dynamics and plasticity in phase transitions. The authors use an appropriate set of techniques to investigate unique phase transitions within proteins induced by polyphosphates. An alternative protein system is used to corroborate their findings that the unique assemblies induced by polyphosphates when compared to DNA are not restricted to a single system. The work here is well-documented, easy to interpret, and of relevance for the condensate community.

      Weaknesses:

      The major weakness of this manuscript is that it is unclear if the information on the initial protein conformational ensemble can be determined solely from the assembly and maturation behavior and the discrimination abilities of polyphosphates. In both systems studied (CytR and FruR), polyphosphate discriminates and results in unique assemblies and maturation behaviors based on the initial protein ensemble. However, it seems the assembly and maturation behavior are not a direct result of the degree of conformational dynamics and plasticity in the initial protein. In the case of CytR, the fully-folded system forms condensates that resolubilize, while the highly disordered state immediately aggregates. Whereas, in the case of FruR, the folded state induces spontaneous aggregation, and the more dynamic, molten globular, system results in short-lived condensates. These results seem to suggest the polyphosphates' ability to discriminate between the initial protein ensemble may not be able to reveal what that initial protein ensemble is unless it is already known.

    1. Reviewer #2 (Public review):

      Summary:

      The paper by Kim et al. investigates the potential of stimulating the dopaminergic A13 region to promote locomotor restoration in a Parkinson's mouse model. Using wild-type mice, 6-OHDA injection depletes dopaminergic neurons in the substantia nigra pars compacta, without impairing those of the A13 region and the ventral tegmentum area, as previously reported in humans. Moreover, photostimulation of presumably excitatory (CAMKIIa) neurons in the vicinity of the A13 region improves bradykinesia and akinetic symptoms after 6-OHDA injection. Whole-brain imaging with retrograde and anterograde tracers reveals that the A13 region undergoes substantial changes in the distribution of its afferents and projections after 6-OHDA injection, thus suggesting a remodeling of the A13 connectome. Whether this remodelling contributes to pro-locomotor effects of the photostimulation of the A13 region remains unknown as causality was not addressed.

      Strengths:

      Photostimulation of presumably excitatory (CAMKIIa) neurons in the vicinity of the A13 region promotes locomotion and locomotor recovery of wild-type mice 1 month after 6-OHDA injection in the medial forebrain bundle, thus identifying a new potential target for restoring motor functions in Parkinson's disease patients. The study also provides a description of the A13 region connectome pertaining to motor behaviors and how it changes after a dopaminergic lesion. Although there is no causal link between anatomical and behavioral data, it raises interesting questions for further studies.

      Weaknesses:

      Although CAMKIIa is a marker of presumably excitatory neurons and can be used as an alternative marker of dopaminergic neurons, some uncertainty remains regarding the phenotype of neurons underlying recovery of akinesia and improvement of bradykinesia.

      Figure 4 is improved, but the results from the correlation analyses remain difficult to interpret, as they may reflect changes in various impaired brain regions independently of the A13 region. While the analysis offers a snapshot of correlated changes within the connectome, it does not identify which specific cell or axonal populations are actually increasing or decreasing. Although functional MRI connectome analyses are well-established, anatomical data seem less suitable for this purpose. How can one interpret correlated changes in anatomical inputs or outputs between two distinct regions?

      Figure 5 is also improved, but there is room for further enhancement. As currently presented, it is difficult to distinguish the differences between the sham and 6-OHDA groups. The first column could compare afferents, while the second column could compare efferents. Given the small sample size, it would be more appropriate to present individual data rather than the mean and standard deviation.

      Appraisal and impact

      Although the behavioral experiments are convincing, the low number of animals in the anatomical studies is insufficient to make any relevant statistical conclusions due to extremely low statistical power.

    1. Reviewer #2 (Public review):

      I appreciate the author's responses to my original review. This is a comprehensive analysis of CAPE on C. difficile activity. It seems like this compound affects all aspects of C. difficile, which could make it effective during infection but also make it difficult to understand the mechanism. Even considering the authors responses, I think it is critical for the authors to work on the conclusions regarding the infection model. There is some protection from disease by CAPE but some parameters are not substantially changed. For instance, weight loss is not significantly different in the C. difficile only group versus the C. difficile + CAPE group. Histology analysis still shows a substantial amount of pathology in the C. difficile + CAPE group. This should be discussed more thoroughly using precise language.

    1. Reviewer #2 (Public review):

      Summary:

      Binge eating is often preceded by heightened negative affect, but the specific processes underlying this link are not well understood. The purpose of this manuscript was to examine whether affect state (neutral or negative mood) impacts food choice decision-making processes that may increase the likelihood of binge eating in individuals with bulimia nervosa (BN). The researchers used a randomized crossover design in women with BN (n=25) and controls (n=21), in which participants underwent a negative or neutral mood induction prior to completing a food-choice task. The researchers found that despite no differences in food choices in the negative and neutral conditions, women with BN demonstrated a stronger bias toward considering the 'tastiness' before the 'healthiness' of the food after the negative mood induction.

      Strengths:

      The topic is important and clinically relevant and methods are sound. The use of computational modeling to understand nuances in decision-making processes and how that might relate to eating disorder symptom severity is a strength of the study.

      Weaknesses:

      The sample size was relatively small and may have been underpowered to find differences in outcomes (i.e., food choice behaviors). Participants were all women with BN, which limits the generalizability of findings to the larger population of individuals who engage in binge eating. It is likely that the negative affect manipulation was weak and may not have been potent enough to change behavior. Moreover, it is unclear how long the negative affect persisted during the actual task. It is possible that any increases in negative affect would have dissipated by the time participants were engaged in the decision-making task.

    1. Reviewer #2 (Public review):

      Summary:

      The authors conducted a brain-wide survey of vasopressin and vasopressin receptor 1A gene expression in the mouse brain using a high-resolution in situ hybridization method called RNAscope. Overall, the findings are useful in identifying brain regions expressing Avpr1a transcript. The impact of findings is decreased by incomplete or inadequate data analysis due to limited description of Avpr1a mRNA distribution within brain regions and limited statistical inference. A comprehensive overview of Avpr1a expression in the mouse brain has the potential to be highly informative and impactful. The current manuscript used RNAscope (a proprietary method of in situ hybridization) to assess the transcript abundance of Avp (arginine vasopressin, a neuropeptide) and its receptor (Avpr1a). The style of graphs, limited use of photomicrographs, and low number of subjects all combine to limit the impact of the dataset. The finding of Avp-expressing cells outside of the hypothalamus and extended amygdala is poorly documented but would be novel. The Avpr1a data suggest expression in numerous brain regions. However, the data presented are difficult to interpret, with every value being an extremely small density value for a large swath of the brain. How many cells are impacted? Are puncta spread across many cells or only present in a few cells? Is density evenly distributed through a brain region or compacted into a subfield? For a descriptive study, there is minimal statistical inference and relatively little description. The authors make a case for the novel nature of the work but do not seem, at times, to recognize a robust literature developed over the last 50 years. In conclusion, the experimental data are important and informative; however, the low number of subjects, lack of statistical power, limited description of individual brain regions, and poor quality and design of data figures reduce the overall impact.

      Strengths:

      A survey of Avpr1a expression in the mouse brain is an important tool for exploring the function of vasopressin in the mammalian brain and developing hypotheses about cell - and circuit-level function.

      Weaknesses:

      (1) The style and type of data presentation, focusing on the density of individual mRNA transcript across a whole brain region, seemed incomplete in so far as the data presentation did not provide a clear visualization of the distribution of Avpr1a-expressing cells or transcript itself. However, knowing which brain regions do express transcript is itself informative.

      (2) The manuscript strongly emphases on the possibility of sex differences in Avp and Avpr1a expression. However, the low number of animals used does not provide adequate statistical power to make strong inferences regarding sex differences in the data.

      (3) The manuscript's methods are minimal but adequate to understand data acquisition. The description of how quantitative analyses were conducted is inadequate and would be impossible to replicate beyond identifying the program used.

    1. Reviewer #2 (Public review):

      Summary:

      The authors perform a series of studies to follow up on their previous work, which established a role for dorsal raphe dopamine neurons (DRN) in the regulation of social-isolation-induced rebound in mice. In the present study, Lee et. al, use a combination of modern circuit tools to investigate putatively distinct roles of DRN dopamine transporting containing (DAT) projections to the bed nucleus of the stria terminalis (BNST), central amygdala (CeA), and posterior basolateral amygdala (BLP). Notably, they reveal that optogenetic stimulation of distinct pathways confers specific behavioral states, with DRNDAT-BLP driving aversion, DRNDAT-BNST regulating non-social exploratory behavior, and DRNDAT-CeA promoting social ability. A combination of electrophysiological studies and in situ hybridization studies reveal heterogenous dopamine and neuropeptide expression and different firing properties, providing further evidence of pathway-specific neural properties. Lastly, the authors combine optogenetics and calcium imaging to resolve social encoding properties in the DRNDAT-CeA pathway, which correlates observed social behavior to socially engaged neural ensembles.

      Collectively, these studies provide an interesting way of dissecting out separable features of a complex multifaceted social-emotional state that accompanies social isolation and the perception of 'loneliness.' The main conclusions of the paper provide an important and interesting set of findings that increase our understanding of these distinct DRN projections and their role in a range of social (e.g., prosocial, dominance), non-social, and emotional behaviors. However, as noted below, the examination of these circuits within a homeostatic framework is limited given that a number of the datasets did not include an isolated condition. The DRNDAT-CeA pathway was investigated with respect to social homeostatic states in the present study for some of the datasets.

      Strengths:

      (1) The authors perform a comprehensive and elegant dissection of the anatomical, behavioral, molecular, and physiological properties of distinct DRN projections relevant to social, non-social, and emotional behavior, to address multifaceted and complex features of social state.

      (2) This work builds on prior findings of isolation-induced changes in DRN neurons and provides a working framework for broader circuit elements that can be addressed across the social homeostatic state.

      (3) This work characterizes a broader circuit implicated in social isolation and provides a number of downstream targets to explore, setting a nice foundation for future investigation.

      (4) The studies account for social rank and anxiety-like behavior in several of the datasets, which are an important consideration to the interpretation of social motivation states, especially in male mice with respect to dominance behavior.

      Weaknesses:

      (1) The conceptual framework of the study is based on the premise of social isolation and perceived 'loneliness' under the framework of social homeostasis, analogous to hunger. In this framework, social isolation should provoke an aversive state and compensatory social contact behavior. In the authors' prior work, they demonstrate synaptic changes in DRN neurons and social rebound following acute social isolation. Thus, the prediction would be that downstream projections also would show state-dependent changes as a function of social housing conditions (e.g., grouped vs. isolated). In the current paper, a social isolation condition was not included for the majority of the studies conducted (e.g., Figures 1-6 do not include an isolated condition, Figures 7-8 do include an isolated condition). Thus, while Figure 1-6 adds a very interesting and compelling set of data that is of high value to the social behavior field with respect to social and emotional processing and general circuit characterization, these studies do not directly investigate the impacts of dynamic social homeostatic state. The main claim of the paper, including the title (e.g., separable DRN projections mediate facets of loneliness-like state), abstract, intro, and discussion presents the claim of this work under the framework of dynamic social homeostatic states, which should be interpreted with caution, as the majority of the work in the paper did not include a social isolation comparison.

      (2) In Figure 1, the authors confirm co-laterals in the BNST and CeA via anatomical tracing studies. The goal of the optogenetic studies is to dissociate the functional/behavioral roles of distinct projections. However, one limitation of optogenetic projection targeting is the possibility of back-propagating action potentials (stimulation of terminals in one region may back-propagate to activate cell bodies, and then afferent projections to other regions), and/or stimulation of fibers of passage. Therefore, one limitation in the dataset for the optogenetic stimulation studies is the possibility of non-specific unintended activation of projections other than those intended (e.g., DRNDAT-CeA). This can be dealt with by administering lidocaine to prevent back-propagating action potentials.

      (3) It is unclear from the test, but in the subjects' section of the methods, it appears that only male animals were included in the study, with no mention of female subjects. It should be clear to the reader that this was conducted in males only if that is the case, with consideration or discussion, about female subjects and sex as a biological variable.

      (4) Averaged data are generally reported throughout the study in the form of bar graphs, across most figures. Individual data points would increase the transparency of the data.

    1. Reviewer #2 (Public review):

      The authors tested tactile acuity on the breast of females using several tasks and reported overall low acuity compared to the back, which is typically considered to have the worst acuity of all body parts. Moreover, there was evidence that acuity is worse the larger the breast; this finding mirrors similar findings for the hand and therefore suggests that the number of tactile sensors is fixed and must be distributed across a larger extent of skin when a body part is larger, thus resulting in comparably lower tactile acuity.

      Strengths:

      I find this an interesting paper with results that are relevant to the tactile community. The authors apply several tasks allowing them to link the paper with previous results. The methodology and psychophysical analysis are sound.

      Weaknesses:

      The analysis of localization error direction, with the result that the nipple area may be a landmark for tactile localization, is interesting and aligns the paper with some other recent papers that have suggested that such landmarks should exist. However, there are major issues with methodology and statistics, so that currently the conclusions are not supported.

      In the following, line numbers refer to the re-formatted manuscript provided by the authors upon request and are mentioned for them to find the relevant passages faster.

      (1) Comments on analysis of tactile acuity:

      - I had a hard time understanding some parts of the report. What is meant by "broadly no relationship" in line 137?

      - It is suggested that spatial expansion (which is correlated with body part size) is related between medial breast and hand - is this to say that women with large hands have large medial breast size? Nipple size was measured, but hand size was not measured, is this correct?

      - It is furthermore unclear how the authors differentiate medial breast and NAC. The sentence in lines 140-141 seems to imply the two terms are considered the same, as a conclusion about NAC is drawn from a result about the medial breast. This requires clarification.

      - Finally, given that the authors suspect that overall localization ability (or attention) may be overshadowed by a size effect, would not an analysis be adequate that integrates both, e.g. a regression with multiple predictors?

      (2) Comments on analysis of "The nipple is a unit":

      - Statistics in this section are not adequately described and may be partly false.

      - In the paragraph about testing quadrants of the nipple, it is stated that only 3 of 10 participants barely outperformed chance with a p < 0.01. It is unclear how a significant t-test is an indication of "barely above chance".

      - The final part of the paragraph on nipple quadrants (starting line 176) explains that there was a trend (4 of 10 participants) for lower tactile acuity being related to the inability to differentiate quadrants. It seems to me that such a result would not be expected: The stated hypothesis is that all participants have the same number of tactile sensors in their nipple and areola, independent of NAC size. In this section, participants determine the quadrant of a single touch. Theoretically, all participants should be equally able to perform this task, because they all have the same number of receptors in each quadrant of nipple and areola. Thus, the result in Figure 2C is curious.

      (3) Comments on analysis of "Absolute localization on the breast is anchored to the nipple"

      - Again, there are things that are unclear with the statistics and description of the analysis.

      - This section reports an Anova (line 193/194) with a factor "participant". This doesn't appear sensible. Please clarify. The factor distance is also unclear; is this a categorical or a continuous variable? Line 400 implies a 6-level factor, but Anovas and their factors, respectively, are not described in methods (nor are any of the other statistical approaches).

      - The analysis on imprecision using mean pairwise error (line 199) is unclear: does pairwise refer to x/y or to touch vs. center of the nipple?

      - p8, upper text, what is meant by "relative over-representation of the depth axis"? Does this refer to the breast having depth but the equivalent area on the back not having depth? What are the horizontal planes (probably meant to be singular?) - do you simply mean that depth was ignored for the calculation of errors? This seems to be implied in Figure 3AB.

      - Lines 232-241, I cannot follow the conclusions drawn here. First, it is not clear to a reader what the aim of the presented analyses is: what are you looking for when you analyze the vectors? Second, "vector strength" should be briefly explained in the main text. Third, it is not clear how the final conclusion is drawn. If there is a bias of all locations towards the nipple, then a point closer to the nipple cannot exhibit a large bias, because the nipple is close-by. Therefore, one would expect that points close to the nipple exhibit smaller errors, but this would not imply higher acuity - just less space for localizing anything. The higher acuity conclusion is at odds with the remaining results, isn't it: acuity is low on the outer breast, but even lower at the NAC, so why would it be high in between the two?

      (4) Comments on the Discussion:

      The discussion makes some concrete suggestions for sensors in implants (line 283). It is not clear how the stated numbers were computed. Also, why should 4 sensors nipple quadrants receive individual sensors if the result here was that participants cannot distinguish these quadrants?

      Additional comments:

      I would find it interesting to know whether participants with small breast measurement delta had breast acuity comparable to the back. Alternatively, it would be interesting to know whether breast and back acuity are comparable in men. Such a result would imply that the torso has uniform acuity overall, but any spatial extension of the breast is unaccounted for. The lowest single participant data points in Figure 1B appear similar, which might support this idea.

    1. Reviewer #2 (Public review):

      Summary:

      The author presents a transport-based morphometry (TBM) approach for the discovery of non-contrast computed tomography (NCCT) markers of hematoma expansion risk in spontaneous intracerebral hemorrhage (ICH) patients. The findings demonstrate that TBM can quantify hematoma morphological features and outperforms existing clinical scoring systems in predicting 24-hour hematoma expansion. In addition, the inversion model can visualize features, which makes it interpretable. In conclusion, this research has clinical potential for ICH risk stratification, improving the precision of early interventions.

      Strengths:

      TBM quantifies hematoma morphological changes using the Wasserstein distance, which has a well-defined physical meaning. It identifies features that are difficult to detect through conventional visual inspection (such as peripheral density distribution and density heterogeneity), which provides evidence supporting the "avalanche effect" hypothesis in hematoma expansion pathophysiology.

      Weaknesses:

      (1) As a methodology-focused study, the description of the methods section somewhat lacks depth and focus, which may make it challenging for readers to fully grasp the overall structure and workflow of the approach. For instance, the manuscript lacks a systematic overview of the entire process, from NCCT image input to the final prediction output. A potential improvement would be to include a workflow figure at the beginning of the manuscript, summarizing the proposed method and subsequent analytical procedures. This would help readers better understand the mechanism of the model.

      (2) The description of the comparison algorithms could be more detailed. Since TBM directly utilizes NCCT images as input for prediction, while SVM and K-means are not inherently designed to process raw imaging data, it would be beneficial to clarify which specific features or input data were used for these comparison models. This would better highlight the effectiveness and advantages of the TBM method.

      (3) The relatively small training and testing dataset may limit the model's performance and generalizability. Notably, while the study mentions that 1,066 patients from the ERICH dataset met the inclusion criteria, only 170 were randomly selected for the test set. Leveraging the full 1,066 ERICH cases for model training and internal validation might potentially enhance the model's robustness and performance.

      (4) Some minor textual issues need to be checked and corrected, such as line 16 in the abstract "Incorporating these traits into a v achieved an AUROC of 0.71 ...".

      (5) Some figures need to be reformatted (e.g., the x-axis in Figure 2 a is blocked).

    1. Reviewer #2 (Public review):

      Summary:

      The paper describes an effort to identify the factors responsible for intron retention and alternate exon splicing in a complex system known to be regulated by the O-GlcNAc cycling system. The CRISPR/Cas9 system was used to identify potential factors. The bioinformatic analysis is sophisticated and compelling. The conclusions are of general interest and advance the field significantly.

      Strengths:

      - Exhaustive analysis of potential splicing factors in an unbiased screen.<br /> - Extensive genome wide bioinformatic analysis.<br /> - Thoughtful discussion and literature survey

      Weaknesses:

      - No firm evidence linking SFSWA to an O-GlcNAc specific mechanism.<br /> - Resulting model leaves many unanswered questions.

      Comments on revisions:

      I think the authors have adequately dealt with the overall reviewer's comments.

    1. Reviewer #2 (Public review):

      Summary:

      ACVR2A is one of a handful of genes for which significant correlations between associated SNPs and the incidences of preeclampsia have been found in multiple populations. It is one of the TGFB family receptors, and multiple ligands of ACVR2A, as well as its coreceptors and related inhibitors, have been implicated in placental development, trophoblast invasion, and embryo implantation. This useful study builds on this knowledge by showing that ACVR2A knockout in trophoblast-related cell lines reduces trophoblast invasion, which could tie together many of these observations. The implication of cross-talk between the WNT and ACRV2A/SMAD2 pathways is an important contribution to the understanding of the regulation of trophoblast function.

      Strengths:

      (1) ACVR2A is one of very few genes implicated in preeclampsia in multiple human populations, yet its role in pathogenesis is not very well studied and this study begins to address that hole in our knowledge.

      (2) ACVR2A is also indirectly implicated in trophoblast invasion and trophoblast development via its connections to many ligands, inhibitors, and coreceptors, suggesting its potential importance.

      (3) The authors have used multiple cell lines to verify their most important observations.

      Editors' note: Following the first round of peer review, the original reviewers were not available to review the revised manuscript. As several specific weakness detailed by the reviewers were largely addressed in the revised manuscript, they are not included here.

    1. Reviewer #2 (Public review):

      The authors of this article investigated the impact of the host enzyme AOAH on the progression of MASLD in mice. To achieve this, they utilized whole-body Aoah-/- mice. The authors demonstrated that AOAH reduced LPS-induced lipid accumulation in the liver, probably by decreasing the expression and activation of SREBP1. In addition, AOAH reduced hepatic inflammation and minimized tissue damage.

      The authors have effectively addressed some key questions I raised. However, I still have some lingering concerns regarding the mechanisms underlying AOAH's effects.

      (1) AOAH is expressed in the intestine, where it may inactivate LPS before it enters systemic circulation. In Fig. 3F, fecal LPS is significantly higher in Aoah⁻/⁻ mice compared to Aoah⁺/⁺ mice, indicating that AOAH in the intestine reduces bioactive LPS levels at the source. This implies that differences in hepatic LPS levels are already influenced by the gut environment, raising doubts about how much Kupffer cells contribute to inactivating LPS in the liver.

      (2) The reliance on Kupffer cell depletion with clodronate-liposomes may overestimate the role of Kupffer cells because clodronate does not exclusively target hepatic Kupffer cells. Clodronate liposomes are taken up by macrophages systemically, potentially depleting macrophages in other organs, including the intestine and circulation. This means observed effects could also be due to loss of AOAH activity in non-hepatic macrophages.

    1. Reviewer #2 (Public review):

      Summary:

      This paper provides a valuable addendum to the findings described in Hamilton et al. 2020 (https://doi.org/10.7554/eLife.56582). In the earlier paper, the authors reconstituted the budding yeast centromeric nucleosome together with parts of the budding yeast kinetochore and tested which elements are required and sufficient for force transmission from microtubules to the nucleosome. Although budding yeast centromeres are defined by specific DNA sequences, this earlier paper did not use centromeric DNA but instead the generic Widom 601 DNA. The reason is that it has so far been impossible to stably reconstitute a budding yeast centromeric nucleosome using centromeric DNA.

      In this new study, the authors now report that they were able to replace part of the Widom 601 DNA with centromeric DNA from chromosome 3. This makes the assay more closely resemble the in vivo situation. Interestingly, the presence of the centromeric DNA fragment makes one type of minimal kinetochore assembly, but not the other, withstand stronger forces.

      Which kinetochore assembly turned out to be affected was somewhat unexpected, and can currently not be reconciled with structural knowledge of the budding yeast centromere/kinetochore. This highlights that, despite recent advances (e.g. Guan et al., 2021; Dendooven et al., 2023), aspects of budding yeast kinetochore architecture and function remain to be understood and that it will be important to dissect the contributions of the centromeric DNA sequence.

      In the future, it will be interesting to pinpoint which interactions contribute to the enhanced force resistance in the presence of centromeric DNA.

      Strength:

      - The paper demonstrates that centromeric DNA can increase the attachment strength between budding yeast microtubules and centromeric nucleosomes.

      Weakness:

      - How centromeric DNA exerts this effect remains unclear.

      Comments on revisions:

      I appreciate the authors' detailed response and their decision to list all the tested in chimeras in Table 3.

      All my prior comments have been addressed.

    1. Reviewer #2 (Public review):

      The Gram-positive cell wall contains for a large part of TAs, and is essential for most bacteria. However, TA biosynthesis and regulation is highly understudied because of the difficulties in working with these molecules. This study closes some of our important knowledge gaps related to this and provides new and improved methods to study TAs. It also shows an interesting role for TAs in maintaining a 'periplasmic space' in Gram positives. Overall, this is an important piece of work. Future work will need to address the possible causal link between TAs and periplasmic space, for instance using complemented mutants and CEMOVIS. It will be interesting to see what happens with the periplasmic space in other mutants besides TA or also in strains with capsules/without capsules and in PG mutants, or in lafB (essential for production of another glycolipid) mutants. Overall, I support the publication of this revised work as it pioneers some new methods that will definitively move the field forward.

    1. Reviewer #2 (Public review):

      Summary

      In this paper, the function of trpγ in lipid metabolism was investigated. The authors found that lipid accumulation levels were increased in trpγ mutants and remained high during starvation; the increased TAG levels in trpγ mutants were restored by the expression of active AMPK in DH44 neurons and oral administration of the anti-diabetic drug metformin. Furthermore, oral administration of lipase, TAG and free fatty acids effectively restored survival of trpγ mutants under starvation conditions. These results indicate that TRPv plays an important role in the maintenance of systemic lipid levels through the proper expression of lipase. Furthermore, authors have shown that this function is mediated by DH44R2. This study provides an interesting finding in that the neuropeptide DH44 released from the brain regulates lipid metabolism through a brain-gut axis, acting on the receptor DH44R2 expressed in gut cells.

      Strengths

      Using Drosophila genetics, careful analysis of which cells express trpγ regulates lipid metabolism is performed in this study. The study supports its conclusions from various angles, including not only TAG levels, but also fat droplet staining and survival rate under starved conditions, and oral administration of substances involved in lipid metabolism.

      Weaknesses

      The function of lipases, as well as identification of cell types, in the DH44R2-expressing cells in the gut can be investigated.

    1. Reviewer #2 (Public review):

      The authors developed an algorithm that allows to deconvolute plasmid sequences from a mixture of plasmids that have been sequenced by nanopore long read technology. As library preparations and barcoding of individual samples increases sequencing costs, the algorithm bypasses this need and thus decreases time on sample prep and sequencing costs. In a first step, the tool assesses which of the plasmid constructions can be mixed in a single library preparation by calculating a distance matrix between the reference plasmid and the constructions producing sequence clusters. The user is given groups of plasmids, from different clusters, to be pooled together for sequencing. After sequencing, the algorithm deconvolutes the reads by classifying them based on alignments to the reference sequence. A Bayesian analysis approach is used to obtain a consensus sequence and quality scores.

      Strengths

      The authors exploit one of the main advantages of long read sequencing that is to accurately resolve regions of high complexity, as regularly found in plasmids, and developed a tool that can validate plasmid constructions by reducing sequencing costs. Multiple plasmids (up to six) can be analyzed simultaneously in a single library without the need of sample barcoding, also reducing sample preparation time. Although inserts must be different, just 2 bases difference would be enough for correct assignation. Maximizes cost-efficiency for projects that require large amounts of plasmid constructions and high-throughput validation. The algorithm also allows for linear DNA analysis offering extra flexibility.

    1. Reviewer #3 (Public review):

      Summary:

      The authors sought to understand the molecular mechanisms that cells use to survive cold temperatures by studying gene expression regulation in response to cold in C. elegans. They determined whether gene expression changes during cold adaptation occur primarily at the transcriptional level and identified specific pathways, such as the unfolded protein response pathway, that are activated to possibly promote survival under cold conditions.

      Strengths:

      Effective use of bulk RNA sequencing (RNA-seq) to measure transcript abundance and ribosome profiling (ribo-seq) to assess translation rates, providing a comprehensive view of gene expression regulation during cold adaptation. This combined approach allows for correlation between mRNA levels and their translation, thereby offering evidence for the authors' conclusion that transcriptional regulation is the primary mechanism of cold-specific gene expression changes.

      Weaknesses:

      Many aspects of the weakness have been addressed by the revision. Still, the weak cold sensitivity phenotype observed in ire-1 mutants suggests the ER-UPR pathway's role is likely minor, modulatory or there is an unknown compensatory mechanism responsible for surviving cold.

    1. Reviewer #2 (Public Review):

      In this manuscript, Hsu et al. used scRNA-seq to profile germ cells isolated from zebrafish ovaries. They identified the transcriptional profile of germ cells representing the early stages of oogenesis, from germline stem cells to newly formed follicle stage oocytes. They identified foxl2l as a gene expressed in probable oocyte progenitor cells, one of the least understood germ cell stages in the ovary. To understand to role of Foxl2l in oogenesis, they produced loss-of-function mutations in foxl2l using CRISPR/Cas9. They found that all foxl2l mutants are males as adults, suggesting that Foxl2l is required for oogenesis. To gain more insights, they performed scRNA-seq on cells isolated from 28 dpf foxl2l mutant ovaries and found that in the absence of foxl2l, germ cells appear to arrest as early progenitors. These results argue that Foxl2l, like its medaka homolog Foxl3, is necessary for promoting oocyte vs. spermatocyte differentiation during the oocyte progenitor stage.

    1. Reviewer #2 (Public review):

      Summary:

      In Cholesterol Taste Avoidance in Drosophila melanogaster, Pradhan et al. used behavioral and electrophysiological assays to demonstrate that flies can: (1) detect cholesterol through a subset of bitter-sensing gustatory receptor neurons (GRNs) and (2) avoid consuming food with high cholesterol levels. Mechanistically, they identified five members of the IR family as necessary for cholesterol detection in GRNs and for the corresponding avoidance behavior. Ectopic expression experiments further suggested that Ir7g + Ir56d or Ir51b + Ir56d may function as tuning receptors for cholesterol detection, together with the Ir25a and Ir76b co-receptors.

      Strengths:

      The experimental design of this study was logical and straightforward. Leveraging their expertise in the Drosophila taste system, the research team identified the molecular and cellular basis of a previously unrecognized taste category, expanding our understanding of gustation. A key strength of the study was its combination of electrophysiological recordings with behavioral genetic experiments.

      Weaknesses:

      My primary concern with this study is the lack of a systematic survey of the IRs of interest in the labellum GRNs. Consequently, there is no direct evidence linking the expression of putative cholesterol IRs to the B GRNs in the S6 and S7 sensilla.

      Specifically, the authors need to demonstrate that the IR expression pattern explains cholesterol sensitivity in the B GRNs of S6 and S7 sensilla, but not in other sensilla. Instead of providing direct IR expression data for all candidate IRs (as shown for Ir56d in Figure 2-figure supplement 1F), the authors rely on citations from several studies (Lee, Poudel et al. 2018; Dhakal, Sang et al. 2021; Pradhan, Shrestha et al. 2024) to support their claim that Ir7g, Ir25a, Ir51b, and Ir76b are expressed in B GRNs (Lines 192-194). However, none of these studies provide GAL4 expression or in situ hybridization data to substantiate this claim.

      Without a comprehensive IR expression profile for GRNs across all taste sensilla, it is difficult to interpret the ectopic expression results observed in the B GRN of the I9 sensillum or the A GRN of the L-sensillum (Figure 4). It remains equally plausible that other tuning IRs-beyond the co-receptor Ir25a and Ir76b-could interact with the ectopically expressed IRs to confer cholesterol sensitivity, rather than the proposed Ir7g + Ir56d or Ir51b + Ir56d combinations.

    1. Reviewer #2 (Public review):

      This study examined the role of CRF neurons in the BNST in both phasic and sustained fear in males and females. The authors first established a differential fear paradigm whereby shocks were consistently paired with tones (Full) or only paired with tones 50% of the time (Part), or controls who were exposed to only tones with no shocks. Recall tests established that both Full and Part conditioned male and female mice froze to the tones, with no difference between the paradigms. Additional studies using the NSF and startle test, established that neither fear paradigm produced behavioral changes in the NSF test, suggesting that these fear paradigms do not result in an increase in anxiety-like behavior. Part fear conditioning, but not Full, did enhance startle responses in males but not females, suggesting that this fear paradigm did produce sustained increases in hypervigilance in males exclusively. Photometry studies found that while undifferentiated BNST neurons all responded to shock itself, only Full conditioning in males lead to a progressive enhancement of the magnitude of this response. BNST neurons in males, but not females, were also responsive to tone onset in both fear paradigms, but only in Full fear did the magnitude of this response increase across training. Knockdown of CRF from the BNST had no effect on fear learning in males or females, nor any effect in males on fear recall in either paradigm, but in females enhanced both baseline and tone-induced freezing only in Part fear group. When looking at anxiety following fear training, it was found in males that CRF knockdown modulated anxiety in Part fear trained animals and amplified startle in Full trained males but had no effect in either test in females. Using 1P imaging, it was found that CRF neurons in the BNST generally decline in activity across both conditioning and recall trials, with some subtle sex differences emerging in the Part fear trained animals in that in females BNST CRF neurons were inhibited after both shock and omission trials but in males this only occurred after shock and not omission trials. In recall trials, CRF BNST neuron activity remained higher in Part conditioned mice relative to Full conditioned mice.

      Overall, this is a very detailed and complex study that incorporates both differing fear training paradigms and males and females, as well as a suite of both state-of-the-art imaging techniques and gene knockdown approaches to isolate the role and contributions of CRF neurons in the BNST to these behavioral phenomena. The strengths of this study come from the thorough approach that the authors have taken, which in turn helped to elucidate nuanced and sex specific roles of these neurons in the BNST to differing aspects of phasic and sustained fear. More so, the methods employed provide a strong degree of cellular resolution for CRF neurons in the BNST. In general, the conclusions appropriately follow the data, although the authors do tend to minimize some of the inconsistencies across studies, although this has now been addressed to some degree. The discussion has also been improved to now address some of the inconsistencies in the data head on. Discussion of a few other points is below:

      - Given the focus on CRF neurons in the BNST, it was unclear why the photometry studies were performed in undifferentiated BNST neurons as opposed to CRF neurons specifically, although the authors have now explained this in better depth making this clearer to the reader.

      - The CRF KD studies are interesting, but it remains speculative as to whether these effects are mediated locally in the BNST or due to CRF signaling at downstream targets. As the literature on local pharmacological manipulation of CRF signaling within the BNST seems to be largely performed in males, the addition of pharmacological studies here would benefit this to help to resolve if these changes are indeed mediated by local impairments in CRF release within the BNST or not. While it is not essential to add these experiments, the authors have addressed this point in the discussion and highlighted studies like this as necessary in future work.

      - The authors have addressed the difference between arousal and anxiety by expanding the discussion to include more focus on the behavioral measures. The CRF KD data are still somewhat confusing but better contextualized now. Overall, the manuscript has been improved by the revisions and edits the authors have made.

    1. Reviewer #2 (Public review):

      Strengths:

      The authors have done a nice job providing additional data in response to reviewer feedback. I appreciate that accuracy plots are now included, as well as a separate analysis where differences in parameter estimates are performed for participants whose accuracy data were above chance levels. I also appreciate the new figure with the sphere ROIs for each participant, as they help us appreciate anatomical variability in the peak response separately for each task.

      I have four concerns related to the weaknesses of the study:

      (1) Although the results still hold when removing participants whose accuracy was 50% or less, a major limitation of this study is that participants made a button press response only to the last trial in a block. This is problematic because a participant could get all trials in a block correct except for the last one, or a participant could get all trials in a block wrong, and performance would be considered equivalent-as a consequence, it is not possible for one to know if participants who are at chance are performing differently from participants who are not at chance, and it is not possible to control for variance in reaction time (a concern also raised by reviewer 3).

      (2) My second concern relates to the way in which the data are interpreted based on thresholding. There is above-threshold activation in the left SMG for all tasks except the fluid cognition task. The z-scores associated with significant voxels in Figure 3 are very strong (minimum z is 6). If one were to relax the threshold of the group level maps to, e.g., p < .001, uncorrected, FDR q < .05, or FWER of .10, there will be overlapping voxels outside the SMG. The discussion of the left SMG in the manuscript is prominent and narrowly construed-the left SMG is discussed as if it were 'the' region: "This confirms that the technical-reasoning network depends upon the recruitment of the left area PF, even if additional cognitive processes involving other peripheral brain areas can be engaged depending on the task" (pp. 9). My intuition is there will be numerous other areas of overlap when using a threshold that is still highly significant (e.g., z = 3 or 4). So, for proponents of the technical reasoning hypothesis, is there a counterfactual or alternative brain area/network/system not in the left SMG?

      (3) I like the new Figure 6 because it shows variability in the location of the peak coordinate at the level of single participants. And, indeed, there's considerable variability that is typical when localizing ROIs in single participants. My concern is the level at which hypothesis testing is performed. An independent SMG ROI is used to extract parameter estimates and correlate responses between tasks to show a pattern of correlation that comports with a technical reasoning model of left SMG function. This is a fine approach but it does not rule out the so-called 'same region different function' interpretation because it relies on correlation-one cannot reverse infer that the left SMG is carrying out the same function across different tasks because the response in that area is more strongly correlated between certain tasks. This finding points to that possibility and makes interesting predictions for future studies to pursue, but it cannot tell us whether common functions in the left SMG are involved in each task. E.g., one interesting prediction for future studies is to test if patients with lesions to this site are disproportionately more inaccurate in the experimental condition of the mechanical problem solving task, the psychotechnical task, the mentalizing task, but not the fluid cognition task.

      (4) I appreciated the approach to testing the adjacency interpretation by showing the sphere and peak Y coordinate across the tasks. It is interesting that across the groups, there is no difference in the peak Y coordinate of the psychotechnical task and both conditions of the mentalizing task, whereas the peak Y coordinate in the fluid intelligence task is more anterior in the post-central gyrus across participants (why is that?). But why restrict the analysis to just the Y coordinate? A rigorous way to test the adjacency hypothesis is to compute Euclidean distance among X, Y, and Z coordinates between any two tasks collected in the same participant. One can then test if the Euclidean distance between, e.g., the psychotechnical task and one condition of the mentalizing task is smaller than the Euclidean distance between the psychotechnical task and the fluid cognition task. Similarly, one can test whether Euclidean distance between the INT and PHY conditions of the mentalizing task is smaller than the Euclidean distance between the INT and psychotechnical task or PHY and psychotechnical task. There is no justification to restrict this analysis to the anterior-posterior dimension only.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript provides experimental evidence on circadian behavioural cycles in Antarctic krill. The krill were obtained directly from krill fishing vessels and the experiments were carried out on board using an advanced incubation device capable of recording activity levels over a number of days. A number of different experiments were carried out where krill were first exposed to simulated light:dark (L:D) regimes for some days followed by continuous darkness (DD). These were carried out on krill collected during late autumn and late summer. A further set of experiments was performed on krill across three different seasons (summer, autumn, winter), where incubations were all DD conditions. Activity was measured as the frequency by which an infrared beam close to the top of the incubation tube was broken over unit time. Results showed that patterns of increased and decreased activity that appeared synchronised to the LD cycle persisted during the DD period. This was interpreted as evidence of the operation of an internal (endogenous) clock. The amplitude of the behavioural cycles decreased with time in DD, which further suggests that this clock is relatively weak. The authors argued that the existence of a weak endogenous clock is an adaptation to life at high latitudes since allowing the clock to be modulated by external (exogenous) factors is an advantage when there is a high degree of seasonality. This hypothesis is further supported by seasonal DD experiments which showed that the periodicity of high and low activity levels differed between seasons.

      Strengths:

      Although there has been a lot of field observations of various circadian type behaviour in Antarctic krill, relatively few experimental studies have been published considering this behaviour in terms of circadian patterns of activity. Krill are not a model organism and obtaining them and incubating them in suitable conditions are both difficult undertakings. Furthermore, there is a need to consider what their natural circadian rhythms are without the overinfluence of laboratory-induced artefacts. For this reason alone, the setup of the present study is ideal to consider this aspect of krill biology. Furthermore, the equipment developed for measuring levels of activity is well-designed and likely to minimise artefacts.

    1. Reviewer #2 (Public review):

      Summary:

      Kaya et al uncover an intriguing relationship between hippocampal sharp wave-ripple production and peripheral hormone exposure, food intake, and lateral hypothalamic function. These findings significantly expand our understanding of hippocampal function beyond mnemonic processes and point a direction for promising future research.

      Strengths:

      Some of the relationships observed in this paper are highly significant. In particular, the inverse relationship between GLP1/Leptin and Insulin/Ghrelin are particularly compelling as this aligns well with opposing hormone functions on satiety.

    1. Reviewer #2 (Public review):

      Summary:

      While bacteria have the ability to induce genes in response to specific stresses, they also use the General Stress Response (GSR) to deal with growth conditions that presumably include a larger range of stresses (for instance, stationary phase growth). The activation of GSR-specific sigma factors is frequently at the heart of the induction of a GSR. Given the range of stresses that can lead to GSR induction, the regulatory inputs are frequently complex. In B. subtilis, the stressosome, a multi-protein complex, contains a set of proteins that, upon appropriate stresses, initiate partner switching cascades that free the sigma B sigma factor from an anti-sigma. The focus here is on the mode of activation of RsbU, a serine/threonine phosphatase of the PPM family, leading to sigB activation. RbsT, a component of the degradosome interacts with RsbU upon stress, activating the phosphatase activity. Once active, RsbU dephosphorylates its target (RsbV, an anti-antisigma), which in turn binds the anti-sigma. The conclusion is that flexible linker domains upstream of the phosphatase domain are the target for activation, resulting in a crossed-linker dimeric structure. The authors then use the information on RsbU to suggest that parallel approaches may be used to activate PPM phosphatases for the GSR response in other bacteria.

      Strengths and Weaknesses:

      (1) A strength of the work is the combination of modeling, genetics and biochemical approaches to support the idea that the flexibility of the linker of the RsbU phosphatase is critical to signalling and that this changes as a result of interactions of the signaling protein RsbT.

      (2) The impact of the work, beyond better understanding of this particular signalling system, lies in the suggested parallels with other GSR system regulators in a range of bacteria. The work here provides fairly clear indications of what mutational changes would be most likely to test the model.

      (3) Assuming that these predictions are shown to be correct in future work, that will leave as an intriguing question why this particular geometry has been conserved in GSR - whether they emerge from a common ancestor (found where?) and/or there is some characteristic (flexibility of modulating the response?) that is particularly important for GSR signal input. Coupled with this will be further understanding of how the linker and/or interacting proteins change in different systems.

    1. Reviewer #2 (Public review):

      Summary:

      Lim et al. have developed a self-amplifying RNA (saRNA) design that incorporates immunomodulatory viral proteins, and show that the novel design results in enhanced protein expression in vitro in mouse primary fibroblast-like synoviocytes. They test constructs including saRNA with the vaccinia virus E3 protein and another with E3, Toscana virus NS protein and Theiler's virus L protein (E3 + NS + L), and another with srIκBα-Smad7-SOCS1. They have also tested whether ML336, an antiviral, enables control of transgene expression.

      Strengths:

      The experiments are generally well-designed and offer mechanistic insight into the RNA-sensing pathways that confer enhanced saRNA expression. The experiments are carried out over a long timescale, which shows the enhance effect of the saRNA E3 design compared to the control. Furthermore, the inhibitors are shown to maintain the cell number, and reduce basal activation factor-⍺ levels.

      Weaknesses:

      One limitation of this manuscript is that the RNA is not well characterized; some of the constructs are quite long and the RNA integrity has not been analyzed. Furthermore, for constructs with multiple proteins, it's imperative to confirm the expression of each protein to confirm that any therapeutic effect is from the effector protein (e.g. E3, NS, L). The ML336 was only tested at one concentration; it is standard in the field to do a dose-response curve. These experiments were all done in vitro in mouse cells, thus limiting the conclusion we can make about mechanisms in a human system.

    1. Reviewer #2 (Public review):

      This manuscript presents a compelling application of NAD(P)H fluorescence lifetime imaging (FLIM) to study metabolic activity in the Drosophila brain. The authors reveal regional differences in oxidative and glycolytic metabolism, with a particular focus on the mushroom body, a key structure involved in associative learning and memory. In particular, they identify metabolic shifts in α/β Kenyon cells following classical conditioning, consistent with their established role in energy-demanding middle- and long-term memories.

      These results highlight the potential of label-free FLIM for in-vivo neural circuit studies, providing a powerful complement to genetically encoded sensors. This study is well-conducted and employs rigorous analysis, including careful curve fitting and well-designed controls, to ensure the robustness of its findings. It should serve as a valuable technical reference for researchers interested in using FLIM to study neural metabolism in vivo. Overall, this work represents an important step in the application of FLIM to study the interactions between metabolic processes, neural activity, and cognitive function.

    1. Reviewer #2 (Public review):

      Summary:

      The revised paper by Kim et al. reports two disease mutations in proBMP4, S91C and E93G, disrupt the FAM20C phosphorylation site at Ser91, blocking the activation of proBMP4 homodimers, while still allowing BMP4/7 heterodimers to function. Analysis of DMZ explants from Xenopus embryos expressing the proBMP4 S91C or E93G mutants showed reduced expression of pSmad1 and tbxt1. The expert amphibian tissue transplant studies were expanded to in vivo studies in Bmp4S91C/+ and Bmp4E93G/+ mice, highlighting the impact of these mutations on embryonic development, particularly in female mice, consistent with patient studies. Additionally, studies in mouse embryonic fibroblasts (MEFs) demonstrated that the mutations did not affect proBMP4 glycosylation or ER-to-Golgi transport but appeared to inhibit the furin-dependent cleavage of proBMP4 to BMP4. Based on these findings and AI modeling using AlphaFold of proBMP4, the authors speculate that pSer91 influences access of furin to its cleavage site at Arg289AlaLysArg292 in a new "Ideas and Speculation" section. Overall, the authors addressed the reviewers' comments, improving the presentation.

      Strengths:

      The strengths of this work continue to lie in the elegant Xenopus and mouse studies that elucidate the impact of the S91C and E93G disease mutations on BMP signaling and embryonic development. Including an "Ideas and Speculation" subsection for mechanistic ideas reduces some shortcomings regarding the analysis of the underlying mechanisms.

      Weaknesses:

      (Minor) In Figure S1 and lines 165-174 and 179-180, the authors should consider that, unlike the wild-type protein (Ser), which can be reversibly phosphorylated or dephosphorylated, phosphomimic mutations are locked into mimicking either the phosphorylated state (Asp) or the non-phosphorylated state (Ala). Consequently, if the S91D mutant exhibits lower activity than WT, it could imply that S91D interferes with other regulatory constraints, as the authors suggest. However, it may also be inhibiting activation. Therefore, caution is warranted when comparing S91D with S91C to conclude that Ser91 phosphorylation increases BMP4 activity. While additional experiments are not necessary, further consideration is essential.

      In Figure 4, panels A, E, and I, the proBMP bands in the mouse embryonic lysates and MEFs expressing the mutations show a clear size shift. Are these shifts a cause or a consequence of the lack of cleavage? Regardless, the size shifts should be explicitly noted.

      (Minor) In line 314, the authors should consider modifying the wording to: "is required for modulating proprotein convertase..."

      (Minor) In lines 394-399, the authors cleverly speculate that pS91 interacts with Arg289-the essential P4 arginine for furin processing. If so, this interaction could hinder the cleavage of proBMP4, as indicated by the results in Figure S1. The discussion would benefit from considering that, contrary to their favored model, dephosphorylation at Ser91 might actually facilitate cleavage.

    1. Reviewer #2 (Public review):

      In this revision the authors have made a solid effort to address each of the points raised by all three reviewers. Due to the fact that animals in this study were freely moving, and there has not been any high-speed video recordings to measure whisker movements or other possible stimulus-induced motor effects it is still not possible to rule out motor effects completely. However, the fact that the multisensory enhancements are stimulus specific, much stronger in the multisensory case than the visual only condition, and short in latency it does seem the most parsimonious explanation is likely that these responses are visual in nature.

      The delayed auditory stimulus offers some explanation for the very small latency difference between audio and visual stimulus elements. Studies using LED flashes in rat V2 report latencies around ~50 ms (e.g. 2017 paper from Brian Allman's group). The response latencies for visual stimuli in this manuscript are of this order of magnitude, albeit still shorter than that (which presumably means they don't originate from V2).

      There are still parts of the manuscript that are inappropriately causal - e.g. line 283 "this suggests that strong multisensory integration is critical for behavior" - it could just as well be the case that high attention / motivation / arousal leads to both strong integration and good behavior.

    1. From Inner Work to Global Impact

      for - program event selection - 2025 - April 2 - 10:30am-12pm GMT - Skoll World Forum - From Inner Work to Global Impact - Stop Reset Go Deep Humanity / cosmolocal - LCE - relevant to - event time conflict - with Building Citizen-Led Movements - solution - watch one live and the other recorded

      meeting notes - see below

      ANNIKA: - inner work helps us stay sane dealing with the chaos in our work - healing is not fixing - hope is a muscle, go to the "hope gym" - not just personal but collective

      EDWIN: - inner WORK - constant, continuous work - how do you scale these things? Is it wrong term to use? Mechanistic? - how do we move to global impact? We don't know yet

      LOUISE - inner work saved my - orientate inside away from trauma architecture - colonized and colonizer energies - they longed to be in union - be with all parts of myself - allow alchemy on the outside to the inside - liberate myself from my trauma structures and unfold myself - we cannot be a restorer unless we do that inner work - systeming - verbalizing / articulating it - we are all actors in creating the system - question - where am i systeming from? - answer - I am an interbeing - Am i systeming from the interbeing space or the trauma architecture space? - Where am I seeding from? What energy do I put into my work? - system is not concrete and fixed but fluid - fielding - bringing different human fields together - I can work with hatred and rage on the inside and transmute it so that I don't add to it on the outside

      JOHN: - stuck systems and lens of trauma can help us get unstock - 70% of people have experienced trauma - trauma is part of the human experience - people make up systems - so traumatized people makes traumatized systems - fight, flight and freeze happens at both levels - at system level, its fractally similiar - disembodied from wisdom - in state of survival and fear - fixing things - until we deal with the trauma in the people, we will continue to have traumatized systems - More work won't help if it's coming from traumatized people

      EDWIN - incremental change - something holding us back - built upon these traumas - Economic metrics are out of touch with how the trauma affects systems - Journey - awareness first, then understanding and inner transformation and finally change - Discussion with funders - most are still stuck in old paradigm of metrics, audits, etc - this comes with trauma because we have no trust on who is on the other side - a big part of the system is built on mistrust, creates more gaps between us - need to become anti-fragile

      ANNIKA - Funders have lack of trust because inner work hasn't been done on both sides - As a funder, we really try to create a space of trust - Think of the language we use to be inclusive - How do we make inner work a part of the operating system of how we work? - We looked at 500 mental health organizations over the years - It's so urgent now that we align our work

      EDWIN - We have a lot of half-formed thoughts - It's very complex and nobody has cracked it - We have a phrase at Axum that we move at the speed of trust - To do something different, they need to trust you - When I think of the discussions I've had with heads of states and CEOs, these meaningful inner ideas are not often brought up

      LAURA - When there's no trust, even if there is no danger, the trauma is still brought up - We need to shift our lens on trauma and become aware of when trauma emerges - quote - inner condition of the intervener determines the success of intervention - Bill O'Brien

      LOUISE - I work a lot with nervous system and body system - We need small changes in our nervous system - If I try to do something big, I can re-traumatize myself - We also have a collective nervous system - Restore love to all parts of your system first - Make friends with trees to seed actions from union

      JOHN - Become aware of my own trauma triggers - When we see an outsized reaction, we can guess that person is undergoing personal trauma - A settled body settles bodies - If we are calm, it helps calm others

      LAURA - Feel where we don't feel grounded, where we shame ourselves, feel compassion there

      QUESTIONS - See below

      • mushrooms and ayuahuasca - is it helpful?

      • A lot of women forget the feminine energy to climb the ladder and get sick?

      • backlash - feels like white men were being pushed to do work they weren't ready to do so now reclaiming their comfortable traumatized space

      • how early do we start to teach this knowledge?

      • How do organizations hold space for the enormous trauma that the US govt is manufacturing. We need to build this practice into organizations to help deal with the onslaight

      • Youth are so hungry for being in the presence of others who are wise, compassionate. We can't move faster than the speed of trust but it needs to become accessible.

      ANSWERS - See below

      LOUISE - Organizations have a huge role to play at this time - We want to reconfigure and transform the trauma - Deep forming teams in organizations to help transform - Trauma fields want to come through human nervous systems to transform - We are both feminine and masculine and the masculine wounding is very important and needs to find the feminine - We cannot go away by ourselves to heal from patriarchy, colonialism energies

      ANNIKA - In terms of how we fund, can we fund differently? We need to fund these spaces

      EDWIN - I sit on board of Wellbeing project - changemakers go through burnout - how do we prevent this and create a container that can sustain them? - Weve brought 20,000 people in summits who have affected 3 million people. Please come to the Hurts summit in Czec and Wellbeing project - When pendulum swings back from individual space, we should be like a spiral

      JOHN - In systems change spaces, trauma is seldom spoken of. - Systems work will not work if we ignore trauma - This is critical

      LOUISE - Arundhati Roy - Another world is not only possible but is on its way. On a quiet day, I can hear it breathing.

    1. Reviewer #2 (Public review):

      This work set out to identify all extracellular matrix proteins and associated factors present within the starlet sea anemone Nematostella vectensis at different life stages. Combining existing genomic and transcriptomic datasets, alongside new mass spectometry data, the authors provide a comprehensive description of the Nematostella matrisome. In addition, immunohistochemistry and electron microscopy were used to image whole mount and de-cellularized mesoglea from all life stages. This served to validate the de-cellularization methods used for proteomic analyses, but also resulted in a very nice description of mesoglea structure at different life stages. A previously published developmental cell type atlas was used to identify the cell type specificity of the matrisome, indicating that the core matrisome is predominantly expressed in the gastrodermis, as well as cnidocytes. The analyses performed were rigorous and the results were clear, supporting the conclusions made by the authors.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript presents a valuable single-cell RNA-seq study on Trypanosoma cruzi, an important human parasite. It investigates the expression heterogeneity of surface proteins, particularly those from the trans-sialidase-like (TcS) superfamily, within amastigote and trypomastigote populations. The findings suggest a previously underappreciated level of diversity in TcS expression, which could have implications for understanding parasite-host interactions and immune evasion strategies. The use of single-cell approaches to delve into population heterogeneity is strong. However, the study does have some limitations that need to be addressed.

      The focus on single-cell transcriptional heterogeneity in surface proteins, especially the TcS family, in T. cruzi is novel. Given the important role of these proteins in parasite biology and host interaction, the findings have potential significance.

      Strengths:

      The key finding of heterogeneous TcS expression in trypomastigotes is well-supported. The analysis comparing multigene families, single-copy genes, and ribosomal proteins highlights the unusual nature of the variation in surface protein-coding genes.

      Weaknesses:

      While the manuscript identifies TcS heterogeneity, the functional implications of the different expression profiles remain speculative. The authors state it may reflect differences in infectivity, but no direct experimental evidence supports this.

      The manuscript lacks any functional validation of the single-cell findings. For instance, do the trypomastigote subpopulations identified based on TcS expression exhibit differences in infectivity, host cell tropism, or immune evasion? Such experiments would greatly strengthen the study.

      The authors identify a subpopulation of TcS genes that are highly expressed in many cells. However, it is unclear if these correspond to previously characterized TcS members with specific functions.<br /> The authors hypothesize that observed heterogeneity may relate to chromatin regulation. However, the study does not directly address these mechanisms. There are interesting connections to be made with what they identify as the colocalization of genes within chromatin folding domains, but the authors do not fully explore this. It would be insightful to address these mechanisms in future work.

      The merging of technical replicates needs further justification and explanation as they were not processed through separate experimental conditions. While barcodes were retained, it would be informative to know how well each technical replicate corresponds with the other. If both datasets were sequenced on the same lane, the inclusion of technical replicates adds noise to the analysis.<br /> While the number of cells sequenced (3192) seems reasonable, it's not clear how much the conclusions are affected by the depth of sequencing. A more detailed description of the sequencing depth and its impact on gene detection would be valuable.

      While most of the methods are clear, the way in which the subsampled gene lists were generated could be more thoroughly described, as some details are not clear for the subsampling of single-copy genes.

      Some of the figures are difficult to interpret. For example, the color scaling in the heatmap of Supplementary Figure 3B is not self-explanatory and it is hard to extract meaningful conclusions from the graph.

    1. Reviewer #2 (Public review):

      Summary:

      The author proposes a novel method for mapping single-cell data to specific locations with higher resolution than several existing tools.

      Strengths:

      The spatial mapping tests were conducted on various tissues, including the mouse cortex, human PDAC, and intestinal villus.

      Weaknesses:

      (1) Although the researchers claim that glmSMA seamlessly accommodates both sequencing-based and image-based spatial transcriptomics (ST) data, their testing primarily focused on sequencing-based ST data, such as Visium and Slide-seq. To demonstrate its versatility for spatial analysis, the authors should extend their evaluation to imaging-based spatial data.

      (2) The definition of "ground truth" for spatial distribution is unclear. A more detailed explanation is needed on how the "ground truth" was established for each spatial dataset and how it was utilized for comparison with the predicted distribution generated by various spatial mapping tools.

      (3) In the analysis of spatial mapping results using intestinal villus tissue, only Figure 3d supports their findings. The researchers should consider adding supplemental figures illustrating the spatial distribution of single cells in comparison to the ground truth distribution to enhance the clarity and robustness of their investigation.

      (4) The spatial mapping tests were conducted on various tissues, including the mouse cortex, human PDAC, and intestinal villus. However, the original anatomical regions are not displayed, making it difficult to directly compare them with the predicted mapping results. Providing ground truth distributions for each tested tissue would enhance clarity and facilitate interpretation. For instance, in Figure 2a and Supplementary Figures 1 and 2, only the predicted mapping results are shown without the corresponding original spatial distribution of regions in the mouse cortex. Additionally, in Figure 3c, four anatomical regions are displayed, but it is unclear whether the figure represents the original spatial regions or those predicted by glmSMA. The authors are encouraged to clarify this by incorporating ground truth distributions for each tissue.

      (5) The cell assignment results from the mouse hippocampus (Supplementary Figure 6) lack a corresponding ground truth distribution for comparison. DG and CA cells were evaluated solely based on the gene expression of specific marker genes. Additional analyses are needed to further validate the robustness of glmSMA's mapping performance on Slide-seq data from the mouse hippocampus.

      (6) The tested spatial datasets primarily consist of highly structured tissues with well-defined anatomical regions, such as the brain and intestinal villus. It remains unclear whether glmSMA can be effectively applied to tissue types where anatomical regions are not distinctly separated, such as liver tissue. Further evaluation of such tissues would help determine the method's broader applicability.

    1. Reviewer #2 (Public review):

      Summary:

      This study introduces a new metric for assessing the efficacy of rotavirus vaccines through the genetic distance clustering of strains. The authors analyzed variations in vaccine protection using whole genome sequencing.

      Strengths:

      Evaluating vaccine efficacy using whole genome sequencing can enhance our understanding of how pathogen evolution influences disease transmission and control.

      Weaknesses:

      While the study proposed a new method for evaluating vaccine efficacy using genetic information, its weaknesses arise from the insufficient evidence that analyses based on whole genome sequencing are more reliable than those that rely solely on VP7 and VP4 genotypes.

      Though most cases received the RV5 vaccine (n=119 compared to n=30 for RV1), Figure 2 and the primary focus of the paper concentrate on RV1, as the authors identified a stronger association with genetic distance.

      Additionally, it is unclear whether the difference between the two groups (j=0 versus j=1) is statistically significant for the analysis based on genetic distance to the RV1 strain, as well as for that based on minimum genetic distance to any of the RV5 vaccine strains. In both cases, the confidence intervals show substantial overlap.

      The authors do not seem to have used a criterion for model selection based on the number of clusters; therefore, k=2 may not represent the optimal number of clusters, particularly in relation to the genetic distance associated with the RV5 vaccine (Figure 1B), which does not appear to show a bimodal distribution.

      Finally, outcomes for RV1 are highly associated with both homotypic and heterotypic antibody responses (Supplemental Figure 10), which have already been shown to impact vaccine effectiveness (The Pediatric Infectious Disease Journal 40(12):p 1135-1143, 2021, doi:10.1097/INF.0000000000003286). Given this strong association, the benefit of using genetic distance is unclear, as the GxPx genotype serves as a good proxy for genetic similarity.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript, "scRNA+TCR-seq Reveals the Proportion and Characteristics of Dual TCR Treg Cells in Mouse Lymphoid and Non-lymphoid Tissues" by Xu and Peng, et al. investigates whether co-expression of 2 T cell receptor (TCR) clonotypes can be detected in FoxP3+ regulatory CD4+ T cells (Tregs) and if it is associated with identifiable phenotypic effects. This paper presents data reanalyzing publicly available single-cell TCR sequencing and transcriptional analysis, convincingly demonstrating that dual TCR co-expression can be detected in Tregs, both in peripheral circulation as well as among Tregs in tissues. They then compare metrics of TCR diversity between single-TCR and dual TCR Tregs, as well as between Tregs in different anatomic compartments, finding the TCR repertoires to be generally similar though with dual TCR Tregs exhibiting a less diverse repertoire and some moderate differences in clonal expansion in different anatomic compartments. Finally, they examine the transcriptional profile of dual TCR Tregs in these datasets, finding some potential differences in the expression of key Treg genes such as Foxp3, CTLA4, Foxo3, Foxo1, CD27, IL2RA, and Ikzf2 associated with dual TCR-expressing Tregs, which the authors postulate implies a potential functional benefit for dual TCR expression in Tregs.

      Strengths:

      This report examines an interesting and potentially biologically significant question, given recent demonstrations that dual TCR co-expression is a much more common phenomenon than previously appreciated (approximately 15-20% of T cells) and that dual TCR co-expression has been associated with significant effects on the thymic development and antigenic reactivity of T cells. This investigation leverages large existing datasets of single-cell TCRseq/RNAseq to address dual TCR expression in Tregs. The identification and characterization of dual TCR Tregs is rigorously demonstrated and presented, providing convincing new evidence of their existence.

      Weaknesses:

      The existence of dual TCR expression by Tregs has previously been demonstrated in mice and humans (Reference #18 and Tuovinen. 2006. Blood. 108:4063; Schuldt. 2017. J Immunol. 199:33, both omitted from references). The presented results should be considered in the context of these prior important findings.

      This demonstration of dual TCR Tregs is notable, though the authors do not compare the frequency of dual TCR co-expression by Tregs with non-Tregs. This limits interpreting the findings in the context of what is known about dual TCR co-expression in T cells.

      Comparison of gene expression by single- and dual TCR Tregs is of interest, but as presented is difficult to interpret. Statistical analyses need to be performed to provide statistical confidence that the observed differences are true.

      The interpretations of the gene expression analyses are somewhat simplistic, focusing on the single-gene expression of some genes known to have a function in Tregs. However, the investigators miss an opportunity to examine larger patterns of coordinated gene expression associated with developmental pathways and differential function in Tregs (Yang. 2015. Science. 348:589; Li. 2016. Nat Rev Immunol. Wyss. 2016. 16:220; Nat Immunol. 17:1093; Zenmour. 2018. Nat Immunol. 19:291).

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents a valuable contribution to the field of ACE structural biology and dynamics by providing the first complete full-length dimeric ACE structure in four distinct states. The study integrates cryo-EM and molecular dynamics simulations to offer important insights into ACE dynamics. The depth of analysis is commendable, and the combination of structural and computational approaches enhances our understanding of the protein's conformational landscape. However, the strength of evidence supporting the conclusions needs refinement, particularly in defining key terms, improving structural validation, and ensuring consistency in data analysis. Addressing these points through major revisions will significantly improve the clarity, rigor, and accessibility of the study to a broader audience, allowing it to make a stronger impact in the field.

      Strengths:

      The integration of cryo-EM and MD simulations provides valuable insights into ACE dynamics, showcasing the authors' commitment to exploring complex aspects of protein structure and function. This is a commendable effort, and the depth of analysis is appreciated.

      Weaknesses:

      Several aspects of the manuscript require further refinement to improve clarity and scientific rigor as detailed in my recommendations for the authors.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, Andriani and colleagues are examining the potential role of Zn flux in sperm and its effect on Slo3 channels. This is an interesting question that is likely critical to how sperm function properly and Slo3 channels are a possible candidate for a downstream molecule that is impacted by Zn. In this paper, the authors use Zn imaging, sperm motility assays, and electrophysiology to show that Zn flux impacts sperm function. They then go on to look at the impact Zn has on Slo3 current and propose a binding site based on MD simulations. While the ideas are interesting, the experiments are not well described in many places making understanding the results very difficult. In addition, critical controls are missing throughout the paper.

      Strengths:

      The question of how Zn flux impacts membrane potential and sperm motility is an important one. Moreover, Slo3 presents an interesting candidate or the target of Zn regulation. The combination of methods used here also has the potential to uncover mechanisms of Zn regulation of Slo3.

      Weaknesses:

      Much of the paper lacks experimental description which makes interpretation quite difficult, or a detailed discussion is missing. Examples include:

      (1) Figure 1, particularly the Zn imaging, is not sufficiently described. How is the fluorescence intensity measured? A representative ROI? The whole tail and head? Are the sperm immobile? If not, there is evidence that motion artifacts can significantly distort these sorts of measures from Calcium measurements in Cilia. Were there controls done? Is the small amount of Zn seen in the tail above the background?

      (2) The second half of Figure 1 is also not well described. What is the extracellular solution in the recordings? When you apply the Zn ionophore, do you expect influx or efflux? I assume efflux is based on the conclusions but this should be discussed explicitly.

      (3) Figure 2H labels the Y axis, "normalized current". Normalized to what? Why do neither of the curves end at 1? A better description of what this figure represents is needed.

      (4) The alpha fold simulations are not well described. How many Zn binding sites were found? Are all of the histidine mutations in Figure 4 Supplement 1 the ones that were found?

      (5) There is no discussion of physiological intracellular Zn concentration. How much Zn is inside the sperm? How much if likely Free vs buffered? Is 100uM a reasonable physiological concentration?

      There are a number of areas where the interpretation is not well supported by the data including:

      (6) You say in the Figure 4 supplement, that "we did not observe any significant decrease in the percentage of current inhibition." But that is a pretty misleading statement. There are large changes (increases) in the amount of zinc inhibition. These might be allosteric changes but I don't think you can safely eliminate these as relevant Zn binding sites. Also, some of these mutations appear to allow at least some unbinding of Zn.

      (7) Following up on the above point, it seems unfair to conclude that the D162S, E169A, and E205 mutants are part of the inhibitory binding site for Zn when the mutation has no effect on inhibition and only an effect on the washout. The mutations on the intracellular side also had an impact on the washout so it seems equally likely that they are the critical residues based on your data.

      (8) Nowhere in the paper do you make the specific link between Zn flux and membrane hyperpolariation via Slo3. You show that Zn flux changes the ability of the sperm to hyperpolarize and you show that Slo3 is inhibited by Zn but the connection between the two is not demonstrated. There appears to be a specific Slo3 blocker. If you use this in sperm, do you no longer see the Zn effect?

      (9) In the second half of Figure 1, the authors suggest that there is "no hyperpolization in 100uM Zn. That is not really true. It is reduced but not absent.

      (10) The claim that Lrcc52 with Slo3 shows a higher current inhibition at pH 7.5 than pH 8 is not well supported because there are only 3 replicates in the 7.5 case. In addition, the claim is made in the test that 100uM ZnCl2 "already inhibited mSlo3+Lrcc52 at pH7.5", contrasted with mSlo3 alone, is not tested statistically.

      In a number of places, better controls are needed.

      (11) How specific is this effect for Zn? Mg2+, for instance, is also a divalent cation that is in the hundreds of uM range inside the cell. Does it exert the same effect? Each ion certainly has unique preferred coordination geometries, does your predicted binding with MD show what you might expect for tetrahedral coordination with Zn? Did you test other divalent cations functionally or in silicon?

      (12) For the VCF experiments, a significantly higher concentration of Zn was used (10mM). What is the reason for this? There is no discussion of how much a "puff" is. Assuming you are using the RNA injector it is probably on the order of 50nL or less. Assuming the volume of an oocyte is 1uL that would argue that the final concentration is 500uM or higher. But this is also complicated by potential local effects of high Zn at the injection site, artifacts of injecting that much metal, and the fact that a great deal of the Zn will likely be bound to other things inside the cell. Better controls are needed for this experiment.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors report on the genomic correlates of the transition to the pathogenic lifestyle in Sordariomycetes. The pathogenic lifestyle was found to be better explained by the number of genes, and in particular effectors and tRNAs, but this was modulated by the type of interacting host (insect or not insect) and the ability to be vectored by insects.

      Strengths:

      The main strength of this study lies in the size of the dataset, and the potentially high number of lifestyle transitions in Sordariomycetes.

      Weaknesses:

      The main strength of the study is not the clarity of the conclusions.

      (1) This is due firstly to the presentation of the hypotheses. The introduction is poorly structured and contradictory in some places. It is also incomplete since, for example, fungus-insect associations are not mentioned in the introduction even though they are explicitly considered in the analyses.

      (2) The lack of clarity also stems from certain biases that are challenging to control in microbial comparative genomics. Indeed, defining lifestyles is complicated because many fungi exhibit different lifestyles throughout their life cycles (for instance, symbiotic phases interspersed with saprotrophic phases). In numerous fungi, the lifestyle referenced in the literature is merely the sampling substrate (such as wood or dung), which doesn't mean that this substrate is a crucial aspect of the life cycle. This issue is discussed by the authors, but they do not eliminate the underlying uncertainties.

    1. Reviewer #2 (Public review):

      Summary:

      The paper introduces the IBEX Knowledge-Base (KB), a shared online resource designed to help scientists working with immunofluorescence imaging. It acts as a central hub where researchers can find and share information about reagents, protocols, and imaging methods. The KB is not static like traditional publications; instead, it evolves as researchers contribute new findings and refinements. A key highlight is that it includes results of both successful and unsuccessful experiments, helping scientists avoid repeating failed experiments and saving time and resources. The platform is built on open-access tools ensuring that the information remains available to everyone. Overall, the KB aims to collaboratively accelerate research, improve reproducibility, and reduce wasted effort in imaging experiments.

      Strengths:

      (1) The IBEX KB is built entirely on open-source tools, ensuring accessibility and long-term sustainability. This approach aligns with FAIR data principles and ensures that the KB remains adaptable to future advancements.

      (2) The KB also follows strict data organization standards, ensuring that all information about reagents and protocols is clearly documented and easy to find with little ambiguity.

      (3) The KB allows scientists to report both positive and negative results, reducing duplication of effort and speeding up the research process.

      (4) The KB is helpful for all researchers, but even more so for scientists in resource-limited settings. It provides guidance on finding affordable alternatives to expensive or discontinued reagents, making it easier for researchers with fewer resources to perform high-quality experiments.

      (5) The KB includes a community discussion forum where scientists can ask for advice, share troubleshooting tips, and collaborate with others facing similar challenges.

      Weaknesses:

      (1) The potential impact of IBEX KB is very clear. However, the paper would benefit by also discussing more on KB maintenance and outreach, and how higher participation could be incentivized.

      (2) Use of resources like GitHub may limit engagement from non-coding members of the scientific community. Will there be alternative options like a user-friendly web interface to contribute more easily?

    1. Reviewer #2 (Public review):

      Summary:

      The authors harness single-cell RNAseq data from zebrafish and mice to identify Oct4 as a candidate driver of neurogenesis. They then use adeno-associated virus vectors to show that while Oct4 overexpression alone converts rare adult Müller glia (MG) to bipolar cells, it synergizes with Notch pathway inhibition to cause this neurogenesis (achieved by Cre-mediated knockout of Rbpj floxed allele). Importantly, they genetically lineage-mark adult MG using a GLAST-CreER transgene and a Sun-GFP reporter, so that any non-MG cells that convert can be identified unambiguously. This is crucial because several high-profile papers made erroneous claims using short promoters in the viral delivery vector itself to mark MG, but those promoters are leaky and mark other non-MG cell types, making it impossible to definitively state whether manipulations studied were actually causing neurogenesis, or were merely the result of expression in pre-existing neurons. Once the authors establish Oct4 + RbpjKO synergy they use snRNAseq/ATACseq to identify known and novel transcription factors that could play a role in driving neurogenesis.

      Strengths:

      The system to mark MG is stringent, so the authors are studying transdifferentiation, not artifactual effects due to leaky viral promoters. The synergy between Oct4 and Notch pathway blockade is notable. The single-cell results add the potential involvement of new players such as Rfx4 in adult-MG-neurogenesis.

      Weaknesses:

      The existing version is difficult to read due to an unusually high number of text errors (e.g. references to the wrong figure panels etc.). A fuller explanation for the fraction of non-MG cells seen in control scRNAseq assays is required, particularly because the neurogenic trajectory which is enhanced in the Oct4/Rbpj-KO context is also evident in the control retina. Claims regarding the involvement of transcription factors in adult neurogenesis (such as Rfx4) need to be toned down unless they are backed up with functional data. It is possible that such factors are important, but equally, they may have no role or a redundant role, and without functional tests, it's impossible to say one way or the other.

      Overall, the authors achieved what they set out to do, and have made new insights into how neurogenesis can be stimulated in MG. Ultimately, a major long-term goal in the field is to replace lost photoreceptors as this is most relevant to many human visual disorders, and while this paper (like all others before it) does not generate rods or cones, it opens new strategies to coax MG to form a related neuronal cell type. Their approach underscores the benefits of using a gold-standard approach for lineage tracing.

    1. Reviewer #2 (Public review):

      Summary:

      In this observational study, Barth et al. investigated the association between menopausal hormone therapy and brain health in middle- to older-aged women from the UK Biobank. The study evaluated detailed MHT data (never, current, or past user), duration of mHT use (age first/last used), history of hysterectomy with or without bilateral oophorectomy, APOEE4 genotype, and brain characteristics in a large, population-based sample. The researchers found that current mHT use (compared to never-users), but not past use, was associated with a modest increase in gray and white matter brain age gap (GM and WM BAG) and decrease in hippocampal volumes. No significant association was found between the age of mHT initiation and brain measures among mHT users. Longer duration of use and older age at last MHT use post-menopause were associated with higher GM and WM BAG, larger WMH volumes, and smaller hippocampal volumes. In a sub-sample, after adjusting for multiple comparisons, no significant associations were found between detailed mHT variables (formulations, route of administration, dosage) and brain measures. The association between mHT variables and brain measures was not influenced by APOEE4 allele carrier status. Women with a history of hysterectomy with or without bilateral oophorectomy had lower GM BAG compared to those without such history. Overall, these observational data suggest that the association between mHT use and brain health in women may vary depending on the duration of use and surgical history.

      Strengths:

      The study has several strengths, including a large, population-based sample of women in the UK, and comprehensive details of demographic variables such as menopausal status, history of oophorectomy/hysterectomy, genetic risk factors for Alzheimer's disease (APOE ε4 status), age at mHT initiation, age at last use, duration of mHT, and brain imaging data (hippocampus and WMH volume).

      In a sub-sample, the study accessed detailed mHT prescription data (formulations, route of administration, dosage, duration), allowing the researchers to study how these variables were associated with brain health outcomes. This level of detail is generally missing in observational studies investigating the association of mHT use with brain health.

      Weaknesses:

      While the study has many strengths, it also has some weaknesses. These weaknesses were properly discussed throughout the article. The manuscript has indicated that the need of mHT use which might be associated with these symptoms may be indicators of preexisting neurological changes, potentially reflecting worse brain health scores, including higher BAG and lower hippocampal volume and/or higher WMH. The authors noted that the UK Biobank lacks detailed information on menopausal symptoms and perimenopausal staging, limiting the study's ability to understand how these variables influence outcomes. The authors also highlighted that these results don't reflect causal relationships. The authors caution that these findings should not guide individual-level decisions regarding the benefits versus risks of mHT use. However, the study raises new questions that should be addressed by randomized clinical trials to investigate the varying effects of MHT on brain health and dementia risk.

    1. Reviewer #2 (Public review):

      The authors have conducted a valuable comparative analysis of perturbation responses in three nonlinear kinetic models of E. coli central carbon metabolism found in the literature. They aimed to uncover commonalities and emergent properties in the perturbation responses of bacterial metabolism. They discovered that perturbations in the initial concentrations of specific metabolites, such as adenylate cofactors and pyruvate, significantly affect the maximal deviation of the responses from steady-state values. Furthermore, they explored whether the network connectivity (sparse versus dense connections) influences these perturbation responses. The manuscript is reasonably well written.

      Comments on latest version:

      The authors have adequately addressed my concerns.

    1. Reviewer #2 (Public review):

      Park et al. set out to test two competing hypotheses about the role of the medial prefrontal cortex (PFC) in cognitive control, the ability to use task-relevant cues and ignore task-irrelevant cues to guide behavior. The "central computation" hypothesis assumes that cognitive control relies on computations performed by the PFC, which then interacts with other brain regions to accomplish the task. Alternatively, the "local computation" hypothesis suggests that computations necessary for cognitive control are carried out by other brain regions that have been shown to be essential for cognitive control tasks, such as the dorsal hippocampus and the thalamus. If the central computation hypothesis is correct, PFC lesions should disrupt cognitive control. Alternatively, if the local computation hypothesis is correct, cognitive control would be spared after PFC lesions. The task used to assess cognitive control is the active place avoidance task in which rats must avoid a sector of a rotating arena using the stationary room cues and ignoring the local olfactory cues on the rotating platform. Performance on this task has previously been shown to be disrupted by hippocampal lesions and hippocampal ensembles dynamically represent the room and arena depending on the animal's proximity to the shock zone. They found no group (lesion vs. sham) differences in the three behavioral parameters tested: distance traveled, latency to enter the shock zone, and number of shock zone entries for both the standard task and the "conflict" task in which the shock zone was rotated by 180 degrees. The only significant difference was the savings index; the lesion group entered the new shock zone more often than the sham group during the first 5 minutes of the second conflict session. This deficit was interpreted as a cognitive flexibility deficit rather than a cognitive control failure. Next, the authors compared cytochrome oxidase activity between sham and lesion groups in 14 brain regions and found that only the amygdala shows significant elevation in the lesion vs. sham group. Pairwise correlation analysis revealed a striking difference between groups, with many correlations between regions lost in the lesion group (between reuniens and hippocampus, reuniens and amygdala and a correlation between dorsal CA1 and central amygdala that appeared in the lesion group and were absent in the sham group. Finally, the authors assessed dorsal hippocampal representations of the spatial frame (arena vs. room) and found no differences between lesion and sham groups. The only difference in hippocampal activity was reduced overdispersion in the lesion group compared to the sham group on the pretraining session only and this difference disappeared after the task began. Collectively, the authors interpret their findings as supporting the local computation hypothesis; computations necessary for cognitive control occur in brain regions other than the PFC.

      Strengths:

      The data were collected in a rigorous way with experimental blinding and appropriate statistical analyses.<br /> Multiple approaches were used to assess differences between lesion and sham groups, including behavior, metabolic activity in multiple brain regions, and hippocampal single unit recording.

      Weaknesses:

      Only male rats were used with no justification provided for excluding females from the sample.

      The conceptual framework used to interpret the findings was to present two competing hypotheses with mutually exclusive predictions about the impact of PFC lesions on cognitive control. The authors then use mainly null findings as evidence in support of the local computation hypothesis. They acknowledge that some people may question the notion that the active place avoidance task indeed requires cognitive control, but then call the argument "circular" because PFC has to be involved in cognitive control. This assertion does not address the possibility that the active place avoidance task simply does not require cognitive control.

      The authors did not link the CO activity with the behavioral parameters even though the CO imaging was done on a subset of the animals that ran the behavioral task nor do they make any attempt to interpret these findings in light of the two competing hypotheses posed in the introduction. Moreover, the discussion is lacking any mechanistic interpretations of the findings. For example, there are no attempts to explain why amygdala activity and its correlation with dCA1 activity might be higher in the PFC lesioned group.

      Publishing null results is important to avoid wasting animals, time, and money. This study's results will have a significant impact on how the field views the role of the PFC in cognitive control. Whether or not some people reject the notion that the active place avoidance task measures cognitive control, the findings are solid and can serve as a starting point for generating hypotheses about how brain networks change when deprived of PFC input.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Obray et al. entitled "Adolescent alcohol exposure promotes mechanical allodynia and alters synaptic function at inputs from the basolateral amygdala to the prelimbic cortex" investigated how adolescent intermittent ethanol exposure (AIE) affects the BLA -> PL circuit, with an emphasis on PAG projecting PL neurons, and how AIE changes mechanical and thermal nociception. The authors found that AIE increased mechanical, but not thermal nociception, and an injection of an inflammatory agent did not produce changes in an ethanol-dependent manner. Physiologically, a variety of AIE-specific effects were found in PL neuron firing at BLA synapses, suggestive of AIE-induced alterations in neurotransmission at BLA-PVIN synapses.

      Strengths:

      This was a comprehensive examination of the effects of AIE on this neural circuit, with an in-depth dissection of the various neuronal connections within the PL.

      Sex was included as a biological variable, yet, there were little to no sex differences in AIE's effects, suggestive of similar adaptations in males and females.

      Comments on revisions:

      The authors addressed the reviews from the first submission which has substantially strengthened the conclusions of the study, including acknowledgement of unanswered questions for future studies to address.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide an important summary of ten years of Brain Initiative funding including a description of the historical development of the initiative, the specific funding mechanisms utilized, and examples of grants funded and work produced. The authors also conduct analyses of the impact on overall funding in Systems and Computational Neuroscience, the raw and field normalized bibliographic impact of the work, the social media impact of the funded work, and the popularity of some tools developed.

      Strengths:

      This is a useful perspective on an important funding initiative over a ten-year period. It is clearly written and the illustrations and analyses are mostly useful for understanding the impact of the initiative.

      Weaknesses:

      The major limitation is that the bibliographic analysis does not provide a comparison group of funded grants. Because work that successfully competes for funding is likely to be more impactful than all work in a given area, the normalization of citations to field medians may reflect this "grant review" effect, rather than anything special about the Brain Initiative. Hopefully, this speculation is incorrect (I would guess that it is), but it would be helpful to try to demonstrate this more directly by including a funded comparison group.

      There are also minor inconsistencies in the numbering of the figures that need to be cleared up.

    1. Reviewer #2 (Public review):

      Summary:

      The authors review the history of the team projects within the Brain initiative and analyze their success in progression to additional rounds of funding and their bibliographic impact.

      Strengths:

      The history of the team projects and the fact that many had renewed funding and produced impactful papers is well documented.

      Weaknesses:

      The core bibliographic and funding impact results have largely been reported in the companion manuscript and so represent "double dipping" I presume the slight disagreement in the number of grants (by one) represents a single grant that was not deemed to address systems/computational neuroscience. The single figure is relatively uninformative. The domains of study are sufficiently large and overlapping that there seems to be little information gained from the graphic and the Sankey plot could be simply summarized by rates of competing success.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Mondal and co-authors present the development of a computational model of homeostatic plasticity incorporating activity-dependent regulation of gating properties (activation, inactivation) of ion channels. The authors show that, similar to what has been observed for activity-dependent regulation of ion channel conductances, implementing activity-dependent regulation of voltage sensitivity participates in the achievement of a target phenotype (bursting or spiking). The results however suggest that activity-dependent regulation of voltage sensitivity is not sufficient to allow this and needs to be associated with the regulation of ion channel conductances in order to reliably reach the target phenotype. Although the implementation of this biologically relevant phenomenon is undeniably relevant, the main conclusions of the paper and the insights brought by this computational work are difficult to grasp.

      Strengths:

      (1) Implementing activity-dependent regulation of gating properties of ion channels is biologically relevant.

      (2) The modeling work appears to be well performed and provides results that are consistent with previous work performed by the same group.

      Weaknesses:

      (1) The writing is rather confusing, and the state of the art explaining the need for the study is unclear.

      (2) The main outcomes and conclusions of the study are difficult to grasp. What is predicted or explained by this new version of homeostatic regulation of neuronal activity?

    1. Reviewer #2 (Public review):

      Summary

      This paper reports histological, PET imaging, functional, and behavioural data evaluating the longevity of AAV2 infection in multiple brain areas of macaques in the context of DREADD experiments. The central aim is to provide unprecedented information about how long the expression of HM4di or HM3dq receptors is expressed and efficient in modulating brain functions after vector injections. The data show peak expression after 40 to 60 days of vector injection, and stable expressions for up to 1.5 years for hM4di, and that hM3dq remained mostly at 75% of peak after a year, declining to 50% after 2 years. DREADDs effectively modulated neuronal activity and behaviour for approximately two years, evaluated with behavioral testings, neural recordings, or FDG-PET. A statistical evaluation revealed that vector titers, DREADD type, and tags contribute to the measured peak level of DREADD expression.

      The article presents a thorough discussion of the limitations and specificities of chemogenetic approaches in monkeys.

      Strength

      These are unique data, in non-human primates (NHP), an animal model that not only features physiological and immunological characteristics similar to humans but also contribute to neurobiological functional studies on a long timescale with experiments spanning months or years. This evaluation of the long-term efficacy of DREADDs will be very important for all laboratories using this approach in NHP but also for future use of such approach in experimental therapies. The longevity estimates are based on multiple approaches including behavioural and neurophysiological ones, thus providing information on the functional efficacy of DREADD expression.

      Performing such evaluation requires specific tools like PET imaging that very few monkey labs have access to in the world. This study was done by the laboratory that has developed the radiotracer c11-DCZ used here, a radiotracer binding selectively to DREADDs and providing, using PET, quantitative in vivo measures of DREADD expression. This study and its data should thus be a reference in the field, providing estimates to plan future chemogenetic experiments.

      Publishing databases of experimental outcomes in NHP DREADD experiments is crucial for the community because such experiments are rare, expensive, and long. It contributes to refining experiments and reducing the number of animals overall used in the domain.

      Weaknesses

      This study is a meta-analysis of several experiments performed in one lab. The good side is that it combined a large amount of data that might not have been published individually; the downside is that all things were not planned and equated, creating a lot of unexplained variances in the data. This was yet judiciously used by the authors, but one might think that planned and organized multicentric experiments would provide more information and help test more parameters, including some related to inter-individual variability, and particular genetic constructs.

    1. Reviewer #2 (Public review):

      In addition to the study by Kaletsky et al. (2025), I read the bioRxiv and eLife versions, as well as the eLife reviewer comments, for Gainey et al. (2024), to which Kaletsky et al. respond.

      Kaletsky et al. provide detailed, rigorous, and reproducible protocols and results. The authors point out the critical methods that the Hunter group failed to follow/confirm (e.g. azide to paralyze animals during pathogenic learning/memory assays; the expression of the P11 small RNA that is both necessary and sufficient for TEI of avoidance behavior; a single condition for training - PA14 grown on plates at 25°C and training at 20°C for 24 hr - that the Hunter lab did not follow and could not reproduce). The Kaletsky et al. response is evidence-based, fair, level-headed and unbiased, which is in contrast to the Gainey et al. paper.

      Reading the eLife review of Gainey et al., I note that the reviewers repeatedly pointed out that authors did not follow published protocols by the Murphy lab.

      Public response by Gainey et al. to Reviewer 2: "It remains possible that we misunderstood the published Murphy lab protocols, but we were highly motivated to replicate the results so we could use these assays to investigate the reported RNAi-pathway dependent steps, thus we read every published version with extreme care."

      Public response by Gainey et al. to Reviewer 3: "We agree that our study was not exhaustive in our exploration of variables that might be interfering with our ability to detect F2 avoidance."

      Gainey et al. provide reasons/excuses for why they did not follow published methods - notably their subjective decision to exclude the paralyzing agent sodium azide from their choice assays, but their abstract reads "We conclude that this example of transgenerational inheritance lacks robustness." I strongly disagree with this conclusion.

    1. Reviewer #2 (Public review):

      Parkes et al. combined real-time keypoint tracking with transdermal activation of sensory neurons to examine the effects of recruitment of sensory neurons in freely moving mice. This builds on the authors' previous investigations involving transdermal stimulation of sensory neurons in stationary mice. They illustrate multiple scenarios in which their engineering improvements enable more sophisticated behavioral assessments, including (1) stimulation of animals in multiple states in large arenas, (2) multi-animal nociceptive behavior screening through thermal and optogenetic activation, and (3) stimulation of animals running through maze corridors. Overall, the experiments and the methodology, in particular, are written clearly. However, there are multiple concerns and opportunities to fully describe their newfound capabilities that, if addressed, would make it more likely for the community to adopt this methodology:

      The characterization of laser spot size and power density is reported as a coefficient of variation, in which a value of ~3 is interpreted as uniform. My interpretation would differ - data spread so that the standard deviation is three times larger than the mean indicates there is substantial variability in the data. The 2D polynomial fit is shown in Figure 2 - Figure Supplement 1A and, if the fit is good, this does support the uniformity claim (range of spot size is 1.97 to 2.08 mm2 and range of power densities is 66.60 to 73.80 mW). The inclusion of the raw data for these measurements and an estimate of the goodness of fit to the polynomials would better help the reader evaluate whether these parameters are uniform across space and how stable the power density is across repeated stimulations of the same location. Even more helpful would be an estimate of whether the variation in the power density is expected to meaningfully affect the responses of ChR2-expressing sensory neurons.

      While the error between the keypoint and laser spot error was reported as ~0.7 to 0.8 mm MAE in Figure 2L, in the methods, the authors report that there is an additional error between predicted keypoints and ground-truth labeling of 1.36 mm MAE during real-time tracking. This suggests that the overall error is not submillimeter, as claimed by the authors, but rather on the order of 1.5 - 2.5 mm, which is considerable given the width of a hind paw is ~5-6 mm and fore paws are even smaller. In my opinion, the claim for submillimeter precision should be softened and the authors should consider that the area of the paw stimulated may differ from trial to trial if, for example, the error is substantial enough that the spot overlaps with the edge of the paw.

      As the major advance of this paper is the ability to stimulate animals during ongoing movement, it seems that the Figure 3 experiment misses an opportunity to evaluate state-dependent whole-body reactions to nociceptor activation. How does the behavioral response relate to the animal's activity just prior to stimulation?

      Given the characterization of full-body responses to activation of TrpV1 sensory neurons in Figure 4 and in the authors' previous work, stimulation of TrpV1 sensory neurons has surprisingly subtle effects as the mice run through the alternating T maze. The authors indicate that the mice are moving quickly and thus that precise targeting is required, but no evidence is shared about the precision of targeting in this context beyond images of four trials. From the characterization in Figure 2, at max speed (reported at 241 +/- 53 mm/s, which is faster than the high speeds in Figure 2), successful targeting occurs less than 50% of the time. Is the initial characterization consistent with the accuracy in this context? To what extent does inaccuracy in targeting contribute to the subtlety of affecting trajectory coherence and speed? Is there a relationship between animal speed and disruption of the trajectory?

  2. Mar 2025
    1. Reviewer #2 (Public review):

      - Approach

      In this study, Yogesh et al. aimed at characterizing hemodynamic occlusion in two photon imaging, where its effects on signal fluctuations are underappreciated compared to that in wide field imaging and fiber photometry. The authors used activity-independent GFP fluorescence, GCaMP and GRAB sensors for various neuromodulators in two-photon and widefield imaging during a visuomotor context to evaluate the extent of hemodynamic occlusion in V1 and ACC. They found that the GFP responses were comparable in amplitude to smaller GCaMP responses, though exhibiting context-, cortical region-, and depth-specific effects. After quantifying blood vessel diameter change and surrounding GFP responses, they argued that GFP responses were highly correlated with changes in local blood vessel size. Furthermore, when imaging with GRAB sensors for different neuromodulators, they found that sensors with lower dynamic ranges such as GRAB-DA1m, GRAB-5HT1.0, and GRAB-NE1m exhibited responses most likely masked by the hemodynamic occlusion, while a sensor with larger SNR, GRAB-ACh3.0, showed much more distinguishable responses from blood vessel change. They thoroughly investigate other factors that could contribute to these signals and demonstrate hemodynamic occlusion is the primary cause.

      - Impact of revision

      This is an important update to the initial submission, adding much supplemental imaging and population data that provide greater detail to the analyses and increase the confidence in the authors conclusions.

      Specifically, inclusion of the supplemental figures 1 and 2 showing GFP expression across multiple regions and the fluorescence changes of thousands of individual neurons provides a clearer picture of how these effects are distributed across the population. Characterization of brain motion across stimulation conditions in supplemental figure 5 provides strong evidence that the fluorescence changes observed in many of the conditions are unlikely to be primarily due to brain motion associated imaging artifacts. The role of vascular area on fluorescence is further supported by addition of new analyses on vasoconstriction leading to increased fluorescence in Figures 4C1-4, complementing the prior analyses of vasodilation.

      The expansion of the discussion on other factors that could lead to these changes is thorough and welcome. The arguments against pH playing a factor in fluorescence changes of GFP, due to insensitivity to changes in the expected pH range are reasonable, as are the other discussed potential factors.

      With respect to the author's responses to prior critique, we agree that activity dependent hemodynamic occlusion is best investigated under awake conditions. Measurement of these dynamics under anesthesia could lead to an underestimation of their effects. Isoflurane anesthesia causes significant vasodilation and a large reduction in fluorescence intensity in non-functional mutant GRABs. This could saturate or occlude activity dependent effects.

      - Strengths

      This work is of broad interest to two photon imaging users and GRAB developers and users. It thoroughly quantifies the hemodynamic driven GFP response and compares it to previously published GCaMP data in a similar context, and illustrates the contribution of hemodynamic occlusion to GFP and GRAB responses by characterizing the local blood vessel diameter and fluorescence change. These findings provide important considerations for the imaging community and a sobering look at the utility of these sensors for cortical imaging.

      Importantly, they draw clear distinctions between the temporal dynamics and amplitude of hemodynamic artifacts across cortical regions and layers. Moreover, they show context dependent (Dark versus during visual stimuli) effects on locomotion and optogenetic light-triggered hemodynamic signals.

      The authors suggest that signal to noise ratio of an indicator likely affects the ability to separate hemodynamic response from the underlying fluorescence signal. With a new analysis (Supplemental Figure 4) They show that the relative degree of background fluorescence does not affect the size of the artifact.

      Most of the first generation neuromodulator GRAB sensors showed relatively small responses, comparable to blood vessel changes in two photon imaging, which emphasizes a need for improved the dynamic range and response magnitude for future sensors and encourages the sensor users to consider removing hemodynamic artifacts when analyzing GRAB imaging data.

      - Weaknesses

      The largest weakness of the paper remains that, while they convincingly quantify hemodynamic artifacts across a range of conditions, they provide limited means of correcting for them. However they now discuss the relative utility of some hemodynamic correction methods (e.g. from Ocana-Santero et al., 2024).

      The paper attributes the source of 'hemodynamic occlusion' primarily to blood vessel dilation, but leaves unanswered how much may be due to shifts in blood oxygenation. Figure 4 directly addresses the question of how much of the signal can be attributed to occlusion by measuring the blood vessel dilation, and has been improved by now showing positive fluorescence effects with vasoconstriction. They now also discuss the potential impact of oxygenation.

      Along these lines, the authors carefully quantified the correlation between local blood vessel diameter and GFP response (or neuropil fluorescence vs blood vessel fluorescence with GRAB sensors). We are left to wonder to what extent does this effect depend on proximity to the vessels? Do GFP/ GRAB responses decorrelate from blood vessel activity in neurons further from vessels (refer to Figure 5A and B in Neyhart et al., Cell Reports 2024)? The authors argue that the primary impact of occlusion is from blood vessels above the plane of imaging, but without a vascular reconstruction, their evidence for this is anecdotal.

      The choice of ACC as the frontal region provides a substantial contrast in location, brain movement, and vascular architecture as compared to V1. As the authors note, ACC is close to the superior sagittal sinus and thus is the region where the largest vascular effects are likely to occur. A less medial portion of M2 may have been a more appropriate comparison. The authors now include example imaging fields for ACC and interesting out-of-plane vascular examples in the supplementary figures that help assess these impacts.

      -Overall Assessment

      This paper is an important contribution to our understanding of how hemodynamic artifacts may corrupt GRAB and calcium imaging, even in two-photon imaging modes. While it would be wonderful if the authors were able to demonstrate a reliable way to correct for hemodynamic occlusion which did not rely on doing the experiments over with a non-functional sensor or fluorescent protein, the careful measurement and reporting of the effects here is, by itself, a substantial contribution to the field of neural activity imaging. It's results are of importance to anyone conducting two-photon or widefield imaging with calcium and GRAB sensors and deserves the attention of the broader neuroscience and in-vivo imaging community.

    1. Reviewer #3 (Public review):

      This paper addresses a long-standing problem in microbiology: the evolution of bacterial cell shape. Bacterial cells can take a range of forms, among the most common being rods and spheres. The consensus view is that rods are the ancestral form and spheres the derived form. The molecular machinery governing these different shapes is fairly well understood but the evolutionary drivers responsible for the transition between rods and spheres is not. Enter Yulo et al.'s work. The authors start by noting that deletion of a highly conserved gene called MreB in the Gram-negative bacterium Pseudomonas fluorescens reduces fitness but does not kill the cell (as happens in other species like E. coli and B. subtilis) and causes cells to become spherical rather than their normal rod shape. They then ask whether evolution for 1000 generations restores the rod shape of these cells when propagated in a rich, benign medium.

      The answer is no. The evolved lineages recovered fitness by the end of the experiment, growing just as well as the unevolved rod-shaped ancestor, but remained spherical. The authors provide an impressively detailed investigation of the genetic and molecular changes that evolved. Their leading results are:

      (1) The loss of fitness associated with MreB deletion causes high variation in cell volume among sibling cells after cell division;<br /> (2) Fitness recovery is largely driven by a single, loss-of-function point mutation that evolves within the first ~250 generations that reduces the variability in cell volume among siblings;<br /> (3) The main route to restoring fitness and reducing variability involves loss of function mutations causing a reduction of TPase and peptidoglycan cross-linking, leading to a disorganized cell wall architecture characteristic of spherical cells.

      The inferences made in this paper are on the whole well supported by the data. The authors provide a uniquely comprehensive account of how a key genetic change leads to gains in fitness and the spectrum of phenotypes that are impacted and provide insight into the molecular mechanisms underlying models of cell shape.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors investigate the optical properties of brochosomes produced by leafhoppers. They hypothesize that brochosomes reduce light reflection on the leafhopper's body surface, aiding in predator avoidance. Their hypothesis is supported by experiments involving jumping spiders. Additionally, the authors employ a variety of techniques including micro-UV-Vis spectroscopy, electron microscopy, transcriptome and proteome analysis, and bioassays. This study is highly interesting, and the experimental data is well-organized and logically presented.

      Strengths:

      The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage. This work provides the first biological evidence demonstrating that natural brochosomes can be used as a camouflage coating to reduce the leafhoppers' observability to their predators. The design of the experiments is novel.

      Weaknesses:

      (1) The observation that brochosome coatings become sparse after 25 days in both male and female leafhoppers, resulting in increased predation by jumping spiders, is intriguing. However, since leafhoppers consistently secrete and groom brochosomes, it would be beneficial to explore why brochosomes become significantly less dense after 25 days.

      (2) The authors demonstrate that brochosome coatings reduce UV (specular) reflection compared to surfaces without brochosomes, which can be attributed to the rough geometry of brochosomes as discussed in the literature. However, it would be valuable to investigate whether the proteins forming the brochosomes are also UV absorbing.

      (3) The experiments with jumping spiders show that brochosomes help leafhoppers avoid predators to some extent. It would be beneficial for the authors to elaborate on the exact mechanism behind this camouflage effect. Specifically, why does reduced UV reflection aid in predator avoidance? If predators are sensitive to UV light, how does the reduced UV reflectance specifically contribute to evasion?

      (4) An important reference regarding the moth-eye effect is missing. Please consider including the following paper: Clapham, P. B., and M. C. Hutley. "Reduction of lens reflection by the 'Moth Eye' principle." Nature 244: 281-282 (1973).

      (5) The introduction should be revised to accurately reflect the related contributions in literature. Specifically, the novelty of this work lies in the demonstration of the camouflage effect of brochosomes using jumping spiders, which is verified for the first time in leafhoppers. However, the proposed use of brochosome powder for camouflage was first described by R.B. Swain (R.B. Swain, Notes on the oviposition and life history of the leafhopper Oncometopta undata Fabr. (Homoptera: Cicadellidae), Entomol. News. 47: 264-266 (1936)). Recently, the antireflective and potential camouflage functions of brochosomes were further studied by Yang et al. based on synthetic brochosomes and simulated vision techniques (S. Yang, et al. "Ultra-antireflective synthetic brochosomes." Nature Communications 8: 1285 (2017)). Later, Lei et al. demonstrated the antireflective properties of natural brochosomes in 2020 (C.-W. Lei, et al., "Leafhopper wing-inspired broadband omnidirectional antireflective embroidered ball-like structure arrays using a nonlithography-based methodology." Langmuir 36: 5296-5302 (2020)). Very recently, Wang et al. successfully fabricated synthetic brochosomes with precise geometry akin to those natural ones, and further elucidated the antireflective mechanisms based on the brochosome geometry and their role in reducing the observability of leafhoppers to their predators (L. Wang et al. "Geometric design of antireflective leafhopper brochosomes." Proceedings of the National Academy of Sciences 121: e2312700121 (2024)).

      Comments on revisions:

      In this revision, the authors have addressed some of the key concerns I raised in our previous comments. However, a few issues remain unaddressed. Additionally, the new experimental data introduced in the manuscript require further clarification, which I outline below.

      (1) As I pointed out in my previous review comments, "The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage." While the authors did cite the original hypothesis proposed by R.B. Swain (1936), they have omitted important references that provide evidence on the use of antireflective properties of brochosomes for camouflage in a synthetic setting (see for example, Fig. 5a of S. Yang, et al. Nat. Commun. 8:1285, 2017). The authors are recommended to revise the Abstract and Introduction accordingly to ensure a fair and accurate representation of the existing literature.

      (2) The antireflection mechanisms of brochosome structures have been discussed in detail, specifically, how their geometries (i.e., brochosome diameter and pore size) contribute to reducing UV reflectance (L. Wang, et al., PNAS. 121: e2312700121, 2024 and P. Banergee, et al., Advanced Photonics Research 4:2200343, 2023). The authors should incorporate these recent findings into their discussion (line 381 - line 383 of the manuscript).

      (3) The authors presented new data brochosomes deposited on a quartz slide and measured their reflectance across UV, visible light, and infrared wavelengths. Since reflectance is highly sensitive to the uniformity of brochosome coverage on the substrate, it is crucial to quantify this coverage across the measurement area for comparison. While the authors include SEM images to illustrate the packing of brochosomes on both the leafhopper wing and the quartz substrate (Fig. S7) at a microscopic scale (~10 um view), it would be beneficial to also provide SEM images at a larger scale (e.g., 100 um - 1 mm) and quantify the density of brochosomes per unit area for comparison.

      (4) For the negative control using acetone to remove the brochosomes the leafhopper wing, have the authors confirmed the absence of brochosomes after treatment? If so, the authors should explicitly indicate this for clarity.

    1. Reviewer #2 (Public review):

      Summary

      This manuscript explores the transcriptomic identities of olfactory ensheathing cells (OECs), glial cells that support life-long axonal growth in olfactory neurons, as they relate to spinal cord injury repair. The authors show that transplantation of cultured, immunopurified rodent OECs at a spinal cord injury site can promote injury-bridging axonal regrowth. They then characterize these OECs using single-cell RNA sequencing, identifying five subtypes and proposing functional roles that include regeneration, wound healing, and cell-cell communication. They identify one progenitor OEC subpopulation and also report several other functionally relevant findings, notably, that OEC marker genes contain mixtures of other glial cell type markers (such as for Schwann cells and astrocytes), and that these cultured OECs produce and secrete Reelin, a regrowth-promoting protein that has been disputed as a gene product of OECs.

      Strengths

      This manuscript offers an extensive, cell-level characterization of OECs, supporting their potential therapeutic value for spinal cord injury and suggesting potential underlying repair mechanisms. The authors use various approaches to validate their findings, providing interesting images that show the overlap between sprouting axons and transplanted OECs, and showing that OEC marker genes identified using single-cell RNA sequencing are present in vivo, in both olfactory bulb tissue and spinal cord after OEC transplantation.

      Concerns about quantification raised during the review were suitably addressed by the authors.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript, the authors ran a dual task. Subjects monitored a peripheral location for a target onset (to generate a saccade to), and they also monitored a foveal location for a foveal probe. The foveal probe could be congruent or incongruent with the orientation of the peripheral target. In this study, the authors manipulated the conspicuity of the peripheral target, and they saw changes in performance in the foveal task.

      Comments on revisions:

      The authors have addressed all comments. Thanks.

    1. Reviewer #2 (Public review):

      Summary:

      Velichko, et al. investigate the role played by the long intrinsically disordered protein Trecle in nucleolar morphology and function, with an interest in its potential ability to undergo condensation. The authors explore Treacle's role in core functions of the nucleolus (rRNA biogenesis and DNA repair), which has been a subject of continual investigation since it was identified that truncation of Treacle is the primary genetic cause of Treacher-Collins syndrome. They show that knock out of Treacle leads to de-mixing of canonical markers of the FC (UBF, RPA194) and DFC (FBL) phases of the nucleolus. They also show that replacing Treacle with mutants that either remove the central region of Treacle (∆83-1121) or reduce the segregation of charged residues by scrambling them (CS- Charge Scrambled) results in different FRAP behavior of the condensates that result from Treacle over-expression. These data give new insight into the role played by the charge-segregated central region of Treacle in terms of having the potential to undergo condensation.

      Strengths:

      The characterizations of changes to nuclear morphology upon Treacle knockout is the strength of this study. The authors characterized effects on the canonical markers of the FC and DFC phases support the idea that Treacle has a scaffolding function. While the effect of Treacle perturbations has been studied before, this has often been investigated in the context of organismal development or rRNA biogenesis and less often at the sub-cellular level, as the authors have carried out.

      Another strength of this study is its characterization of the effects of the charge scramble mutant. The authors find that replacing endogenous Treacle with this mutant reduces the bulk dynamics of Treacle as assessed by FRAP, de-mixes FBL from the DFC, lowers pre-rRNA synthesis, and abolishes the recruitment of the DNA-damage response factor TOPBP1.

      Weaknesses:

      The conclusion that Treacle is a core scaffold of the FC is weakly supported. Recombinant Treacle has intrinsic potential to condense, and its condensation is disrupted by the expected solution conditions (i.e., condensates fail to form at high salt but do form in the presence of an aliphatic alcohol). It should be kept in mind that all proteins will condense at sufficiently high concentrations and under crowding. The authors observed condensation at 100uM protein and 5% PEG8000.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide compelling evidence that stimulation of epidermal cells in Drosophila larvae results in the stimulation of sensory neurons that evoke a variety of behavioral responses. Further, the authors demonstrate that epidermal cells are inherently mechanoresponsive and implicate a role for store-operated calcium entry (mediated by Stim and Orai) in the communication to sensory neurons.

      Strengths:

      The study represents a significant advance in our understanding of mechanosensation. Multiple strengths are noted. First, the genetic analyses presented in the paper are thorough with appropriate consideration to potential confounds. Second, behavioral studies are complemented by sophisticated optogenetics and imaging studies. Third, identification of roles for store-operated calcium entry is intriguing. Lastly, conservation of these pathways in vertebrates raise the possibility that the described axis is also functional in vertebrates.

      Weaknesses:

      The study has a few conceptual weaknesses that are arguably minor. The involvement of store-operated calcium entry implicates ER calcium store release. Whether mechanical stimulation evokes ER calcium release in epidermal cells and how this might come about (e.g., which ER calcium channels, roles for calcium-induced calcium release etc.) remains unaddressed. On a related note, the kinetics of store-operated calcium entry is very distinct from that required for SV release. The link between SOC and epidermal cells-neuron transmission is not reconciled. Finally, it is not clear how optogenetic stimulation of epidermal cells results in the activation of SOC.

      Revised manuscript:

      The authors have adequately addressed my original concerns.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript proposes that the use of a latent cause model for the assessment of memory-based tasks may provide improved early detection of Alzheimer's Disease as well as more differentiated mapping of behavior to underlying causes. To test the validity of this model, the authors use a previously described knock-in mouse model of AD and subject the mice to several behaviors to determine whether the latent cause model may provide informative predictions regarding changes in the observed behaviors. They include a well-established fear learning paradigm in which distinct memories are believed to compete for control of behavior. More specifically, it's been observed that animals undergoing fear learning and subsequent fear extinction develop two separate memories for the acquisition phase and the extinction phase, such that the extinction does not simply 'erase' the previously acquired memory. Many models of learning require the addition of a separate context or state to be added during the extinction phase and are typically modeled by assuming the existence of a new state at the time of extinction. The Niv research group, Gershman et al. 2017, have shown that the use of a latent cause model applied to this behavior can elegantly predict the formation of latent states based on a Bayesian approach, and that these latent states can facilitate the persistence of the acquisition and extinction memory independently. The authors of this manuscript leverage this approach to test whether deficits in the production of the internal states, or the inference and learning of those states, may be disrupted in knock-in mice that show both a build-up of amyloid-beta plaques and a deterioration in memory as the mice age.

      Strengths:

      I think the authors' proposal to leverage the latent cause model and test whether it can lead to improved assessments in an animal model of AD is a promising approach for bridging the gap between clinical and basic research. The authors use a promising mouse model and apply this to a paradigm in which the behavior and neurobiology are relatively well understood - an ideal situation for assessing how a disease state may impact both the neurobiology and behavior. The latent cause model has the potential to better connect observed behavior to underlying causes and may pave a road for improved mapping of changes in behavior to neurobiological mechanisms in diseases such as AD.

      Weaknesses:

      I have several substantial concerns which I've detailed below. These include important details on how the behavior was analyzed, how the model was used to assess the behavior, and the interpretations that have been made based on the model.

      (1) There is substantial data to suggest that during fear learning in mice separate memories develop for the acquisition and extinction phases, with the acquisition memory becoming more strongly retrieved during spontaneous recovery and reinstatement. The Gershman paper, cited by the authors, shows how the latent causal model can predict this shift in latent states by allowing for the priors to decay over time, thereby increasing the posterior of the acquisition memory at the time of spontaneous recovery. In this manuscript, the authors suggest a similar mechanism of action for reinstatement, yet the model does not appear to return to the acquisition memory state after reinstatement, at least based on the examples shown in Figures 1 and 3. Rather, the model appears to mainly modify the weights in the most recent state, putatively the 'extinction state', during reinstatement. Of course, the authors must rely on how the model fits the data, but this seems problematic based on prior research indicating that reinstatement is most likely due to the reactivation of the acquisition memory. This may call into question whether the model is successfully modeling the underlying processes or states that lead to behavior and whether this is a valid approach for AD.

      (2) As stated by the authors in the introduction, the advantage of the fear learning approach is that the memory is modified across the acquisition-extinction-reinstatement phases. Although perhaps not explicitly stated by the authors, the post-reinstatement test (test 3) is the crucial test for whether there is reactivation of a previously stored memory, with the general argument being that the reinvigorated response to the CS can't simply be explained by relearning the CS-US pairing, because re-exposure the US alone leads to increase response to the CS at test. Of course there are several explanations for why this may occur, particularly when also considering the context as a stimulus. This is what I understood to be the justification for the use of a model, such as the latent cause model, that may better capture and compare these possibilities within a single framework. As such, it is critical to look at the level of responding to both the context alone and to the CS. It appears that the authors only look at the percent freezing during the CS, and it is not clear whether this is due to the contextual US learning during the US re-exposure or to increased response to the CS - presumably caused by reactivation of the acquisition memory. For example, the instance of the model shown in Figure 1 indicates that the 'extinction state', or state z6, develops a strong weight for the context during the reinstatement phase of presenting the shock alone. This state then leads to increased freezing during the final CS probe test as shown in the figure. By not comparing the difference in the evoked freezing CR at the test (ITI vs CS period), the purpose of the reinstatement test is lost in the sense of whether a previous memory was reactivated - was the response to the CS restored above and beyond the freezing to the context? I think the authors must somehow incorporate these different phases (CS vs ITI) into their model, particularly since this type of memory retrieval that depends on assessing latent states is specifically why the authors justified using the latent causal model.

      (3) This is related to the second point above. If the question is about the memory processes underlying memory retrieval at the test following reinstatement, then I would argue that the model parameters that are not involved in testing this hypothesis be fixed prior to the test. Unlike the Gershman paper that the authors cited, the authors fit all parameters for each animal. Perhaps the authors should fit certain parameters on the acquisition and extinction phase, and then leave those parameters fixed for the reinstatement phase. To give a more concrete example, if the hypothesis is that AD mice have deficits in differentiating or retrieving latent states during reinstatement which results in the low response to the CS following reinstatement, then perhaps parameters such as the learning rate should be fixed at this point. The authors state that the 12-month-old AD mice have substantially lower learning rate measures (almost a 20-fold reduction!), which can be clearly seen in the very low weights attributed to the AD mouse in Figure 3D. Based on the example in Figure 3D, it seems that the reduced learning rate in these mice is most likely caused by the failure to respond at test. This is based on comparing the behavior in Figures 3C to 3D. The acquisition and extinction curves appear extremely similar across the two groups. It seems that this lower learning rate may indirectly be causing most of the other effects that the authors highlight, such as the low σx, and the changes to the parameters for the CR. It may even explain the extremely high K. Because the weights are so low, this would presumably lead to extremely low likelihoods in the posterior estimation, which I guess would lead to more latent states being considered as the posterior would be more influenced by the prior.

      (4) Why didn't the authors use the latent causal model on the Barnes maze task? The authors mention in the discussion that different cognitive processes may be at play across the two tasks, yet reversal tasks have been suggested to be solved using latent states to be able to flip between the two different task states. In this way, it seems very fitting to use the latent cause model. Indeed, it may even be a better way to assess changes in σx as there are presumably 12 observable stimuli/locations.

    1. Reviewer #2 (Public review):

      Summary:

      The current dataset utilized a 2x2 factorial shuttle-escape task in combination with extracellular single-unit recording in the anterior cingulate cortex (ACC) of mice to determine ACC action coding. The contributions of neocortical signaling to action-outcome learning as assessed by behavioral tasks outside of the prototypical reward versus non-reward or punished vs non-punished is an important and relevant research topic, given that ACC plays a clear role in several human neurological and psychiatric conditions. The authors present useful findings regarding the role of ACC in action monitoring and learning. The core methods themselves - electrophysiology and behavior - are adequate; however, the analyses are incomplete since ruling out alternative explanations for neural activity, such as movement itself, requires substantial control analyses, and details on statistical methods are not clear.

      Strengths:

      (1) The factorial design nicely controls for sensory coding and value coding, since the same stimulus can signal different actions and values.

      (2) The figures are mostly well-presented, labeled, and easy to read.

      (3) Additional analyses, such as the 2.5/7.5s windows and place-field analysis, are nice to see and indicate that the authors were careful in their neural analyses.

      (4) The n-trial + 1 analysis where ACC activity was higher on trials that preceded correct responses is a nice addition, since it shows that ACC activity predicts future behavior, well before it happens.

      (5) The authors identified ACC neurons that fire to shuttle crossings in one direction or to crossings in both directions. This is very clear in the spike rasters and population-scaled color images. While other factors such as place fields, sensory input, and their integration can account for this activity, the authors discuss this and provide additional supplemental analyses.

      Weaknesses:

      (1) The behavioral data could use slightly more characterization, such as separating stay versus shuttle trials.

      (2) Some of the neural analyses could use the necessary and sufficient comparisons to strengthen the authors' claims.

      (3) Many of the neural analyses seem to utilize long time windows, not leveraging the very real strength of recording spike times. Specifics on the exact neural activity binning/averaging, tests, classifier validation, and methods for quantification are difficult to find.

      (4) The neural analyses seem to suggest that ACC neurons encode one variable or the other, but are there any that multiplex? Given the overwhelming evidence of multiplexing in the ACC a bit more discussion of its presence or absence is warranted.

    1. Reviewer #2 (Public review):

      This study provides some interesting observations on how different flavors of e-cigarettes can affect lung immunology, however there are numerous flaws including a low number of replicates and a lack of effective validation methods which reduces the robustness and rigor of the findings.

      Strengths:

      The strength of the study is the successful scRNA-seq experiment which gives good preliminary data that can be used to create new hypotheses in this area.

      Weaknesses:

      The major weakness is the low number of replicates and the limited analysis methods. Two biological n per group is not acceptable to base any solid conclusions. Any validatory data was too little (only cell % data) and did not always support the findings (e.g. Figure 4D does not match 4C). Often n seems to be combined and only one data point is shown, it is not at all clear how the groups were analysed and how many cells in each group were compared.

      Other specific weaknesses were identified in addition to the ones above:

      (1) Only 71,725 cells means only 7,172 per group, which is 3,586 per animal - how many of these were neutrophils, T-cells, and macrophages? This was not shown and could be too low.

      (2) The dynamic range of RNA measurement using scRNAseq is known to be limited - how do we know whether genes are not expressed or just didn't hit detection? This links into the Ly6G negative neutrophil comment, but in general, the lack of gene expression in this kind of data should be viewed with caution, especially with a low n number and few cells.

      (3) There is no rigorous quantification of Ly6G+ and Ly6G- cells int he flow cytometry data.

      (4) Eosinophils are heavily involved in lung biology but are missing from the analysis.

      (5) The figures had no titles so were difficult to navigate.

      (6) PGVG is not defined and not introduced early enough.

      (7) Neutrophils are not well known to proliferate, so any claims about proliferation need to be accompanied by validation such as BrdU or other proliferation assays.

      (8) It was not clear how statistics were chosen and why Table S2 had a good comparison (two-way ANOVA with gender as a variable) but this was not used for other data particularly when looking at more functional RNA markers (Table S2 also lacks the interaction statistic which is most useful here).

      (9) Many statistics are only vs air control, but it would be more useful as a flavour comparison to see these vs PGVG. In some cases, the carrier PGVG looks worse than some of the flavours (which have nicotine).

      (10) The n number is a large issue, but in Figures such as 4, 6, and 7 it could be a bigger factor. The number of significant genes identified has been determined by chance rather than any real difference, e.g. Is Il1b not identified in Fruit flavour vs air because there wasn't enough n, while in Air vs Tobacco, it randomly hit the significance mark. This is but an example of the problems with the analysis and conclusions

      (11) The data in Figure 7A is confusing, if this is a comparison to air, then why does air vs air not equal 1? Even if this was the comparison to the average of air between males and females, then this doesn't explain why CCL12 is >1 in both. Is this z-score instead? Regardless the data is difficult to interpret in this format.

      (12) Individual n was not shown for almost all experiments - e.g. Figure 1D - what is this representative of? Figure 2D - is this bulk-grouped data for all cells and all mice? The heatmaps are also pooled from 2n and don't show the variability.

    1. Reviewer #2 (Public review):

      Summary:

      The authors aimed to find out how - and how well - adult and adolescent mice discriminate tones of different frequencies and whether there are differences in processing at the level of the auditory cortex that might explain differences in behavior between the two groups. Adolescent mice were found to be worse at sound frequency discrimination than adult mice. The performance difference between the groups was most pronounced when the sounds were close in frequency and thus difficult to distinguish, and could, at least in part, be attributed to the younger mice's inability to withhold licking in no-go trials. By recording the activity of individual neurons in the auditory cortex when mice performed the task or were passively listening as well as in untrained mice the authors identified differences in the way that the adult and adolescent brains encode sounds and the animals' choice that could potentially contribute to the differences in behavior.

      Strengths:

      The study combines behavioural testing in freely-moving and head-fixed mice, optogenetic manipulation, and high-density electrophysiological recordings in behaving mice to address important open questions about age differences in sound-guided behavior and sound representation in the auditory cortex.

      Weaknesses:

      For some of the analyses that the authors conducted it is unclear what the rationale behind them is and, consequently, what conclusion we can draw from them. The results of the optogenetic manipulation, while very interesting, warrant a more in-depth discussion.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, Chittajallu and colleagues present compelling evidence that mu opioid receptor (MOR) activation can potentiate synaptic neurotransmission in a medial habenula to interpeduncular nucleus (mHb-IPN) subcircuit. While, projections from mHb tachykinin 1 (Tac1) neurons onto lateral IPN neurons show a canonical opioid-induced synaptic depression in glutamate release, excitatory neurotransmission in mHb choline acetyltransferase (ChAT) projections to the rostral IPN is potentiated by opioids. This process may require the inhibition of voltage-gated potassium channels (Kv1.2) and results in an augmented co-release of glutamate and acetylcholine. This function emerges around age P27 in mice, when MOR expression in the IPN peaks.

      Strengths:

      Carefully executed electrophysiological experiments with appropriate controls. Interesting description of a neurodevelopmental change in the effects of opioids on mHb-IPN signaling.

      Weaknesses:

      The genetic strategy used to target the mHb-IPN pathway (constitutive expression in all ChAT+ and Tac1+ neurons) is not specific to this projection. In addition, a braking mechanism involving Kv1.2 has not been identified.

    1. Reviewer #2 (Public review):

      Summary:

      The authors follow up their preclinical work on beta-glucan-induced trained immunity in murine tumor models that they published in Cell in 2020. In particular, they focus on the role of trained immunity and efferocytosis of cancer cells

      Strengths:

      While properly conducted, the work is underwhelming and fully depends on in vitro observations performed with co-cultures of bone marrow derived macrophages from beta-glucan-treated mice and tumor cell lines. From these in vitro studies, the authors conclude that trained immunity induction has no effect on antibody-dependent cellular phagocytosis, while it decreases efferocytosis.

      Weaknesses:

      It would be important to study these phenomena in tumor mouse models in vivo. The authors clearly have the expertise as they have shown in previous studies. Especially because the in vitro observation appears to conflict with the in vivo anti-tumor found in mice prophylactically treated with beta-glucan. Clearly, trained immunity is associated with diverse cellular responses and mechanisms, some of which may promote tumor growth, as the current manuscript suggests, but in the absence of in vivo studies, it is merely a mechanistic exercise of which the relevance is difficult to determine.

    1. Reviewer #2 (Public review):

      Summary:

      This study uses functional MRI to evaluate visual contrast sensitivity across the visual field at the level of the visual cortex, testing the method in a small group of normally sighted individuals and one with sight loss as proof of principle. The results suggest a promising technique to measure vision objectively across the visual field and overcomes the requirement for careful fixation which is often challenging in those with low vision or sight loss.

      Strengths:

      (1) Objective measure of central vision: The proposed method may provide a more comprehensive and objective assessment of residual visual function in individuals with sight loss. This may be particularly useful for those with central visual field loss without the requirement of stable fixation or subjective motor responses.

      (2) More sensitive measure: The use of slope to calculate contrast sensitivity across a range of contrasts within the brain is clever and likely more sensitive than single threshold measurements or standard clinical measures of visual acuity using letter charts. Standard supra-threshold (high contrast) tests are not ideal for capturing residual vision or partial vision loss.

      (3) Good agreement with standard atlas: The Benson atlas provides a good estimate of visual field maps within V1 based on anatomical landmarks, and the authors take steps to refine this informed by cortical magnification and V1 surface area (brain size) for each individual participant. This could allow the technique to be generalised without the need to collect lengthy individual mapping data from every participant.

      (4) Within-subject reproducibility: The measurements appear to be sensitive and reproducible, particularly in those with normal vision, and are consistent with known features of visual sensitivity differences in different parts of the visual field.

      (5) Potential tool to measure visual field sensitivity in controls: Even if the proposed methods are not ideal for widespread clinical translation, they do offer an exciting tool to test hypotheses about visual field differences in healthy controls. For example, there seems to be an increase in sensitivity on either side of the simulated ring scotoma (Figure 6 - perhaps due to the release of lateral inhibition?). Reliability measures suggest that individual differences are consistent in healthy controls (although not tested statistically, perhaps due to the small sample size?). Whether they reflect behaviourally meaningful differences in visual field sensitivity could be tested in individuals by comparing them to behavioural measures across the visual field.

      (6) Potential tool to test novel treatments: The proposed techniques could be used to test within-subject changes in visual function in environments that are equipped to measure and analyse fMRI data, including clinical trials aimed at determining the success of novel treatments. Further testing should reveal whether the method is suitable for testing low-vision patients with unstable fixation (e.g., nystagmus) and whether this affects slope and contrast sensitivity estimates. In theory, it should not have a substantial effect, except perhaps in regions near the stimulus edges.

      Weaknesses:

      (1) Questionable sensitivity to differences in patients. The variability in heat maps across healthy control participants is somewhat surprising. Do differences between individuals represent actual visual sensitivity differences, or are they an artifact of the measurement technique, e.g., due to signal-to-noise differences introduced by local variations in brain anatomy? Will the substantial variance across controls allow for a sufficiently stable baseline to detect meaningful differences in individual patients? Also, as the authors rightly point out, Benson atlas does not model differences along meridians, so upper/lower field differences might not be detectable.

      (2) Effects of unstable fixation/eye movements not explicitly tested: The methods state, 'In all tasks, participants were asked to report when the color of a central fixation dot changed', suggesting participants maintained fairly good fixation. Most of the results seem to pertain to measurements where central fixation is required. How does unstable fixation affect measurements?

      (3) Potential for clinical translation. Although it is a sensitive measure, functional MRI is costly, is not available in all clinical settings, requires significant post-processing analyses, and may be contraindicated in some individuals due to safety (e.g., metallic implants) or other concerns (e.g., claustrophobia). These could present significant barriers to widespread clinical translation if this were the ultimate goal of the study.

      (4) Limited range of spatial frequencies. The spatial frequencies tested were still quite low (0.3 and 3cpd) compared to measures such as visual acuity. Extending the measurements to higher spatial frequencies could allow better characterization of central vision, although necessarily for peripheral vision.

    1. Reviewer #2 (Public review):

      The paper is well-written overall. The findings are clearly presented, and the data seems solid overall. I do have, however, a few major and some minor comments representing some concerns. My major comments are below.

      (1) This may seem somewhat semantic, yet, it has implications on the way the data is presented and moreover on the conclusions drawn - a single ganglion cannot show fictive crawling. It can demonstrate rhythmic patterns of activity that may serve in the (fictive) crawling motor pattern. The latter is a result of the intrinsic within single-ganglion connectivity AND the inter-ganglia connections and interactions (coupling) among the sequential ganglia. It may be affected by both short-range and long-range connections (e.g., descending inputs) along the ganglia chain.

      (2) The point above is even more critical where the authors set to compare the motor pattern in single ganglia with the intact animals. It would have made much more sense to add a description of the motor pattern of a chain of interconnected ganglia. The latter would be expected to better resemble the intact animal. Furthermore, this project would have benefitted from a three-way comparison (isolated ganglion-interconnected ganglia-intact animal.

      (3) Two previous studies by the same group are repeatedly mentioned (Rela and Szczupak, 2003; Rodriguez et al., 2009) and serve as a basis for the current work. The aim of one of these previous studies was to assess the role of the NS neurons in regulating the function of motor networks. The other (Rodriguez et al., 2009) reported on a neuron (the NS) that can regulate the crawling motor pattern. LL 71-74 of the current report presents the aim of this study as evaluating the role of the known connectivity of the premotor NS neuron in shaping the crawling motor pattern. The authors should make it very clear what indeed served as background knowledge, what exactly was known about the circuitry beforehand, and what is different and new in the current study.

    1. Delegate Led Discussion - Big Bet Philanthropy

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Big Bet Philanthropy - Stop Reset Go - TPF - LCE - relevant to - event time conflict - with - Project Dandelion

    2. Delegate Led Discussion - Strategies for Action and Care

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Delegate Led Discussion - Strategies for Action and Care in Closing Civic Space - Stop Reset Go - Indyweb autonomy - relevant to - event time conflict - with - Project Dandelion

    3. Delegate Led Discussion - Tuning In: Music

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Delegate Led Discussion - Tuning In: Music, Deep Listening - Stop Reset Go - Deep Humanity BEing journeys - relevant to - event time conflict - with - Project Dandelion

    4. Creative Tensions: Collaboration, Compromise, and Convict

      for - program event selection - 2025 - April 3 - 10:30am-12pm GMT - Skoll World Forum - Creative Tension: Collaboration, Compromise and Conviction - Stop Reset Go - TPF - LCE - relevant to - event time conflict - with Aligning Profit and Purpose

    5. Aligning Profit and Purpose

      for - program event selection - 2025 - April 3 - 10:30am-12pm GMT - Skoll World Forum - Aligning Profit and Purpose - new portmanteau - greentruthing - opposite of greenwashing - Stop Reset Go - Deep Humanity - TPF - LCE - Greentruthing vs greenwashing - relevant to

    6. Delegate Led Discussion - The Changing State of AI, Media

      for - program event selection - 2025 - April 2 - 2-3:15pm GMT - Skoll World Forum - The Changing State of AI, Media - Indyweb - Stop Reset Go - TPF - Eric's project - Skoll's Participatory Media project - relevant to - adjacency - indyweb - Stop Reset Go - participatory news - participatory movie and tv show reviews - Eric's project - Skoll's Particiipatory Media - event time conflict - with - Leadership in Alien Times

      adjacency - between - Skoll's Participatory Media project - Global Witness - Indyweb - Stop Reset Go's participatory news idea - Stop Reset Go's participatory movie and TV show review idea - Eric's media project - adjacency relationship - Participatory media via Indyweb and idea of participatory news and participatory movie and tv show reviews - might be good to partner with Skoll Foundation's Participatory Media group

    7. Leadership in Alien Times

      for - program event selection - 2025 - April 2 - 2-3:30pm GMT - Skoll World Forum - Leadership in Alien Times - Stop Reset Go - Deep Humanity - LCE - transition - relevant to - event time conflict - with Building Comfort with Discomfort - solution - watch one live and the other recorded

    8. Comfort with Discomfort: Practices

      for - program event selection - 2025 - April 2 - 2-3:30 pm GMT - Skoll World Forum - Comfort with Discomfort: Practices for Lasting Social Change - Stop Reset Go - Deep Humanity - Common Human Denominators - LCE - relevant to - event time conflict - with - Leadership in Alien Times

    9. Philanthropy at a Crossroads: Can We Fund

      for - program event selection - 2025 - April 2 - 10:30am-12pm GMT - Skoll World Forum - Philanthropy at a Crossroads: Can we Fund at the Speed of Impacts? - Fellowship of the Sacred Commons - LCE - relevant to - event time conflict - with Building Citizen-led Movements - solution - watch one live and the other recorded - funding the commons

    10. Building Citizen-Led Movements to Reshape Civic Life

      for - program event selection - 2025 - April 2 - 10:30am-12pm GMT - Skoll World Forum - Building Citizen-ed Movements to Reshape Civic Life - Stop Reset Go - TPF - LCE - Building Citizen-Led Movements - relevant to

    Tags

    Annotators

    URL

    1. Reviewer #2 (Public Review):

      The main question asked by Umenati et al. is whether persister cells to ampicillin arise preferentially from dormant, non-dividing cells or from cells that are actively growing before antibiotic exposure. The authors tracked persister cells generated from populations at different growth phases and culture media using a microfluidic device coupled to fluorescence microscopy, which is a challenge due to the low frequency of these persister cells. One of the main conclusions is that the majority of persisters arising in exponentially-growing populations originated from actively-dividing cells before the antibiotic treatment, reinforcing the idea that dormancy is not a prerequisite for persister formation. The authors made use of a fluorescent reporter monitoring RpoS activity (RpoS-mCherry fusion) and observed that RpoS levels in these persister cells were low. In the few lineages that exhibited no growth before the ampicillin treatment, RpoS levels were low as well, indicating that RpoS is not a predictive marker for persistence. By performing the same experiment with early and late stationary phase cultures, the authors observed that the proportion of persister cells that originated from dormant cells before the ampicillin treatment is significantly increased under these conditions. In the late stationary phase condition, dormant cells were expressing high levels of RpoS. The authors suggested that RpoS-mCherry proteins form aggregates which were suggested by the authors to be a characteristic of 'deep dormancy'. These cells were mostly unable to restart growth after the antibiotic removal while others with the lowest levels of RpoS tended to be persister. Confirming that these cells indeed contain protein aggregates as well as determining the physiological state of these cells appears to be crucial.

    1. Reviewer #2 (Public review):

      Summary:

      Weiler et al use retrograde tracers, two-photon tomography, and automatic cell detection to provide a detailed quantitative description of the laminar and area sources of ipsi- and contralateral cortico-cortical inputs to two primary sensory areas and a primary motor area. They found considerable bilateral symmetry in the areas providing cortico-cortical inputs. However, although the same regions in both hemispheres tended to supply inputs, a larger proportion of inputs from contralateral areas originated from deeper layers (L5 and L6).

      Strengths:

      The study applies state-of-the-art anatomical methods, and the data is very effectively presented and carefully analyzed. The results provide many novel insights on the similarities and differences of inputs from the two hemispheres. While over the past decade there has been many studies quantitively and comprehensively describing cortico-cortical connections, by directly comparing inputs from the ipsi and contralateral hemispheres, this study fills in an important gap in the field. It should be of great utility and an important reference for future studies on inter hemispheric interactions.

      Weaknesses:

      Overall, I do not find any major weakness in the analyses or their interpretation. However, one must keep in mind that the study only analyses inputs projecting to three areas. This is not an inherent flaw of the study; however, it warrants caution when extrapolating the results to callosal projections terminating in other areas. As inputs to two primary sensory areas and one is the primary motor cortex are studied, some of the conclusions could potentially be different for inputs terminating in high-order sensory and motor areas. Given that primary areas were injected, there are few instances of feedforward connections sampled in the ipsilateral hemisphere. The study finds that while ipsi- projections from visual cortex to barrel cortex are feedforward given its fILN values, those from the contralateral visual cortex are feedback instead. This is now acknowledged in the revised discussion.

      Another issue that is left unexplored is that, in the current analyses the barrel and primary visual cortex are analyzed as a uniform structure. It is well established that both the laminar sources of callosal inputs and their terminations differ in the monocular and binocular areas of the visual cortex (border with V2L). Similarly, callosal projections differ when terminating the border of S1 (A row of whiskers ) then in other parts of S1. Thus, some of the conclusions regarding the laminar sources of callosal inputs might depend on whether one is analyzing inputs terminating or originating in these border regions. This is now acknowledged in the revised version.

    1. Reviewer #2 (Public review):

      Summary:

      This study aimed to uncover the protein composition and evolutionary conservation of electrical synapses in retinal neurons. The authors employed two complementary BioID approaches: expressing a Cx35b-TurboID fusion protein in zebrafish photoreceptors and using GFP-directed TurboID in Cx36-EGFP-labeled mouse AII amacrine cells. They identified conserved ZO proteins and endocytosis components in both species, along with over 50 novel proteins related to adhesion, cytoskeleton remodeling, membrane trafficking, and chemical synapses. Through a series of validation studies¬-including immunohistochemistry, in vitro interaction assays, and immunoprecipitation - they demonstrate that novel scaffold protein SIPA1L3 interacts with both Cx36 and ZO proteins at electrical synapse. Furthermore, they identify and localize proteins ZO-1, ZO-2, CGN, SIPA1L3, Syt4, SJ2BP, and BAI1 at AII/cone bipolar cell gap junctions.

      Strengths:

      The study demonstrates several significant strengths in both experimental design and validation approaches. First, the dual-species approach provides valuable insights into the evolutionary conservation of electrical synapse components across vertebrates. Second, the authors compare two different TurboID strategies in mice and demonstrate that the HKamac promoter and GFP-directed approach can successfully target the electrical synapse proteome of mouse AII amacrine cells. Third, they employed multiple complementary validation approaches - including retinal section immunohistochemistry, in vitro interaction assays, and immunoprecipitation-providing evidence supporting the presence and interaction of these proteins at electrical synapses.

      Weaknesses:

      The conclusions of this paper are supported by data; however, some aspects of the quantitative proteomics analysis require clarification and more detailed documented. The differential threshold criteria (>3 log2 fold for mouse vs >1 log2 fold for zebrafish) will benefit from biological justification, particularly given the cross-species comparison. Additionally, providing details on the number of biological or technical replicates used in this study, along with analyses of how these replicates compare to each other, would strengthen the confidence in the identification of candidate proteins. Furthermore, including negative controls for the histological validation of proteins interacting with Cx36 could increase the reliability of the staining results.

      While the study successfully characterized the presence of candidate proteins at the electrical synapses between AII amacrine cells and cone bipolar cells, it did not compare protein compositions between the different types of electrical synapses within the circuit. Given that AII amacrine cells form both homologous (AII-AII) and heterologous (AII-cone bipolar cell) electrical synapses-connections that serve distinct functional roles in retinal signaling processing-a comparative analysis of their molecular compositions could have provided important insights into synapse specificity.

    1. Reviewer #2 (Public review):

      Summary

      The authors have used the UK Biobank data to interrogate the association between plasma metabolites and glaucoma.

      (1) They initially assessed plasma metabolites as predictors of glaucoma: The addition of NMR-derived metabolomic data to existing models containing clinical and genetic data was marginal.<br /> (2) They then determined whether certain metabolites might protect against glaucoma in individuals at high genetic risk: Certain molecules in bioenergetic pathways (lactate, pyruvate and citrate) conferred protection.<br /> (3) They provide support for protection conferred by pyruvate in a murine model.

      Weaknesses

      (1) Although it is an invaluable treasure trove of data, selection bias and self-reporting are inescapable problems when using the UK Biobank data for glaucoma research. The high-impact glaucoma-related GWAS publications (Ref 26 and 27) referenced in support of the method suffer the same limitations. This doesn't negate the conclusions but must be taken into consideration. The authors might note that it is somewhat reassuring that the proportion of glaucoma cases (4%) is close to what would be expected in a population-based study of 40-69-year-olds of predominantly white ethnicity.<br /> (2) As noted by the authors, a limitation is the predominantly white ethnicity profile that comprises the UK Biobank.<br /> (3) Also as noted by the authors, the study is cross-sectional and is limited by the "correlation does not imply causation" issue.<br /> (4) The optimal collection, transport and processing of the samples for NMR metabolite analysis is critical for accurate results. Strict policies were in place for these procedures, but deviations from protocol remain an unknown influence on the data.<br /> (5) In addition, all UK Biobank blood samples had unintended dilution during the initial sample storage process at UK Biobank facilities. (Julkunen, H. et al. Atlas of plasma NMR biomarkers for health and disease in 118,461 individuals from the UK Biobank. Nat Commun 14, 604 (2023) Samples from aliquot 3, used for the NMR measurements, suffered from 5-10% dilution. (Allen, Naomi E., et al. Wellcome Open Research 5 (2021): 222.) Julkunen et al. report that "The dilution is believed to come from mixing of participant samples with water due to seals that failed to hold a system vacuum in the automated liquid handling systems. While this issue is likely to have an impact on some of the absolute biomarker concentration values, it is expected to have limited impact on most epidemiological analyses."

      Strengths

      The huge sample size supports a powerful statistical analysis and the opportunity for the inclusion of multiple covariates and interactions without overfitting the models.<br /> The authors have constructed a robust methodology and statistical design.<br /> The manuscript is well-written, and the study is logically presented.<br /> The Figures are of good quality.

      Broadly, the conclusions are justified by the findings.

      Impact<br /> The findings advance personalized prognostics for glaucoma that combine metabolomic and genetic data. In addition, the protective effect of certain metabolites influences further research on novel therapeutic strategies.

      Comments on revisions:

      The authors have thoughtfully and comprehensively addressed my comments. I have no further comments.

    1. Reviewer #2 (Public review):

      Summary:

      This work assesses the genetic interaction between the Bmp signaling pathway and the factor Numb, which can inhibit Notch signalling. It follows up on the previous studies of the group (Tian, eLife, 2014; Tian, PNAS, 2014) regarding BMP signaling in controlling stem cell fate decision as well as on the work of another group (Sallé, EMBO, 2017) that investigated the function of Numb on enteroendocrine fate in the midgut. This is an important study providing evidence of a Numb-mediated back up mechanism for stem cell maintenance.

      Strengths:

      (1) Experiments are consistent with these previous publications while also extending our understanding of how Numb functions in the ISC.<br /> (2) Provides an interesting model of a "back up" protection mechanism for ISC maintenance.

      Weaknesses:<br /> (1) Aspects of the experiments could be better controlled or annotated:<br /> (a) As they "randomly chose" the regions analyzed, it would be better to have all from a defined region (R4 or R2, for example) or to at least note the region as there are important regional differences for some aspects of midgut biology.<br /> (b) It is not clear to me why MARCM clones were induced and then flies grown at 18{degree sign}C? It would help to explain why they used this unconventional protocol.

      (2) There are technical limitations with trying to conclude from double-knockdown experiments in the ISC lineage, such as those in Figure 1 where Dl and put are both being knocked down: depending on how fast both proteins are depleted, it may be that only one of them (put, for example) is inactivated and affects the fate decision prior to the other one (Dl) being depleted. Therefore, it is difficult to definitively conclude that the decision is independent of Dl ligand.

      (3) Additional quantification of many phenotypes would be desired.<br /> (a) It would be useful to see esg-GFP cells/total cells and not just field as the density might change (2E for example).<br /> (b) Similarly, for 2F and 2G, it would be nice to see the % of ISC/ total cell and EB/total cell and not only per esgGFP+ cell.<br /> (c) Fig1: There is no quantification - specifically it would be interesting to know how many esg+ are su(H)lacZ positive in Put- Dl- condition compared to WT or Put- alone. What is the n?<br /> (d) Fig2: Pros + cells are not seen in the image? Are they all DllacZ+?<br /> (e) Fig3: it would be nice to have the size clone quantification instead of the distribution between groups of 2 cell 3 cells 4 cell clones.<br /> (f) How many times were experiments performed?

      (4) The authors do not comment on the reduction of clone size in DSS treatment in Figure 6K. How do they interpret this? Does it conflict with their model of Bleo vs DSS?

      (5) There is probably a mistake on sentence line 314 -316 "Indeed, previous studies indicate that endogenous Numb was not undetectable by Numb antibodies that could detect Numb expression in the nervous system".

      Comments on revisions:

      The authors have by and large addressed my main points.

    1. Reviewer #2 (Public review):

      Summary:

      The authors used whole-network imaging to identify sensory neurons that responded to the repellant 1-octanol. While several olfactory neurons responded to the initial onset of odor pulses, two neurons consistently responded to all the pulses, ASH and AWC. ASH typically activates in response to repellants, and AWC typically activates in response to the removal of attractants. However, in this case, AWC activated in response to the removal of 1-octanol, which was unexpected because 1-octanol is a harmful repellant to the worm. The authors further investigated this phenomenon by testing different concentrations of 1-octanol in a chemotaxis assay and found that at lower (less harmful) concentrations the odor is actually an attractant, but becomes repulsive at higher concentrations. The amplitude of the ASH response appeared to be modulated by concentration, but this was not true for AWC. The authors propose a model where the behavioral response of the worm is the result of integrating these two opposing drives, where repulsion is a result of the increased ASH activity overriding the positive drive from AWC. The authors further tested this theory by testing mutants that ablated the AWC response (tax-4) or ASH response (osm-9), which produced results consistent with their hypothesis. While the interneuron(s) that integrate these signals to influence behavior were not identified, the authors did find that increasing concentrations of 1-octanol did increase the likelihood of AVA activity, a neuron that drives reversals (and hence, behavioral repulsion).

      Strengths:

      This was simple and elegant work that identified specific neurons of interest which generated a hypothesis, which was further tested with mutants that altered neuronal activity. The authors performed both neuronal imaging and behavioral experiments to verify their claims.

      Weaknesses:

      tax-4, but not osm-9 mutants were used in chemotaxis and imaging assays. It would have been nice to have osm-9 results as well for these assays. The mutants are not specific to AWC and ASH. Cell-specific rescue of these neurons would have strengthened the proposed model.

    1. Reviewer #3 (Public review):

      This manuscript reports interesting data on sex differences in expression across several somatic and reproductive tissues among 4 mice species or subspecies. The focus is on sex-biased expression in the somatic tissues, where the authors report high rates of turnover such that the majority of sex-biased genes are only sex-biased in one or two taxa. The authors show sex-biased genes have higher expression variance than unbiased genes but also provide some evidence that sex-bias is likely to evolve from genes with higher expression variance. The authors find that sex-biased genes (both female- and male-biased) experience more adaptive evolution (i.e., higher alpha values) than unbiased genes. The authors develop a summary statistic (Sex-Bias Index, SBI) of each individual's degree of sex-bias for a given tissue. They show that the distribution of SBI values often overlap considerably for somatic (but not reproductive) tissues and that SBI values are not correlated across tissues, which they interpret as indicating an individual can be relatively "male-like" in one tissue and relatively "female-like" in another tissue.

      Though the data are interesting, there are some disappointing aspects to how the authors have chosen to present the work. For example, their criteria for sex-bias requires an expression ratio of one sex to the other of 1.25. A reasonably large fraction of the "sex-biased genes" have ratios just beyond this cut-off (Fig. S1). A gene which has a ratio of 1.27 in taxa 1 can be declared as "sex-biased" but which has a ratio of 1.23 in taxa 2 will not be declared as "sex-biased". It is impossible to know from how the data are presented in the main text the extent to which the supposed very high turnover represents substantial changes in dimorphic expression. A simple plot of the expression sex ratio of taxa 1 vs taxa 2 would be illuminating but the authors declined this suggestion.

      I was particularly intrigued by the authors' inference of the proportion of adaptive substitutions ("alpha") in different gene sets. The show alpha is higher for sex-biased than unbiased genes and nicely shows that the genes that are unbiased in focal taxa but sex-biased in the sister taxa also have low alpha. It would be even stronger that sex-bias is associated with adaptive evolution to estimate alpha for only those genes that are sex-biased in the focal taxa but not in the sister taxa (the current version estimates alpha on all sex-biased genes within the focal taxa, both those that are sex-biased and those that are unbiased in the sister taxa).

      The author's Sex Bias Index is measured in an individual sample as: SBI = median(TPM of female-biased genes) - median(TPM of male-biased genes). This index has some strange properties when one works through some toy examples (though any summary statistic will have limitations). The authors do little to jointly discuss the merits and limitations of this metric. It would have been interesting to examine their two key points (degree of overlapping distributions between sexes and correlation across tissues) using other individual measures of sex-bias.

      Figure 5 shows symmetric gaussian-looking distributions of SBI but it makes me wonder to what extent this is the magic of model fitting software as there are only 9 data points underlying each distribution. Whereas Figure 5 shows many broadly overlapping distributions for SBI, Figure 6 seems to suggest the sexes are quite well separated for SBI (e.g., brain in MUS, heart in DOM).

      Fig. S1 should be shown as the log(F/M) ratio so it is easier to see the symmetry, or lack thereof, of female and male-biased genes.<br /> It is important to note that for the variance analysis that IQR/median was calculated for each gene within each sex for each tissue. This is a key piece of information that should be in the methods or legend of the main figure (not buried in Supplemental Table 17).

    1. Reviewer #3 (Public review):

      Summary:

      The article presents a meticulous and quantitative anatomical reconstruction of the compound eye of a tiny wasp at the level of subcellular structures, cellular and optical organization of the ommatidia and reveals the ectopic photoreceptors, which are decoupled from the eye's dioptrical apparatus.

      Strengths:

      The graphic material is of very high quality, beautifully organized and presented in a logical order. The anatomical analysis is fully supported by quantitative numerical data at all scales, from organelles to cells and ommatidia, which should be a valuable source for future studies in cellular biology and visual physiology. The 3D renders are highly informative and a real eye candy.

      Weaknesses:

      The claim that the large dorsal part of the eye is the dorsal rim area (DRA), supported by anatomical data on rhabdomere geometry and connectomics in authors' earlier work, would eventually greatly benefit from additional evidence, obtained by other methods.

      Comments on revisions:

      Thank you for considering my remarks and advice. All is fine.

    1. Reviewer #2 (Public review):

      Summary:

      In the manuscript entitled "Oviductin sets the species-specificity of the mammalian zona pellucida", de la Fuente et al analyze the species specificity of sperm-egg recognition by looking at sperm binding and penetration of zonae pellucidae from different mammalian species and find a role for the oviductal protein OVGP1 in determining species specificity.

      Strengths:

      By combining sperm, oocytes, zona pellucida (ZP), and oviductal fluid from different mammalian species, they elucidate the essential role of OVGP1 in conferring species-specific fertilization.

      Weaknesses:

      Mice with OVGP1 deletion are viable and fertile. It would be quite interesting to investigate the species-specificity of sperm-ZP binding in this model. That would indicate whether OVGP1 is the only glycoprotein involved in determining species-specificity. Alternatively, the authors could immunodeplete OVGP1 from oviductal fluid and then ascertain whether this depleted fluid retains the ability to impede cross-species fertilization.

      Comments on revisions:

      This resubmission addresses most of my comments and concerns.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors report that Nora virus, a natural Drosophila pathogen that also persistently infects many laboratory fly stocks, infects intestinal stem cells (ISCs), leading to a shorter life span and increased sensitivity to intestinal infection with the Pseudomonas bacterium. Nora virus infection was associated with an increased proliferation of ISC and disrupted gut barrier function. Genetically, the authors show that increased ISC division in Nora virus and Pseudomonas coinfected flies is driven by signaling through the JAK-STAT pathway and apoptosis.

      Accordingly, blocking apoptosis and JAK-STAT signaling reduces viral load, suggesting that in this context the JAK-STAT pathway is proviral in contrast to other previous observations in systemically infected flies. This work adds to the findings of another recent paper showing that another persistent fruit fly virus, Drosophila A virus, also increases ISC proliferation and decreases gut barrier function. Intestinal viruses should therefore be considered confounders in studies of fly intestinal physiology.

      Strengths:

      Overall, the data are convincing and robust, starting with two wildtype fly stocks (Ore-R strain) that differ in their Nora virus infection status, followed by experiments in which cleared stocks are reinfected with a purified Nora virus stock preparation. The conclusions of the paper will be of interest to scientists working on insect physiology, virology, and immunology, but should also serve as a warning for scientists that use the fly as a model to study gut physiology.

      Weaknesses:

      The title does not seem to be fully supported by the data. While the authors convincingly show the increased sensitivity to Pseudomonas infection, effects on another tested bacterium, Serratia marcescens, were not significantly different between Nora-virus-infected and non-infected flies. Thus effects of 'intestinal infection' seem to be too broad a claim. Also, whether the Nora virus increases sensitivity to oxidative stress is not so clear to me: the figure that supports this claim is the survival assay of Figure 5F. However, the difference in survival between control and paraquat-treated Nora (-) flies seems to be in the same order as between control and paraquat-treated Nora (+) flies. Rather, cause and effect seem to be the reverse: paraquat increases ISC proliferation, higher viral loads, and consequently shorter survival. I suggest rephrasing the title and conclusions accordingly.

      Quantification of immunofluorescence microscopy is missing, rendering the images somewhat anecdotal. Quantification should be provided. It will then also be of interest to quantify the number of Nora(+) cells and the Nora virus levels per infected cell (e.g. Figure 5H). Also, the claim that the Nora virus initially infects ISC and later (upon stress) infects enterocytes requires quantification.

      Genetic support for the role of the JAK-STAT pathway in driving ISC proliferation and supporting Nora virus replication is convincing. It would also be of interest to analyze other pathways implicated in ISC proliferation (e.g. JNK, EGFR), especially given the observations of Nigg et al, showing an involvement of STING/NF-kB and EGFR pathway in driving intestinal phenotypes of Drosophila A virus-infected flies (doi: 10.1016/j.cub.2024.05.009).

      Figure 5E: An intriguing observation is that GFP:Dicer2 seems to be unstable in Nora virus-infected cells. Here, GFP control driven by the same driver line would be required to confidently conclude that this is due to an effect on Dicer-2 specifically.

      Legends are mostly conclusive, and essential information about the experimental setup is missing in the captions of multiple figures, making the interpretation of the data difficult. See my private recommendations for suggestions to improve the data presentation.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have developed a behavioral paradigm to experimentally manipulate the sense of control experienced by the participants by changing the level of difficulty of a wheel-stopping task. In the first study, this manipulation is tested by administering the task in a factorial design with two levels of controllability and two levels of stressor intensity to a large number of participants online while simultaneously recording subjective ratings on perceived control, anxiety, and stress. In the second study, the authors used the wheel-stopping task to induce a high sense of controllability and test whether this manipulation buffers the response to a subsequent stress induction when compared to a neutral task, like looking at pleasant videos.

      Strengths:

      (1) The authors validate a method to manipulate stress.<br /> (2) The authors use an experimental manipulation to induce an enhanced sense of controllability to test its impact on the response to stress induction.<br /> (3) The studies involved big sample sizes.

      Weaknesses:

      (1) The study was not preregistered.

      (2) The control manipulation is conflated with task difficulty, and, therefore the reward rate. Although the authors acknowledge this limitation at the end of the discussion, it is a very important limitation, and its implications are not properly discussed. The discussion states that this is a common limitation with previous studies of control but omits that many studies have controlled for it using yoking.

      (3) The methods are not always clear enough, and it is difficult to know whether all the manipulations are done within-subjects or some key manipulations are done between subjects.

      (4) The analysis of internal consistency is based on splitting the data into odd/even sliders. This choice of data parcellation may cause missed drifts in task performance due to learning, practice effects, or tiredness, thus potentially inflating internal consistency.

      (5) Study 2 manipulates the effect of domain (win versus loss WS task), but the interaction of this factor with stressor intensity is not included in the analysis.

      This study will be of interest to psychologists and cognitive scientists interested in understanding how controllability and its subjective perception impact how people respond to stress exposure. Demonstrating that an increased sense of control buffers/protects against subsequent stress is important and may trigger further studies to characterize this phenomenon better. However, beyond the highlighted weaknesses, the current study only studied the effect of stress induction consecutive to the performance of the WS task on the same day and its generalizability is not warranted.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript follows up on a previously published paper (Busch and Hansel 2023) which proposed that the morphological variation of dendritic bifurcation in Purkinje cells in mouse and human is indicative of the number of climbing fiber inputs, with dendritic bifurcation at the level of the soma resulting in a proportion of these neurons being multi-innervated. The functional and anatomical climbing fiber data was obtained solely from mice, since all human tissue was embalmed and fixed, and the extension of these findings to human Purkinje cells was indirect. The current comparative anatomy study aims to resolve this question in human tissue more directly and to further analyse in detail the properties of adult human Purkinje cell dendritic morphology.

      Strengths:

      The authors have carried out a meticulous anatomical quantification of human Purkinje cell dendrites, in tissue preparations with better signal to noise ratio than their previous study, comparing them with those from mice. They show that human PC dendrites are much larger than would be expected from straightforward scaling to brain size and, importantly, they now present immunolabelling results that trace climbing fiber axons innervating human PCs in a subset of the data. As well as providing detailed analyses of spine properties and interesting and unexpected new findings of human PC dendritic length and spine types, the work suggests that human PCs that have two clearly distinct dendritic branches have an approximately 80% chance of receiving more than one CF input, segregated across the two branches. Albeit entirely observational, the data will be of widespread interest to the cerebellar field, in particular those building computational models of Purkinje cells.

      Weaknesses:

      The work is, by necessity, purely anatomical. It remains to be seen whether there are any functional differences in ion channel expression or functional mapping of granule inputs to human PCs compared with the mouse that might mitigate the major differences in electronic properties suggested.

      Comments on revisions:

      I am happy with the updated manuscript in response to my suggestions and I have no further comments.

    1. Reviewer #2 (Public review):

      The manuscript from Belato et al., used advanced NMR approaches and a mutagenesis campaign probe the conformational dynamics of the recognition lobe (Rec) of the CRISPR Cas9 enzyme from G. stearothermophilus (GeoCas9). Using truncated and full-length constructs they assess the impacts of two different point mutations have on the redistribution and timescale of these motions and assess gRNA recognition and specificity. Single point mutations in the Rec domain in a Cas9 from a related species had profound impacts on- and off-target DNA editing, therefore the authors reasoned analogous mutations in GeoCas9 would have similar effects. However, despite a redistribution of local motions and changes in global stability, their chosen mutations had little impact on DNA editing in the context of the full-length enzyme.

      In their revised manuscript, the authors were highly responsive to the reviewer's comments incorporating new experimental results including molecular dynamics simulations and RNA binding data using full-length GeoCas9, as well as reframing their discussion and conclusions in consideration of the new data. They were receptive to suggestions for clarification in both the text and methods section. With these changes, the manuscript has been significantly improved.

      Their studies highlight the species-specific complexity of interdomain communication and allosteric mechanisms used by these multi-domain endonucleases. The noted strengths of the article remain, and despite the negative results, their approach will garner interest from investigators interested in understanding how the activity and specificity of these enzymes can be engineered to tune activity and limit off-target cleavage by these enzymes. Generally, the manuscript highlights the challenges of studying the effect of allosteric networks on protein function, particularly in multidomain proteins, and thus will be of broad interest to the community.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Li and colleagues study the fate of endothelial cells in a mouse model of ischemic stroke. Using genetic lineage tracing approaches, they found that endothelial cells give rise to non-endothelial cells, which they term "E-pericytes." They further show that depleting these cells exacerbates blood-brain barrier leakage and worsens functional recovery. The authors also provide evidence that endothelial-to-mesenchymal transition, myeloid cell-derived TGFβ1, and endothelial TGFβRII are involved in this process. These are potentially interesting findings, however, the experimental evidence that endothelial cells undergo transdifferentiation to non-endothelial cells is weak, as is the evidence that these cells are pericytes. Addressing this foundational weakness will facilitate the interpretation of the other findings.

      Strengths:

      (1) The authors address an important question about blood vessel function and plasticity in the context of stroke.

      (2) The authors use a variety of genetic approaches to understand cell fate in the context of stroke. Particularly commendable is the use of several complementary lineage tracing strategies, including an intersectional strategy requiring both endothelial Cre activity and subsequent mural cell NG2 promoter activity.

      (3) The authors address upstream cellular and molecular mechanisms, including roles for myeloid-derived TGFβ.

      Weaknesses:

      (1) The authors use Cdh5-CreERT2; Ai47 mice to permanently label endothelial cells and their progeny with eGFP. They then isolate eGFP+ cells from control and MCAO RP7D and RP34D brains, and use single-cell RNA-seq to identify the resulting cell types. Theoretically, all eGFP+ cells should be endothelial cells or their progeny. This is a very powerful and well-conceived experiment. The authors use the presence of a pericyte cluster as evidence that endothelial-to-pericyte transdifferentiation occurs. However, pericytes are also present in the scRNA-seq data from sham mice, as are several other cell types such as fibroblasts and microglia. This suggests that pericytes and these other cell types might have been co-purified (e.g., as doublets) with eGFP+ endothelial cells during FACS and may not themselves be eGFP+. Pericyte-endothelial doublets are common in scRNA-seq given that these cell types are closely and tightly associated. Additionally, tight association (e.g., via peg-socket junctions) can cause fragments of endothelial cells to be retained on pericytes (and vice-versa) during dissociation. Finally, it is possible that after stroke or during the dissociation process, endothelial cells lyse and release eGFP that could be taken up by other cell types. All of these scenarios could lead to the purification of cells that were not derived (transdifferentiated) from endothelial cells. The authors note that the proportion of pericytes increased in the stroke groups, but it does not appear this experiment was replicated and thus this conclusion is not supported by statistical analysis. The results of pseudotime and trajectory analyses rely on the foundation that the pericytes in this dataset are endothelial-derived, which, as discussed above, has not been rigorously demonstrated.

      (2) I have the same concern regarding the inadvertent purification of cells that were not derived from endothelial cells in the context of the bulk RNA-seq experiment (Figure S4), especially given the sample-to-sample variability in gene expression in the RP34D, eGFP+ non-ECs-group (e.g., only 2/5 samples are enriched for mesenchymal transcription factor Tbx18, only 1/5 samples are enriched for mural cell TF Heyl). If the sorted eGFP+ non-ECs were pericytes, I would expect a strong and consistent pericyte-like gene expression profile.

      (3) The authors use immunohistochemistry to understand localization, morphology, and marker expression of eGFP+ cells in situ. The representative "E-pericytes" shown in Figure 3A-D are not associated with blood vessels, and the authors' quantification also shows that the majority of such cells are not vessel-associated ("avascular"). By definition, pericytes are a component of blood vessels and are embedded within the vascular basement membrane. Thus, concluding that these cells are pericytes ("E-pericytes") may be erroneous.

      (4) CD13 flow cytometry and immunohistochemistry are used extensively to identify pericytes. In the context of several complementary lineage tracing strategies noted in Strength #2, CD13 immunohistochemistry is the only marker used to identify putative pericytes (Figure S3J-M). In stroke, CD13 is not specific to pericytes; dendritic cells and other monocyte-derived cells express CD13 (Anpep) in mouse brain after stroke (PMID: 38177281, https://anratherlab.shinyapps.io/strokevis/).

      (5) The authors conclude that "EC-specific overexpression of the Tgfbr2 protein by a virus (Tgfbr2) decreases Evans blue leakage, promotes CBF recovery, alleviates neurological deficits and facilitates spontaneous behavioral recovery after stroke by increasing the number of E-pericytes." All data in Figure 10, however, compare endothelial Tgfbr2 overexpression to a DsRed overexpression control. There is no group in which Tgfbr2 is overexpressed but "E-pericytes" are eliminated with DTA (this is done in Figure 9B, but this experiment lacks the Tgfbr2 overexpression-only control). Thus, the observed functional outcomes cannot be ascribed to "E-pericytes"; it remains possible that endothelial Tgfbr2 overexpression affects EB leakage, CBF, and behavior through alternative mechanisms.

      (6) Single-cell and bulk RNA-seq data are not available in a public repository (such as GEO). Depositing these data would facilitate their independent reevaluation and reuse.

    1. Reviewer #2 (Public review):

      Summary:

      Jaber et al. describe the generation and characterization of a knock-in mouse strain expressing the p53 Y217C hot-spot mutation. While the homozygous mutant cells and mice reflect the typical loss-of-p53 functions, as expected, the Y217C mutation also appears to display gain-of function (GOF) properties, exemplified by elevated metastasis in the homozygous context (as noted with several hot-spot mutations). Interestingly, this mutation does not appear to exhibit any dominant-negative effects associated with most hot-spot p53 mutations, as determined by absence of differences in overall survival and tumor predisposition of the heterozygous mice, as well as target gene activation upon nutlin treatment.

      In addition, the authors noted a severe reduction in the female 217/217 homozygous progeny, significantly more than that observed with the p53 null mice, due to exencephaly, leading them to conclude that the Y217C mutation also has additional, non-cancer related GOFs. Thought this property has been well described and attributed to p53 functional impairment, the authors conclude that the Y217C has additional properties in accelerating the phenotype.<br /> Transcriptomic analyses of thymi found additional gene signature differences between p53 null and the Y217C strains, indicative of novel target gene activation, associated with inflammation.

      Strengths:

      Overall, the characterisation of the mice highlights the expected typical outcomes associated with most hot-spot p53 mutations published earlier. The quality of the work presented is well done and good, and the conclusions and reasonably well justified.

      Comments on revisions:

      Revised version has addressed most of our queries and is acceptable.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by Paturi and colleagues uses an approach that combines structural biology and biochemistry to probe protein-protein and protein-RNA interactions for two protein factors related to the dsRNA pathway in plants.

      Strengths:

      A key finding in the research is the direct demonstration of the ability of the single dsRBD (double-strand RNA binding domain) of DRB7.2 to interact simultaneously with dsRNA as well as the C-terminal domain of DRB4. The heterodimerization of DRB7.2 and DRB4 is demonstrated to make a high-affinity complex with dsRNA and it is proposed that this atypical use of the dsRBD domain to bridge the protein and RNA may contribute to the ability to prevent cleavage that would otherwise occur for dsRNA. The primary results for the interactions are generally well-supported by the data, and the conclusions are taken from the available results without excessive speculation.

      Weaknesses:

      There is a need for some statistical repeats, as well as a suggested movement of many protein characterization findings in the solution state to support data or to better indicate how these properties could play a role in the final proposed mechanism. There is also the need for certain measurement replicates, such as for the ITC data which are derived from single measurements and lack sufficient estimates of error.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents experiments using an ex vivo colonic tissue assay, clearly showing that fecal material promotes Salmonella cell invasion into the tissue. It also shows that serine and indole can modulate the invasion, although their effects are much smaller. In addition, the authors characterized the direct chemotactic responses of these cells to serine and indole using a capillary assay, demonstrating repellent and attractant responses elicited by indole and serine, respectively, and that serine can dominate when both are present. These behaviors are generally consistent with those observed in E. coli, as well as with the observed effects on cell invasion.

      Strengths:

      The most compelling finding reported here is the strong influence of fecal material on cell invasion. Also, the local and time-resolved capillary assay provides a new perspective on the cell's responses.

      Weaknesses:

      The weakness is that indole and serine chemotaxis does not seem to control the fecal-mediated cell invasion and thus the underlying cause of this effect remains unclear.

      In addition, the fact that serine alone, which clearly acts as a strong attractant, did not affect cell invasion (compared to buffer) is somewhat puzzling. Additionally, wild-type cells showed nearly a tenfold advantage even without any ligand (in buffer), suggesting that factors other than chemotaxis might control cell invasion in this assay, particularly in the serine and indole conditions. These observations should probably be discussed.

      Final comment. As shown in reference 12, Tar mediates attractant responses to indole, which appear to be absent here (Figure 3J). Is it clear why? Could it be related to receptor expression?

    1. Reviewer #2 (Public review):

      This manuscript describes a detailed model of bats flying together through a fixed geometry. The model considers elements that are faithful to both bat biosonar production and reception and the acoustics governing how sound moves in the air and interacts with obstacles. The model also incorporates behavioral patterns observed in bats, like one-dimensional feature following and temporal integration of cognitive maps. From a simulation study of the model and comparison of the results with the literature, the authors gain insight into how often bats may experience destructive interference of their acoustic signals and those of their peers, and how much such interference may actually negatively affect the groups' ability to navigate effectively. The authors use generalized linear models to test the significance of the effects they observe.

      In terms of its strengths, the work relies on a thoughtful and detailed model that faithfully incorporates salient features, such as acoustic elements like the filter for a biological receiver and temporal aggregation as a kind of memory in the system. At the same time, the authors' abstract features are complicating without being expected to give additional insights, as can be seen in the choice of a two-dimensional rather than three-dimensional system. I thought that the level of abstraction in the model was perfect, enough to demonstrate their results without needless details. The results are compelling and interesting, and the authors do a great job discussing them in the context of the biological literature.

      The most notable weakness I found in this work was that some aspects of the model were not entirely clear to me. For example, the directionality of the bat's sonar call in relation to its velocity. Are these the same? If so, what is the difference between phi_target and phi_tx in the model equations? What is a bat's response to colliding with a conspecific (rather than a wall)? From the statistical side, it was not clear if replicate simulations were performed. If they were, which I believe is the right way due to stochasticity in the model, how many replicates were used, and are the standard errors referred to throughout the paper between individuals in the same simulation or between independent simulations, or both?

      Overall, I found these weaknesses to be superficial and easily remedied by the authors. The authors presented well-reasoned arguments that were supported by their results, and which were used to demonstrate how call interference impacts the collective's roost exit as measured by several variables. As the authors highlight, I think this work is valuable to individuals interested in bat biology and behavior, as well as to applications in engineered multi-agent systems like robotic swarms.

    1. Reviewer #2 (Public review):

      In this manuscript, Mella et al. investigate the effect of GFP tagging on the localization and stability of the nuclear-localized tail-anchored (TA) protein Emerin. A previous study from this group showed that C-terminally GFP-tagged Emerin protein traffics to the plasma membrane and reaches lysosomes for degradation. It is suggested that the C-terminal tagging of tail-anchored proteins shifts their insertion from the post-translational TRC/GET pathway to the co-translational SRP-mediated pathway. The authors of this paper found that C-terminal GFP tagging causes Emerin to localize to the plasma membrane and eventually reach lysosomes. They investigated the mechanism by which Emerin-GFP moves to the secretory pathway. By manipulating the cytosolic domain and the hydrophobicity of the transmembrane domain (TMD), the authors identify that an ER retention sequence and strong TMD hydrophobicity contribute to Emerin trafficking to the secretory pathway. Overall, the data are solid, and the knowledge will be useful to the field. However, the authors do not fully answer the question of why C-terminally GFP-tagged Emerin moves to the secretory pathway. Importantly, the authors did not consider the possible roles of GFP in the ER lumen influencing Emerin trafficking to the secretory pathway.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by García-Vázquez et al identifies the G2 and S phases expressed protein 1(GTSE1) as a substrate of the CycD-CDK4/6 complex. CycD-CDK4/6 is a key regulator of the G1/S cell cycle restriction point, which commits cells to enter a new cell cycle. This kinase is also an important therapeutic cancer target by approved drugs including Palbocyclib. Identification of substrates of CycD-CDK4/6 can therefore provide insights into cell cycle regulation and the mechanism of action of cancer therapeutics. A previous study identified GTSE1 as a target of CycB-Cdk1 but this appears to be the first study to address the phosphorylation of the protein by Cdk4/6.

      The authors identified GTSE1 by mining an existing proteomic dataset that are elevated in AMBRA1 knockout cells. The AMBRA1 complex normally targets D cyclins for degradation. From this list they then identified proteins that contain a CDK4/6 consensus phosphorylation site and were responsive to treatment with Palbocyclib.

      The authors show CycD-CDK4/6 overexpression induces a shift in GTSE1 on phostag gels that can be reversed by Palbocyclib. In vitro kinase assays also showed phosphorylation by CDK4. The phosphorylation sites were then identified by mutagenizing the predicted sites and phostag gets to see which eliminated the shift.

      The authors go on to show that phosphorylation of GTSE1 affects the steady state level of the protein. Moreover, they show that expression and phosphorylation of GTSE1 confer growth advantage on tumor cells and correlate with poor prognosis in patients.

      Strengths:

      The biochemical and mutagenesis evidence presented convincingly show that the GTSE1 protein is indeed a target of the CycD-CDK4 kinase. The follow-up experiments begin to show that the phosphorylation state of the protein affect function and have an impact on patient outcome.

      Weaknesses:

      It is not clear at which stage in the cell cycle GTSE1 is being phosphorylated and how this is affecting the cell cycle. Considering that the protein is also phosphorylated during mitosis by CycB-Cdk1, it is unclear which phosphorylation events may be regulating the protein.

      Additional comments for the revised manuscript

      The authors have made many modifications to the manuscript in response to the reviewer comments, including the addition of new data that have clarified some of the conclusions. Some of the questions regarding the phase of the cell cycle affected have been addressed with flow cytometry.

      There is one issue raised in the first review that can be better addressed. As the authors mentioned in their rebuttal letter, all the reviewers and editor concluded from the original manuscript that GTSE1 was being proposed as a physiological target of CycD-Cdk4 even in non-transformed cells. The authors believe that GTSE1 is likely only a target in cancerous cells that overexpress CycD and have made alterations in the abstract and main text making this point more clear.

      Some additional evidence that GTSE1 phosphorylation is occurring in CycD overexpressing tumor cells would strengthen this argument beyond the overexpression experiments presented in the manuscript. For example, in Supplemental Fig 4A of the revised manuscript, bubble plots from CPTAC data is used to show that total protein levels of GTSE1 correlate with proteins associated with proliferation and metastasis. Do levels of GTSE1 correlate with CycD in this data set?

    1. Reviewer #2 (Public review):

      Summary:

      The work aims to further understand the role of macrophages in lung precancer/lung cancer evolution

      Strengths:

      (1) The use of single-cell RNA seq to provide comprehensive characterisation.

      (2) Characterisation of cross-talk between macrophages and the lung precancerous cells.

      (3) Functional validation of the effects of S100a4+ cells on lung precancerous cells using in vitro assays.

      (4) Validation in human tissue samples of lung precancer / invasive lesions.

      Weaknesses identified previously:

      (1) The authors need to provide clarification of several points in the text.

      (2) The authors need to carefully assess their assumptions regarding the role of macrophages in angiogenesis in precancerous lesions.

      (3) The authors should discuss more broadly the current state of anti-macrophage therapies in the clinic.

      Comments on revised version:

      The authors have adequately addressed all of my comments.

    1. Reviewer #3 (Public review):

      Summary:

      The relationships of proteins and lipids: it's complicated. This paper illustrates how cardiolipins can stabilize membrane protein subunits - and not surprisingly, positively charged residues play an important role here. But more and stronger binding of such structural lipids does not necessarily translate to stabilization of oligomeric states, since many proteins have alternative binding sites for lipids which may be intra- rather than intermolecular. Mutations which abolish primary binding sites can cause redistribution to (weaker) secondary sites which nevertheless stabilize interactions between subunits. This may be at first sight counterintuitive but actually matches expectations from structural data and MD modelling. An analogous cardiolipin binding site between subunits is found in E.coli tetrameric GlpG, with cardiolipin (thermally) stabilizing the protein against aggregation.

      Strengths:

      The use of the artificial scaffold allows testing of hypothesis about the different roles of cardiolipin binding. It reveals effects which are at first sight counterintuitive and are explained by the existence of a weaker, secondary binding site which unlike the primary one allows easy lipid-mediated interaction between two subunits of the protein. Introducing different mutations either changes the balance between primary and secondary binding sites or introduced a kink in a helix - thus affecting subunit interactions which are experimentally verified by native mass spectrometry.

      [Editors' note: The reviewers agreed that the authors addressed all reviewer comments adequately and rigorously.]

    1. Reviewer #2 (Public review):

      This paper describes an interesting observation that ER-targeted misfolded proteins are trapped within vesicles inside nucleus to facilitate quality control during cell division. This work supports the concept that transient sequestration of misfolded proteins is a fundamental mechanism of protein quality control. The authors satisfactorily addressed several points asked in the review of first submission. The manuscript is improved but still unable to fully address the mechanisms.

      Strengths:

      The observations in this manuscript are very interesting and open up many questions on proteostasis biology.

      Weaknesses:

      Despite inclusions of several protein-level experiments, the manuscript remained a microscopy-driven work and missed the opportunity to work out the mechanisms behind the observations.

    1. Reviewer #2 (Public review):

      Summary:

      Identifying an important role for Integrator complex in repressing HIV transcription and suggesting that by targeting subunits of this complex specifically, INTS12, reversal of latency with and without latency reversal agents can be enhanced.

      Strengths:

      The strengths of the paper include the general strategy for screening targets that may activate HIV latency and the rigor of exploring the mechanism of INTS12 repression of HIV transcriptional elongation.

      Weaknesses:

      Minor point-there was an opportunity to examine a larger panel of latency reversal agents that reactivate by different mechanisms to determine whether INTS12 and transcriptional elongation are limiting for a broad spectrum of latency reversal agents.

      Comments on revisions:

      I feel the authors have adequately addressed the original questions and concerns.

    1. Reviewer #2 (Public review):

      This paper shows and analyzes an interesting phenomenon. It shows that when people are exposed to sequences of moving dots (That is moving dots in one direction, followed by another direction etc.), that showing either the starting movement direction, or ending movement direction causes a coarse-grained brain response that is similar to that elicited by the complete sequence of 4 directions. However, they show by decoding the sensor responses that this brain activity actually does not carry information about the actual sequence and the motion directions, at least not on the time scale of the initial sequence. They also show a reverse reply on a highly-compressed time scale, which is elicited during the period of elevated activity, and activated by the first and last elements of the sequence, but not others. Additionally, these replays seem to occur during periods of cortical ripples, similar to what is found in animal studies.

      These results are intriguing. They are based on MEG recordings in humans, and finding such replays in humans is novel. Also, this is based on what seems to be sophisticated statistical analysis. The statistical methodology seems valid, but due to its complexity it is not easy to understand. The methods especially those described in figures 3 and 4 should be explained better.

    1. Reviewer #2 (Public review):

      Summary:

      The authors investigate the problem of olfactory search in turbulent environments using artificial agents trained using tabular Q-learning, a simple and interpretable reinforcement learning (RL) algorithm. The agents are trained solely on odor stimuli, without access to spatial information or prior knowledge about the odor plume's shape. This approach makes the emergent control strategy more biologically plausible for animals navigating exclusively using olfactory signals. The learned strategies show parallels to observed animal behaviors, such as upwind surging and crosswind casting. The approach generalizes well to different environments and effectively handles the intermittency of turbulent odors.

      Strengths:

      * The use of numerical simulations to generate realistic turbulent fluid dynamics sets this paper apart from studies that rely on idealized or static plumes.<br /> * A key innovation is the introduction of a small set of interpretable olfactory states based on moving averages of odor intensity and sparsity, coupled with an adaptive temporal memory.<br /> * The paper provides a thorough analysis of different recovery strategies when an agent loses the odor trail, offering insights into the trade-offs between various approaches.<br /> * The authors provide a comprehensive performance analysis of their algorithm across a range of environments and recovery strategies, demonstrating the versatility of the approach.<br /> * Finally, the authors list an interesting set of real-world experiments based on their findings, that might invite interest from experimentalists across multiple species.

      Weaknesses:

      * Using tabular Q-learning is both a strength and a limitation. It's simple and interpretable, making it easier to analyze the learned strategies, but the discrete action space seems somewhat unnatural. In real-world biological systems, actions (like movement) are continuous rather than discrete. Additionally, the ground-frame actions may not map naturally to how animals navigate odor plumes (e.g. insects often navigate based on their own egocentric frame).

    1. Reviewer #2 (Public review):

      Summary:

      In this study by Sánchez-León and colleagues, the authors attempted to determine the influence of neuronal orientation on the efficacy of cerebellar tDCS in modulating neural activity. To do this, the authors made recordings from Purkinje cells, the primary output neurons of the cerebellar cortex, and determined the inter-dependency between the orientation of these cells and the changes in their firing rate during cerebellar tDCS application.

      Strengths:

      (1) A major strength is the in vivo nature of this study. Being able to simultaneously record neural activity and apply exogenous electrical current to the brain during both an anesthetized state and during wakefulness in these animals provides important insight into physiological underpinnings of tDCS.<br /> (2) The authors provide evidence that tDCS can modulate neural activity in multiple cell types. For example, there is a similar pattern of modulation in Purkinje cells and non-Purkinje cells (excitatory and inhibitory interneurons). Together, these data provide wholistic insight into how tDCS can affect activity across different populations of cells, which is important implications for basic neuroscience, but also clinical populations where there may be non-uniform or staged effects of neurological disease on these various cell types.<br /> (3) There is systematic investigation into the effects of tDCS on neural activity across multiple regions of the cerebellum. The authors demonstrate that the pattern of modulation is dependent on the target region. These findings have important implications for determining the expected neuromodulatory effects of tDCS when applying this technique over different target regions non-invasively in animals and humans.<br /> (4) The authors provide a thorough background, rationale, and interpretation regarding the expected and observed influence of neuronal orientation on excitability modulation by electrical stimulation.

    1. Reviewer #2 (Public review):

      Summary:

      This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during expected test suggests a memory verification process, whereas the prolonged spatial bias during unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

      Strengths:

      The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

      Weaknesses:

      The authors addressed the identified weaknesses in a thorough revision during the review process.

    1. Reviewer #2 (Public review):

      Li, Zhang, Wu, and colleagues investigated the non-canonical localization of IDH1 in the cell nucleus and its unconventional functions, expanding our understanding of the roles of metabolic enzymes such as IDH1. To study its nuclear function, they generated a HUDEP2 cell line with a specific deletion of nuclear IDH1. They found that the loss of nuclear IDH1 led to abnormalities in nuclear morphology and chromatin organization, particularly in H3K79me3. By integrating ChIP-seq, ATAC-seq, and RNA-seq analyses, they identified SIRT1 as a key regulatory factor mediating IDH1's role in nuclear morphology regulation during the terminal stages of erythroid differentiation.

      Notably, abnormalities in H3K79me3 were also observed in AML/MDS patients harboring IDH1 mutations, offering new perspectives for disease diagnosis and treatment. To robustly determine the nuclear distribution of IDH1 in erythroid cells, the authors employed multiple approaches, including immunofluorescence and nucleus-cytoplasm fractionation. The development of a HUDEP2 cell line lacking nuclear IDH1 was pivotal for studying its non-canonical nuclear functions.

      Experimental results, including euchromatin/heterochromatin observations, histone modification analyses, ChIP-seq, and ATAC-seq, indicated that the deletion of IDH1 disrupts the chromatin landscape. While the authors have identified SIRT1 as a key gene affected by the deficiency of IDH1, the mechanisms underlying IDH1's nuclear function are worth further exploration in future studies.

      Overall, this study advances our understanding of the non-canonical localization of metabolic enzymes and their nuclear functions, shedding new light on their roles in cellular regulation.

    1. Reviewer #2 (Public review):

      Summary:

      Carabalona and colleagues investigated the role of the membrane-deforming cytoskeletal regulator protein Abba (MTSS1L/MTSS2) in cortical development to better understand the mechanisms of abnormal neural stem cell mitosis. The authors used short hairpin RNA targeting Abba20 with a fluorescent reporter coupled with in utero electroporation of E14 mice to show changes to neural progenitors. They performed flow cytometry for in-depth cell cycle analysis of Abba-shRNA impact to neural progenitors and determined an accumulation in S phase. Using culture rat glioma cells and live imaging from cortical organotypic slides from mice in utero electroporated with Abba-shRNA, the authors found Abba played a prominent role in cytokinesis. They then used a yeast-two-hybrid screen to identify three high confidence interactors: Beta-Trcp2, Nedd9, and Otx2. They used immunoprecipitation experiments from E18 cortical tissue coupled with C6 cells to show Abba requirement for Nedd9 localization to the cleavage furrow/cytokinetic bridge. The authors performed an shRNA knockdown of Nedd9 by in utero electroporation of E14 mice and observed similar results as with the Abba-shRNA. They tested a human variant of Abba using in utero electroporation of cDNA and found disorganized radial glial fibers and misplaced, multipolar neurons, but lacked the impact of cell division seen in the shRNA-Abba model.

      Strengths:

      Fundamental question in biology about the mechanics of neural stem cell division.<br /> Directly connecting effects in Abba protein to downstream regulation of RhoA via Nedd9.<br /> Incorporation of human mutation in ABBA gene.<br /> Use of novel technologies in neurodevelopment and imaging.

      Weaknesses:

      Unexplored components of the pathway (such as what neurogenic populations are impacted by Abba mutation) and unleveraged aspects of their data (such as the live imaging) limit the scope of their findings and left significant questions about the effect of ABBA on radial glia development.

      (1) Claim of disorganized radial glial fibers lacks quantifications.<br /> -On page 11, the authors claim that knockdown of Abba lead to changes in radial glial morphology observed with vimentin staining. Here they claim misoriented apical processes, detached end feet, and decreased number of RGP cells in the VZ. However, they no not provide quantification of process orientation to better support their first claim. Measurements of radial glia fiber morphology (directionality, length) and of angle of division would be metrics that can be applied to data. Some of these analysis could be done in their time-lapse microscopy images, such as to quantify the number of cell division during their period of analysis (though that is short-15 hours).

      (2) Unclear where effect is:<br /> -in RG or neuroblasts? Is it in cell cleavage that results in accumulation of cells at VZ (as sometimes indicated by their data like in Fig 2A or 4D)? Interrogation of cell death (such as by cleaved caspase 3) would also help. Given their time lapse, can they identify what is happening to the RG fiber? The authors describe a change in "migration" but do not show evidence for this for either progenitor or neuroblast populations. Given they have nice time-lapse imaging data, could they visualize progenitor versus young neuron migration? Analysis of neuroblasts (such as with doublecortin expression in the tissue) would also help understand any issues in migration (of neurons v stem cells).<br /> -at cleaveage furrow? In abscission? There is high resolution data that highlights the cleavage furrow as the location of interest (fig 3A), however there is also data (fig 3B) to suggest Abba is expressed elsewhere as well and there is an overall soma decrease. More detail of the localization of Abba during the division process would be helpful-for example, could cleavage furrow proteins, such as Aurora B, co-localization (and potentially co-IP) help delineate subpopulations of Abba protein? Furthermore, the FRET imaging is unique way to connect their mutation with function-could they measure/quantify differences at furrow compared to rest of soma to further corroborate that Abba-associated RhoA effect was furrow-enriched?<br /> -The data highlights nicely that a furrow doesn't clearly form when ABBA expression and subsequent RhoA activity are decreased (in Fig 3 or 5A). Does this lead to cells that can't divide because of poor abscission, especially since "rounding" still occurs? Or abnormal progenitors (with loss of fiber or inability to support neuroblast migration)? Or abnormal progression of progenitors to neuroblasts?

      (3) Limited to a singular time point of mouse cortical development<br /> On page 13, the authors outline the results of their Y2H screen with the identification of three high confidence interactors. Notably, they used a E10.5-E12.5 mouse brain embryo library rather than one that includes E14, the age of their in utero electroporation mice. Many of the authors' claims focus on in utero electroporation of shRNA-Abba of E14 mice that are then evaluated at E16-18. Justification for the focus on this age range should be included to support that their findings can then be applied to all of mouse corticogenesis.

      (4) Detail of the effect of the human variant of the ABBA mutation in mouse is lacking.<br /> Their identification of the R671W mutation is interesting and the IUE model warrants more characterization, as they did with their original KD experiments.<br /> -Could they show that Abba protein levels are decreased (in either cell lines or electroporated tissue)?<br /> -While time-lapse morphology might not have been performed, more analysis on cell division phenotype (such as plane of division and radial glia morphology) would be helpful.

      The resubmission has addressed many of the questions raised.

      I have a few comments that should be addressed:

      (1) The authors maintain a deficit in "migration of immature neurons" which remains unsubstantiated. In their resonse, they state: "we believe that the data showing the accumulation of migrating electroporated cells in the ventricular (V) and subventricular (SV) zones provide compelling evidence of abnormal migration in ABBA-shRNA electroporated cells. "<br /> -Firstly, they do not demonstrate that it's immature neurons, not RGs, that are affected. Secondly, accumulation of cells at the V-SVZ could be due to soley the inability for the RGC to undergo mitosis, therefore remaining stuck"<br /> The commentary of migration, especially of neurons, should be modified.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors show that depletion of MARK2 alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation.

      Impact:

      The Golgi apparatus is a key organelle in cell migration- post translationally modifying and sorting cargo for directed trafficking, acting as a signalling hub, whilst functioning as a nucleation site for microtubules. These functions are essential to establish cell polarity during migration, highlighting the importance of understanding how cells reorient their Golgi in response to different environmental cues.

      The study will be of interest to fundamental biologists investigating Golgi function, and positioning, particularly in the context of different cell migration settings. It may also interest scientists investigating the loss of polarity in cancer or the maintenance of epithelial tissue architecture. I am a cell biologist with expertise in cell trafficking, cytoskeleton, and cell migration- during processes spanning development, homeostasis and cancer.

      Comments on latest version:

      Labelling of graphs - many of the graphs are comparing HT1080 cells with two conditions: parental and KO i.e. Figure 2F, H, I. The labels the authors use are "HT1080 and CAMSAP2 KO". This is confusing and should be changed to "parental and CAMSAP2 KO", the cell type HT1080 could be listed in the figure legend or on the graph below the conditions. (Similar to the labelling in Figure 3 H, I where they use "control and siRNA").

      The method section needs improvement - particularly around analysis methods, and statistical details for experiments. I recommend a supplementary table outlining exactly where the data is from (pooled, biological/technical repeats, n definitions, tests of normality etc).

    1. Reviewer #2 (Public review):

      Summary:

      This work provides a comprehensive understanding of cellular immunity in bivalves. To precisely describe the hemocytes of the oyster C. gigas, the authors morphologically characterized seven distinct cell groups, which they then correlated with single-cell RNA sequencing analysis, also resulting in seven transcriptional profiles. They employed multiple strategies to establish relationships between each morphotype and the scRNAseq profile. The authors correlated the presence of marker genes from each cluster identified in scRNAseq with hemolymph fractions enriched for different hemocyte morphotypes. This approach allowed them to correlate three of the seven cell types, namely hyalinocytes (H), small granule cells (SGC), and vesicular cells (VC). A macrophage-like (ML) cell type was correlated through the expression of macrophage-specific genes and its capacity to produce reactive oxygen species. Three other cell types correspond to blast-like cells, including an immature blast cell type from which distinct hematopoietic lineages originate to give rise to H, SGC, VC, and ML cells. Additionally, ML cells and SGCs demonstrated phagocytic properties, with SGCs also involved in metal homeostasis. On the other hand, H cells, non-granular cells, and blast cells expressed antimicrobial peptides. This study thus provides a complete landscape of oyster hemocytes with functional validation linked to immune activities. This resource will be valuable for studying the impact of bacterial or viral infections in oysters.

      The main strength of this study lies in its comprehensive and integrative approach, combining single-cell RNA sequencing, cytological analysis, cell fractionation and functional assays to provide a robust characterization of hemocyte populations in Crassostrea gigas.

      (1) The innovative use of marker genes, quantifying their expression within specific cell fractions, allows for precise annotation of different cellular clusters, bridging the gap between morphological observations and transcriptional profiles.

      (2)The study provides detailed insights into the immune functions of different hemocyte types, including the identification of professional phagocytes, ROS-producing cells, and cells expressing antimicrobial peptides.

      (3) The identification and analysis of transcription factors specific to different hemocyte types and lineages offer crucial insights into cell fate determination and differentiation processes in oyster immune cells.

      (4) The authors significantly advance the understanding of oyster immune cell diversity by identifying and characterizing seven distinct hemocyte transcriptomic clusters and morphotypes.

      These strengths collectively make this study a significant contribution to the field of invertebrate immunology, providing a comprehensive framework for understanding oyster hemocyte diversity and function.

      Conclusion:

      The authors largely achieved their primary objective of providing a comprehensive characterization of oyster immune cells. They successfully integrated multiple approaches to identify and describe distinct hemocyte types. The correlation of these cell types with specific immune functions represents a significant advancement in understanding oyster immunity. The authors are aware of the limitations of their study, particularly with regards to the pseudotime analysis, which provides a conceptual framework for understanding lineage relationships but requires further experimental validation to confirm its findings.

      This study is likely to have a significant impact on the field of invertebrate immunology, particularly in bivalve research. It provides a new standard for comprehensive immune cell characterization in invertebrates. The identification of specific markers for different hemocyte types will facilitate future research on oyster immunity. The proposed model of hemocyte lineages, while requiring further validation, offers a framework for studying hematopoiesis in bivalves.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript reconsiders the "general form" of Hamilton's rule, in which "benefit" and "cost" are defined as regression coefficients. It points out that there is no reason to insist on Hamilton's rule of the form -c+br>0, and that, in fact, arbitrarily many terms (i.e. higher-order regression coefficients) can be added to Hamilton's rule to reflect nonlinear interactions. Furthermore, it argues that insisting on a rule of the form -c+br>0 can result in conditions that are true but meaningless and that statistical considerations should be employed to determine which form of Hamilton's rule is meaningful for a given dataset or model.

      Strengths:

      The point is an important one. While it is not entirely novel-the idea of adding extra terms to Hamilton's rule has arisen sporadically (Queller 1985, 2011; Fletcher & Zwick 2006; van Veelen et al. 2017)--it is very useful to have a systematic treatment of this point. I think the manuscript can make an important contribution by helping to clarify a number of debates in the literature. I particularly appreciate the heterozygote advantage example in the SI.

      Weaknesses:

      Although the mathematical analysis is rigorously done and I largely agree with the conclusions, I feel there are some issues regarding terminology, some regarding the state of the field, and the practice of statistics that need to be clarified if the manuscript is truly to resolve the outstanding issues of the field. Otherwise, I worry that it will in some ways add to the confusion.

      (1) The "generalized" Price equation: I agree that the equations labeled (PE.C) and (GPE.C) are different in a subtle yet meaningful way. But I do not see any way in which (GPE.C) is more general than (PE.C). That is, I cannot envision any circumstance in which (GPE.C) applies but (PE.C) does not. A term other than "generalized" should be used.

      (2) Regression vs covariance forms of the Price equation

      I think the author uses "generalized" in reference to what Price called the "regression form" of his equation. But to almost everyone in the field, the "Price Equation" refers to the covariance form. For this reason, it is very confusing when the manuscript refers to the regression form as simply "the Price Equation".

      As an example, in the box on p. 15, the manuscript states "The Price equation can be generalized, in the sense that one can write a variety of Price-like equations for a variety of possible true models, that may have generated the data." But it is not the Price equation (covariance form) that is being generalized here. It is only the regression that Price used that is being generalized.

      To be consistent with the field, I suggest the term "Price Equation" be used only to refer to the covariance form unless it is otherwise specified as in "regression form of the Price equation".

      (3) Sample covariance: The author refers to the covariance in the Price equation as "sample covariance". This is not correct, since sample covariance has a denominator of N-1 rather than N (Bessel's correction). The correct term, when summing over an entire population, is "population covariance". Price (1972) was clear about this: "In this paper we will be concerned with population functions and make no use of sample functions". This point is elaborated on by Frank (2012), in the subsection "Interpretation of Covariance".

      Of course, the difference is negligible when the population is large. However, the author applies the covariance formula to populations as small as N=2, for which the correction factor is significant.

      The author objects to using the term "population covariance" (SI, pp. 8-9) on the grounds that it might be misleading if the covariance, regression coefficients, etc. are used for inference because in this case, what is being inferred is not a population statistic but an underlying relationship. However, I am not convinced that statistical inference is or should be the primary use of the Price equation (see next point). At any rate, avoiding potential confusion is not a sufficient reason to use incorrect terminology.

      Relatedly, I suggest avoiding using E for the second term in the Price equation, since (as the ms points out), it is not the expectation of any random variable. It is a population mean. There is no reason not to use something like Avg or bar notation to indicate population mean. Price (1972) uses "ave" for average.

      I should add, however, that the distinction between population statistics vs sample statistics goes away for regression coefficients (e.g. b, c, and r in Hamilton's rule) since in this case, Bessel's correction cancels out.

      (4) Descriptive vs. inferential statistics

      When discussing the statistical quantities in the Price Equation, the author appears to treat them all as inferential statistics. That is, he takes the position that the population data are all generated by some probabilistic model and that the goal of computing the statistical quantities in the Price Equation is to correctly infer this model.

      It is worth pointing out that those who argue in favor of the Price Equation do not see it this way: "it is a mistake to assume that it must be the evolutionary theorist, writing out covariances, who is performing the equivalent of a statistical analysis." (Gardner, West, and Wild, 2011); "Neither data nor inferences are considered here" (Rousset 2015). From what I can tell, to the supporters of the Price equation and the regression form of Hamilton's rule, the statistical quantities involved are either population-level *descriptive* statistics (in an empirical context), or else are statistics of random variables (in a stochastic modeling context).

      In short, the manuscript seems to argue that Price equation users are performing statistical inference incorrectly, whereas the users insist that they are not doing statistical inference at all.

      The problem (and here I think the author would agree with me) arises when users of the Price equation go on to make predictive or causal claims that would require the kind of statistical analysis they claim not to be doing. Claims of the form "Hamilton's rule predicts.." or use of terms like "benefit" and "cost" suggest that one has inferred a predictive or causal relationship in the given data, while somehow bypassing the entire theory of statistical inference.

      There is also a third way to use the Price equation which is entirely unobjectionable: as a way to express the relationship between individual-level fitness and population-level gene frequency change in a form that is convenient for further algebraic manipulation. I suspect that this is actually the most common use of the Price equation in practice.

      For a paper that aims to clarify these thorny concepts in the literature, I think it is worth pointing out these different interpretations of statistical quantities in the Price equation (descriptive statistics vs inferential statistics vs algebraic manipulation). One can then critique the conclusions that are inappropriately drawn from the Price equation, which would require rigorous statistical inference to draw. Without these clarifications, supporters of the Price equation will again argue that this manuscript has misunderstood the purpose of the equation and that they never claimed to do inference in the first place.

      (5) "True" models

      Even if one accepts that the statistical quantities in the Price equation are inferential in nature, the author appears to go a step further by asserting that, even in empirical populations, there is a specific "true" model which it is our goal to infer. This assumption manifests at many points in the SI when the author refers to the "true model" or "true, underlying population structure" in the context of an empirical population.

      I do not think it is necessary or appropriate, in empirical contexts, to posit the existence of a Platonic "true" model that is generating the data. Real populations are not governed by mathematical models. Moreover, the goal of statistical inference is not to determine the "true model" for given data but to say whether a given statistical model is justified based on this data. Fitting a linear model, for example, does not rule out the possibility there may be higher-order interactions - it just means we do not have a statistical basis to infer these higher-order interactions from the data (say, because their p-scores are insignificant), and so we leave them out.

      What we can say is that if we apply the statistical model to data generated by a probabilistic model, and if these models match, then as the number of observations grows to infinity, the estimators in the statistical model converge to the parameters of the data-generating one. But this is a mathematical statement, not a statement about real-world populations.

      A resolution I suggest to points 3, 4, and 5 above is:<br /> *A priori, the statistical quantities in the Price Equation are descriptive statistics, pertaining only to the specific population data given.<br /> *If one wishes to impute any predictive power, generalizability, or causal meaning to these statistics, all the standard considerations of inferential statistics apply. In particular, one must choose a statistical model that is justified based on the given data. In this case, one is not guaranteed to obtain the standard (linear) Hamilton's rule and may obtain any of an infinite family of rules.<br /> *If one uses a model that is not justified based on the given data, the results will still be correct for the given population data but will lack any meaning or generalizability beyond that.<br /> *In particular, if one considers data generated by a probabilistic model, and applies a statistical model that does not match the data-generating one, the results will be misleading, and will not generalize beyond the randomly generated realization one uses.

      Of course, the author may propose a different resolution to points 3-5, but they should be resolved somehow. Otherwise, the terminology in the manuscript will be incorrect and the ms will not resolve confusion in the field.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors use AlphaFold2 to identify potential binding partners of nuage localizing proteins.

      Strengths:

      The main strength of the paper is that the authors experimentally verify a subset of the predicted interactions.

      Many studies have been performed to predict protein-protein interactions in various subsets of proteins. The interesting story here is that the authors (i) focus on an organelle that contains quite some intrinsically disordered proteins and (ii) experimentally verify some (but not all) predictions.

      Weaknesses:

      Identification of pairwise interactions is only a first step towards understanding complex interactions. It is pretty clear from the predictions that some (but certainly not all) of the pairs could be used to build larger complexes. This is Done only for some cases and could be extended to the entire network.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, the authors investigate the molecular mechanism behind kinesin-1's coordinated movement along microtubules, with a focus on how ATP binding, hydrolysis, and microtubule attachment/detachment are regulated in the leading and trailing heads. Using pre-steady state kinetics and single-molecule assays, they show that the neck linker's conformation modulates nucleotide affinity and detachment rates in each head differently, establishing an asynchronous chemo-mechanical cycle that prevents simultaneous detachment. Supported by cryo-EM structural data, their findings suggest that strain-induced conformational changes in the nucleotide-binding pockets are crucial for kinesin's hand-over-hand movement, presenting a detailed kinetic model of its stepping mechanism. The manuscript is well-crafted, technically rigorous, and should be of significant interest to cell biology and cytoskeletal motor researchers.

      Significance:

      All conclusions are well-supported by the provided data. The findings address a critical gap in our understanding of how kinesin's two motor domains coordinate their movements, offering insights into the molecular basis of its stepping mechanism. This work should be of significant interest to the cytoskeletal research community.

      Comments on latest version:

      The authors have satisfactorily addressed my comments, although I recommend the addition of the following reference:

      Lu Rao, Jan O. Wirth, Jessica Matthias, and Arne Gennerich. 2025. A Two-Heads-Bound State Drives KIF1A Superprocessivity. bioRxiv 2025.01.14.632505

      This paper provides conclusive evidence that kinesin-1 predominantly adopts a one-head-bound state at limiting ATP concentrations and remains in this state for a significant portion of its enzymatic cycle even at saturating ATP. This limits its processivity compared to KIF1A, which predominantly adopts a two-heads-bound state under saturating ATP conditions. These findings directly support the authors' conclusion that trailing head dissociation is favored over leading head detachment.

    1. Reviewer #2 (Public review):

      This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

      This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

      While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

      (1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

      (2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

      (3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

      (4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

      (5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

      (6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

      (7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

    1. Reviewer #2 (Public review):

      Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

      (1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

      (2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

      (3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

      (4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

      (5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

      (6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

    1. Reviewer #2 (Public review):

      Summary

      This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

      Strengths

      This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

      The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

      The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

      Weaknesses

      As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

      As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

      This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

      However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of a fed vs hungry state on food decision-making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings:

      Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

    1. Reviewer #2 (Public review):

      Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

      Strengths:<br /> The potential application to dentin regeneration is interesting.

      Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

      (1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

      (2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

      (3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

      (4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

      (5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

    1. Reviewer #2 (Public review):

      Summary:

      For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

      Strengths:

      By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

    1. Reviewer #2 (Public review):

      Summary:

      Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

      Strengths:

      Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

      Weaknesses:

      The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

    1. Reviewer #2 (Public review):

      It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

    1. Reviewer #2 (Public review):

      Summary:

      Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

      Strengths:

      The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

      Weaknesses:

      (1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

      (2) There is no statement for the upper limitation of the expandability.

      (3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

    1. Reviewer #2 (Public review):

      Summary:

      The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

      Strengths:

      (1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

      (2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

      (3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

      Weaknesses:

      (1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

      (2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

      (3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

    1. Reviewer #2 (Public review):

      The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

      Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

      (1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

      (2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

      (3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

      (4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

      (5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

      To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

    1. Reviewer #2 (Public review):

      Summary and strengths:

      Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

      They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

      Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

      Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

      Strengths:

      The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

      Weaknesses:

      Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

    1. Reviewer #2 (Public review):

      Summary:

      The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

      Strengths:

      The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

      Weaknesses:

      Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

    1. Reviewer #3 (Public review):

      Summary:

      Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

      Strengths:

      The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

      Weaknesses:

      A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

    1. Reviewer #3 (Public review):

      Summary:

      The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

      Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

      Strengths:

      The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

      Weaknesses:

      The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

      Strengths:

      These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

      Weaknesses:

      There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

      Comments on the current version: The authors have addressed my concerns adequately

    1. Reviewer #3 (Public review):

      Summary:

      The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

      Strengths:

      The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

      Comments on revisions:

      I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

    1. Reviewer #2 (Public review):

      This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

      The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

      The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

      The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

      The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

      The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

      One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

      In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

      Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

      Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

      Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    1. Different regions can have unique soilcompositions due to variations in geology, climate, and vegetation.

      "Since soil composition differs by mineral, organic, and environmental components"

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    1. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.

    1. Reviewer #2 (Public Review):

      • A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

      • An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

      Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

      • An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

      • A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

    1. Reviewer #2 (Public review):

      In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

      Major points

      (1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

      (2) The rationale regarding the PR8 hybrid is not well described and should be described better.

      (3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

      (4) Figure 5A and 7A: Negative controls are missing.

      (5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

    1. Reviewer #2 (Public review):

      This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

      The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

      Strengths:

      The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

      Comments on revised version:

      In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

      In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

      Additional comments:

      The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    1. Reviewer #2 (Public review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

      In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

      (1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

      Strengths:

      To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

      Weaknesses:

      However, several critical points need to be addressed.

      (1) Use of Liftoff for GTF Annotation

      The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

      (2) Transcript Filtering and Potential Biases

      The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

      (3) Data Integration with Harmony

      The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

    1. Reviewer #3 (Public review):

      In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

      Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

    1. Reviewer #2 (Public review):

      Summary:

      This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

      Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

      Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

      Strengths:

      The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

      The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

      Weaknesses:

      This study is not, however, without caveats and several specific conclusions are not fully convincing.

      First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

      Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

      Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

      For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

      TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

      In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

      Strengths:

      (1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

      (2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

      Weaknesses:

      (1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

      (2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

      (3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

      (4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

      (5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

      (6) L214, ablations of individual features are missing.

      (7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

      (8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

      (9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

      (10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

      The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

      Strengths:

      The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

      This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

      Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

      Weaknesses:

      Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

      A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

      It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

      The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

      The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

    1. Reviewer #2 (Public review):

      Summary:

      The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

      Strengths:

      The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

      Weaknesses:

      The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

    1. Reviewer #2 (Public review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

      Strengths:

      The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

      That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

      The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

      The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

      I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

      Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

      The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

      Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

      Strengths:

      I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

      Weaknesses:

      The weakness of the study revolves around two aspects:

      (1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

      (2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

      Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

    1. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript Bohra et al. measure the effects of estrogen responsive gene expression upon induction on nearby target genes using a TAD containing the genes TFF1 and TFF3 as a model. The authors propose that there is a sort competition for transcriptional machinery between TFF1 (estrogen responsive) and TFF3 (not responsive) such that when TFF1 is activated and machinery is recruited, TFF3 is activated after a time delay. The authors attribute this time delay to transcriptional machinery that was being sequestered at TFF1 becomes available to the proximal TFF3 locus. The authors demonstrate that this activation is not dependent on contact with the TFF1 enhancer through deletion, instead they conclude that it is dependent on a phase-separated condensate which can sequester transcriptional machinery. Although the manuscript reports an interesting observation that there is a dose dependence and time delay on the expression of TFF1 relative to TFF3, there is much room for improvement in the analysis and reporting of the data. Most importantly there is no direct test of condensate formation at the locus in the context of this study: i.e. dissolution upon the enhancer deletion, decay in a temporal manner, and dependence of TFF1 expression on condensate formation. Using 1,6' hexanediol to draw conclusion on this matter is not adequate to draw conclusions on the effect of condensates on a specific genes activity given current knowledge on its non-specificity and multitude of indirect effects. Thus, in my opinion the major claim that this effect of a time delayed expression of TFF3 being dependent on condensates in not supported by the current data.

      Strengths:

      The depends of TFF1 expression on a single enhancer and the temporal delay in TFF3 is a very interesting finding.

      The non-linear dependence of TFF1 and TTF3 expression on ER concentration is very interesting with potentially broader implications.

      The combined use of smFISH, enhancer deletion, and 4C to build a coherent model is a good approach.

      Weaknesses:

      There is no direct observation of a condensate at the TFF1 and TFF3 locus and how this condensate changes over time after E2 treatment, upon enhancer deletion, whether transcriptional machinery is indeed concentrated within it, and other claims on condensate function and formation made in the manuscript. The use of 1,6' HD is not appropriate to test this idea given how broadly it acts.

      Comments on latest version:

      I don't think the response to Reviewer 2's comment on LLPS condensates on TFF1 are adequate and given this point is essential to the claims of the manuscript they must be addressed. Namely, the data from Saravavanan, 2020 actually suggest that condensate formation at the locus is not very predictive and barely enriched over random spots. The claims in the manuscript on the dependence of the condensate being responsible for sequestering transcriptional machinery are quite strong and the crux of the current model. To continue to make this claim (which I don't think is necessary since there are other possible models) the authors must test if the condensate at his locus (1) shows time dependent behavior, (2) is not present or weakened at the locus in cells that show high TFF3 expression, (3) is indeed enriched for transcriptional machinery when TFF1 peaks. The use of 1,6 hexanediol is not appropriate as pointed out by reviewer 2 and is no longer considered as an appropriate experiment by many as the whole notion of LLPS forming nuclear condensates is now under question. Such condensates can form through a variety of mechanisms as reviewed for example by Mittaj and Pappu (A conceptual framework for understanding phase separation and addressing open questions and challenges, Molecular Cell, 2022). Furthermore, given the distance between TFF1 and TFF3 it is hard to imagine that if a condensate that concentrates machinery in a non-stoichiometric manner was forming how it would not boost expression on both genes and be just specific to one. There must be another mechanism in my opinion.

      I would recommend the authors remove this aspect of their manuscript/model and simply report their interesting findings that are actually supported by data: The temporal delay of TFF3 expression, the dependence on ER concentration, and the enhancer dependence.