1,154 Matching Annotations
  1. May 2019
    1. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D­mannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
    2. Synthesis of Stearyl linked Gal 1,4 ~ Man phosphate (synthetic substrate for elongating-MPT activity)
    3. Synthesis of Radiolabeled Exogenous Precursor of Phosphoglycan Biosynthesis
    4. Design, Synthesis and Evaluation of Inhibitors of Phosphoglycan biosynthesis
    5. 3.37 (t, J = 2 Hz, 1 H), 3.34 (s, 3H, OMe); 13C NMR (020, 75 MHz) 8 103.01, 102.17, 100.70,99.71,78.64,77.46,77.21,77.05,75.50,75.31, 75.17, 73.79, 72.92, 72.60, 72.48, 72.24, 70.82, 70.23, 69.94, 68.40, 68.08, 66.62, 60.99, 60.79, 60.46, 56.83; HRMS(FAB): Calculated for [ M+ Nat C25H44021Na 703.227279, found 703.226277.
    6. MR ( 020, 300 MHz) 8 5.23.(q, J = 1.46 Hz, 1 H, H-1"'), 5.20 (d, J = 1.22 Hz, 1 H, H-1"), 4.86 (bs, 1H, H-1), 4.26 (d, J = 8.51 Hz, 1H, H-1'), 3.95 (d, J = 1.83 Hz, 1 H, H-2"), 3.93 (m, 1 H), 3.9 (d, J= 2.53 Hz, 1 H, H-2), 3.76 (bs, 1 H), 3.75 (bs, 1 H, H-2"), 3.54 (d, J = 1.8 Hz, 3H), 3.40 (d, J = 7.91 Hz, 1 H, H-2'),
    7. at -30°C when TlC showed complete disappearance of the reactants. The mixture was quenched with pyridine (2 ml), filtered through celite pad and the filtrate was co-concentrated with toluene. The residue was purified by silica column using ethyl ace'late-hexane (32:68) to provide fully protected tetrasaccharide cap (43, 0.019 g, 63~~) domain of LPG; R, = 0.236 in 50% ethyl acetate-hexane; [a]D +12.06 (c 0.058, CHCI3); 1H NMR (COCI3, 300 MHz) 8 7.29-7.14.(m, 30H, ArH), 5.33 (d, J = 1.8 Hz, 11-l), 5.38-5.32 (m, 3H), 5.28-5.23 (d, J = 9.9 Hz, 2H), 5.18 (dd, J = 1.8, 1.5 Hz, 1 H), 4.93-4.89 (d, J = 11 Hz, 2H), 4.75-4.74 (d, J = 2.1 Hz, 1 H, H-1'or H-1"'), 4.66-4.60 (rn, 2H), 4.62-4.61 (d, J = 1.64 Hz, 1H, H-1"' or H-1"), 4.54-4.50 (d, J = 12 Hz, 2H), 4.44-4.42 (d, J = 6.9 Hz, 1H, H-1'), 4.40-4.38 (d, J = 6.1 Hz, 1H), 4.35-4.31 (d, J = 9.9 Hz, 2H), 4.25 (m, 1 H), 4.29-4.17 (m, 4H), 4.14-4.07 (m, 4H), 4.04 (m, 2H), 4.00 (m, :2H), 3.89 (d, J = 2.7 Hz, 1 H), 3.83-3.80 (m, 1 H), 3.74-3.68 (m, 1 H), 3.57-3.52 (m, 1 H), 3.46 (s, 3H, OMe), 3.44-3.32 (m, 4H), 2.09, 2.03, 2.01, 2.00, 1.99, 1.97, 1.96 (7 x s, 21 H, 7 x OCOCH3); 13C NMR (COCI3, 75 MHz) 8 174.9, 173.5, 171.2, 170.3, 169.6, 169.5, 169.3, 146.6, 138.9, 138.6, 132.6, 130.9, 129.8, 128.4, 128.2, 128.1, 128.07,128.0,127.76,127.72,127.65,127.54,127.4, 127.34, 127.3, 126.9, 109.15, 103, 100.6, 98.56, 74.7, 74.5, 73.2, 72.9, 72.5, 69.6, 68.1, 66.1, 62.3, 62.1, 61.9, 56.8,20.76,20.58; HRMS(FAS): Calcd. for [M+Nar C81H94028Na 1537.58290, found 1537.58270. Methyl 0-( a-D-man nopyranosyl )-( 1--72)-O-a-D-mannopyranosyl-(1--72)-0-[J3-D-galactopyranosyl-(1--74)]-a-D-mannopyranoside (44). Solution of the fully protected tetrasaccharide cap 43 (2 mg, 0.0014 mmol) in absolute EtOH (3 ml) and palladium hydroxide (5 mg, 20 wt %) was stirred under slight pressure of hydrogen for 4 h. The reaction mixture was filtered through celite and the filtrate concentrated under reduced pressure to obtain debenzylated product. This was dissolved in anhydrous CH30H (1.5 ml), catalytic amount of sodium methoxide (0.8 mg) was added and the solution was stirred for 2 h at rt. The reaction mixture was quenched with 3 drops of 0.5% HCI solution and excess of CH30H was removed under reduced pressure and the residue was lyophilized three times with the addition of water (500 Jll) to remove traces of HC!. This provided pure methyl glycoside of the tetrasaccharide cap 44 in quantitative yield; R, = 0.276 in nPrOH:acetone:H20 (first run 9:6:5, second run 5:4:1); 1H N
    8. eves (4 A, 150 mg) under nitrogen for 30 min. The mixture was then cooled to -30°C and trimethylsilyltriflate solution (TMSOTf, 3.66 III dissolved in 1 ml CH2CI2) was added dropwise keeping the reaction temperature at -30°C. The reaction mixture was stirred for another 15 min
    9. 0.09 in 50% ethylacetate-hexane; [aJo +19.54 (c 0.22, CHCI3); 1H NMR (CDCI3, 300 MHz) .85.40-5.42 (dd, J = 2.4,3.3 Hz, 1H, H-3), 5.38-5.37 (d, J = 3.3 Hz, 1H, H-1), 5.36-5.33 (m, 2H, H-4', H-4), 5.30-5.23 (m, 2H, H-2', H-3), 4.92 (d, J = 1.8 Hz, 1 H, H-1'),4.23-4.19 (m, 2H, H-6a', H-6b'), 4.17-4.14 (dd, J = 3.7,5.1 Hz, 1H, H-2), 4.13-4.11 (m, 2H, H-6a,6b), 4.08-4.05 (ddd, J = 2.7,2.4 Hz, 1 H, H-5), 3.65-3.59 (m, 1 H, H-5'), 2.13-1.99 (7 x s, 21 H, COMe); 13C NMR (CDCI3, 75 MHz) 8 171.0, 170.6, 170.3, 169.7, 169.6, 169.4, 169.37, 169.3, 98.6, 92.5, 77.2, 70.4, 69.97, 69.6, 69.5, 68.97, 68.3, 66.2, 66.0, 62.27, 62.1,20.77-20.54; HRMS(FAB): Calcd for [M+Hr C26H37018 637.197990, found 637.200305. 3,4,6-Tri-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-(a-D-mannopyranosyl)-(3-D-manno pyranosyl trichloroacetimidate (42). To a solution of heptaacetate 41 (254 mg, 0.4 mmol) in anhydrous CH2CI2 (3 ml) at O°C was added successively, trichloroacetonitrile (10.0 equiv, 400 Ill) and DBU (0.0325 equiv, 20 Ill). After stirring for 1 h at 0 °C TlC showed completion of the reaction. Solvent was evaporated under reduced pressure and the residue was flash chromatographed (30:70, ethyl acetate-hexane) to give the disaccharide donor 42 (O.185g, 60%); [aJo +31.21, (c 1.36, CHCI3); 1H NMR (CDCb, 300 MHz) 8 8.71 (1 H, s, NH), 6.41 (d, J = 1.86 Hz, 1H, H-1), 5.49-5.46 (bd, J = 9.9 Hz, 1H, H-4), 5.43-5.38 (dd, J = 3.45,10.2 Hz, 1H, H-3'), 5.35-5.31 (dd, J = 3.15, 10.2 Hz, 1 H, H-3), 5.28-5.23 (m, 1 H, H-4'), 5.28-5.26 (dd, J = 1.8, 3.3 Hz, 1 H, H-2'), 4.98 (d, J = 1.5 Hz, 1 H, H-1 '), 4.29-4.27 (1 H, dd, J = 2.55,5.1, H-2), 4.24-4.14 (5H, m, H-6'a, 6'b, 5', 6a, 6b), 4.12-4.10 (ddd, J = 3,3.6,3.6 Hz, 1 H, H-5), 2.14-2.00 (7 x s, 21 H, COMe); 13C NMR (CDCb, 75 MHz) 8 170.6, 170.5, 170.2, 169.78, 169.59, 169.37, 169.10,99.1,95.4,76.4,75.4,74.8,71.1, 69.7, 69.5, 69.4, 68.2, 66.0, 65.2, 62.1, 61.5, 20.74-20.53; HRMS(ESMS): Calcd for [M+Nar C28H36018NCI3Na 802.0896, found 802.0801. Methyl 0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosYI)-(1-72)-0-(3,4,6-tri-0-acetyl-a-D-mannopyranosYI)-(1-72)-0-[(2,3,4,6-tetra-O-benzyl-(3-D-galactopyra nosyl)-(1-74)]-3,6-di-O-benzyl-a-D-mannopyranoside (43). A solution of the protected Gal-Man acceptor 35 (0.018 g, 0.020 mmol) and mannobiose trichloroacetamidate donor 42 (0.031 g, 0.04 mmol) in anhydrous CH2CI2 (2 ml) was stirred with freshly activated molecular si
    10. NMR (CDCI3, 300 MHz) /55.78 (d, J = 0.9 Hz, 1 H, H-1), 5.46-5.50 (dd, J = 9.9 Hz, 1H, H-4', H-2'), 5.29-5.31 (dd, J = 3.6,1.95 Hz, 1H, H-4), 5.09-5.13 (dd, J = 9.6, 3 Hz, 1 H, H-3), 5.00 (d, J = 1.8 Hz, 1 H, H-1'), 4.40 (m, 1 H, H-5'), 4.14-4.16 (dd, J = 3,1.2 Hz, 1H, H-2), 4.01-4.34 (m, 4H, H-6', H-6), 3.76-3.80 (m, 1H, H-5), 2.01-2.15 (8 x s, 24H, COMe); 13C NMR (CDCI3, 75 MHz) 820.3-20.77,60.2, 61.6, 62.1, 65.6, 66.0, 68.2, 68.7, 69.8, 72.0, 73.1, 74.5, 75.1, 77.1, 90.8, 98.2, 168.2, 169.1, 169.3, 169.5, 169.6, 170.4, 170.7, 171. HRMS(FAB): Calcd. for [M+Nar C2sH3S019Na 701.190499, found 701.187839. 3,4,6-Tri-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosyl)-j3-D-manno pyranose (41). The mannobiose octaacetate 40 (300 mg, 0.47 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (39 mL) at -20°C and stirred for 5 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated. Flash column chromatography of the crude product with 40% ethyl acetate-hexane resulted in pure heptaacetate 41 (0.225 g, 91 %); R, =
    11. mixture was left at rt for 90 min. after which a solution of sodium acetate (42.5 g) in water (53 mL) at 5 °C was slowly added, keeping the internal temperature of the mixture around 35°C. The resultant solution was then poured onto ice, and the mixture was extracted with CH2CI2 (60 mL x 3). The organic layer was thoroughly washed with cold water and saturated aqueous NaHC03 solution, dried over Na2S04 and concentrated. The residue was crystallized from dry ether to afford pure 39 (3.5 g), and was characterized by comparison with data of commercially available material from Sigma. 1 ,3,4,6-Tetra-O-acetyl-2-0-(2,3,4,6-tetra-O-acetyl-a-D-mannopyranosyl)-j3-D-mannopyranose (40). A solution of man nose trichloroacetimidate donor 38 (985 mg, 2 mmol) and freshly prepared 39 (348 mg, 1 mmol) in anhydrous CH2CI2 (20 mL) was stirred with activated molecular sieves (10 g, 4 A) under nitrogen for 30 min. The reaction mixture was cooled to -30°C and a solution of trimethylsilyltriflate (TMSOTf, 220 ilL, 1.2 mmol) in anhydrous CH2CI2 (10 mL) was added dropwise. The temperature was maintained below -30°C for 15 min when TLC indicated completion of the reaction. The mixture was quenched with pyridine (5 mL), filtered through celite, and the filtrate was co-concentrated with toluene. Flash chromatography of the crude product with 50 % ethyl acetate-hexane afforded pure mannobiose octaacetate 40 as amorphous solid (0.406 g, 60%); R, = 0.208 in 50% ethylacetate-hexane; [a]D +9 (c 0.25, CHCI3); 1H
    12. 2,3,4,6-Tetra-O-acetyl-a-D-mannopyranosyl-trichloroacetimidate (38) 1,2,3,4,6-penta-O-acetyl-a-D-mannopyranose (36, 500 mg, 128 mmol) was dissolved in dry CH3CN saturated with dimethylamine (35 mL) and stirred at -20°C for 1 h after which TLC confirmed complete disappearance of the starting material. Extra dimethylamine was removed under reduced pressure at room temperature and the reaction mixture was concentrated. Flash column chromatography (25:75 ethyl acetate-hexane) provided 2,3,4,6-tetra-O-acetyl-a-D-mannopyranose (37, 445 mg) in quantitative yield. To a solution of compound 37 (0.335 g, 0.962 mmol) in anhydrous CH2CI2 (3 mL) was added trichloroacetonitrile (CI3CCN, 10.0 equiv, 1 mL) and 1,8-diaza bicyclo[5.4.0]undec-7-ene (DBU, 74.7 uL, 0.05 equiv) at O°C. After stirring for 75 min, the solvent was evaporated under reduced pressure and the residue purified by flash chromatography with 20 % ethyl acetate-hexane to give pure 38 (331 mg,70%); 1H NMR (CDCI3, 300 MHz) 8 8.77 (s, 1 H, NH), 6.26 (d, J = 1.8 Hz, 1 H, H-1), 5.45 (dd, J = 2.3 Hz, 1 H, H-2), 5.39-5.37 (dd, J = 2,5 Hz, 1 H, H-3), 5.42-5.33 (m, 1 H, H-4 ), 4.18 (m, 1 H, H-5), 4.12-4.29 (m, 2H, H-6); 13C NMR (CDCI3, 75 MHz) 8 170.45, 169.68, 169.60, 169.50, 159.62, 94.39, 71.08, 68.67, 68.13, 67.73, 65.26, 61.91, 20.54; HRMS(ESMS): Calcd. for [M+Hr C1sH2101ONCI3 491.0153, found 491.0187. 1,3,4,6-Tetra-O-acetyl-f3-D-mannopyranose (39). Few crystals of D-mannose were added to acetic anhydride (53 mL), followed by the addition of 6-7 drops of 60% perchloric acid. This solution was maintained at 45°C and to this was added 0-mannose (14 g) portionwise with constant stirring for 20 min. the mixture was then left at rt for 1 h and subsequently cooled to 15°C. Phosphorus tribromide (13.4 mL) was added dropwise to this mixture, followed by the addition of water (4.8 mL). The
    13. using 20% ethyl acetate in hexane to yield methyl 0-(2,3,4,6-tetra-O-benzyl-a-D-galactopyranosyl)-(1-74)-3,6-di-O-benzyl-a-D-mannopyranoside 35 (149 mg, 64.5%); R, = 0.27 in 50% ethyl acetate-hexane; [a]o +3.891, (c 0.257, CHCI3 ); 1H NMR (CDCI3, 300 MHz) 87.7-6.89 (m, 30H, Ph), 4.96-4.31 (m, 12H, PhCH2), 4.47-4.45 (d, J = 5 Hz, 1H, H-1'), 4.35 (d, J = 2.1 Hz, 1H, H-1), 4.08 ("t", J = 8.7 Hz, 1H, H-4), 4.03 (bs, 1 H, H-2), 3.9-3.89 (d, J = 2.4 Hz, 1 H, H-4'), 3.84-3.80 (dd, J = 2.5, 8.1 Hz, 1 H, H-3), 3.78-3.73 (dd, J = 5.4, 10.4 Hz, 1 H, H-2'), 3.55-3.47 (m, 7H), 3.52 (s, 3H, OMe); 13C NMR (CDCI3, 75 MHz) .8138.85, 138.63, 138.39, 138.33, 137.88, 135.52 (6 ipso C), 128.30-127.29 (ArC's), 103.07, 100.65,82.48,79.75,76.91,75.27,75.06,74.49, 73.39, 73.07, 72.54, 72.33, 68.52, 68.29, 56.87; HRMS(FAB): calcd for [M+Nar CSSHSOOllNa 919.4033333, found 919.400521.
    14. (232 mg, 91 %); Rt= 0.16 in 50% ethyl acetate-hexane; [a]o +21.84 (c 0.238, CHCI3); 1H NMR (COCI3, 300 MHz) 8 5.0 (d, J = 2.1 Hz, 1H, H-1), 4.55 (d, J = 12.9 Hz, 1H, H-3), 4.55 (m, 1 H, H-4), 4.40-4.22 (m, 3H, H-1', 2', 4'), 3.85 (m, 2H, H-5, 5'), 3.50 (m, 2H, H-6), 3.40 (m, 2H, H-6'), 3.11 (d, J = 2.1 Hz, 1 H, H-2); 13C NMR (COCI3, 75 MHz) 8 138.6-138.2 (6 ipso C), 128.3-127.4 (ArC's), 102.51,82,4,79.7,76.6,75.2, 74.6, 73.5, 73.47, 73.41, 73.0, 72.69, 72.61, 69.17, 68.36; HRMS(ESMS): calcd for [M+Nat CS4Hs601O Na 887.3771 found 887.3761. Methyl 0-(2,3,4,6-tetra-O-benzyl-a-D-galactopyranosYI)-(174)-3, 6 -di-O-benzyl-a-D-glucopyranoside (34). The a-epoxide (33, 232 mg, 0.268 mmol) was dissolved in anhydrous CH30H (150 mL) and allowed to stir at rt for 4 h. The solvent was evaporated and the residue dried under vacuum to yield B-methyl lactoside 34 (231 mg, 96.08%); Rt= 0.37 in 50% ethyl acetate in hexane; [a]o +12 (c 0.200, CHCI3); 1H NMR (COCh, 300 MHz) 8 7.32-7.20 (m, 30H, Ph), 5.11-4.34 (m, 12H, PhCH2), 4.29 (s,1H, H-1'), 4.25 (s, 1H, H-2'), 4.22-4.19 (dd, J = 3.6,7.5 Hz, 1H, H-1), 3.95 (m,1H, H-3), 3.90 (d, J = 2.7 Hz, 1 H, H-4'), 3.8-3.78 (dd, J = 4.35, 11 Hz, 1 H, H-3'), 3.76-3.69 (m, 2H, H-2, H-4), 3.54 (s, 3H, OMe), 3.57-3.33 (m, 6H); 13C NMR (COCb, 300 MHz) 8 138.92, 138.82, 138.68, 138.39, 138.22, 137.92 (6 ipso C), 128.29-127.35 (ArC's), 103.40, 102.69, 82.65, 74.62, 74.54, 73.36, 73.32, 73.06, 72.94, 72.52, 68.09, 56.87; HRMS(FAB): calcd for [M+Nat CSSH60011Na 919.4033, found 919.4023. Methyl 0-(2,3,4,6-tetra-O-benzYI-a-D-galactopyranosyl)-(174)-3,6 -di-O-benzyl-a-D-mannopyranoside (35). A solution of oxalyl chloride (95.8 JlL, 0.177 mmol) in anhyd CH2CI2 (7 mL) was cooled to -78°C, and anhydrous OMSO (154.3 JlL, 0.349 mmol) was added dropwise. The mixture was stirred at -78°C for 10 min and solution of methyl glycoside 34 (231 mg, 0.258 mmol) in CH2CI2 (11.5 mL) was added over 10 min. The cloudy solution was stirred for 40 min followed by addition of triethylamine (5 mL) to give a clear solution. The mixture was brought to rt, diluted with cold water (30 mL) and extracted with CH2CI2• The organic layer was dried over Na2S04 and concentrated under reduced pressure to yield the oxidised 2-ulose intermediate (Rt = 0.53 in 50% ethyl acetate in hexane). This product was dissolved in 50% CH2CI2 in CH30H (4 mL) and NaBH4 (150 mg, 3.96 mmol) was added at 0 °C. The reaction mixture was brought to rt and after 4 h it was diluted with CH2CI2 and washed with cold water. The organic layer was collected, dried over Na2S04 and concentrated to give a crude product which was purified by flash chromatography
    15. am of nitrogen gas, and further dried under vacuum to provide a semisolid hexa-O-benzyl lactal 1,2a-epoxide 33
    16. dissolved in water (100 mL) and extracted with CH2Cb (3 x 60 mL). All the organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyllactal (30, 7.2 g, 87.8%) as amorphous solid [a]o -18 (c 1.0, CHCI3)84. Hexa-O-benzyl lactal (32). A solution of hexa-O-acetyl lactal (30, 7.26 g, 0.013 mmol), dry sodium carbonate (9 g, 0.085 mol) in anhyd CH30H (150 mL) was stirred at rt for 90 min. The suspension was filtered to remove extra Na2C03 and the filtrate was concentrated under reduced pressure to give deacetylated lactal 31 (same as described in Scheme-1) as an amorphous solid (3.87 g, 97.7%); R, = 0.2 in 7:3 CHCkCH30H; [a]o +27 (c 1.6, H20)84. Compound 31 (500 mg, 1.62 mmol) dissolved in anhydrous DMF (5 mL) was added dropwise at 0 °C to a suspension of NaH (1.3 g, 60% dispersion in paraffin) in DMF (5 mL), followed by addition of benzyl bromide (2 mL, 16.8 mmol) and few crystals of tetrabutyl ammonium iodide. The reaction mixture was brought to rt and stirred for 3 h. After completion of the reaction, the mixture was cooled to 0 °C and quenched with CH30H (5 mL), diluted with cold water (50 mL) and extracted with diethyl ether (3 x 30 mL). The ethereal layer was dried over Na2S04 and concentrated to give a crude product which was flash chromatographed using 5% ethyl acetate in hexane to provide compound 32 (792 mg, 60.2%); R, = 0.6 in 50% ethyl acetate-hexane; [a]o -2.1 (c 0.726, CHCI3); 1H NMR (CDCI3, 300 MHz) () 6.43 (dd, J = 6.2,1.1 Hz, 1H, H-1), 4.92 (brd, J = 10.8 Hz, 1 H, H-3'), 4.86 (m, 1 H, H-2), 4.53 (dd, J = 10.5, 1.2 Hz, 1 H, H-4'), 4.35 ( d, J = 4.2 Hz, 2H, H-1'), 4.29 (brs, 1 H, H-4), 4.26 (m, 1 H, H-3), 3.86-3.74 (m, 2H, H-5, 5'), 3.65 (m, 2H, H-6), 3.45 (d, J = 4.2 Hz, 2H, H-1'); 13C NMR (CDCI3, 75 MHz) () 138.6-138.2 (6 ipso C), 128.3-127.4 (ArC's), 102.51, 82.4,79.7, 76.6, 75.2, 74.6, 73.5, 73.47, 73.41,73.0,72.69,72.61,69.17,68.36; HRMS (FAB): calcd for [M+Nat CS4Hs60sNa 871.382204, found 871.386586. Hexa-O-benzyl-lactal-1,2a-epoxide (33). A solution of 3,3-dimethyl dioxirane (DMD) in acetone was freshly prepareds3.s4 by adding potassium monoperoxy sulphate (Oxone, DuPont, 25 g, 0.041 mol) into a mixture of water (20 mL), acetone (13 mL, 0.177 mol), sodium bicarbonate (12 g) in a two neck flask with vigorous stirring at rt. The DMD solution was received through a water condenser (5°C) by application of slight vacuum into a flask cooled to -50°C. DMD was added dropwise to a solution of compound 32 (250 mg, 0.3 mmol) in anhydrous CH2CI2 (2 mL) at 0 °C. After 2 h the reaction mixture was concentrated with a strea
    17. Hexa-O-acetyl lactal (30). A solution of Vitamin B12 (310 mg, 0.22B mmol) in anhydrous CH30H (BO ml) was thoroughly purged with nitrogen for 30 min and zinc powder (17.5 g, 267.6 mmol) and ammonium chloride (14.2 g, 266.25 mmol) were added to the solution. The reaction mixture was stirred for another 45 min and heptaacetyl lactosyl bromide (29), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (4B% hydrobromic acid in acetic acid)], was dissolved in CH30H (30 ml) and added. Immediately after addition of the bromide, the dark red solution changed to reddish yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, and the celite pad was washed with CH30H and the filtrate was concentrated under reduced pressure to give a white and red solid product. This was
    18. Synthesis of Tetrasaccharide Cap Domain of LPG
    19. Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
    20. Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
    21. Synthesis of phosphoglycans by polycondensation
    22. Selective cleavage of phosphoglycans from the resin. This was accomplished by taking the PG loaded resin (3 mg) and Wilkinson's catalyst (1 mg) in argon-purged solvent mixture (300 Ill, toluene-PrOH-H20, 2:1 :0.08 containing 0.01 N HCI) and shaking it for 7 h at rt. The cleavage after first cycle of coupling provided 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galacto pyranosyl]-a-D-mannopyranosyl-phosphate. This intermediate was subjected to full deprotection to provide ~-D-galactopyranosyl-a-D-mannopyranosyl phosphate (25) and compared with authentic sample earlier reported86 by our laboratory; [a]D = +10° (c 0.1, H20); lH NMR (D20, assignments by 2D COSY and TOCSY experiments) 0 3.45 (dd, J = 6.67 and 1.5 Hz, 1 H, H-2'), 3.46 (m, 1 H, H-5), 3.60 (m, 1 H, H-5'), 3.53-3.56 (m, 2H, H-2,3'), 3.68 (m, 2H, H-6), 3.76 (t, J = 7.11 and 2.64 Hz, 1 H, H-3), 3.83 (m, 2H, H-6'), 3.83 (m, 1 H, H-4'), 3.94 (m, 1 H, H-2), 4.38 (d, J = 9.65 Hz, 1 H, H-4), 4.38 (d, J = 7.6 Hz, 1 H, H-1'), 5.27 (dd, J1H-P = 6.8 Hz and J1•2 = 1.9 Hz, 1 H, H-1); 31p NMR 0 -2.07; ESMS, 421.2 [M-1 Ht; HRMS (ESMS): calcd for [M-Hr C12H22014P 421.2720 found 421.2718. Similar procedure was used to cleave phosphotetrasaccharide 22 from resin followed by complete deprotection, which provided compound 23 that was characterized by its comparison with standard prepared by solution method.
    23. opyranosyl phosphate] triethylammonium salt (22). The butenediol-linker functionalized Merrifield resin (19, 50 mg, 0.43 mmol/g, 0.021 mmol) was swollen in anhydrous pyridine (100 Ill) for 15 min, followed by addition of phosphoglycan H-phosphonate donor 6 (26 mg, 0.03 mmol) dissolved in anhydrous pyridine (500 Ill). Now pivaloyl chloride (20 Ill) was added and the resin mixture was shaken for 2 h. Thereafter a 200 III solution of iodine (4 mg) in 95% aqueous pyridine was added and stirring continued for another hour. The resin was then thoroughly washed with CH30H (700 III x 3) and dried over P20S overnight to afford acceptor-functionalized resin (20, 50 mg). ~ The coupled intermediate was characterized by positive ion ESMS after cleaving it off from the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl-a-D­mannopyranose which was identical to compound 5, already synthesized by solution method described earlier; ESMS m/z 731.3 (M+Nat. This compound on full deprotection with 48% aqueous HF-CH3CN (5:95) and CH30H-H20-EhN (5:2:1) provided disaccharide Gal1 ,4~Man (24); lH NMR 8 5.12 (d, J = 1.67 Hz, 1 H, H-1 a), 4.85 (d, 1 H, J = 0.98 Hz, 1 H, H-1 ~), 4.40-4.36 (m, 2H, H-1' and H-4), 3.75 (dd, 1 H, H-2'),3.94-3.92 (m, 2H, H-4' and H-2), 3.89-3.83 (m, 2H, H-6'), 3.81-3.79 (dd, 1H, J= 6 and 2 Hz, 1 H, H-3), 3.75-3.71 (m, 2H, H-6), 3.63-3.59 (dd, 1 H, H-3'), 3.51-3.46 (m, 2H, H-5, H-5'); ESMS: m/z 341.0 [M-Hr. To a part of the PG loaded resin 20 (15 mg), 48% aqueous HF-CH3CN (5:95,500 Ill) was added at 0 °C and the mixture was stirred on a orbital shaker for 3 h. The resin was then washed with CH30H (500 III x 2) and dried under vacuum to afford acceptor bound resin (21) with free 6' hydroxyl groups. This intermediate was again characterized by ESMS after cleaving it off from a small part of the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-O-acetyl-4-0-(2,3,4-tri-O-acetyl-~­D-galactopyranosyl)-a-D-mannopyranose. Authenticity of this compound was confirmed by its comparison (TlC, NMR, ESMS) with standard separately prepared via solution synthesis by deprotection (HF-CH3CN) of TBDMS group from compound 5 (Scheme-1). A second cycle of PG coupling was carried out with identical procedure given above to afford phosphotetrasaccharide (22).
    24. and water (150 mL). The organic layer was dried (Na2S04) and concentrated. The crude product was purified by silica column chromatography (20% ethyl acetate in hexane with 1% EhN) to afford 17 (4.2 g, 80%); Rf = 0.3 in 50% ethyl acetate in hexane; 1H NMR (CDCI3, 300 MHz): <52.03 (s, 1 H), 3.68 (d, J = 4.8 Hz, 2H), 3.78 (s, 6H), 4.03 (d, J = 5.4 Hz, 2H), 5.73-5.75 (m, 2H), 6.82 (tt, J = 1.2 and 9.0 Hz, 4H), 7.25-7.44 (m, 9H); 13C NMR (CDCb, 75 MHz): 55.12, 55.13, 58.75, 59.93, 113.05, 126.68,127.76,127.99,128.95,129.87,130.92, 136.07,144.79,158.37; ESMS m/z 413.39 (M+Nat Preparation of functionalized resin by coupling of linker (19). 4-(4,4'-Dimethoxytrityl)-2-cis-butenol (17, 1 g, 2.56 mmol) was dissolved in anhydrous DMF (8 mL). Upon cooling to 0 °C, sodium hydride (60% dispersion in mineral oil, 150 mg, 3.75 mmol) was added and the solution was stirred for 1 h. Merrifield's resin (18, 650 mg, chloromethylated polystyrene cross-linked with 1 % divinylbenzene, Fluka-63865) was added along with tetra-butylammonium iodide (95 mg, 0.256 mmol) and shaking was continued for an additional hour at 0 °C after which the reaction mixture was brought to rt and shaken for another 12 h. The capping of unreacted sites on resin was accomplished by addition of CH30H (100 ilL) and sodium hydride (100 mg) and shaking the contents for another 4 h, after which more CH30H (5 mL) was added and the resin was washed sequentially with 1:1 CH30H: DMF (10 mL), THF (10 mL x 3) and CH2CI2 (10 mL x 3). The resin was dried over P20s under vacuum to afford 836 mg of the linker-attached resin (19). To quantify loading8S of linker onto the solid support, a stock solution of 3% TFA in CH2CI2 (10 ml) was prepared which contained effectively 0.167 mg of the protected resin. The resulting orange colour liberated by the release of dimethoxytrityl (DMTr) cation was measured by UV at 503 nm, and the loading of the linker onto the resin was calculated to be 0.43 mmol/g of resin. The deprotection of the entire DMTr-linker functionalized resin was then carried out by treating the resin with 1 % TFA in CH2CI2 (10 mL). Further washing with CH2CI2 (20 mL x 3), 1% EhN in CH2CI2 (10 mL) and CH2CI2 (10 mL) and drying under vacuum afforded 640 mg of deprotected resin ready for coupling with phosphoglycan donors. Solid Phase Synthesis of 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a.-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldi methylsi lyl)-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a.-D-mann
    25. Synthesis of SOlid-phase linker, 4-(4,4'-Dimethoxytrityl)-cis-2-butenol (17). To a solution of cis-butene-1,4-diol (16, 4.7 mL, 5 g, 56.7 mmol) in anhydrous pyridine (100 mL) at 0 °C was added 4,4'-dimethoxytrityl chloride (6.4 g, 18.9 mmol). The reaction mixture was gradually brought to rt over 3 h and stirred for additional 12 h. Ethyl acetate (200 mL) was added and the organic phase was washed with water (150 mL), saturated aqueous NaHC03 (200 mL), saturated aqueous NaCI (200 mL)
    26. Solid phase phosphoglycan synthesis
    27. (250 ~L) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M TEAS solution (pH=7, 1 mL). The clear solution was stirred for 15 min. after which CH2CI2 was added and the organic layer was washed with ice cold water (1 mL x 2), cold 1 M TEAS buffer (1 mL x 2), dried over Na2S04, and concentrated to yield compound 13 (5.1 mg, 86%); ESMS m/z 1'427.9 (M-Et3N-H): 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl -(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-~­D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate] } bistriethylammonium salt (14). Mixture of compounds 13 (5.1 mg, 0.003 mmol) and 6 (5 mg, 0.007 mmol) was dried by evaporation of pyridine (500 ~L x 2). The residue was dissolved in anhydrous pyridine (200 ~L) and pivaloyl chloride (2.4 ~L, 0.02 mmol) was added. The mixture was stirred at rt for 1 h and a freshly prepared iodine solution (200 ~L, 4 mg, 0.015 mmol in pyridine-water, 95:5) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M aqueous Na2S203 solution (2 mL x 2), ice-cold 1 M TEAS buffer (2 mL x 2), dried over Na2S04 and concentrated to afford 14 (4.5 mg, 61%); Rf = 0.11 in 10% CH30H in CH2CI2; ESMS m/z2061.44 (M-2EhN-H), 2062.35 (M-2EhN). ~-D-Galactopyranosyl-(1~4)-a-D-mannopyranoside {6-~-D-galactopyranosyl­(1~4)-a-D-mannopyranosyl phosphate 6-[ ~-D-galactopyranosyl-(1~4)-a-D­mannopyranosyl phosphate]} bis-triethylammonium salt (15). The global deprotection of fully protected phosphohexasaccharide 14 was carried out by same method as given for preparation of compound 9, and this compound was identical to PG oligomer 12 prepared by upstream extension described earlier.
    28. (19 x OCOCH3), 3.50 (m, 6H, H2-6 Gal/Gal'/Gal"), 3.87-3.94 (m, 3H, H-5, Gal/Gal'/Gal"), 4.14-4.07 (m, 3H, 5-H, Man/Man'/Man"), 4.30-4.35 (m, 3H, 4-H, Man/Man'/Man"), 4.39 (m, 6H, H2-6, Man/Man'/Man"), 4.48 (m, 2H, 3-H, Man'/Man"), 4.52 (m, 1 H, 3-H, Man), 4.94 (d, J = 7.7 Hz, 3H, H-1, Gal/Gal'/Gal"), 5.28 (m, 6H, 2-H Man, H-4 Gal/Gal'/Gal", H-3 Gal'/Gal"), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 2H, H-2 Gal'/Gal"), 5.45 (dd, JHH = 1.9 and JHP = 7.0 Hz, 2H, H-1, Man'/Man"), 5.46 (m, 3H, H-2, Gal/Gal'/Gal"), 6.01 (d, J = 1.9 Hz, 1 H, 1-H, Man); 31p_NMR: 8 -1.94; ESMS m/z2061.44 (M-2Et3N-H), 2062.35 (M-2Et3N). ~-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside {S-~-D-galactopyranosyl­(1~4)-a-D-ma nnopyranosyl phosphate S-[ ~-D-galactopyranosyl-(1~4)-a-D­mannopyranosyl phosphate]) bis-triethylammonium salt (12). The global deprotection of fully protected phosphohexasaccharide 11 was carried out by same method as given for preparation of compound 9 earlier; 1 H-NMR (020), due to Oligomeric nature of the molecule (three identical PG repeats), all NMR peaks could not be assigned,: 3.45 (m, 3H, H-2, Gal/Gal'/Gal"), 3.46 (m, 2H, H-5, Man'/Man"), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 3H, H-3, Gal/Gal'/Gal"), 3.60 (m, 3H, H-5, Gal/Gal'/Gal"), 3.68 (m, 6H, H2-6, Man/Man'/Man"), 3.76 (m, 3H, H-3, Man/Man'/Man"), 3.80 (m, 6H, H2-6, Gal/Gal'/Gal"), 3.83 (m, 3H, H-4, GaVGal'/Gal"), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 2H, H-2, Man'/Man"), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J= 7.6 Hz, 2H, H-1, Gal'/Gal"), 4.35 (d, J= 7.6, 1H, H-1, Gal), 5.09 (d, J= 1.8, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed und
    29. = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the anomeric deprotected product in quantitative yield. To a stirred solution of imidazole (6 mg, 0.87 mmol) in anhydrous CH3CN (250 J!L) at 0 °C was added PCI3 (10 J!L, 0.112 mmol) and EhN (30 J!L, 0.215 mmol). The mixture was stirred for 20 min, after which a solution of the above compound in anhydrous CH3CN
    30. Man), 61.37 (C-6, Man'), 62.30 (C-6, Gal'), 65.53 (C-6, d, Jcp = 5.5 Hz, Gal), 69.28 (C-4, Gal), 69.83 (C-4, Gal' and C-3, Man'), 70.84 (C-3, Man and C-2, Man), 71.08 (C-2, d, Jcp = 7.4 Hz, Man'), 72.13 (C-2, Gal' and C-2, Gal), 72.34 (C-5, Man), 73.69 (C-3, Gal', C-3, Gal and C-5, Man'), 74.89 (C-5, d, JcP = 7.5 Hz, Gal), 76.52 (C-5, Gal'), 77.05 (C-4, Man'), 78.14 (C-4, Man), 97.03 (C-1, d, Jcp = 5.5 Hz, Man'), 100.76 (C-1, Man), 104.20 (C-1, Gal'), 104.42 (C-1, Gal); 31p-NMR: -1.29; ESMS m/z 745.38 (M-Et3N-H)"; HRMS (ESMS): calcd for (M-Et3N-H)" C24H42024P 745.1804, found 745.1830. 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mann opyranoside 6-(2,3,4-tri-O-acetyl-(3-D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl­a-D-mannopyranosylphosphate ) triethylammonium salt (10). A solution of 48% aqueous HF in CH3CN (5:95, 5 ml) was added to compound 8 (20 mg, 0.015 mmol) at 0 DC and stirred at 0 DC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated to give compound 10 (15.6 mg, 85%); ESMS m/z 1290.4 (M-EhN-H)" 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactopyrano syl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl -(3-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate ]) bis-triethylammonium salt (11). Mixture of phosphotetrasaccharide acceptor 10 (15.6 mg, 0.015 mmol) and H-phosphonate donor 6 (20.8 mg, 0.024 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (500 Ill), and pivaloyl chloride (10 Ill, 0.083 mmol) was added. The mixture was stirred for 1 h at rt after which a freshly prepared solution of iodine (500 Ill, 16 mg, 0.06 mmol in pyridine-water, 95:5) was added. After 30 min, CH2CI2 was added and the solution was washed successively with cold 1 M aq Na2S203 solution (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. The silica column purification using 5% CH30H in CH2CI2 with 1 % EhN afforded compound 11 (16 mg, 63%); R, = 0.11 in 10% CH30H in CH2Cb; lH-NMR (CDCI3); assignments by 1 H_l H COSY and HMQC experiments. Due to repeating nature (three repeats of phosphoglycan) of the molecule, all NMR peaks could not be assigned:1H NMR 0 0.01 (s, 6H, OSiM~CMe3), 0.84 (s, 9H, OSiMe2CMe3), 2.15-1.96
    31. 2.15 (13 x OCOCH3), 3.50 (m, 4H, H2-6 Gal and Gal'), 3.87 (m, 1 H, H-5, Gal'), 3.94 (m, 1H, H-5, Gal), 4.07-4.10 (m, 1H, H-5, Man'), 4.07-4.14 (m, 1H, H-5, Man), 4.35 (m, 1 H, H-4, Man'), 4.39 (m, 4H, 4-H, H2-6, Man and H2-6, Man'), 4.40 (m, 1 H, H-4, Man), 4.48 (m, 1 H, H-3, Man'), 4.52 (m, 1 H, H-3, Man), 4.94 (d, J = 7.7 Hz, 2H, H-1 ,Gal and H-1, Gal'), 5.28 (m, 4H, H-2 Man, H-4 Gal, H-3 Gal' and H-4 Gal'), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 1 H, H-2 Gal'), 5.45 (dd, JHH= 1.9 and JHP = 7.0 Hz, 1 H, H-1, Man'), 5.46 (m, 1 H, H-2, Gal), 6.01 (d, J = 2.7 Hz, 1 H, H-1, Man); 13C NMR: 0 -5.75, 17.95 and 25.57 (for TBOMS group), 20.48-20.79 (CH~02 x 13), 60.06 (C-6, Gal'), 60.42 (d, Jcp = 8 Hz, C-6, Gal), 62.22 (C-6, Man), 62.63 (C-6, Man'), 66.55 (d, C-2, Man'), 67.46 (d, C-5, Gal), 68.27 (C-4, Gal), 68.64 (C-4, Gal'), 69.37 (C-3, Man'), 69.66 (C-5, Man), 69.84 (C-3, Man), 70.14 (C-5, Man'), 70.75 (C-2, Gal'), 70.88 (C-2, Gal), 71.20 (C-2, Man), 73.31 (C-3, Gal'), 73.76 (C-3, Gal), 74.24 (C-4, Man'), 77.15 (C-4, Man), 78.95 (C-5, Gal'), 90.41 (d, C-1, Man'), 91.69 (C-1, Gal), 101.08 (C-1, Man), 101.29 (C-1, Gal'), 168-171 (CH3CO x 13); 31p_NMR: 0 -2.90 (dt, JPH 7.5 and 10); ESMS m/z 1405.2 (M-EhN-Hf; HRMS (ESMS): calcd for (M-Et3N-Hf C56H82037PSi 1405.4042, found 1405.4105. J3-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside 6-[J3-D-galactopyranosyl-(1~)-a-D-mannopyranosyl phosphate] triethylammonium salt (9). A solution of 48% aqueous HF in CH3CN (5:95, 1.5 ml) was added to compound 8 (15 mg, 0.01 mmol) at 0 °C. The solution was stirred at 0 °C for 2 h. The reaction was quenched by the addition of aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated. The residue was dissolved in anhydrous CH30H (500 Ill) and NaOMe (15 mg) was added, the solution was stirred overnight at rt, deionized with AG-X8 resin (H+), filtered and immediately neutralized with Et3N. After concentration, water (500 III x 3) was evaporated off from the residue to afford tetrasaccharide phosphodiester 9 (7.9 mg, 94%); [a]o = 34° (c 0.15, H20); lH-NMR (020), lH_1H_ COSY assignments: 3.45 (m, 2H, H-2, GaVGal'), 3.46 (m, 1 H, H-5, Man'), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 2H, H-3, Gal/Gal'), 3.60 (m, 2H, H-5, Gal/Gal'), 3.68 (m, 4H, H2-6, Man/Man'), 3.76 (m, 2H, H-3, Man/Man'), 3.80 (m, 4H, H2-6, Gal/Gal'), 3.83 (m, 2H, H-4, GaVGal'), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 1 H, H-2, Man'), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J = 7.6 Hz, 1 H, H-1, Gal'), 4.35 (d, J = 7.6 Hz, 1 H, H-1, Gal), 5.09 (d, J = 1.8 Hz, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 Hz and JHP = 6.8 Hz, 1 H, H-1, Man'); 13C-NMR, assignment made by 20 lH_13C HETCOR experiment, 61.37 (C-6,
    32. 66.57 (C-4'), 69.36 (C-3), 69.53 (C-5), 69.69 (C-2'), 71.20 (C-2). 73.30 (C-3'), 73.86 (C-5'), 91.59 (C-4), 92.54 (C-1), 101.09 (C-1'), 169.13-170.49 (COMe); 31p NMR: 8= 0.13; ESMS m/z 771.26 (M-Et3N-Hr; HRMS (ESMS): calcd for (M-EbN-Hr C30H48019PSi 771.2297, found 771.2276. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4-tri-O-acetyl-j3-D-galactopyranosyl)-a-D-manno pyranose (7). A solution of 48% aqueous HF in CH3CN (5:95, 8 ml) was added to compound 4 (100 mg, 0.132 mmol) at 0 °C and the solution was stirred for 2 h. The reaction was quenched with aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2. The organic layer was washed thoroughly with water, dried over Na2S04 and concentrated to give 7 (72 mg, 85.7%); Rt = 0.3 in 70% ethyl acetate in hexane; [a]o = +4.6° (c 0.3, CHCI3); 1H NMR (CDCI3, 300 MHz) 81.97-2.16 (m, 21 H, 7 x OAc), 3.67-3.74 (m, 3H, H-5',6), 4.08-4.14 (m, 3H, H-5,6'), 4.58 (d, J = 7.8 Hz, 1H, H-1'), 5.16 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.23 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.32 (d, J = 3.3 Hz, 1 H, H-4), 5.41 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 6.01 (d, J = 2.1 Hz, 1 H, H-1); 13C NMR (CDCI3, 75 MHz) 8 20.42-20.77 (7 x COMe), 60.74 (C-6'), 62.25 (C-6), 67.56 (C-4'), 68.31 (C-3), 69.35 (C-5), 69.43 (C-2'), 70.77 (C-2), 70.83 (C-3'), 73.98 (C-5'), 74.32 (C-4), 90.45 (C-1), 101.30 (C-1'), 168.32-170.80 (7 x COMe),; ESMS m/z659.28 (M+Nar; HRMS (ESMS): calcd for (M+NH4r C26H40N018 654.2245, found 654.2272. 2,3,4-Tri-O-acetyl-j3-D-galactopyranosyl-(1-?4)-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-j3-D-galactopyranosyl -(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mannopyranosyl phosphate] triethyl ammonium salt (8). Mixture of H-phosphonate donor 6 (32 mg, 0.036 mmol) and acceptor 7 (23 mg, 0.036 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (600 Ill) and pivaloyl chloride (15 Ill, 0.123 mmol) was added. The reaction mixture was stirred for 1 h at rt and a freshly prepared iodine solution (600 Ill, 18 mg, 0.078 mmol in pyridine-water, 95:5) was added. After 30 min. CH2CI2 (10 ml) was added and the solution was washed successively with cold 1 M aqueous solution of Na2S203 (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. Column chromatography on silica gel (3% CH30H in CH2CI2 with 1 % EbN) afforded product 8 (40 mg, 73.8%); Rt= 0.21 in 10% CH30H in CH2CI2; [a]o = -6.1° (c 0.18, CHCI3); 1H_ NMR (CDCI3, 300 MHz); assignments confirmed by 1H_1H COSY and HMQC experiments: 1 H NMR 8 0.01 (5, 6H, OSiM9:2CMe3), 0.84 (s, 9H, OSiMe2CMe3). 1.96-
    33. 2,3,6-Tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactop yranosyl]-a-D-mannopyranose (5). Compound 4 (100 mg, 0.132 mmol) was dissolved in saturated Me2NH solution in anhydrous CH3CN (20 ml) at -20°C and stirred for 3 h after which TlC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the desired anomeric deprotected compound 5 in quantitative yield; R, = 0.25 in 70% ethyl acetate in hexane; [a]D = +3.75° (c 0.16, CHCI3); 1H NMR (CDCI3, 300 MHz) 80.01 (s, 6H, M~SiCMe3), 0.84 (s, 9H, Me2SiCMSJ), 1.95-2.19 (m, 18H, 6 x OAc), 3.56-3.66 (m, 4H, H-6,6'), 3.91 (m, 1H, H-5), 4.12-4.16 (m, 2H, H-5', OH), 4.40 (d, J= 4.5 Hz, 1H, H-4), 4.40 (d, J= 7.8 Hz, 1 H, H-1'), 4.99 (dd, J = 3.3 and 7.8 Hz, H-3'), 5.09 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'), 5.17 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.23 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 5.43 (m, 2H, H-4',1); 13C NMR (CDCI3, 75 MHz) 8 -5.77 (M~SiCMe3), 17.98 , (Me2SiCMe3)" 20.40-21.38 (OAc), 25.58 (Me2SiCMe3), 60.06 (C-6'), 62.62 (C-6), 66.56 (C-4'), 68.78 (C-3), 69.30 (C-5), 69.51 (C-2'), 70.06 (C-2), 71.21 (C-3'), 73.37 (C-5'), 74.15 (C-4), 91.82 (C-1), 101.04 (C-1'), 169.10-170.52 (COMe); ESMS m/z 731.3 (M+Nat. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethyl silyl)-(3-D-galactopyranosyl]-a-D-mannopyranosyl hydrogen phosphonate (6). To a stirred solution of imidazole (224 mg, 3.28 mmol) in anhydrous CH3CN (5 ml) at o °C was added PCI3 (160 Ill, 1.8 mmol) and EhN (480 Ill, 3.44 mmol). The mixture was stirred for 20 min, after which a solution of compound 5 dissolved in anhydrous CH3CN (5 ml) was added dropwise. The mixture was stirred at 0 °C for 3 hand quenched with 1 M triethylammonium bicarbonate (TEAS) buffer (pH 7, 2 ml). The clear solution was stirred for 15 min, diluted with CH2CI2 (20 ml), and the organic layer was washed with ice cold water (10 ml x 2) and cold 1 M TEAS solution (10 ml x 2) successively, dried over Na2S04 and concentrated to yield phosphoglycan donor 6 (100 mg, 86%); R, = 0.45 in 20% CH30H in CH2CI2; [a]D = -4.5° (c 0.27, CHCb); 1H NMR (CDCI3, 300 MHz) 8 0.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, M~SiCMSJ), 1.95-2.09 (m, 18H, 6 x OAc), 3.49-3.68 (m, 4H, H-6,6'), 3.88 (m, 1 H, H-5), 4.14 (m, 1 H, H-5'),4.36 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1'), 4.95 (dd, J = 3.3 and 7.8 Hz, 1H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.41 (d, J = 3.3 Hz, 1 H, H-4'), 5.48 (dd, J = 1.8 and 8 Hz, 1 H, H-1), 6.92 (d, JH,p= 637.0 Hz, 1H, H-1); 13C NMR (CDCI3, 75 MHz) 8 -5.80, (M~SiCMe3), 17.98 (Me2SiCMe3), 20.48-20.76 (OAc), 25.57 (Me2SiCMSJ), 60.10 (C-6'), 62.42 (C-6),
    34. chromatography (8% CH30H in CH2CI2) to provide compound 2 (10.8 g, 79.5%); Rf = 0.47 in 15% CH30H in CH2CI2; [a]o = +3.45° (c 0.29, CH30H); 1H NMR (020, 300 MHz) 00.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, Me2SiCM~), 3.48 (m, 1 H, H-2'), 3.58 (m, 1 H, H-3'), 3.65 (m, 1 H, H-5), 3.76 (m, 4H, H-6,6'), 3.82 (d, J = 3.1 Hz, 1 H, H-4'), 3.92 (m, 1 H, H-5'), 4.38 (m, 1 H, H-3), 4.31 (d, J = 5.7 Hz, 1 H, H-4), 4.46 (d, J = 7.8 Hz, 1 H, H-1'), 4.76 (dd, J = 3.6 and 6.3 Hz, 1 H, H-2), 6.37 (dd, J = 1.1 and 6.2 Hz, 1 H, H-1); 13C NMR (020, 75 MHz) 0 -4.84 (M~SiCMe3), 25.23 (Me2SiCM~), 59.57 (C-6'), 60.89 (C-6), 67.14 (C-4'), 68.45 (C-3), 70.87 (C-5), 72.52 (C-2'), 75.23 (C-2), 76.68 (C-3'), 77.43 (C-5'), 101.73 (C-4), 102.87 (C-1'), 143.88 (C-1); ESMS m/z 445.10 (M+Naf; HRMS (FAB): calcd for (M+Lif C18H3409SiLi 429.2132, found 429.2126. 1,2,3,6-Tetra-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-( t-butyldimethylsilyl)-~-D-gala ctopyranosyl]-a-D-mannopyranose (4). A solution of 2 (5 g, 11.8 mmol) in water (50 mL) was stirred, to which was added a solution of m-CPBA (6.5 g, 36 mmol) in diethyl ether (50 mL) dropwise at -10 °C. The reaction mixture was brought to 0 °C and stirred for 4 h, and aqueous layer was extracted thoroughly with ether, Iyoph iii zed to afford 4-0-[6-0-( t-butyldi methylsilyl)-f3-0-galactopyranosyl]-a-0-mannopyranose (3) . This was dissolved in anhydrous pyridine (25 mL) and acetic anhydride (25 mL) was added dropwise at 0 °C. The mixture was gradually brought to rt and stirred for 16 h, and after completion of the reaction it was quenched with ice and diluted with CH2CI2. The organic layer was washed with water, dried (Na2S04) and concentrated to give a syrup which was purified by silica column (20% ethyl acetate in hexane) to provide compound 4 as white amorphous solid (7.5 g, 84%); [a]o = +6.72° (c 0.55, CHCI3); Rf = 0.69 in 70% ethyl acetate in hexane; 1H NMR (COCI3, 300 MHz) 0 0.01 (s, 6H, M~SiCMe3)' 0.84 (s, 9H, Me2SiCMe3), 1.95-2.14 (m, 21 H, 7 x OAc), 3.56-3.64 (m, 4H, H-6,6'), 4.17-5.04 (m, 2H, H-5,5'), 4.53 (d, J = 7.8 Hz, 1H, H-1'), 5.01 (dd, J = 3.3 and 7.8 Hz, 2H, H-4), 5.12 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1H, H-2), 5.34 (dd, J = 3.6 and 4.5 Hz, 1H, H-3), 5.41 (d, J = 3.3 Hz, 1H, H-4'), 6.01 (d, J = 2.1 Hz, 1H, H-1); 13C NMR (COCI3, 75 MHz) 8 -5.85 (M~SiCMe3), 17.94 (Me2SiCMe3), 20.40-20.86 (OAc), 25.54 (Me2SiCMe3), 60.01 (C-6'), 62.14 (C-6), 66.45 (C-4'), 68.18 (C-3), 69.25 (C-5), 69.39 (C-2'), 70.58 (C-2), 70.79 (C-3'), 73.38 (C-5'), 73.62 (C-4), 90.25 (C-1), 101.14 (C-1'), 168.08-170.23 (7 x CO); ESMS m/z 773.24 (M+Naf; HRMS (ESMS): calcd for (M+NH4f C32Hs4 N018 Si 768.3110, found 768.3139
    35. Lactal (1). A solution of cyanocobalamin83 (Vitamin B12, 1.5 g, 1.14 mmol) in anhydrous CH30H (400 mL) was thoroughly purged with nitrogen gas for 30 min and zinc powder (87.5 g, 1.338 mol) and ammonium chloride (71 g, 1.33 mol) were added to the solution. The reaction was stirred for another 45 min and hepta-O-acetyl lactosyl bromide (47 g, 67.5 mmol), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (48% hydrobromic acid in acetic acid)], was dissolved in CH30H (150 mL) and added. Immediately after addition of the bromide, the dark red solution changed to reddish-yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, the celite pad was washed with CH30H and the filtrate was concentrated to give a white and red solid. This mixture was dissolved in water (500 mL) and extracted with CH2CI2 (300 mL x 3). Organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyl lactal (36 g, 87%) as an amorphous solid, mp 113° (lit84 mp 114°); [a)D = -18° (c 1.0, CHCI3) (Iit84, -18°, c 1.0, CHCI3). In the next step of complete deacylation, hexa-O-acetyl lactal (36 g, 64.5 mmol) and freshly dried Na2C03 (45 g, 425 mmol) were suspended in anhydrous CH30H (750 mL) and stirred for 90 min at rt. The suspension was filtered to remove excess of Na2C03 and the filtrate was concentrated under reduced pressure to give deprotected lactal (1) as an amorphous solid (19.4 g, 98%); R,= 0.2 in 30% CH30H in CH2CI2; mp 191-193°; [a]D = +27° (c 1.6, H20) (lit84, +27°, c 1.6, H20). 6'-0-(f-butyldimethylsilyl)-lactal (2). A solution of lactal (1, 10 g, 32.4 mmol) and BU2SnO (8 g, 32.5 mmol) in anhydrous CH30H (1000 mL) was heated to reflux for 4 h followed by removal of solvent which provided a yellow powder. The dibutyltin complex was dissolved in anhydrous THF (1000 mL) and TBDMSCI (4.9 g, 32.3 mmol) was added, and the solution was stirred for 48 h at rt. After the completion of reaction, the solvent was evaporated to give a residue which was purified by silica
    36. Solution Phase Synthesis of Phosphoglycans
    37. Synthesis of Phosphoglycan Repeats of Lipophosphoglycan
    38. The NMR spectra of the compounds were obtained on a 300 MHz (for 1H) NMR spectrometer (Avance-DRX 300; Bruker), equipped with a quadrinuclear probe (QNP) and an inverse gradient probe, using XWIN NMR software. Both these probes were 5 mm probes. Deutrated solvents (CDCI3, CD30D, 020 etc) were used for dissolving samples and locking the instrument. Tetramethylsilane (TMS, SiMe4) was used as the internal reference for 1H NMR and 80% ortha-phosphoric acid as external reference for 31 P-NMR. The chemical shifts have been expressed in terms of parts per million (ppm, 6) relative to TMS and coupling constants (J-values) have been expressed in Hertz (Hz). Molecular masses of the compounds were determined by mass spectrometry. Depending on the nature of the compound, electrospray-ionization (ES-MS) was obtained in negative or positive ion mode on a quadrupole mass spectrometer (VG Platform II; VG BioTech, Fisons Instruments, Altrincham, UK) using MassLynx software. High resolution mass spectra were obtained from IICT, Hyderabad and University of Kansas mass spectrometry facility. Optical rotations were obtained using a Perkin-Elmer 241 Spectropolarimeter. Measurements were made at 25°C using sodium D-line. The [alo values have been expressed in the units of 10.1 deg cm2 gm-1. The entire radioactivity operation was carried out in a fume-hood devoted to radiochemical work. Disposable items were discarded at a defined and instructed place. All other necessary precautions for handling radioactivity were taken. Liquid scintillation counting of samples was done on a scintillation counter using preset program for 1H ~ emitter. A suitable aliquot in triplicate was mixed with 5 mL scintillation fluid (Cocktail W-10 g PPO, 0.25 g POPPO and 100 g naphthalene per litre of 1,4-dioxan; SRL) in scintillation vials. For solvent blank, vial containing 5 mL scintillation cocktail was used.
    39. All the reagents used in chemical syntheses and biosynthetic experiments were of the highest purity grade available. Glass-backed and aluminium TLC plates (Kieselgel 60 F254) were procured from Merck. Silica coated preparative glass-backed TLC plates were purchased from AnalTech. AG1-X8 and Dowex 2X8 anion exchange resins were obtained from Bio-Rad. All dry solvents were prepared in the laboratory using standard procedures for drying. Milli Q UF (Reverse Osmosed, ion exchanged and Ultra-filtered; Millipore Corporation, USA) grade water was used. For refluxing an oil-bath (high boiling silicone oil) was used and the temperature was controlled by a variostate and sensor. Stirring of the contents of reaction flasks, oil bath etc., were done using appropriate sized magnetic bars and Magnetic stirrer (Remi). For filtration of materials, Whatman #1 paper and Celite (Fluka) was used. For removing solvent from compounds, a flash evaporator (Rotavapour R-114, Buchi) was used which was connected to a water-chiller circulator and at times with a high vacuum pump to remove high boiling solvents. Monitoring the progress of reactions, analysis of column fractions and identification of reaction intermediates were done by thin layer chromatography on glass backed precoated TLC plates. The developed plates were air-dried and subjected to the following detection system: 1. Iodine vapors: Sublime iodine crystals were mixed with silica gel in an air-tight chamber. When the chamber was full of iodine vapors, the plates were exposed to this when yellowish brown spots were visible against white background. 2. Ultraviolet light: U.V. absorbing compounds were visualized by a hand-held UV lamp (Spectroline Model ENF-260C/F) employing both long and short wavelength UV. 3. Ammonium molybdate-ceric sulfate reagent: This reagent was prepared by dissolving ammonium molybdate (2.5 g) and ceric sulfate (1 g) in water (90 mL) and conc. Sulfuric acid (10 mL). The developed plates were immersed in this reagent and heated with a heat-gun (HEJET Model, Aldrich). Blue spots were observed when the compounds reacted with this reagent.
    40. General procedures
    1. RFFIT is used for detennination of rabies virus neutralizing antibody (RVNA) titers. It is an in vitro cell culture based technique in which foci of virus-infected cells are observed by fluorescent antibody staining. In brief, mouse neuroblastoma (MNA) cells were cultured in T-25 tissue culture flasks in DMEM supplemented with 10% FCS at 35°C in humidified atmosphere of0.5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDT A in DMEM without FCS), centrifuged at 150 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T -25 flasks. Sera from immunized mice were heat inactivated at 56°C for 30 min and the RVNA titers were determined by RFFIT as described previously (Smith . et al., 1996). Briefly, 100 111 of various dilutions of the reference (Standard Rabies Immune Globulin, Biological Research and Reviews, FDA, Maryland, US) and the test sera were mixed with 100 111 Challenge Virus Strain-11 of rabies virus (containing 50 FFD50) in 8-well tissue culture chamber slides and incubated at 35°C in presence of 0.5% C02 for 90 min. After the incubation period, 0.2 ml of MNA cells ( 1 x 1 05) were added to each well and the slides incubated for 40 h following which these were fixed in chilled acetone and stained with FITC conjugated anti-rabies MAb (Centocor Inc, USA) for 45 min. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan). Data was expressed as neutralizing antibody titer that is the reciprocal of the serum dilution resulting in a 50% reduction in the number of the virus infected cells in the presence of the test serum.
    2. RAPID FLUORESCENT FOCUS INHIBITION TEST (RFFIT)
    3. Turku, Finland). Data were expressed as mean counts per minute (cpm) ± SE of triplicate cultures.
    4. Single cell suspensions of splenocytes in RPMI-1640 medium were prepared from plasmid DNA immunized mice, on day 45, by mechanical disruption of the spleen. Red blood cells were lysed by exposing the cell pellet to 1 OX concentration of 50 mM PBS and immediately bringing the concentration to IX PBS by addition of water. Cells were diluted to a final concentration of 3 x 106 cells/ml in RPMI-1640 medium supplemented with l 0% FCS. A 100 J.ll aliquot of splenocytes was added to each well of a 96-well microtitration plate containing serial dilutions of refolded recombinant proteins (r-bmZP1, r-dZP3 orr-rG), diluted in the same medium, as a source of antigen. All assays were carried out in . triplicates. Three days after the addition of the cells, culture were pulsed with 1 J.lCi/well of eH] thymidine (NEN, Life Science Products, Boston, MA) for 16 h. Cells were lysed and harvested onto glass fibre filaments for liquid scintillation counting (Betaplate; Wallac,
    5. T CELL PROLIFERATION ASSAY
    6. weight) as a general anesthetic and ovaries were snap frozen in liquid nitrogen. Ovarian sections of 5 J.lm thickness were cut in a cryostat at -20°C and fixed in chilled methanol for 15 min at RT. Sections passing through follicles were selected, washed with 50 mM PBS and blocked with 3% normal goat serum (NGS) in PBS (v/v) at RT for 1 h. Sections were then washed two times with PBS and incubated with 1: 1 0 dilution of immune serum samples. Ovarian sections incubated with 1:10 dilution of mouse preimmune or immune sera from mice immunized with VR1020 vector served as negative controls. After incubation, the sections were washed three times with PBS and incubated with 1:800 dilution of goat anti-mouse IgG conjugated to FITC (Sigma) for 1 hat RT. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan).
    7. Ability of mouse polyclonal antibodies, generated subsequent to immunization with VRbmZP1 and VRdZP3 plasmid DNA, to recognize native ZP was evaluated by indirect immunofluorescence assay. A normal cycling female bonnet monkey and a female dog were ovariectomized after administration of ketamine hydrochloride (5 mg/kg body
    8. REACTIVITY WITH NATIVE ZP OF THE IMMUNE SERUM SAMPLES OBTAINED FROM MICE IMMUNIZED WITH VRbmZPl AND VRdZP3 PLASMID DNA
    9. The antibody isotypes in the immune sera were determined, by indirect ELISA, using mouse MAb isotyping reagents (Sigma). The microtitration plates coated with r-dZP3 (400 ng/well) and blocked with 1% BSA, were incubated with doubling dilution of pooled serum samples of a group of immunized animals. All the incubations were carried out at 37°Cand were followed by three washings with PBST. The incubation was followed by addition of goat anti-mouse isotype specific antibodies at 1:1000 dilution. The binding was revealed by rabbit anti-goat lgG-HRPO conjugate (Pierce) at an optimized dilution of I: 10,000 and processed for enzymatic activity estimation as described earlier.
    10. Antibody isotyping
    11. 492 run with 620 nm as the reference filter. The antibody response generated was represented as the geometric mean of the absorbance of individual mice sera in a group of immunized animals. b1 addition, the antibody titer against r-dZP3 was also determined by ELISA. The assay was carried out as described above except that 100 ~l of doubling dilutions of the serum samples (dilutions made in PBST supplemented with 0.1% BSA) were added per well in duplicate. For each serum sample tested, a reciprocal of dilution giving an absorbance of 1.0 was calculated by regression analysis and represented as antibody units (AU).
    12. Microtitration plates were coated with optimized concentration of r-bmZP1 (250 ng/well), r-dZP3 (400 ng/well) or r-rG (500 ng/well) in 50 mM PBS, pH 7.4, at 37°C for 1 h and then at 4°C, 0/N. The plates were washed once with PBS and incubated with 1% BSA, (200 Jll/ well) in PBS for 2 h at 37°C for blocking the non-specific sites. All subsequent incubations were carried out for 1 h at 37°C and each incubation was followed by three washings with PBS containing 0.05% Tween-20 (PBST). Post-blocking, the plates were incubated with 1 :50 dilution of either the preimmune or the immune serum samples obtained from mice immunized with the respective plasmid DNA. Antibodies bound tor-bmZP 1, r-dZP3 and r-rG were revealed with 1:2000 dilution of goat anti-mouse IgG (whole molecule) HRPO (Dako). Estimation of the enzymatic activity was carried out with 0.05% OPD in 50 mM citrate phosphate buffer, pH 5.0, containing 0.06% H202 as the substrate. The reaction was stopped with 50 Jll of 5 N H2S04 and the absorbance read at
    13. Enzyme Linked Immunosorbant Assay (ELISA)
    14. CHARACTERIZATION OF THE ANTIBODIES GENERATED IN RESPONSE TO PLASMID DNA IMMUNIZATION
    15. d) Particle delivery using the Helios gene gun A day prior to immunization, hair were removed from the abdominal region of mice using a commercial depilatory agent (Anne French cream). Two cartridges/mouse ( ~ 2 Jlg DNA) were shot under pressurized helium gas ( 400 psi) intradermally at the shaven area of the abdomen of mice using the Helios gene gun. Two boosters comprising of two cartridges each were given on days 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 Jlglmouse in saline). Mice were bled retro-orbitally on days 0, 45 and 52 for analysis of antibody response.
    16. tubing, which was cut into 0.5 inch pieces (cartridges). These cartridges were used to deliver DNA into epidermis of male/female mice. a) Preparation of DNA-gold microcarrier suspension Twenty five mg of gold microcarriers were weighed in a 1.5 ml eppendorf tube to which 100 J..Ll of 0.05 M spermidine was added and vortexed for 10 sec. To the above mixture 100 J..Ll of DNA (0.5 mg/ml) was added and vortexed for another 10 sec. While vortexing, 100 J..Ll of 1 M CaCh was added dropwise to the mixture and left at RT for 10 min to allow precipitation of DNA onto gold microcarriers. The DNA-gold pellet was collected by centrifuging at 12,000 X g for 1 min at RT. The pellet was washed thrice with 100% ethanol (freshly opened bottle), resuspended in 3 ml of 0.1mg/ml polyvinylpyrollidone (PVP) in ethanol and stored at -20°C till further use. b) Loading the DNA/microcarrier suspension into gold-coat tubing using the tubing prep station A 25 inch length of tubing was cut and fixed on tubing prep station, air dried by passing nitrogen gas through it for 15 min. The DNA/microcarrier suspension was vortexed and injected into the tubing using a 5 ml syringe and the microcarriers allowed to settle in the tubing for 3 min. Ethanol from the tubing was removed by slowly sucking into the syringe. The tubing was rotated, while passing the nitrogen gas, using the tubing prep station, for 20-30 sec to allow the microcarriers to evenly coat the inside of the tubing. c) Preparation of cartridges using the tubing cutter The tubing was cut into 0.5 inch long pieces (cartridges) by using the tubing cutter and cartridges stored at 4°C in vials containing desiccant pellets till further use.
    17. Suspension of DNA adsorbed onto gold microcarriers at 0.5 Microcarrier Loading Quantity (MLQ; 50 J.lg DNA/25 mg gold microcarriers) was prepared and coated inside Tefzel
    18. Plasmid DNA adsorbed onto gold microcarriers
    19. A day prior to immunization, hair were removed from both the hind limbs of the mice using a commercial depilatory agent (Anne French cream, Geoffrey Manners & Co. Ltd, Mumbai, India). Mice were immunized in a similar way as in the saline group but in addition, ten very short electric pulses were given at the site of injection immediately after DNA administration using a gas igniter (Upadhyay, 2001). Voltage delivered in each trigger was 18kV for 10-7s.
    20. Plasmid DNA administered by electroporation
    21. Inbred male BALB/c.T mice (6-8 week, Small Experimental Animal Facility, National Institute of Immunology, New Delhi, India) were immunized intramuscularly (i.m.) with 100 J.lg of respective plasmid DNA or VR1020 vector in 100 J.ll saline (0.9% NaCl) in the anterior tibialis muscle in the hind limbs (each receiving 50 J.ll). Two booster injections of 100 J.lg DNA in saline were given on day 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 J.lg/mouse in saline). Mice were anesthetized and bled retro-orbitally on days 0, 45 and 52 for analysis of respective antibody responses.
    22. Plasmid DNA administered in saline
    23. IV. IN-VIVO IMMUNIZATION STUDIES These experiments were carried out with the approval of Institutional Animal Ethics Committee. Three different modes of administration were used:
    24. a) Purification oLin elusion bodies For the purification of inclusion bodies, the bacterial cell pellet from 1 liter culture was resuspended in 10 ml of Tris-HCl buffer (50 mM; pH 8.5) containing 5 mM EDTA and sonicated using Branson sonifier-450 for 8 cycles of 90 sec each (30 watt output; Branson Ultrasonic Corp., Danbury, CT, USA) on ice. The inclusion bodies were collected by centrifugation of the sonicate at 8000 X g for 30 min at 4°C. The pellet was washed twice with 15 ml of 50 mM Tris-HCl buffer with 5 mM EDTA containing 2% sodium deoxycholate in order to remove loosely bound E. coli proteins from the inclusion bodies. Subsequently, the inclusion body pellet was washed with 50 mM Tris-HCI buffer (pH 8.5), followed by a washing with the double distilled water. All the buffers used for the purification contained 20 mM of phenylmethyl sulphonyl fluoride (PMSF). b) Solubilization and renaturation The purified inclusion bodies were solubilized in 100 mM Tris-HCl (pH 12.0) containing 2M urea at RT for 30 min, and centrifuged at 8000 X g for 30 min at 4°C. The pH ofthe supernatant was brought down immediately to 8.5 with 1 N HCl and then extensively dialyzed against renaturation buffer (50 mM Tris-HCl buffer; pH 8.5, 1 mM EDT A, 0.1 mM reduced glutathione, 0.01 mM oxidized glutathione and 10% sucrose). The protein was finally dialyzed against 20 mM Tris-HCl, pH 8.5 and its concentration estimated using BCA.
    25. Purification in refolded form
    26. The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).
    27. Purification in denatured form
    28. PURIFICATION OF r-bmZPl, r-dZP3 AND r-rG EXPRESSED IN E. coli
    29. reached a value of 0.5-0.6. The cultures were then induced with 1 mM IPTG for 2 h at 37°C. Cells were pelleted at 4000 X g for 30 min at 4°C and stored at -70°C until used.
    30. For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600
    31. incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water
    32. The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent
    33. Analysis of expressed recombinant protein by immunoblot
    34. COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
    35. Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry
    36. To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
    37. Localization of the expressed recombinant protein in COS-1 cells
    38. albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively
    39. Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum
    40. Detection of the expressed recombinant protein following i11 vitro transfection of mammalian cells with the plasmid DNA.
    41. 6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.
    42. A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at
    43. Purification of plasmid DNA in large amount
    44. N-VITRO TRANSFECTION OF MAMMALIAN CELLS WITH V ARlO US PLASMID DNA CONSTRUCTS AND CHARACTERIZATION OF EXPRESSED RECOMBINANT PROTEINS
    45. stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells
    46. The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
    47. Cloning in VRl 020 mammalian expression vector
    48. Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE
    49. Large scale plasmid DNA isolation
    50. collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.
    51. Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was
    52. Small scale plasmid DNA isolation and restriction
    53. separately on LB plates containing 100 j...tg/ml ampicillin, 80 j...tg/ml of X-gal and 20 mM of IPTG. The plates were incubated at 37°C for 12 h.
    54. The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated
    55. Preparation of competent cells and transformation
    56. The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).
    57. Media composition and bacterial culture
    58. The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.
    59. Agarose gel electrophoresis and ligation of PCR amplified fragments in pPCR-Script Amp SK (+)cloning vector
    60. mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
    61. The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
    62. Assembly of eDNA encoding dZP3-rG fusion protein by PCR
    63. described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
    64. To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
    65. PCR amplification of rG cDNAs
    66. GAAGATCTCAGACCATCTGGCCAACT-3' as the forward pnmer, and 5'-GAAGATCTT-TAAGTGTGGGAAACAGACTT-3' as the reverse primer as described for bmZPl except that primer annealing was performed at 53°C for 1 min.
    67. The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-
    68. PCR amplification of dZP3 eDNA
    69. Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.
    70. PCR amplification of bmZPl eDNA
    71. CLONING OF eDNA ENCODING bmZPl, dZP3, rG AND dZP3-rG GLYCOPROTEINS IN MAMMALIAN EXPRESSION VECTOR VR1020
    1. EROD
    2. ITALYusinga96wellmicrolitreplatereadbyELISAmicroplatereader(modelEL3/Sx,BioTeKInstrumentsINC).Thefinalsolutionwasreadatawavelengthof450nm.Theplasmacortisolconcentrationwascalculatedbasedonaseriesofstandards.
    3. PlasmacortisolwasmeasuredbyadirectimmunoenzymaticdeterminationofcortisolkitmanufacturedbyEquiparSriviaG.Ferrari,21/N-21047,SARONNO
    4. Plasmacortisol
    5. Thecapabilityofheadkidneyneutrophilstomovewasassayedbyamigration-under-agarosetechniquemodifiedfromNelsonetal.(1975).ThemethodhasbeendescribedbySaloetal.(1998).Thedistance,thecellshadmigratedfromthemarginofthewelltowardsthewellcontainingcasein(directedmigration)andintheopposite direction(randommigration)weremeasuredunderthemicroscope.
    6. Migration
    7. Phagocytesfromtheheadkidneywerestimulatedwithphorbol12-myristate13 -acetate(PMA,SigmachemicalCo)andtherespiratoryburstwasdeterminedbytheluminol-enhancedCLmethod(ScottandKlesius,1981)
    8. Theenzyme-linkedimmunospot(ELISPOT)assaywasusedfortheenumeration of totalimmunoglobulinsecretingcells(ISC)andantigen(BCG)-specificantibody-secretingcells(ASC)inthespleenandtheblood.TheELISPOTassayfollowedby Aaltonenetal.(1994)wasused.
    9. EnumerationofsecretinglymphocyteswithELISPOTassay
    10. TheamountoftotalIgMandspecificantibovineY-globulin(BGG)antibodyinthefishplasmawasmeasuredbyanenzyme-linkedimmunosorbentassay(ELISA)asgiven byAaltonenetal.(1994)
    11. Serumimmunoglobulin
    12. Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.
    13. Headkidney
    14. Thespleenswereremovedandhomogenisedindividuallythroughanylonnet(80mesh).Forisolationoflymphocytes,thetissuehomogenatewaslayeredonatwo-stepPercolldensitygradientandcentrifugedfor30minat400xg.Thelymphocyteswerecollectedatthe1.040-1.080g/cm3interface,washedtwice(400xg,10min)withrHbss,andresuspendedin2mlrRPMl.Cellswerecountedbytrypanblueexclusioninahaemocytometer(viability>95%)andthenumberoflymphocytesfrombloodandspleenwereadjustedto2x106/ml
    15. Spleen
    16. Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters
    17. Collectionofplasma
    18. Immunologicalanalysis
    19. ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)
    20. Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%
    21. Ionconcentrations
    22. Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg
    23. Plasmaosmolality
    24. Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
    25. Plasmaseparation
    26. ClinicalAnalyses
    27. phosphoricacidformedisreducedbytheadditionof1-amino2napthol~4-sulphonicacid(ANSA)reagenttoproducethebluecolor.Theactivityofthebluecolorwasreadat680nmagainstreagentblankusingaU.V.Spectrophotometer.Suitablestandardswererunthrougheachbatchofassays.Theenzymeactivitywasexpressedintermsofpgofinorganicphosphorusformedhr'1mg'1protein.
    28. Aftereffluentexposure,thecontrolandeffluentexposedfishtissueswereremovedandplacedinabeakercontainingice-coldSEIbuffer(300mMsucrose,200mMNa2EDTA,50mMimidazole,pH7.23)foranalysisofNa+-K+ATPaseactivity.ThetissueswereimmediatelyfrozeninliquidN2andstoredat-80°Cuntilanalyzed. Thespecificactivitiesofsodium,potassium,magnesiumandcalciumdependentATPaseswereassayedaccordingtothemethodsdescribedbyWatsonandBeamish(1980)and Boeseetal.(1982).AdenosinetriphosphatasecatalysestheconversionofATPandADP.Duringthisconversion,onemolecule ofphosphorusisliberated.ATPaseAdenosinetriphosphate^...^Adenosinediphosphate+PTheinorganicphosphorusliberatedwasassayedaccordingtothemethodofFiskeandSubbarow(1925).Inthismethodtheproteinisprecipitatedwithtrichloroaceticacid.Theproteinfreefiltrateistreatedwithaceticacidmolybdatesolutionandthe
    29. Na+K+ATPase,Mg2+ATPaseandCa2+ATPase
    30. Thereactionproduction,p-nitrophenolinacidphosphatewasmeasuredspectrophotometricallyat415nmagainstreagentblank.Theenzymeactivitywascalculatedfromthestandardcurveandexpressedasmicromolesofp-nitrophenolformedperhourpermilligramprotein.Therateofhydrolysisofp-nitrophenolphophateisproportionaltotheenzymepresentinthetissue.p-nitrophenylphosphate+NaoH—phosphat?-—>p -nitrophenol+phosphateThecolordevelopedinalkalinephosphataseactivitywasreadat410nmagainstreagentblankspectrophotometrically.Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein
    31. ThealkalinephosphataseactivitywasestimatedbythemethodofMorton(1955)usingp-nitrophenylphosphatesocolorlessinsolutionbutuponhydrolysis,thephosphategroupliberatesp-nitrophenylwhichishighlycoloredinalkalinesolution
    32. Alkalinephosphatase(AKP:ortho-phosphoricmonoester-phosphohydrolase;E.C.3.1.3.1)
    33. AcidphosphatasewasassayedfollowingtheprocedureofMorton(1955).Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein.
    34. Acidphosphatase(ACP:acidorthophosphoricphosphohydrolase)(EC3.1.3.2)
    35. LDHisthekeyenzymeinvolvedinglycolysis,andisresponsiblefortheanaerobicconversionofpyruvicacidtolacticacid,theterminalstageintheEmbden-Meyerhofpathway.Theenzymeactivitywasdeterminedinthecontrolandeffluentexposedfishbrain,gill,muscle,liver,heart,kidneyandair-breathingorgansfollowingSrikantanandKrishnamurthi(1955).TheopticaldensitiesweremeasuredinaUVSpectrophotometerusing340 nmfilterandtheresultsare expressedaspmolesofformazanmg'1proteinhr’1
    36. Lactatedehydrogenase(LDH)(L-LactateNADoxidoreductase)(EC1.1.1.27)
    37. Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1
    38. Thisisanimportantenzymeinvolvedinthecitricacidcycle.Thehomogenatesofcontrolandeffluentexposedtissueswerepreparedin0.25MicecoldsucroseusingPotterElvehjemtypeglasshomogenizerandcentrifugedat3000rpmfor15min
    39. Succinicdehydrogenase(SDH)(E.C.1.3.99.1
    40. Theacetylcholineconcentrationinthetissueswasestimatedspectrophotometricallyat540nmbythemethodofHestrin(1949)usingformicacid-acetonemixture(0.15mformicacidacetone,3:17V/V)astheextractionmediumAchconcentrationwascalculatedintermsofnmolAch/mgtissue
    41. Acetylcholine(Ach)
    42. Aftereffluentexposure,thetissuesweredissectedout,weighedandhomogenizedin0.25Msucrose.Thehomogenateswerecentrifugedat10,000rev/minatatemperaturebelow8°C.AcetylcholinesteraseactivityofthesampleswasdeterminedatpH7.0usingafinalhomogenateconcentrationof25mgmf1at10°CwithmMacetylcholineiodideassubstrate and0.001or0.002NsodiumhydroxideastitrantfollowingHestron’smethodasgivenbyMetcalf(1951).ProteindeterminationsforalltheChEanalyseswereconductedonaliquotsofthehomogenatesusingamodificationoftheLowryetal.(1951)method.AchEactivityisexpressedinpmolesofacetylcholinechloridehydrolysedmgtissue'1hr'1
    43. Acetylcholinesterase(AchE
    44. 0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes
    45. Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof
    46. Collectionoftissues
    47. Enzymologicalanalyses
    48. Immediatelyafterisolation,thetissueswereweighedandsubjectedtolipidextractionthatwascarriedoutinduplicateaccordingtoFolchetal.(1957)
    49. Totallipids
    50. Salineextracts(0.89%)oftissueswerepreparedinTeflonglasshomogenizer.ThecarbohydratecontentoftheextractwasdoneaccordingtothemethodofShibkoetal.(1967)
    51. Carbohydrates
    52. TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard
    53. Totalproteins
    54. Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,liver,muscle,gill,kidneyandair-breathingorgans werepooled incoldcondition andusedforbiochemicalestimations.
    55. BiochemicalAnalysis
    56. Thegillandmuscleswereisolatedfromcontrolandeffluentexposed(7%)fishes.Physiologicalsalinesolution(0.75%NaCl)wasusedtorinseandcleanthetissues.Theywerethenimmediatelystudiedandphotographed.
    57. Aftertheperiodofexposure,thecaudalfinwasseveredtogetthebloodforsmearing.BufferedLeishman'sstainofpH6.8gaveexcellentresults.Theworkreportedhereisbasedontheanalysisofslidesoffishestreatedwith7%effluentconcentrationsastheobservedchangesaremaximuminthesefishes.
    58. Bloodandorganstudies
    59. Bloodsampleswereobtainedbycuttingthecaudalpeduncleandanalysedforlacticacidusinganenzymatictechnique(SigmaCo,1974)MeasurementsweremadeinQuartzcuvettesat340nmwithaBeckmanAVSpectrophotometer.Standardcurvesweremadeonthedaythebloodlacticaciddeterminationsweremade.
    60. Bloodlacticacid
    61. BloodglucosewasestimatedbyFolin-Wumethod(KlontzandSmith,1968).Glucoseonboilingwithalkalinecoppersolution,reducescopperfromthecuprictothecuprousstate(cuprousoxide).Thecuprousoxidesoformedreducesphosphomolybdicacidtothebluecoloredmolybdenumblue,whichismeasuredcolorimeterically.TheintensityofthebluecolorisproportionaltoglucoseconcentrationanditiscolorimetricallydeterminedinaBoschandLombSpectrophotometerat620nm
    62. Bloodglucose
    63. TheO2carryingcapacity(Vol%)ofbloodwascalculatedby multiplyingtheHbcontentwith1.25O2combiningpowerofHb/g(Johansen,1970).
    64. TheO2carryingcapacity
    65. ThebloodbicarbonatewasestimatedbythemanometricmethodofVanslykeandCullen(1969).
    66. StandardBicarbonates
    67. Meancorpuscularhaemoglobinconcentration(MCHC)istheaverageHbconcentrationperunitvolume(100)ofpackedredcells(W/V).Henceitisexpresseding/1whichisthesameaspercent(%).ItiscalculatedbythefollowingformulaHbMCHC=—......x100(g/dl)PCV
    68. MCHC
    69. MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC
    70. MCV
    71. RedBloodcellsindices
    72. micro-haematocrittubewasfilledto100mmwithanticoagulatedblood.Oneendofthetubewassealedwithsealingwaxandthetubewasthenkeptinaverticalpositioninaglassbeakerstuffedwithcotton.Afteronehour,lengthoftheplasmacolumnwasmeasuredwitha rulergraduatedin0.5mm.
    73. ESRwasdeterminedbythemicromethodbecausethequantityofbloodavailablefromindividualfishwasinsufficienttoadoptanymacromethod.Anon-heparinised
    74. ErythrocytesedimentationRate(ESR)
    75. BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated
    76. Redbloodcellcount(RBC
    77. Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes
    78. PackedCellVolume(PCV)orHaematocrit(Ht)
    79. HaemoglobinwasdeterminedbySahlimethod.HaemoglobinisconvertedtoacidhaematinbytheactionofHC1.Theacidhaematinsolutionisfurtherdilutedwiththeaciduntilitscolormatchesexactlythatofthepermanentstandardofthecomparatorblock.TheHbconcentrationisreaddirectlyfromthecalibrationcurve.
    80. Haemoglobin(Hb)determination
    81. BloodwastakenbyheartpunctureusingMS222astheanaesthetic.Nofishwasusedmorethanonce.
    82. CollectionofBlood
    83. HaematologicalAnalysis
    84. TheO2consumptionofthetissueswasmeasuredbymanometrictechniquesinaWarburgconstantvolumerespirometer(Gallenkemp,England)aspertheproceduresgivenbyUmbreitetal.(1959).Thecontrolandeffluentexposedfisheswerekilledandthebrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereisolated.ThetissueswereslicedandplacedinWarburgflasks(60-80mgtissuesflask)containing2.5mloffishringersolutionwithphosphatebufferatpH7.5asthesuspensionmediumforthetissuesand0.2ml15%KOH.Temperaturewas28°CduringO2uptakedetermination.Inordertocomparedatafromthedifferentseriesoftreatment,arespiratoryindexwascalculatedusingthefollowingformula:KO2treated-KO2controlr=100-------------------------------------x100KO2controlWhere,K=O2consumptioninpi/100mgwettissue/hrThisindexindicatespercentrespirationoftreatedtissuesrelatedtothecontrolvalues ofthesameseries.
    85. TissueRespiration
    86. ThecircadianrhythmofbimodalO2uptakeofcontrolandeffluenttreatedfisheswerestudiedseparatelyat28°±1°C.TheamountsofO2extractedfromwaterandairwereseparatelydeterminedforadayatregularintervalsof3hreach.TotalO2uptakeateachtimewasobtainedbysummingupthevaluesforaquaticandaerialrespirationobtainedatthecorrespondingtime.Throughoutthepresentstudy,theinitialO2contentofthewaterwaskeptconstant(6±0.5mgF1)
    87. CircadianrhythmofbimodalO2uptake
    88. Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm

    Tags

    Annotators

    URL

    1. 54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)