CaseMYH7-8: Japan, Asian

CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.

Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)

ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/

gnomAD: Not in gnomAD

CaseMYH7-7: Japan, Asian

CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.

Variant: NM_000257.3:c.1358G>A (p.Arg453His)

ClinVar: 42838 https://www.ncbi.nlm.nih.gov/clinvar/variation/42838/

gnomAD: Not in gnomAD

CaseMYH7-9: Japan, Asian

CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.

Variant: NM_000257.3:c.1012G>A (p.Val338Met)

ClinVar: 164381 https://www.ncbi.nlm.nih.gov/clinvar/variation/164381/

gnomAD: Not in gnomAD

Case153: Female, 0.083 years onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682, HP:0025169 (Left ventricular noncompaction, Left ventricular systolic dysfunction)

HPOsFreeText: Left Ventricular Ejection Fraction at 46%, LVDD-Z score at 0.795

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: Sister also has LVNC

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.1342G>A (p.Glu448Lys)

CAID: CA389050830 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.1342G%3EA

gnomAD: Not in gnomAD

Case361: Female, Birth onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682, HP:0025169, HP:0001635 (Left ventricular noncompaction, Left ventricular systolic dysfunction, Heart failure)

HPOsFreeText: Left Ventricular Ejection Fraction at 38%, LVDD-Z score at 0.977

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: No family history

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.896-1G>A

CAID: CA389051805 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3%3Ac.896-1G%3EA

gnomAD: Not in gnomAD

Case333: Male, Birth onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682, HP:0025169, HP:0001635 (Left ventricular noncompaction, Left ventricular systolic dysfunction, Heart failure)

HPOsFreeText: Left Ventricular Ejection Fraction at 10%, LVDD-Z score at -0.4

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: No family history

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.668C>T (p.Ala223Val)

CAID: CA389052292 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.668C%3ET

gnomAD: Not in gnomAD

Case250: Male, 0.04 years onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682, HP:0001635 (Left ventricular noncompaction, Heart failure)

HPOsFreeText: Left Ventricular Ejection Fraction at 60%, LVDD-Z score at 1.6326

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: No family history

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.2030A>T (p.Glu677Val)

CAID: CA389049283 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.2030A%3ET

gnomAD: Not in gnomAD

Case427: Female, 1.5 years onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

FamilyInfo: Father has DCM

CasePresentingHPOs: HP:0030682, HP:0025169 (Left ventricular noncompaction, Left ventricular systolic dysfunction)

HPOsFreeText: Left Ventricular Ejection Fraction at 44.1%, LVDD-Z score at 1.3709

CaseNotHPOs: HP:0011675, HP:0001635 (Arrhythmia, Heart failure)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo:

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.2821C>T (p.Arg941Cys)

CAID: CA389046936 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.2821C%3ET

gnomAD: Not in gnomAD

Case392: Male, 0.083 years onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682, HP:0025169, HP:0001635 (Left ventricular noncompaction, Left ventricular systolic dysfunction, Heart failure)

HPOsFreeText: Left Ventricular Ejection Fraction at 29%, LVDD-Z score at 2.1428

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: No family history

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.944A>G (p.Gln315Arg)

CAID: CA389051698 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.944A%3EG

gnomAD: Not in gnomAD

Case378: Female, Birth onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

FamilyInfo: Sister has LVNC

CasePresentingHPOs: HP:0030682, HP:0025169, HP:0001635, HP:0005110 (Left ventricular noncompaction, Left ventricular systolic dysfunction, Heart failure, Atrial fibrillation)

HPOsFreeText: Left Ventricular Ejection Fraction at 20%, LVDD-Z score at 0.1

CaseNotHPOs: N/A

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo:

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.1859T>C (p.Leu620Pro)

CAID: CA389049669 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.1859T%3EC

gnomAD: Not in gnomAD

Case298: Female, 6 years onset, Japan, Asian

DiseaseAssertion: Left ventricular noncompaction

CasePresentingHPOs: HP:0030682 (Left ventricular noncompaction)

HPOsFreeText: Left Ventricular Ejection Fraction at 65%, LVDD-Z score at 2.1

CaseNotHPOs: HP:0011675 (Arrhythmia)

NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes

CaseAddInfo: No family history

CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.

CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.2710C>T (p.Arg904Cys)

ClinVar: 164316 https://www.ncbi.nlm.nih.gov/clinvar/variation/164316/

gnomAD: Ashkenazi Jewish 9.921e-5, Overall 3.977e-6 https://gnomad.broadinstitute.org/variant/14-23893328-G-A

Case7: Female, 13 years diagnosis, China, Asian

DiseaseAssertion: Hypertrophic Cardiomyopathy

CasePresentingHPOs: HP:0001639, HP:0001667, HP:0001279 (Hypertrophic cardiomyopathy, Right ventricular hypertrophy, Syncope)

HPOsFreeText: 2 SCD risk factors, NYHA class is II, Right ventricular wall thickness 12 mm

CaseNotHPOs: HP:0002092, HP:0001642, HP:0030680, HP:0011675 (Pulmonary arterial hypertension, Pulmonary stenosis, Congenital heart disease, Arrhythmia)

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Probands' genomic DNA was extracted from blood samples. WES was performed, with the resulting sequence data mapped to a reference genome and variants filtered for pathogenicity and predicted effects. All variants identified were confirmed via Sanger sequencing of the respective genes.

Variant reported as below, but no SNP corresponds to the variant.

Variant: NP_000248.2:p.R719E

ClinVar: N/A

gnomAD: N/A

MultipleGeneVariants:

MYOM1 Variant:

Variant: NM_003803.3:c.2507G>T (p.Gly836Val)

CAID: CA8874590 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_003803.3:c.2507G%3ET

gnomAD: East Asian 5.044e-4, Overall 3.707e-5 https://gnomad.broadinstitute.org/variant/18-3129517-C-A

AKAP9 Variant:

Variant: NM_005751.4:c.11590T>C (p.Cys3864Arg)

CAID: CA368165252 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_005751.4:c.11590T%3EC

gnomAD: Not in gnomAD

Case1: Male, 27 years diagnosis, China, Asian

DiseaseAssertion: Hypertrophic Cardiomyopathy

CasePresentingHPOs: HP:0001639, HP:0001667 (Hypertrophic cardiomyopathy, Right ventricular hypertrophy)

HPOsFreeText: 0 SCD risk factors, NYHA class is I, Right ventricular wall thickness 13 mm

CaseNotHPOs: HP:0002092, HP:0001642, HP:0030680, HP:0011675 (Pulmonary arterial hypertension, Pulmonary stenosis, Congenital heart disease, Arrhythmia)

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Probands' genomic DNA was extracted from blood samples. WES was performed, with the resulting sequence data mapped to a reference genome and variants filtered for pathogenicity and predicted effects. All variants identified were confirmed via Sanger sequencing of the respective genes.

Variant listed as MYH7-478N. Typo is suspected, below is the entry for MYH7-I478N, the actual variant at this location

Variant: NM_000257.3:c.1433T>A (p.Ile478Asn)

CAID: CA389050614 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3:c.1433T%3EA

gnomAD: Not in gnomAD

MultipleGeneVariants:

TTN Variants:

Unknown Variant

Variant1: TTN-S3872fs

CAID: N/A

gnomAD: N/A

Unknown Variant

Variant2: TTN-S6350A

CAID: N/A

gnomAD: N/A

Unknown Variant

Variant3: TTN-P10663R

CAID: N/A

gnomAD: N/A

ACTN2 Variant

Unknown Variant

Variant: ACTN2-P32fs

CAID: N/A

gnomAD: N/A

CaseMYH7-21: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: 1 other proband shares this genotype

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.2389G>A (p.Ala797Thr)

ClinVar: 42901 https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/

gnomAD: African 1.230e-4, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894525-C-T

CaseMYH7-34: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.1370T>C (p.Ile457Thr)

ClinVar: 42840 https://www.ncbi.nlm.nih.gov/clinvar/variation/42840/

gnomAD: European (Non-Finnish) 8.790e-6, Overall 3.976e-6 https://gnomad.broadinstitute.org/variant/14-23898201-A-G

CaseMYH7-25: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: 1 other proband shares this genotype

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.2207T>C (p.Ile736Thr)

ClinVar: 164342 https://www.ncbi.nlm.nih.gov/clinvar/variation/164342/

gnomAD: Not in gnomAD

CaseMYH7-28: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.2155C>T (p.Arg719Trp)

ClinVar: 14104 https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/

gnomAD: European (Non-Finnish) 6.481e-5, Overall 3.185e-5 https://gnomad.broadinstitute.org/variant/14-23895180-G-A

CaseMYH7-10: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.3592G>T (p.Asp1198Tyr)

ClinVar: 520451 https://www.ncbi.nlm.nih.gov/clinvar/variation/520451/

gnomAD: Not in gnomAD

CaseMYH7-36: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.1208G>A (p.Arg403Gln)

ClinVar: 14087 https://www.ncbi.nlm.nih.gov/clinvar/variation/14087/

gnomAD: Not in gnomAD

CaseMYH7-24: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.2221G>T (p.Gly741Trp)

ClinVar: 177665 https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/

gnomAD: Not in gnomAD

CaseMYH7-6: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: 2 other probands have this genotype

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.4135G>A (p.Ala1379Thr)

ClinVar: 42993 https://www.ncbi.nlm.nih.gov/clinvar/variation/42993/

gnomAD: Latino 2.822e-5, Overall 3.535e-6 https://gnomad.broadinstitute.org/variant/14-23887453-C-T

CaseMYH7-31: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: 1 other proband shares this genotype

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.1954A>G (p.Arg652Gly)

ClinVar: 177626 https://www.ncbi.nlm.nih.gov/clinvar/variation/177626/

gnomAD: Not in gnomAD

CaseMYH7-37: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.1207C>T (p.Arg403Trp)

ClinVar: 14102 https://www.ncbi.nlm.nih.gov/clinvar/variation/14102/

gnomAD: Not in gnomAD

CaseMYH7-13: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.3064A>G (p.Lys1022Glu)

CAID: CA389045738 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3%3Ac.3064A%3EG

gnomAD: Not in gnomAD

CaseMYH7-18: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.2578A>G (p.Lys860Glu)

ClinVar: 192312 https://www.ncbi.nlm.nih.gov/clinvar/variation/192312/

gnomAD: Not in gnomAD

CaseMYH7-2: Australia

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.

Variant: NM_000257.3:c.5287G>A (p.Ala1763Thr)

ClinVar: 177846 https://www.ncbi.nlm.nih.gov/clinvar/variation/177846/

gnomAD: European (Non-Finnish) 1.238e-4, Overall 7.423e-5 https://gnomad.broadinstitute.org/variant/14-23884476-C-T

Case2: Female, 14 years report, Netherlands

CasePresentingHPOs: HP:0011663, HP:0011675, HP:0001279, HP:0005135, HP:0001707, HP:0001711, HP:0004308, HP:0001635 (Right ventricular cardiomyopathy, Arrhythmia, Syncope, Abnormal T-wave, Abnormality of the right ventricle, Abnormality of the left ventricle, Ventricular arrhythmia, Congestive heart failure)

HPOsFreeText: Positive EPS inducibility

CaseNotHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

NotHPOsFreeText: ECG Depolarization abnormality, Cardiac transplant

CaseAddInfo:

CasePreviousTesting: No variants were in any of DSP, PKP2, DSG2, DSC2, and JUP. Patients were tested for variants in ACTC1, MYBPC3, MYH7, MYL2, MYL3, TNNC1, TNNI3, TNNT2, and TPM1.

CaseGenotypingMethod: 92 patients underwent panel sequencing of the specific genes listed above, and 45 were subject to Whole Exome Sequencing to locate variants. Afterwards, all variants were verified by PCR amplification and Sanger sequencing and filtered for pathogenicity.

Variant: NM_000257.3:c.4499G>A (p.Arg1500Gln)

ClinVar: 180439 https://www.ncbi.nlm.nih.gov/clinvar/variation/180439/

gnomAD: European (Non-Finnish) 2.637e-5, Overall 1.591e-5 https://gnomad.broadinstitute.org/variant/14-23886382-C-T

Case: Pedigree 2 proband, male, 37yo at diagnosis, Iraqi‐Jewish

CasePresentingHPOs: HP:0001639, HP:0005110, HP:0001708, HP:0005180 (hypertrophic cardiomyopathy, atrial fibrillation, right heart failure, tricuspid regurgitation)

HPOsFreeText: clinical severity: moderate to asymptomatic

CaseNotHPOs:

NotHPOsFreeText: skeletal involvement

CasePreviousTesting: exact genes sequenced not specified

CaseGenotypingMethod: Fifty‐six genes known to cause HCM were sequenced in parallel

Variant: NM_000257.3(MYH7):c.427C>T (p.Arg143Trp)

ClinVar: 164401, https://www.ncbi.nlm.nih.gov/clinvar/variation/164401/

gnomAD: 0.00002784, https://gnomad.broadinstitute.org/variant/14-23901923-G-A

FamilyInfo: older brother had sudden death at 33yo with postmortem diagnosis of HCM, patient's siblings, aged 67 and 70, were also found to be heterozygous for this variant, though they are both clinically asymptomatic with no echocardiographic evidence of HCM

CaseCM1832: Male, 0 years diagnosis, Japan, Asian

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)

NotHPOsFreeText: Neuromuscular disease, Malformation syndromes

CaseAddInfo: No family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Mother is negative for this variant

CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.

CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.

Variant: NM_000257.3:c.2609G>T (p.Arg870Leu)

ClinVar: 235031 https://www.ncbi.nlm.nih.gov/clinvar/variation/235031/

gnomAD: Not in gnomAD

CaseCM1839: Female, 12 years diagnosis, Japan, Asian

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)

NotHPOsFreeText: Neuromuscular disease, Malformation syndromes

CaseAddInfo: Positive family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2

CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.

CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.

Variant: NM_000257.3:c.2221G>T (p.Gly741Trp)

ClinVar: 177665 https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/

gnomAD: Not in gnomAD

MultipleGeneVariants:

(1) BAG3 Variant Variant: NM_004281.3:c.1015A>G (p.Ile339Val)

ClinVar: 228453 https://www.ncbi.nlm.nih.gov/clinvar/variation/228453/

gnomAD: East Asian 5.437e-5, Overall 3.976e-6 https://gnomad.broadinstitute.org/variant/10-121436081-A-G

CaseCM1871: Male, 0 years diagnosis, Japan, Asian

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)

NotHPOsFreeText: Neuromuscular disease, Malformation syndromes

CaseAddInfo: No family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Mother shows negative for this variant with no symptoms

CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.

CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.

Variant: NM_000257.3:c.2608C>T (p.Arg870Cys)

ClinVar: 161326 https://www.ncbi.nlm.nih.gov/clinvar/variation/161326/

gnomAD: Ashkenazi Jewish 9.923e-5, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894049-G-A

CaseCM1844: Male, 6 years diagnosis, Japan, Asian

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)

NotHPOsFreeText: Neuromuscular disease, Malformation syndromes

CaseAddInfo: No family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Mother and father are both negative for this variant

CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.

CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.

Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)

ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/

gnomAD: Not in gnomAD

CaseCM0969: Male, 6 years diagnosis, Japan, Asian

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)

NotHPOsFreeText: Neuromuscular disease, Malformation syndromes

CaseAddInfo: Positive family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Variant is asserted as novel, Both father and sister with HCM tested positive for this variant

CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.

CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.

Variant: NM_000257.3:c.2777T>C (p.Leu926Pro)

ClinVar: 525005 https://www.ncbi.nlm.nih.gov/clinvar/variation/525005/

gnomAD: Not in gnomAD

CaseMYH7-8: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.427C>T (p.Arg143Trp)

ClinVar: 164401 https://www.ncbi.nlm.nih.gov/clinvar/variation/164401/

gnomAD: East Asian 1.087e-4, Overall 2.784e-5 https://gnomad.broadinstitute.org/variant/14-23901923-G-A

CaseMYH7-16: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.2681A>G (p.Glu894Gly)

ClinVar: 42922 https://www.ncbi.nlm.nih.gov/clinvar/variation/42922/

gnomAD: Not in gnomAD

CaseMYH7-22: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.2788G>A (p.Glu930Lys)

ClinVar: 42933 https://www.ncbi.nlm.nih.gov/clinvar/variation/42933/

gnomAD: Not in gnomAD

CaseMYH7-26: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.2609G>A (p.Arg870His)

ClinVar: 14120 https://www.ncbi.nlm.nih.gov/clinvar/variation/14120/

gnomAD: European (Non-Finnish) 1.549e-5, Overall 7.072e-6 https://gnomad.broadinstitute.org/variant/14-23894048-C-T

CaseMYH7-1: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.1987C>T (p.Arg663Cys)

ClinVar: 42874 https://www.ncbi.nlm.nih.gov/clinvar/variation/42874/

gnomAD: Not in gnomAD

CaseMYH7-13: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.1208G>A (p.Arg403Gln)

ClinVar: 14087 https://www.ncbi.nlm.nih.gov/clinvar/variation/14087/

gnomAD: Not in gnomAD

CaseMYH7-5: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.2198G>T (p.Gly733Val)

ClinVar: 181177 https://www.ncbi.nlm.nih.gov/clinvar/variation/181177/

gnomAD: Not in gnomAD

CaseMYH7-2: N/A

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.

Variant: NM_000257.3:c.5135G>A (p.Arg1712Gln)

ClinVar: 36642 https://www.ncbi.nlm.nih.gov/clinvar/variation/36642/

gnomAD: European (Non-Finnish) 4.657e-5, Overall 2.125e-5 https://gnomad.broadinstitute.org/variant/14-23884860-C-T

CaseVI: Brazil, Caucasian

DiseaseAssertion: Hypertrophic cardiomyopathy

FamilyInfo: Family history of HCM

CasePresentingHPOs: HP:0001712, HP:0001639 (Left ventricular hypertrophy, Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: Only MYH7, MYBPC3, and TNNT2 were tested.

CaseGenotypingMethod: DNA was extracted from peripheral blood and the above genes were subject to PCR amplification and directly sequenced. The resulting sequences were compared with the reference and filtered for pathogenicity.

Variant: NM_000257.3:c.2389G>A (p.Ala797Thr)

ClinVar: 42901 https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/

gnomAD: African 1.230e-4, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894525-C-T

CaseHCM1.1: Indian

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0000819 (Diabetes mellitus)

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.611G>A (p.Arg204His)

ClinVar: 43095 https://www.ncbi.nlm.nih.gov/clinvar/variation/43095/

gnomAD: East Asian 5.012e-5, Overall 1.767e-5 https://gnomad.broadinstitute.org/variant/14-23900998-C-T

CaseHCM34.1: Mixed ancestry

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0000819 (Diabetes mellitus)

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)

ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/

gnomAD: Not in gnomAD

CaseHCM14.1: Mixed ancestry

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0000819 (Diabetes mellitus)

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See Table 1

CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.

Variant: NM_000257.3:c.2167C>T (p.Arg723Cys)

ClinVar: 14095 https://www.ncbi.nlm.nih.gov/clinvar/variation/14095/

gnomAD: South Asian 3.266e-5, Overall 1.194e-5 https://gnomad.broadinstitute.org/variant/14-23895023-G-A

CasePT-38: United States

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)

NotHPOsFreeText: N/A

CaseAddInfo: Two other siblings have the same genotype

CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.

Variant: NM_000257.3:c.727C>T (p.Arg243Cys)

ClinVar: 43101 https://www.ncbi.nlm.nih.gov/clinvar/variation/43101/

gnomAD: European (Non-Finnish) 6.482e-5, Overall 3.184e-5 https://gnomad.broadinstitute.org/variant/14-23900799-G-A

CasePT-30: United States

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.

Variant: NM_000257.3:c.2606G>A (p.Arg869His)

ClinVar: 177667 https://www.ncbi.nlm.nih.gov/clinvar/variation/177667/

gnomAD: African 1.230e-4, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894051-C-T

CasePT-76: United States

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.

Variant: NM_000257.3:c.2334C>G (p.Asp778Glu)

ClinVar: 265252 https://www.ncbi.nlm.nih.gov/clinvar/variation/265252/

gnomAD: Not in gnomAD

CasePT-97: United States

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.

Variant: NM_000257.3:c.4159G>A (p.Glu1387Lys)

ClinVar: 181244 https://www.ncbi.nlm.nih.gov/clinvar/variation/181244/

gnomAD: South Asian 3.266e-5, Overall 3.977e-6 https://gnomad.broadinstitute.org/variant/14-23887429-C-T

CasePT-62: United States

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)

NotHPOsFreeText: N/A

CaseAddInfo:

CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.

Variant: NM_000257.3:c.1370T>C (p.Ile457Thr)

ClinVar: 42840 https://www.ncbi.nlm.nih.gov/clinvar/variation/42840/

gnomAD: European (Non-Finnish) 8.790e-6, Overall 3.976e-6 https://gnomad.broadinstitute.org/variant/14-23898201-A-G

CaseBII-1: Male, 23 years diagnosis, China, Asian

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: No family history, pedigree provided

CasePresentingHPOs: HP:0001639, HP:0100749 (Hypertrophic cardiomyopathy, Chest pain)

HPOsFreeText: Interventricular septal thickness at 15.6 mm, Left ventricular posterior wall thickness at 12.1 mm

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Parents tested negative for variant, therefore it is asserted as de novo

CasePreviousTesting: See list of sequenced genes

CaseGenotypingMethod: Genomic DNA was isolated from whole blood of all patients and controls. Whole coding exons and exon-intron boundaries of the 19 HCM-related genes listed above were amplified and sequenced on Ion Torrent PGM. These variants were then filtered for pathogenicity and compared to the controls. Any mutations found were confirmed by conventional dideoxy sequencing and Sanger sequencing.

Variant: NM_000257.3:c.2572C>T (p.Arg858Cys)

ClinVar: 164324 https://www.ncbi.nlm.nih.gov/clinvar/variation/164324/

gnomAD: Not in gnomAD

CaseA14: Female, 44 years report, China, Asian

DiseaseAssertion: Hypertrophic Cardiomyopathy

FamilyInfo: No family history

CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)

HPOsFreeText: Interventricular septal thickness at 17.6 mm, Left ventricular posterior wall thickness at 8.8 mm, Left ventricular end-diastolic diameter at 42.7 mm, Left ventricular septal thickness at 36.6 mm, Left ventricular ejection fraction at 68%

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

CasePreviousTesting: See list of sequenced genes

CaseGenotypingMethod: Genomic DNA was isolated from whole blood of all patients and controls. Whole coding exons and exon-intron boundaries of the 19 HCM-related genes listed above were amplified and sequenced on Ion Torrent PGM. These variants were then filtered for pathogenicity and compared to the controls. Any mutations found were confirmed by conventional dideoxy sequencing and Sanger sequencing.

Variant: NM_000257.3:c.161G>A (p.Arg54Gln)

ClinVar: 42856 https://www.ncbi.nlm.nih.gov/clinvar/variation/42856/

gnomAD: East Asian 2.506e-4, Overall 2.475e-5 https://gnomad.broadinstitute.org/variant/14-23902781-C-T

CaseST4-91: Sweden

DiseaseAssertion: Idiopathic Dilated Cardiomyopathy

FamilyInfo: N/A

CasePresentingHPOs: HP:0001644 (Dilated cardiomyopathy)

HPOsFreeText: N/A

CaseNotHPOs: HP:0002140, HP:0000822, HP:0001654, HP:0030955, HP:0000819, HP:0002666, HP:0000845, HP:0000820 (Ischemic stroke, Hypertension, Valvular heart disease, Alcoholism, Diabetes mellitus, Pheochromocytoma, Acromegaly, Thyroid disease)

NotHPOsFreeText: Patients were excluded for significant systemic infection, systemic diseases, previous cancer treatment including irradiation, and tachycardia-induced cardiomyopathy or other primary cardiomyopathy.

CaseAddInfo: N/A

CasePreviousTesting: See Supplemental Table 1

CaseGenotypingMethod: Genomic DNA was extracted from the patients. 41 exons of previously-reported genes that were reported in DCM patients were amplified and directly sequenced. Afterwards, the variants were aligned and sorted for pathogenicity.

Variant: NM_000257.3:c.1113G>C (p.Glu371Asp)

CAID: CA389051328 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000257.3%3Ac.1113G%3EC

gnomAD: Not in gnomAD

CaseIP-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 0.43, MS/MS ennzyme activity at 0.13

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant in literature as c.1396C>T, however the reference has G there. Corrected for poossible typo.

Variant1: NM_000152.4:c.1396G>T (p.Val466Phe)

CAID: CA401366509 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1396G%3ET

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

CaseAddInfo: Infantile Onset Pompe Disease

CaseLP2-2: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.08 umol/hr/L, Serum CK at 109 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.424_440del17 (p.Ser142Leufs*29)

CAID: CA658795228 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.424_440del17

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1958C>A (p.Thr653Asn)

CAID: CA8815557 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1958C%3EA

gnomAD: East Asian 2.548e-4, Overall 1.825e-5 http://gnomad.broadinstitute.org/variant/17-78086744-C-A

CaseAddInfo: Late Onset Pompe Disease

CaseIP2-11: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.15 umol/hr/L, Serum CK at 662 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant3: NM_000152.4:c.2303C>T (p.Pro768Leu)

CAID: CA401324900 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2303C%3ET

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates that Variant 1 and 3 are in trans and that 2 is in cis with one of them

CaseOPOPD-47: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.83 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1461C>G (p.Phe487Leu)

CAID: CA401366857 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1461C%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPOPD-52: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.13 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.1850T>G (p.Val617Gly)

CAID: CA401369628 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1850T%3EG

gnomAD: Not in gnomAD

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPOPD-72: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.31 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2662G>T (p.Glu888Ter)

ClinVar: 578595 https://www.ncbi.nlm.nih.gov/clinvar/variation/578595/

gnomAD: East Asian 2.719e-4, Overall 1.998e-5 http://gnomad.broadinstitute.org/variant/17-78092467-G-T

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele, 2 other patients have the same genotype

CaseOPOPD-38: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.56 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.784G>A (p.Glu262Lys)

ClinVar: 188806 https://www.ncbi.nlm.nih.gov/clinvar/variation/188806/

gnomAD: East Asian 5.016e-5, Overall 1.417e-5 http://gnomad.broadinstitute.org/variant/17-78081447-G-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPTPD-1: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.47 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.546+5G>T

ClinVar: 557811 https://www.ncbi.nlm.nih.gov/clinvar/variation/557811/

gnomAD: East Asian 4.978e-4, Overall 3.824e-5 http://gnomad.broadinstitute.org/variant/17-78078936-G-T

CaseAddInfo: One Pompe Mutation allele and Two Pseudodeficency Mutation alleles, Nomenclature indicates patient is homozygous for Variant 1 and Variant 2 is in cis with only one copy, 2 other patients have the same genotype

CaseIP2-4: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.08 umol/hr/L, Serum CK at 385 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1194+2T>C

ClinVar: 370077 https://www.ncbi.nlm.nih.gov/clinvar/variation/370077/

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant3: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates Variant 1 and 2 are in trans, also that Variant 3 is in cis with only one of them

CaseOPM-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

CAID: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation, Nomenclature indicates Variants 1 and 2 are in cis and the other allele is Wildtype

CaseLP2-10: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.06 umol/hr/L, Serum CK at 670 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.752C>T (p.Ser251Leu)

ClinVar: 325781 https://www.ncbi.nlm.nih.gov/clinvar/variation/325781/

gnomAD: East Asian 2.760e-3, Overall 3.540e-4 http://gnomad.broadinstitute.org/variant/17-78081415-C-T

Variant2: NM_000152.4:c.761C>T (p.Ser254Leu)

ClinVar: 325782 https://www.ncbi.nlm.nih.gov/clinvar/variation/325782/

gnomAD: East Asian 2.759e-3, Overall 1.947e-4 http://gnomad.broadinstitute.org/variant/17-78081424-C-T

Variant3: NM_000152.4:c.2662G>T (p.Glu888Ter)

ClinVar: 578595 https://www.ncbi.nlm.nih.gov/clinvar/variation/578595/

gnomAD: East Asian 2.719e-4, Overall 1.998e-5 http://gnomad.broadinstitute.org/variant/17-78092467-G-T

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

CaseOPOPD-10: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

ClinVar: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation and One Pseudodeficency Mutation

CaseLP2-7: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.22 umol/hr/L, Serum CK at 89 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.752C>T (p.Ser251Leu)

ClinVar: 325781 https://www.ncbi.nlm.nih.gov/clinvar/variation/325781/

gnomAD: East Asian 2.760e-3, Overall 3.540e-4 http://gnomad.broadinstitute.org/variant/17-78081415-C-T

Variant2: NM_000152.4:c.761C>T (p.Ser254Leu)

ClinVar: 325782 https://www.ncbi.nlm.nih.gov/clinvar/variation/325782/

gnomAD: East Asian 2.759e-3, Overall 1.947e-4 http://gnomad.broadinstitute.org/variant/17-78081424-C-T

Variant3: NM_000152.4:c.1054C>T (p.Gln352Ter)

CAID: CA294891876 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA294891876

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

CaseOPOPD-67: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.93 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2236T>G (p.Trp746Gly)

ClinVar: 556431 https://www.ncbi.nlm.nih.gov/clinvar/variation/556431/

gnomAD: East Asian 6.410e-4, Overall 3.186e-5 http://gnomad.broadinstitute.org/variant/17-78090813-T-G

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele, 2 other patients have this genotype

CaseOPM-1: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.97 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation, Nomenclature indicates Variants 1 and 2 are in cis and the other allele is Wildtype

CaseIP2-6: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.02 umol/hr/L, Serum CK at 709 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates that Variant 1 and 2 are in cis and the patient is homozygous for this allele, 2 more patients also have the same genotype

Case8HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 8 pmol/punch/hr, GAA activity at 33% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2242dupG (p.Glu748Glyfs)

ClinVar: 370651 https://www.ncbi.nlm.nih.gov/clinvar/variation/370651/

gnomAD: European (Non-Finnish) 1.767e-5, Overall 7.975e-6 https://gnomad.broadinstitute.org/variant/17-78090813-T-TG

CaseAddInfo:

Case14HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 0.1 umol/h/L, GAA activity at 33% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1441T>C (p.Trp481Arg)

ClinVar: 189007 https://www.ncbi.nlm.nih.gov/clinvar/variation/189007/

gnomAD: African 8.031e-5, Overall 2.126e-5 https://gnomad.broadinstitute.org/variant/17-78084529-T-C

CaseAddInfo:

Case34

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1942G>A (p.Gly648Ser)

ClinVar: 188902 https://www.ncbi.nlm.nih.gov/clinvar/variation/188902/

gnomAD: South Asian 3.365e-4, Overall 5.361e-5 http://gnomad.broadinstitute.org/variant/17-78086728-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case56

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1796C>A (p.Ser599Tyr)

ClinVar: 551558 https://www.ncbi.nlm.nih.gov/clinvar/variation/551558/

gnomAD: European (Non-Finnish) 2.683e-5, Overall 1.207e-5 http://gnomad.broadinstitute.org/variant/17-78086418-C-A

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Juvenile Late Onset Pompe Disease

Case85

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.784G>A (p.Glu262Lys)

ClinVar: 188806 https://www.ncbi.nlm.nih.gov/clinvar/variation/188806/

gnomAD: East Asian 5.016e-5, Overall 1.417e-5 http://gnomad.broadinstitute.org/variant/17-78081447-G-A

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease, 2 other patients have the same genotype

Case10

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1978C>T (p.Arg660Cys)

ClinVar: 558604 https://www.ncbi.nlm.nih.gov/clinvar/variation/558604/

gnomAD: East Asian 5.554e-5, Overall 4.142e-6 http://gnomad.broadinstitute.org/variant/17-78086764-C-T

Variant2: NM_000152.4:c.2221G>A (p.Asp741Asn)

ClinVar: 571521 https://www.ncbi.nlm.nih.gov/clinvar/variation/571521/

gnomAD: East Asian 1.087e-4, Overall 7.971e-6 http://gnomad.broadinstitute.org/variant/17-78090798-G-A

CaseAddInfo: Infantile Onset Pompe Disease

Case1

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1075G>T (p.Gly359Ter)

ClinVar: 420101 https://www.ncbi.nlm.nih.gov/clinvar/variation/420101/

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case27

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1411_1414delGAGA (p.Glu471fs*5)

ClinVar: 188874 https://www.ncbi.nlm.nih.gov/clinvar/variation/188874/

gnomAD: East Asian 2.513e-4, Overall 1.781e-5 http://gnomad.broadinstitute.org/variant/17-78083827-CGAGA-C

Significance of this variant is unknown.

Variant2: NM_000152.4:c.460_465del (Arg154_Thre155del)

ClinVar: 551306 https://www.ncbi.nlm.nih.gov/clinvar/variation/551306/

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease

Case39

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs*45)

CAID: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Infantile Onset Pompe Disease, 1 more patient has the same genotype

Case49

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.-32-17_-32-10delins TCCCTGCTGAGCCTCCTACAGGCCTCCCGC

CAID: CA913184750 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184750

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1447G>A (p.Gly483Arg)

ClinVar: 285157 https://www.ncbi.nlm.nih.gov/clinvar/variation/285157/

gnomAD: African 6.170e-5, Overall 7.972e-6 http://gnomad.broadinstitute.org/variant/17-78084535-G-A

CaseAddInfo: Infantile Onset Pompe Disease

Case77

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2560C>T (p.Arg854*)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case30

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1327-2A>C

CAID: CA401366173 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1327-2A%3EC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case53

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

CaseAddInfo: Juvenile Late Onset Pompe Disease

Case58

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1143delC (p.Ala382Leufs*10)

CAID: 370263 https://www.ncbi.nlm.nih.gov/clinvar/variation/370263/

gnomAD: European (Non-Finnish) 8.946e-6, Overall 4.031e-6 http://gnomad.broadinstitute.org/variant/17-78082353-AC-A

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case32

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1933G>A (p.Asp645Asn)

ClinVar: 188728 https://www.ncbi.nlm.nih.gov/clinvar/variation/188728/

gnomAD: African 6.599e-5, Overall 8.250e-6 http://gnomad.broadinstitute.org/variant/17-78086719-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant, 1 more patient has the same genotype

Case4

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.148_859-11del (p.Glu50Hisfs*37; exons2–4deletion)

CAID: CA658795223 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.148_859-11del

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.685_686insCGGC (p.Arg229fsProfs*102)

CAID: CA658795233 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.685_686insCGGC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease

Case60

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1445C>G (p.Pro482Arg)

CAID: CA401366794 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1445C%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease, 1 person more with the same genotype

Case21

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2560C>T (p.Arg854*)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.1129G>C (p.Gly377Arg)

ClinVar: 497033 https://www.ncbi.nlm.nih.gov/clinvar/variation/497033/

gnomAD: European (Non-Finnish) 2.356e-5, Overall 1.072e-5 http://gnomad.broadinstitute.org/variant/17-78082341-G-C

CaseAddInfo: Infantile Onset Pompe Disease

Case15: Female, 39 years onset, 40 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 41, GAA Activity at ~6.5 pmol/min/mg before ERT and ~11 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2237G>A (p.Trp746Ter)

ClinVar: 280063 https://www.ncbi.nlm.nih.gov/clinvar/variation/280063/

gnomAD: European (Non-Finnish) 8.834e-6, Overall 3.988e-6 http://gnomad.broadinstitute.org/variant/17-78090814-G-A

CaseAddInfo: Late Onset Pompe Disease

Case14: Female, 15 years onset, 16 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 16, GAA Activity at ~8 pmol/min/mg before ERT and ~12 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1927G>A (p.Gly643Arg)

ClinVar: 4023 https://www.ncbi.nlm.nih.gov/clinvar/variation/4023/

gnomAD: European (Non-Finnish) 3.667e-5, Overall 2.479e-5 http://gnomad.broadinstitute.org/variant/17-78086713-G-A

CaseAddInfo: Late Onset Pompe Disease

Case1: Female, Danish, 38 years report, 25 years onset

CasePresentingHPOs: HP:0008956 (Thigh muscle atrophy)

HPOsFreeText: 6-min walk test achieved 531 m, MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 2.8/2.2 (L)

NotHPOsFreetext: Not on ERT

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.307T>G (p.Cys103Gly)

ClinVar: 92483 https://www.ncbi.nlm.nih.gov/clinvar/variation/92483/

gnomAD: European (Non-Finnish) 7.874e-6, Overall 3.578e-6 http://gnomad.broadinstitute.org/variant/17-78078692-T-G

CaseAddInfo: Late Onset Pompe Disease

Case7: Male, Danish, 20 years report, 1 year onset

HPOsFreeText: MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 5.6/5.3 (L), Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.2228A>G (p.Gln743Arg)

CAID: CA401324753 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2228A%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.2237G>C (p.Trp746Ser)

ClinVar: 188484 https://www.ncbi.nlm.nih.gov/clinvar/variation/188484/

gnomAD: African 3.210e-4, Overall 7.089e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-C

Variant3: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

Case4: Male, French, 65 years report, 55 years onset

HPOsFreeText: 6-min walk test achieved 540 m, MRC score is 5/5 (thigh/calf), Forced vital capacity sitting/supine is 2.7/1.8 (L), On the medications Statin and Allopurinol, Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.3G>A

CAID: CA401359809 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.3G%3EA

gnomAD: European (Non-Finnish) 8.945e-6, Overall 4.041e-6 http://gnomad.broadinstitute.org/variant/17-78078388-G-A

CaseAddInfo: Late Onset Pompe Disease

CasePD/Pathogenic-6: 4 weeks diagnosis

HPOsFreeText: GAA activity 8.8 (nmol · h−1 · mg−1), Mean percentage of normal 12.3%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Chromosomal code not provided

Variant3: NP_000143.2:p.N87Tfs*55

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 1 and 2 are in cis

CasePD/VOUS-3: 2 weeks diagnosis

HPOsFreeText: GAA activity 11.3 (nmol · h−1 · mg−1), Mean percentage of normal 15.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Variant3: NM_000152.4:c.664G>A (p.Val222Met)

ClinVar: 290223 https://www.ncbi.nlm.nih.gov/clinvar/variation/290223/

gnomAD: South Asian 5.393e-3, Overall 6.931e-4 http://gnomad.broadinstitute.org/variant/17-78079665-G-A

CaseAddInfo: Patient has one pseudodeficency allele and one allele of uncertain significance, Nomenclature claims Variant 1 and 2 are in cis

CasePD/Pathogenic-10: 2 weeks diagnosis

HPOsFreeText: GAA activity 5.5 (nmol · h−1 · mg−1), Mean percentage of normal 7.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 https://www.ncbi.nlm.nih.gov/clinvar/variation/4020/

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Variant2: NM_000152.4:c.2161G>T (p.Glu721Ter)

CAID: CA401370611 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2161G%3ET

gnomAD: Not in gnomAD

Variant3: NM_000152.4:c.2237G>T (p.Trp746Leu)

ClinVar: 284776 https://www.ncbi.nlm.nih.gov/clinvar/variation/284776/

gnomAD: European (Non-Finnish) 1.244e-4, Overall 7.798e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-T

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 2 and 3 are in cis

CaseLOPD-15: 2 weeks diagnosis

HPOsFreeText: GAA activity 3.6 (nmol · h−1 · mg−1), Mean percentage of normal 5.1%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 http://www.ncbi.nlm.nih.gov/clinvar/variation/4020

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Chromosomal code not provided

Variant2: NP_000143.2:p.V740Gfs*55

ClinVar: N/A

gnomAD: N/A

Chromosomal code not provided and typo likely

Variant3: NP_000143.2:p.T234 mol/L

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease, Nomenclature claims Variant 1 and 2 are in cis

CaseLOPD-18: 2 weeks diagnosis

HPOsFreeText: GAA activity 2.9 (nmol · h−1 · mg−1), Mean percentage of normal 4.0%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2188G>T (p.Glu730Ter)

ClinVar: 495665 https://www.ncbi.nlm.nih.gov/clinvar/variation/495665/

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

CasePD/VOUS-2: 2 weeks diagnosis

HPOsFreeText: GAA activity 16.6 (nmol · h−1 · mg−1), Mean percentage of normal 23.3%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Variant3: NM_000152.4:c.2069C>T (p.Pro690Leu)

ClinVar: 424308 https://www.ncbi.nlm.nih.gov/clinvar/variation/424308/

gnomAD: East Asian 1.077e-4, Overall 2.337e-5 http://gnomad.broadinstitute.org/variant/17-78087045-C-T

CaseAddInfo: Patient has one pseudodeficency allele and one allele of uncertain significance, Nomenclature claims Variant 1 and 2 are in cis

CaseLOPD-12: 2 weeks diagnosis

HPOsFreeText: GAA activity 2.0 (nmol · h−1 · mg−1), Mean percentage of normal 2.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Chromosomal code not provided and typo likely

Variant2: NP_000143.2:p.V350 mol/L

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease

CaseLOPD-14: 2 weeks diagnosis

HPOsFreeText: GAA activity 3.0 (nmol · h−1 · mg−1), Mean percentage of normal 4.2%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2509C>T (p.Arg837Cys)

ClinVar: 456408 https://www.ncbi.nlm.nih.gov/clinvar/variation/456408/

gnomAD: European (Non-Finnish) 4.676e-5, Overall 2.487e-5 http://gnomad.broadinstitute.org/variant/17-78092019-C-T

CaseAddInfo: Late Onset Pompe Disease

Patient2: female, 29 yo, Caucasian

CasePresentingHPOs: HP:0003724, HP:0008988, HP:0003691, HP:0003391, HP:0003551, HP:0040081, HP:0002910, HP:0003557, HP:0100295, HP:0100295, HP:0009051, HP:0004356, HP:0002111

HPOsFreeText: paravertebral muscle atrophy, atrophies with paresis grade of 3-4 MRC, cannot stand from squatting position, impaired overhead work, CK = 1390 U/l, AST = 65 U/l, ALAT = 72 U/L, symmetrical atrophy of thigh muscle, fatty deposits in m. adductor magnus, flause signal elevation in the mm. semimembranosus and mm. biceps femoris bilateral, reticulation in the proximal vastus intermedius and vastus lateralis, vacuolated muscle fibres, PAS-positive glycogen storage with enhanced lysosomal activity in the PAS staining, increased lysosomal activity, GAA activity = 0.22nmol/spot x 21hrs

CaseNotHPOs: HP:0001639

CaseAddInfo:

CasePreviousTesting: MRI of thigh muscle, muscle biopsy of mm. vastus lateralis, hematoxylin and eosin stain, Peri acid-Schiff reaction, Acid phosphatase staining, transthoracic echocardiogram, respiratory function test

CaseGenotypingMethod: Sanger Sequencing

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Case32: Female, 45 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 533 meters, Forced Vital Capacity at 77%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1888+1G>A

CAID: CA8815511 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1888%2B1G%3EA

gnomAD: European (Non-Finnish) 9.843e-6, Overall 4.375e-6 http://gnomad.broadinstitute.org/variant/17-78086511-G-A

CaseAddInfo: Late Onset Pompe Disease

Case9: Female, 34 years report

HPOsFreeText: 6 years of ERT completed, 6 Minute Walking Test at 452 meters, Forced Vital Capacity at 76%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

Variant2: NM_000152.4:c.1688A>T (p.Gln563Leu)

CAID: CA401368995 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1688A%3ET

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case19: Male, 57 years report

HPOsFreeText: 8 years of ERT completed, 6 Minute Walking Test at 273 meters, Forced Vital Capacity at 77%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1819_1836del (p.Gly607_His612del )

CAID: CA658795266 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1819_1836del

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case31: Male, 41yo (at enrollment and onset)

CasePresentingHPOs: HP:0002094, HP:0003701, HP:0003327, HP:0003236, HP:0002098, HP:0002111, HP:0003458, HP:0100284

HPOsFreeText: asymmetric weakness of extremities, CK = 573 IU/L, required use of ventilator, FVC = 33.7%, unspecific myopathic changes present in muscle pathology, DBS GAA activity = .05, mixed leukocyte GAA activity = 1.40

CaseNotHPOs: HP:0001627

NotHPOsFreeText:

CaseAddInfo:

CasePreviousTesting: clinical history, laboratory data, DBS and ML assays to measure GAA activity, electromyography, muscle pathology analysis

CaseGenotypingMethod: full sequencing of GAA gene

VariantAllele1: NM_000152.3:c.1822C>T

CAID: CA8815488, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.1822C%3ET

gnomAD: 0.00001806, http://gnomad.broadinstitute.org/variant/17-78086444-C-T

VariantAllele2: NM_000152.4(GAA):c.2238G>C (p.Trp746Cys)

ClinVar: 265160, https://www.ncbi.nlm.nih.gov/clinvar/variation/265160/

gnomAD: 0.0002987, http://exac.broadinstitute.org/variant/17-78090815-G-C

Family 9 - Patient 9

FamilyPresentingHPOs: HP:0007340, HP:0003701, HP:0000467, HP:0003327, HP:0010628, HP:0003306, HP:0002111, HP:0040081

HPOsFreeText: muscle pathology with slight vacuolar myopathy with mild glycogen excess

FamilyNotHPOs: HP:0002015, HP:0003691, HP:0002650

Ethnicity: Iranian

ProbandLabel:

FamilyAddInfo: onset at 28yo, diagnosed at 35yo, MRC sum score = 81

FamilyPreviousTesting: Respiratory Evaluation: FVC = 71%, CK = 748 U/L, muscle pathology examined, DBS enzyme activity (with inhibition) = 3.5 μmol/L/h

FamilyGenotypingMethod: GAA analyzed with Sanger Sequencing for entire coding region and conserved exon-intron splice junctions, PCR performed for deletion screening

VariantAllele1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

VariantAllele2: NM_000152.4(GAA):c.1799G>A (p.Arg600His)

ClinVar: 370130, https://www.ncbi.nlm.nih.gov/clinvar/variation/370130/

gnomAD: 8.675e-06, http://exac.broadinstitute.org/variant/17-78086421-G-A

CaseCII-1: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 1515 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.194T>C (p.Ile65Thr)

ClinVar: 636 https://www.ncbi.nlm.nih.gov/clinvar/variation/636/

gnomAD: 0.0005574, https://gnomad.broadinstitute.org/variant/12-102894893-A-G?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.1065+1G>A

ClinVar: 102501 https://www.ncbi.nlm.nih.gov/clinvar/variation/102501/

gnomAD: 0.00004622, http://gnomad.broadinstitute.org/variant/12-103238113-C-T

CaseAII-2: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 375 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.165del (p.Phe55fs)

ClinVar: 611 https://www.ncbi.nlm.nih.gov/clinvar/variation/611/

gnomAD: 0.00002639, https://gnomad.broadinstitute.org/variant/12-103306571-CA-C?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.898G>T (p.Ala300Ser)

ClinVar: 92751 https://www.ncbi.nlm.nih.gov/clinvar/variation/92751/

gnomAD: 0.006318, https://gnomad.broadinstitute.org/variant/12-102851701-C-A?dataset=gnomad_r3

CaseBII-2: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 270 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.688G>A (p.Val230Ile)

ClinVar: 102784 https://www.ncbi.nlm.nih.gov/clinvar/variation/102784/

gnomAD: 0.0009025, https://gnomad.broadinstitute.org/variant/12-102855154-C-T?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.1241A>G (p.Tyr414Cys)

ClinVar: 593 https://www.ncbi.nlm.nih.gov/clinvar/variation/593/

gnomAD: 0.0005264, https://gnomad.broadinstitute.org/variant/12-102840474-T-C?dataset=gnomad_r3