10,000 Matching Annotations
  1. Jul 2018
    1. On 2013 Nov 15, George McNamara commented:

      The PubSpectra dataset of over 2,000 fluorescence spectra is now (2013) downloadable in the Excel XLSX file inside a zip archive downloadable from

      http://works.bepress.com/gmcnamara/9/

      The Boswell spectra graphing site described in this paper is defunct and has been replaced by Urs Utzinger and Carl Boswell's University of Arizona Spectra site

      http://www.spectra.arizona.edu/

      Urs has added additional spectra - especially 2-photon excitation spectra - to his web site.

      Several vendors have spectral graphing sites, including (but not limited to)

      http://www.semrock.com/searchlight-welcome.aspx

      http://www.chroma.com/spectra-viewer

      LifeTech/Invitrogen/Molecular Probes http://www.lifetechnologies.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html instructions: http://www.lifetechnologies.com/us/en/home/references/molecular-probes-the-handbook/technical-notes-and-product-highlights/using-the-fluorescence-spectraviewer.html

      Leica http://www.leica-microsystems.com/fluoscout/ (filter sets are from Chroma, so may be simpler to use Chroma’s web site)

      BD Biosciences http://www.bdbiosciences.com/research/multicolor/spectrum_viewer/index.jsp

      Most of the confocal microscope companies have spectral viewers in their software. Zeiss ZEN acknowledges PubSpectra as the source of data.

      Re-using data: This 2006 paper includes a section,

      Data Is Not Copyrightable During the course of developing this data, one of us had an epiphany while reading in Lessig (18) about a U.S. Supreme Court decision: data is not subject to copyright (14). Text and commentary about Feist can be found on many legal web sites by doing a Google search. Indeed, the broad availability of the text of Supreme Court decisions is because they are not subject to copyright. The Feist decision reaffirmed the U.S. Copyright act of 1976 that "there can be no copyright in facts". The basis for the Feist decision can be found in the U.S. Constitution. 14. Feist Publications, Inc. v. Rural Tel. Serv. Co. 1991;499 U.S. 340. 18. Lessig L. The Future of Ideas. New York: Random House; 2001. p 368. For those interested in reference 17, Multi-Probe Microscopy, it is available for download at http://works.bepress.com/gmcnamara/2/

      Now in 2013, I want to reinforce in this PubMed Comment, that: 1. Data is not copyrightable (in the United States). 2. I encourage re-use of PubSpectra instead of you starting from scratch. 3. If anyone wants to "take over" adding data, please go ahead and do so. I would love for someone to find money and organizational skills to set up a village in India or China - or downtown Troy NY or Detroit MI - to hire people to unscan spectra graphs, and add it to "New PubSpectra".


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      The courageous effort by Emanuel to outline a new pre-medical and medical curriculum has one contradiction and two omissions.

      First, after advocating a year of biochemistry in the pre-medical curriculum, he rightly states that knowledge of the Krebs cycle generally has no practical use at the bedside. This contradiction suggests that devoting a year to biochemistry is excessive.

      Second, there is a fundamental, yet unspoken truth about medicine: as an intellectual endeavor, it is extremely easy. While the hard sciences require detailed understanding and nuanced application of difficult quantitative principles, medical textbooks simply demand memorization on a massive scale. One could argue that mnemonic training is the greatest omission in medical teaching and that, of all pre-medical requirements, organic chemistry is the greatest developer of memorization skills.

      Finally, I wish there were some way to teach humility more effectively and more permanently. Any physician not cowed by their own ignorance should be drummed out of the profession.

      (1) Emanuel EJ. Changing premed requirements and the medical curriculum. JAMA. 2006 Sep 6;296(9):1128-1131. Pubmed 16954492


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 07, Morten Oksvold commented:

      This article should have been retracted after an investigation by The University of Maryland found this article to contain "compromised" data (a total of 26 articles in 11 journals were affected). The journal Cancer Research was informed in August 2016, according to Retraction Watch.

      http://retractionwatch.com/2017/04/26/university-asked-numerous-retractions-eight-months-later-three-journals-done-nothing/


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 23, Ben Goldacre commented:

      This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the body of the text of the article. The ID given is NCT00092791. We believe the correct ID, which we have found by hand searching, is NCT00092781.

      This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

      Many thanks,

      Jessica Fleminger, Ben Goldacre*

      [1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8

      * Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Sep 14, Daniel Haft commented:

      EpsH family proteins in bacteria are now called exosortase. Their very distant homologs in the archaea are termed archaeosortase. Exosortases and archaeosortases belong to an extended superfamily, exclusive to prokaryotes, whose members can be detected by TIGRFAMs model TIGR04178. An updated description of the superfamily occurs in PMID:22037399 (Haft, et al., 2012). The variety of archaeosortase and exosortase systems should recall the situation with sortases and their substrates, "An embarrassment of sortases - a richness of substrates?" (PMID:11239768, Pallen, et al. 2001).

      The first characterized member of the extended family is archaeosortase A, ArtA, from Haloferax volcanii. Its primary target is the major cell surface glycoprotein, which forms the S-layer. This target has been a model for studying post-translational modification in the archaea. Knocking out ArtA blocks removal of the PGF-CTERM sorting signal and causes a variety of phenotypic differences include S-layer defects. See Abdul Halim, et al., 2013, PMID:23651326.

      The work on archaeosortase suggests that both exosortases and archaeosortases may be transpeptidases. The S-layer glycoprotein was previously known to have a large prenyl-derived lipid, attached somewhere toward the C-terminus. Its purpose was unclear because the final C-terminal transmembrane helix seemed sufficient to anchor the protein to membrane. However, proof that the PGF-CTERM sorting signal is removed during maturation suggests that the lipid replaces it as the anchor. Transpeptidase activity would allow removal of the C-terminal sorting signal and attachment of the lipid to occur simultaneously.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jun 15, Jorge H Ramírez commented:

      Related articles:

      Ramírez JH, Palacios M, Tamayo O, et al. Acute and subacute toxicity of Salvia scutellarioides in mice and rats. J Ethnopharmacol 2007;109:348–53. URL: http://www.ncbi.nlm.nih.gov/pubmed/16978817 Full text article available in English

      Ramírez JH, Palacios M, Gutiérrez O. Implementation of the isolated vascular tissue model as a device for the validation of medicinal plants: Study of the vasodilator activity of Salvia scutellarioides. Colomb. Med. 2007;38:28–39. URL: http://colombiamedica.univalle.edu.co/index.php/comedica/article/view/471/480 Full text article available in English and Spanish.

      Ramírez JH, Palacios M, Ocampo HH, et al. Lack of association between blood pressure, target organ damage and retinopathy in the L-NAME rat hypertension model: Are new animal models of hypertension required?. Colomb. Med. 2006;37:328–31. URL: http://colombiamedica.univalle.edu.co/index.php/comedica/article/view/465/471 Full text article available in Spanish. Abstract available in English.

      Ramírez JH, Palacios M, Gutiérrez O. Evaluation of the antihypertensive effect of Salvia scutellarioides in a rat model of hypertension. Colomb Med 2006; 37: 53-60. URL: http://colombiamedica.univalle.edu.co/index.php/comedica/article/view/412/417 Full text article available in Spanish. Abstract available in English.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Sep 06, Jakob Suckale commented:

      PubSum: The stem cells that can generate our body's specialized cell types take cues from the stiffness of their environment to decide which cell to become; soft generates nerve-like cells, hard generates bone-like cells. To arrive at this hypothesis researchers grew human stem cells on surfaces of varying stiffness and analyzed how they changed over time.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 18, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Feb 14, Henning Voss commented:

      We were aware of the possibility of artefacts in DTI at the time of publishing of [1], and therefore as noted in our study [1] we tested for increased residuals in the tensor fits, which would be a sign of the artefact described in [2] and [3]. We did not find increased residuals in the medial parietal occipital region or the cerebellar vermis. In particular for the vermis, later we also created plots corresponding to [3], Figure 2, on higher quality data of the same subject obtained with a headcoil unavailable at the time of first timepoint of study (not published) which showed the same effect. We did not find any hint for the artefact there, either. We also compared this case with 20 healthy control subjects scanned on the same equipment with the same protocol and the patient had the highest anisotropy in the medial parietal occipital region.

      [1] Voss HU, Uluç AM, Dyke JP, Watts R, Kobylarz EJ, McCandliss BD, Heier LA, Beattie BJ, Hamacher KA, Vallabhajosula S, Goldsmith SJ, Ballon D, Giacino JT, Schiff ND. Possible axonal regrowth in late recovery from the minimally conscious state. J Clin Invest. 2006 Jul;116(7):2005-11. [2] Berl M, Walker L, Sarlls J, and Pierpaoli, C. Investigation of vibration induced artifacts in clinical diffusion weighted imaging of the brain. Proc. Intl. Soc. Mag. Reson. Med. 20, 3740 (2012). [3] Gallichan D, Scholz J, Bartsch A, Behrens TE, Robson MD, Miller KL. Addressing a systematic vibration artifact in diffusion-weighted MRI. Hum Brain Mapp. 2010 Feb;31(2):193-202.

      H.U. Voss and N.D. Schiff


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2013 Nov 04, Jamie Horder commented:

      In a conference abstract, Berl and colleagues suggested that the striking results presented in this paper may have been the result of an artifact, observed in some MRI DTI sequences.

      They argued that although the vibration signal-loss artifact in question is best known as an issue on Siemens MRI scanners, GE scanners, such as the one used in the Voss study, are not immune.

      Berl et al wrote:

      "The artifact may be the basis for a clinical misinterpretation that has been cited as evidence to change policy and practice [i.e the Voss study]. The speed that this article was propagated was assisted by the inherent interest of the case details; however, it also illustrates the danger of premature clinical interpretation of DTI data.

      We suggest that repositioning the patient by adjusting the roll would be a simple and practical method to determine if such findings were indeed axonal regrowth or artifact."


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Mar 04, Chris Del Mar commented:

      Between 1 - 5/1,000 children aged <5 years in developed countries may need hospital admission each year because of influenza infections, (PMID: 26111238) -- much lower (e.g. 0.6/1,000 children when based on laboratory confirmation of influenza, (http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19365). The benefits of influenza vaccination in children are a NNTB of 28 to prevent one child age aged >6 years getting influenza, but there is no effect on any downstream consequences such as secondary infections, nor benefit for children aged <2 years, from a Cochrane review (PMID 22895945). This systematic review estimates a rate of fevers of 6-7%, and of febrile convulsions at ~1/1,000 from inactivated vaccine fever in children aged >6 years (NNTH of 16 and 1,000 respectively) -- in the same range as those who might be prevented from a post-influenza admission. This suggests the decision about influenza vaccination needs discussion with parents to balance benefits against harms, perhaps using shared decision making (patient decision aid might be ideal), rather than public health pronouncements. Peer Collingnon collignon.peter@gmail.com; Chris Del Mar cdelmar@bond.edu.au


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 22, Rafael Najmanovich commented:

      Genome-wide metabolic reconstructions have numerous uses. One of which is predicting what would be the effect of knocking out one or more genes or inhibiting the function of the corresponding protein(s). Once a gene is deleted or the protein inhibited, matter flows around other available metabolic routes. Such rearrangements may drastically disrupt the production of biomass or altogether prevent it, signifying that the gene/protein is fundamental or essential. Such proteins represent potential therapeutic targets.

      Flux Balance Analysis (FBA) is widely used to perform predictions of gene essentiality Orth JD, 2010. Wunderlich and Mirny introduce Synthetic Accessibility (SA) as an alternative method that is based solely on the topology of the metabolic network. The idea is derived from synthetic chemistry labs where the difficulty in creating a new molecule is measured as the number of synthetic steps necessary to produce the molecule starting from available starting materials. In the case of metabolic networks, the idea is to calculate the number of steps necessary to produce biomass compounds from input metabolites.

      The validity of the SA approach in predicting essential genes was verified in E. coli and S. cerevisiae. When a gene is knocked out or its protein inhibited in silico, the SA will necessarily either remain unchanged or increase (even infinitely) reflecting the longer path (or the absence thereof) necessary to reach output compounds using alternate metabolic routes.

      SA and FBA are equivalent in terms of accuracy, around 60% and 80% respectively for E. coli and S. cereviseae. We implemented both SA and FBA in our lab and independently verified these results. Furthermore we also tested B. subtilis where a metabolic network exists Oh YK, 2007 and the full list of essential genes is known Kobayashi K, 2003, obtaining a success rate of 92% with SA (equivalent to the 94% obtained by Oh et al. Oh YK, 2007 with FBA). Wunderlich and Mirny point that the equivalent success rates between FBA and SA suggests the success of the former should be attributed mainly to network topology.

      Some advantages of SA over FBA involve the simplicity of the approach (in terms of implementation and execution), not requiring any knowledge of the stoichiometry of reactions (or initial ranges for reaction rates). The latter in my opinion is a very interesting aspect of SA that allows its application to mixed networks that integrate gene regulatory networks, metabolic networks and other cellular processes that are more difficult to define in terms of stoichiometry and reaction rates.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 20, Peter Gøtzsche commented:

      This meta-analysis, which was based on observational studies, found that a history of depression doubled the risk of developing Alzheimer’s disease later in life. The authors speculate that vascular disease and inflammation may be risk factors for both diseases. Nowhere in the paper do they alert their readers to the most obvious explanation. Virtually all people with a history of depression have been treated with antidepressant drugs and it might very well be the drugs that cause dementia.

      We know for sure that antipsychotics cause permanent brain damage, and many of us suspect that this is also the case for other psychotropic drugs. Animal studies have been particularly worrying in this respect. However, the psychiatrists have learned from the drug industry never to blame the drug but always to blame the disease (1-4). There are countless studies in depression and countless statements by official bodies representing psychiatry about how dangerous untreated depression is, about visible deterioration on brain scans, etc, when in actual fact these opinions are built on studies of patients who were treated with antidepressant drugs (3). This makes no sense.

      Peter C Gøtzsche Professor and Director, DrMedSci, MSc, MD Nordic Cochrane Centre Rigshospitalet Copenhagen

      Conflicts of interest: none.

      1. Healy D. Let Them Eat Prozac. New York: New York University Press; 2004.

      2. Whitaker R. Anatomy of an Epidemic. New York: Broadway Paperbacks; 2010.

      3. Raven M. Depression and antidepressants in Australia and beyond: A critical public health analysis. PhD thesis, University of Wollongong, Australia; 2012 (http://ro.uow.edu.au/theses/3686/, accessed 13 August 2014).

      4. Gøtzsche PC. Deadly medicines and organised crime: How big pharma has corrupted health care. London: Radcliffe Publishing, 2013.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 20, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Apr 20, Daniel Corcos commented:

      There is a serious bias in this study, as the mutation status for the cases was determined after diagnosis, whereas the controls were at-risk women. The large majority of the cancers were not diagnosed by screening mammography, indicating that screening was not performed efficiently in this group. On the contrary, being at-risk implicates implementation of screening, and, as a consequence, more mammograms in this group.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 28, Rafael Irizarry commented:

      I highly recommend reading this paper. It presents the statistical motivation for the widely used limma package. Although originally developed for microarrays, I have used the ideas presented here for other high throughput data include next generation sequencing. Of particular importance is the idea of shrinking sample standard deviations before computing signal to noise summaries such as the t-test.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 29, Hilda Bastian commented:

      The results of this systematic review are contradicted by a more recent and more comprehensive analysis of the methodologically more rigorous trials of viscosupplementation of the knee (Rutjes AW, 2012). In that more recent review, Rutjes and colleagues identify significant publication bias as a contributing factor in previous over-estimations of the benefit of intra-articular injections.

      Rutjes and colleagues conclude that the intervention has only a clinically irrelevant benefit on pain, no statistically significant effect on function and is associated with serious unexplained adverse events. They discourage the use of the intervention and suggest an individual patient data meta-analysis would be needed to explore the issue of adverse events.

      Doubts about the potential for viscosupplementation of the knee to do more good than harm were also expressed in another systematic review published after that by Bellamy and colleagues (Samson DJ, 2007).

      UPDATE: A network meta-analysis by Bannuru RR, 2015 was able to analyze intra-inarticular injections, intra-articular placebos, and oral placebos, as well as a range of active treatments. It found a clinically meaningful benefit from intra-articular hyaluronic acid injections, in large part attributable to the effects of intra-articular injections per se.

      (I discussed the implications of the 2015 review in a February 2015 blog post.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Sep 21, Morten Oksvold commented:

      The published erratum of this article does not mention that a committee at McGill University has completed an investigation and concluded that several articles, included this one, were subjected to research misconduct. More specifically they found that two figures in this study “were intentionally contrived and falsified,”.

      Please see a discussion at Retraction Watch: http://retractionwatch.com/2013/01/25/mcgill-committee-says-nature-figures-were-intentionally-contrived-and-falsified/

      More recently a study by Vande Walle et al. (Nature, Brief communication) is questioning the conclusions in this article.

      Please follow link:

      http://www.nature.com/nature/journal/v534/n7605/full/nature17649.html


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Feb 12, Ferenc Zsila commented:

      This text is shown on the page 24, in the paper of Ma et al. (see above):

      "Figure 2C shows the change in intensity of CD bands in the presence of 1.0 mol equiv of Cu<sup>2+</sup> at 252, 312, and 514 nm. Relatively strong CD bands are often for d-d transitions of Cu<sup>2+</sup> tetragonal complexes.<sup>29</sup> However, these complexes involve main-chain amide coordination as well as histidine coordination via the imidazole ring. In these cases, the dominant contribution to optical activity observed is due to the vicinal contributions resulting from the asymmetric alpha carbon held in a chelate ring between two chelating donor atoms, such as adjacent main-chain amides.<sup>43</sup> At physiological pH and below, the lack of optical activity from the d-d transition of the complex suggests that backbone amide coordination is absent. At pH 8.5 and above, amide proton is deprotonated, which promotes copper coordination by the main chain, resulting in a negative CD band appearing at 514 nm. Clearly, Aβ(1-16) forms a type II square-planar coordination geometry with Cu<sup>2+,</sup> and the coordination geometry is 3N1O at pH 7.5. Both visible absorption and CD spectra indicate that the coordinating ligands are strongly pH dependent, a mixed species is present at physiological pH, and main-chain amide coordination is absent at lower pH values."

      The following text is shown on the page 18171, in the paper of Syme et al. Syme CD, 2004:

      "The insets in Fig. 2 show the change in the intensity of CD bands in the presence of 1 eq of Cu<sup>2+</sup> at 252, 312, and 514 nm. Relatively strong CD bands are often observed for d-d transitions of Cu<sup>2+</sup> tetragonal complexes (36, 37). However, these complexes involve main-chain amide coordination as well as histidine coordination via the imidazole ring. In these cases, the dominant contribution to optical activity observed is due to the vicinal contributions resulting when the asymmetric α-carbon is held in a chelate ring between two chelating donor atoms (e.g. adjacent main-chain amides) (38). At physiological pH and below, the lack of optical activity from the d-d transition of the Cu-Aβ complex suggests that backbone amide coordination is not taking place. It is likely that raising the pH above 8 promotes amide deprotonation and copper coordination by the main chain, resulting in a CD band being observed at 514 nm. In summary, it is clear that Aβ forms a TypeII square-planar coordination geometry with Cu<sup>2+,</sup> and both EPR and CD measurements indicate that the coordinating ligands are highly pH-dependent, a mixed species is present at physiological pH, and main-chain amide coordination is not present at lower pH values."

      [Syme CD, Nadal RC, Rigby SE, Viles JH. Copper binding to the amyloid-β (Aβ) peptide associated with Alzheimer's disease: folding, coordination geometry, pH dependence, stoichiometry, and affinity of Abeta-(1-28): insights from a range of complementary spectroscopic techniques. J. Biol. Chem. 2004 (279) 18169-18177.]


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Oct 17, Arturo Martí-Carvajal commented:

      Reading this abstract, I asked myself two questions:

      1. What is the relation between title and conclusions of this RCT?
      2. TWAUC cholesterol from week 4 decreased more in the pravastatin group (-0.8 +/- 1.0 versus -0.3 +/- 0.9 mmol/L/week; P = 0.04) Query: mean (SE) or (SD)?

      Does somebody have the answer please? Arturo


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 09, Tom Kindlon commented:

      Comment on the discussion of the effectiveness of interventions for CFS

      (This was originally posted here http://www.biomedcentral.com/1741-7015/4/9/comments in 2009)

      The authors state that, in this study, "effect sizes and confidence intervals will be reported for each group", which is to be welcomed. As well as giving the protocol for the FINE Trial, this paper also gives information and data from some previous studies in the area including saying some treatments have been shown to be "effective". However, it does not report effect sizes.

      Readers of this paper may be interested to know about a recent meta-analysis of the efficacy of CBT for CFS[1]. The studies involved a total of 1371 patients. It involved calculating the size of an effect measure, the Cohen's d value. They calculated d using the following method: "Separate mean effect sizes were calculated for each category of outcome variable (e.g., fatigue self- rating) and for each type of outcome variable (mental, physical, and mixed mental and physical). Studies generally included multiple outcome measures. For all analyses except those that compared different categories or types of outcome variables, we used the mean effect size of all the relevant outcome variables of the study." d was calculated to be 0.48.

      For anyone unfamiliar with Cohen's d values, they are not bounded by 1; also, the higher the score, the bigger the "effect size" i.e. the more "effective" a treatment was found to be. Cohen's d values are considered to be a small effect size at 0.2, a moderate effect size at 0.5, and a large effect size at 0.8[2]. CBT had a more general definition in this paper and included some papers on GET. For example, the current paper says that, "Graded exercise therapy has also been shown to be effective in randomised controlled trials with selected hospital patients[3] and in our own previous study with a more general sample of hospital patients[4]." Malouff et al[1] calculated the d value for these studies as 0.46 (95% CI: 0.03 -0.95) and 0.17 (95% CI: -0.30 - +0.65) respectively (For the latter study, Malouff et al calculated the figures by comparing drug (i.e. antidepressant) treatment plus CBT to drug treatment without CBT).

      References:

      [1] Malouff, J. M., et al., Efficacy of cognitive behavioral therapy for chronic fatigue syndrome: A meta-analysis. Clinical Psychology Review (2007), doi:10.1016/j.cpr.2007.10.004

      [2] Cohen J: Statistical power analysis for the behavioural sciences. Edited by: 2. New Jersey: Lawrence Erlbaum; 1988.

      [3] Fulcher KY, White PD: Randomised controlled trial of graded exercise in patients with the chronic fatigue syndrome. BMJ 1997, 314:1647-1652.

      [4] Wearden, A. J., Morriss, R. K., Mullis, R., Strickland, P. L., Pearson, D. J., Appleby, L., et al. (1998). Randomised, double-blind, placebo-controlled treatment trial of fluoxetine and graded exercise for chronic fatigue syndrome. British Journal of Psychiatry, 172, 485?490.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Jan 09, Tom Kindlon commented:

      (contd.)

      There are numerous pre-existing instruments out there that measure other symptoms associated with CFS. Off the top of my head, two that come to mind are the Chronic Fatigue Syndrome Symptom List and the CFS CDC Symptom Inventory. It encompasses the 19 most frequently reported symptoms in a sample of 1578 chronic fatigue syndrome patients[8]. In order to assess the severity of the symptoms included in the Chronic Fatigue Syndrome Symptom List, visual analogue scales (100 mm) are used. The Symptom Inventory "collects information about the presence, frequency, and intensity of 19 fatigue and illness-related symptoms" including the 8 CDC criteria symptoms. Perceived frequency of each symptom is rated on a four-point scale (1=a little of the time, 2=some of the time, 3=most of time, 4=all of the time), and severity or intensity of symptoms was measured on a three-point scale (1=mild, 2=moderate, 3=severe). To summarize the degree of distress associated with each symptom, individual symptom scores were calculated by multiplying the frequency score by the intensity score. The scoring would not have to be done like this - for example in the same paper I quoted from for the method of scoring above, the CDC team[8] used the following method: they "transformed the intensity scores into equidistant scores before multiplication (i.e., 0 = symptom not reported 1 = mild, 2.5 = moderate, 4 = severe) resulting in range 0–16 for each symptom." A total score for each person can be calculated by summing the 19 individual symptom scores (possible range from 0 to 304). A Case Definition score can be calculated as the sum of the 8 individual CFS case-definition symptom scores and an Other Symptoms score by considering only the 11 non-CFS symptoms.Calculating levels of various symptoms like this would have given a better overall idea of the health of the patients and how badly affected they were by "CFS/ME".

      They could also have been used before and after the exercise testing.

      In most management strategies these days, whether they're based on a graded exercise/activity model or a pacing model, patients are discouraged from "boom and bust" i.e. doing too much or pushing themselves and then crashing with lots of symptoms. Faced with the exercise testing, a patient who is good at avoiding "booming and busting" may not push themselves as hard as another patient. That does not mean they are not as well or do not manage their illness as well as another patient. One way of measuring whether this occurred with the exercise testing was if measures were used before and after the exercise testing. Given the post-exertional nature of many of the symptoms of "CFS/ME", it can be good not to restrict testing just to the day of exercise testing.

      There are some examples in the literature of patients being followed up after exercise testing. For example, Nijs[10] performed a gentle walking exercise on patients where they walked on average 558m(+/-340) (range: 120-1620) at a speed of 0.9m/s (+/-0.2) (range: 0.6-1.1). This resulted in a statistically significant (p<0.05) worsening of scores in the following areas when comparing pre-exercise, post-exercise and 24 hour post-exercise scores using ANOVA: VAS fatigue, VAS musculoskeletal pain, VAS sore throat, SF-36 bodily pain and SF-36 general health perception. 14 out of 24 subjects experienced a clinically meaningful change (worsening) in bodily pain (i.e. a minimum change of the SF-36 bodily pain subscale score of at least 10).In another study, Lapp [11] reported on the effects of 31 patients to his practice who were asked to monitor their symptoms three weeks before to 12 days after a maximal exercise test. 74% of the patients experienced worsening fatigue and 26% stayed the same. None improved. The average relapse lasted 8.82 days although 22% were still in relapse when the study ended at 12 days. There were similar changes with exercise in lymph pain, depression, abdominal pain, sleep quality, joint and muscle pain and sore throat.

      Actometers could also have been used in the period before and after testing to see whether there was "booming and busting" and so to see whether the exercise testing alone is useful or not.

      I am unsure whether much of what I've written can be used at this stage for this study but it may be useful for people interpreting the results as well as for others designing further trials.* When quoting from the paper's text, I have changed the reference numbers of papers to ones I've used.

      Publications

      1 Whiting P, Bagnall A-M, Sowden A, Cornell J, Mulrow C, Ramirez G: Interventions for the treatment and management of chronic fatigue syndrome. A systematic review. JAMA 2001, 286:1360-1368.

      2 Friedberg, F. Does graded activity increase activity? A case study of chronic fatigue syndrome. Journal of Behavior Therapy and Experimental Psychiatry, 2002, 33, 3-4, 203-215

      3 Prins JB, Bleijenberg G, Bazelmans E, et al. Cognitive behaviour therapy for chronic fatigue syndrome: a multicentre randomised controlled trial. Lancet 2001; 357: 841-47.

      4 Van Essen, M and de Winter, LJM. Cognitieve gedragstherapie by het vermoeidheidssyndroom cognitive behaviour therapy for chronic fatigue syndrome). Report from the College voor Zorgverzekeringen. Amstelveen: Holland. June 27th, 2002. Bijlage B. Table 2.

      5 O'Dowd, H., Gladwell, P., Rogers, CA., Hollinghurst, S and Gregory, A. Cognitive behavioural therapy in chronic fatigue syndrome: a randomised controlled trial of an outpatient group programme. Health Technology Assessment, 2006, 10, 37, 1-140.

      6 Roberts AD, Papadopoulos AS, Wessely S, Chalder T, Cleare AJ. Salivary cortisol output before and after cognitive behavioural therapy for chronic fatigue syndrome. J Affect Disord. 2008 Oct 18.

      7 Priebe S, Fakhoury WK, Henningsen P. Functional incapacity and physical and psychological symptoms: how they interconnect in chronic fatigue syndrome. Psychopathology. 2008;41(6):339-45.

      8 De Becker P, McGregor N, De Meirleir K. A definition-based analysis of symptoms in a large cohort of patients with chronic fatigue syndrome. J Intern Med 2001; 250: 234–40.

      9 Wagner D, Nisenbaum R, Heim C, Jones JF, Unger ER, Reeves WC. Psychometric properties of the CDC Symptom Inventory for assessment of chronic fatigue syndrome. Popul Health Metr. 2005 Jul 22;3:8.

      10 Nijs J, Almond F, De Becker P, Truijen S, Paul L. Can exercise limits prevent post-exertional malaise in chronic fatigue syndrome? An uncontrolled clinical trial. Clin Rehabil. 2008 May;22(5):426-35.

      11 Lapp, C (1997). Exercise limits in chronic fatigue syndrome. Am J Med, 103: 83-84.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2014 Jan 09, Tom Kindlon commented:

      Further comments on the outcome measures being used and suggestions for other outcome measures that could be useful in such trials

      (This was originally posted here http://www.biomedcentral.com/1741-7015/4/9/comments in 2009)

      In the protocol, the authors say the following: "A 2001 systematic review of all treatments for CFS/ME concluded that cognitive behaviour therapy (CBT) and graded exercise therapy (GET) were the most promising treatments for CFS/ME, but that owing to the small number of studies available for review, the generalisability of these results could not be assured [1]*. The authors recommended that further studies be carried out using standardised outcome measures."

      They authors neglect to say that the authors of that review also recommended the use of more objective outcome measures: e.g. "Outcomes such as 'improvement,' in which participants were asked to rate themselves as better or worse than they were before the intervention began, were frequently reported. However, the person may feel better able to cope with daily activities because they have reduced their expectations of what they should achieve, rather than because they have made any recovery as a result of the intervention. A more objective measure of the effect of any intervention would be whether participants have increased their working hours, returned to work or school, or increased their physical activities."

      It is very disappointing that the organisers of this trial have not taken this on board with this study. Given the cost of the trial (over £1m), the cost of some actometers (for example) would have virtually neglible.

      Existing research has some interesting findings on the issue. For example, one study (on a single patient)[2] found "using a 26-session graded activity intervention involved gradual increases in physical activity" that "from baseline to treatment termination, the patient’s self-reported increase in walk time from 0 to 155 min a week contrasted with a surprising 10.6% decrease in mean weekly step counts."The authors of the current trial refer to the Prins (2001) study[3] as an example of a study which supposedly found that hospital-based hospital-based CBT was an "effective treatment" for CFS. Judging by some of the questionnaire data, it does look like CBT has had an effect. However the actometer data from this study subsequently became available[4) and the increases in activity were minimal. For instance, the baseline average for the group which received CBT was 67.9, which increased to 68.8 after treatment and to 72.2 at follow-up. About 4 points. Not unlike the medical care controls, who went from 64.9 to 68.7 in the same period.

      One of the aims of CBT (for CFS) has been said to be "increased confidence in exercise and physical activity"[5]. Thus it may be the case that when asked questions about one's ability to do things, such as in the physical functioning subscale of SF-36 (one of the three primary outcome measures in the FINE Trial), the patients might say that they are "Limited A Little" or "Not Limited At All" but may be just as limited as patients in other arms of study who say "limited a lot".

      The physical functioning subscale is the primary outcome measure that is also being used to measure "clinically significant improvement" ("An improvement of 50% or more on the SF-36 physical functioning scale, or a score of 75% or more on that scale, will be considered a clinically significant improvement"). It is not an objective instrument, particularly in a psychosocial trial.

      In my two previous comments, I have criticised the use of the bimodal Chalder Fatigue Scale as an outcome measure in a trial of patients with "CFS/ME". Recently another trial[6] was published involving CFS patients in the UK. The mean score was not given but the median mark was 11. That is to say, at least 50% of the people scored the maximum mark before the intervention. These people can not "get worse" on the scale using the scale even if they feel worse.

      The third and final primary outcome measure being used is a quality of life measure. Although it may be useful to measure the quality of life, the findings of a recent study[7] make for interesting reading. It used 73 patients, also with a diagnosis of CFS according to the Oxford criteria, from UK clinics. It involved using principal-component analysis to analyse various bits of questionnaire. The Principal-component analysis of all scale scores revealed 2 distinct components, explaining 53% of the total variance. The results are summarised in the following extract: "The perceived incapacity in fulfilling social and physical roles may be best captured by the subscales of the SF-36 on social and physical functioning. The scores on these subscales are associated with vitality and inversely with one of the defining symptoms of CFS, i.e. fatigue (Chalder Fatigue Scale, Fatigue Visual Analogue Scale). They are also associated with other physical symptoms (SDQ, SCL-90-R subscale ‘somatization’), but not with psychological symptoms such as depression (Beck Hopelessness Scale, SCL-90-R subscale ‘depression’) and anxiety (Spielberger Trait Anxiety Questionnaire, SCL-90-R subscale ‘anxiety’). These psychological symptoms are linked to a generic measure of quality of life (MANSA), reflecting satisfaction with life in general and life domains, and to emotional role functioning and mental health (SF-36, subscale)."

      Of course, the instrument to measure quality of life is different in this study so the relevance of this study is unclear at this time. But like the other two outcome measures (Chalder Fatigue Scale and SF-36 PF), the Euroqol is subjective.

      It is disappointing that there apart from checking for the presence or absence of the CDC criteria, there appears to be no measurement of other symptoms apart from fatigue. (And of course I've already pointed out the problems with using the bimodal Chalder Fatigue Scale e.g. it's hard for some patients to score "worse" scores using the scale). But most researchers do not think CFS = fatigue. Even if some patients have few other symptoms because the Oxford criteria is being used, this should not have mattered.

      (contd.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2014 Jan 09, Tom Kindlon commented:

      Study confirms problems of using the 11-item bimodal Chalder Fatigue Scale as an outcome measure

      (This was originally posted here http://www.biomedcentral.com/1741-7015/4/9/comments in 2008)

      A study[1] has recently been published which confirms the problems 11-item bimodal Chalder Fatigue Scale I highlighted in my first comment[2].

      In a group of 26 people with ME recruited from a local support group in England, it found a mean bimodal score of 9.81 (SD 2.04). Fifty per cent of the patients recorded the maximum score using the bimodal method and 77% recorded the two highest scores. The two questions which attracted the lowest scores and which were responsible for most of the variance were ‘do you feel sleepy or drowsy’ and ‘do you have problems starting things’. These are hardly crucial elements of CFS/ME.

      References:

      [1] Goudsmit EM, Stouten B, Howes S: Fatigue in Myalgic Encephalomyelitis. Bulletin of the IACFS/ME - Volume 16, Issue 3. http://tinyurl.com/3zcgw8 i.e. http://www.iacfsme.org/BULLETINFALL2008/Fall08GoudsmitFatigueinMyalgicEnceph/tabid/292/Default.aspx

      [2] Kindlon Tom: Why is the 11-item bimodal Chalder Fatigue Scale being used as a primary outcome measure? http://www.biomedcentral.com/1741-7015/4/9/comments


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    5. On 2014 Jan 09, Tom Kindlon commented:

      References:

      [1] Stouten B: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution. BMC Health Serv Res. 2005 May 13;5:37. http://www.biomedcentral.com/1472-6963/5/37

      [2] Powell P, Bentall RP, Nye FJ, Edwards RHT: Randomised controlled trial of patient education to encourage graded exercise in chronic fatigue syndrome. BMJ 2001, 322:387-390.http://www.bmj.com/cgi/content/full/322/7283/387

      [3] Jenkins M, Rayman M. Nutrient intake is unrelated to nutrient status in patients with chronic fatigue syndrome. Journal of Nutritional & Environmental Medicine, 2005, 15, 4, 177-189.

      [4] Independent Working Group: A Report of the CFS/ME working group. Report to the Chief Medical Officer of an Independent Working Group. London: Department of Health; 2002.

      [5] Action for ME & Association of Youth with ME Survey 2008. http://afme.wordpress.com/ (Accessed 31st May 2008)

      [6] Action for ME Survey 2003.www.afme.org.uk/res/img/resources/AfME members survey.PDF (Accessed 31st May 2008)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    6. On 2014 Jan 09, Tom Kindlon commented:

      Why is the 11-item bimodal Chalder Fatigue Scale being used as a primary outcome measure?

      (This was originally posted here http://www.biomedcentral.com/1741-7015/4/9/comments in 2008)

      Stouten [1] has analysed some commonly used fatigue scales in the CFS area: the Chalder Fatigue Scale, the Checklist Individual Strength and the Krupp Fatigue Severity. He calculated the lower bound for the number and percentage of items with the maximum score for several studies and found that "extreme scoring" was common in studies in the field using these instruments. What is clear from this analysis is that the bimodal Chalder Fatigue Scale comes out worst in this regard.

      Two of the authors of the current study should have been "intimately" aware of this problem as they were involved in one [2] of the two studies examined by Stouten [1] that used the 11-item bimodal Chalder Fatigue Scale. Here is the data from that study[2]: Baseline assessment for four intervention groups: Mean (95% Confidence Interval): 10.6 (10.4 to 10.9); 10.4 (10.0 to 10.7); 9.9 (9.2 to 10.6); 10.2 (9.9 to 10.6).

      In percentage terms, this means that the lower bounds for the number of items with the maximum score for intervention groups were: 96%;95%;90%;93%. One can also calculate a lower bound for the percentage of patients who scored a maximum of 11 out of 11 for the items in the four intervention groups: 60%; 40%; 0%; 20%.

      It should be remembered that these are lower bounds and the actual figure is likely to be higher (unless the authors give this data one can't calculate it from the mean). This can be illustrated by calculating the lower bound for the percentage of maximum (11 out of 11) scores for one study of an outpatient clinic in London[3] and comparing it to the actually percentage with the maximum score that was given. The Mean Score on the 11-item bimodal Chalder Fatigue Scale was 9.9. This translates to a lower bound for the percentage of patients who scored a maximum of 11 out of 11 of 0% (this could be achieved, for example, by 90% of the patients scoring 10/11 and 10% scoring 9/11). However the actual percentage of patients who scored the maximum (11/11) was 58%.

      This shows that the 11-item bimodal Chalder Fatigue Scale doesn't just have a low ceiling for each individual question but also for the total score when applied to Chronic Fatigue Syndrome patients. Why is this important? Well, as the authors point out, some surveys of patient groups have found patients reporting being made worse by interventions such as Graded Exercise Therapy and Cognitive Behavioural Therapy (CBT).

      For example, the results of a large survey with 2338 respondents were published in a report for the Chief Medical Officer[4]: it found that, of 285 who had done Cognitive Behavioural Therapy, 26% reported being made worse by the program, compared to 7% who said they were helped and 67% who said it made no difference. Of 1214 people who had done a graded exercise program, 50% had been been made worse by it (compared to 34% who said it helped and 16% who said it made no difference).These are not once-off results. For example, a recently published report of 2763 patients with ME or CFS in the UK[5] which asked about people's experiences of treatments over the last three years, found that of 699 who said they'd tried Graded Exercise Therapy, 34% said they'd been made worse by it compared to 45% who said they'd been helped and 21% who said it made no difference. The contention that people would not have being made worse by a treatment if they had done the treatment under specialist supervision, is not backed up by the data from this study[5]. Patients were asked who provided the GET treatment. Of the 567 who answered this question, 181 (31.92%) said it had made them worse compared to 276 (48.68%) who said it helped and 110 (19.40%) who said it made no difference; these are very similar percentages to the subgroup of 335 patients who had done the management strategy under an "NHS specialist": 111 (31.27%) of this group said they'd been made worse compared to 162 (45.63%) who said they'd been helped and 82 (23.10%) who said it made no difference. Again these don't appear to be once-off figures. In 2003, Action for ME did a smaller survey of 550 members asking about their experiences of Treatments[6]. 354 (64%) replied. The numbers for this study were small but if you combined the data from those who had done GET under a Physiotherapist, Occupational Therapist, Doctor or Behavioural Therapist, the results are: Negative 22 (56.41%) Neutral 2 (5.13%) Positive 15 (38.46%). [These don't compare favorably to the small group who did GET under no professional: Negative 1 (8.33%), Neutral 4 (33%) and Positive 7 (58%)]. A large percentage of the patients also reported being made by made worse by CBT in this study. Of 55 who had done CBT under a CBT Therapist/psychologist, Doctor/Psychiatrist, CPN/Other Mental Health, Counsellor/Psychotherapist, OT or Nurse specialist, 19 (34.55%) said it had made them worse compared to 24 (43.64%) who had been helped and 12 (21.82%) who said it made no difference.

      The reason this is important is that if somebody already has a score of 11/11, they can't come up on the 11-item bimodal Chalder Fatigue Scale as being made worse on the treatment. Indeed, once they improved on one item, it would be marked as an improvement overall even if they actually felt worse on one or more of the other 10 items. Of course, this doesn't just apply to patients who score 11 out of 11; a patient could score 10/11 (say), feel worse on several items they'd already scored the maximum but come out as an improver once they improved on one idea. Saying all that, it would be good if the authors reported how many patients in each branch of the study scored the maximum.

      Some of the items on the 11-item Chalder Fatigue Scale may also not be good as a measure of severity of CFS or ME. For example, somebody could be severe but not answer positively to the question, 'do you feel sleepy or drowsy'. Similarly a patient could disimprove and still not answer positively to this question. So a patient who scores 11 may not necessarily be more severely affected on a patient scoring 10. Saying all this, the generally very high scores (i.e. close to 11 on average) found in previous studies in the field suggest that the Likert method (0,1,2,3) of scoring does appear preferable. However it too also suffers from a ceiling effect although not to the same extent[1]. Also as previously pointed out, because of questions such as 'do you feel sleepy or drowsy', (which many if not most would feel are not intrinsic to Chronic Fatigue Syndrome or ME), even the likert version of the Chalder Fatigue Scale is not ideal for measuring severity of the condition.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Oct 19, Richard Kunert commented:

      The central claim of this paper is not supported by the numbers reported in the paper.

      p. 142:

      Participants exhibited the core personality features of psychopathy (Factor 1) to a greater extent than the core behavioral features of psychopathy (Factor 2).

      In contradiction to this central claim of the paper, Factor 2 scores at 7.1 (the behavioural features of psychopathy) are actually higher than the Factor 1 scores at 5.2 (the personality features of psychopathy). The numbers tell the exactly opposite story to the words.

      The numbers are given twice in the paper making a typo unlikely (p. 138 and p. 139). Adjusting the scores for the maxima of the scales that they are from (factor 1 x/xmax = 0.352 < factor 2 x/xmax=0.394) or the sample maximum (factor 1 x/xmaxobtained = 0.433 < factor 2 x/xmaxobtained = 0.44375) makes no difference. No outlier rejection is mentioned in the paper.

      In sum, it appears as if DeMatteo and his co-authors interpret their numbers in a way which makes intuitive sense but which is in direct contradiction to their own data.

      This issue was first raised publicly on Brain's Idea. The first author (DeMatteo) and the editor of the journal (Ewing) have been invited to respond via e-mail on 12/8/2016. Now, more than two months later, there is still no response.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 20, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 20, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jul 29, Noel O'Boyle commented:

      I believe that the description of the structure as cyclo-(D-NMePhe-L-Leu-L-Ile-L-NMeTyr-L-Phe-NMeGly-L-Pro) is incorrect, as the convention is to write the residues from the N terminus to the C terminus. This is a cyclic peptide, and thus missing the terminii, but there is still a directionality from the N of a residue towards its carbonyl.

      In short, to be consistent with the X-ray and structural depiction, I believe that it should be written instead as cyclo-(L-Pro-NMeGly-L-Phe-L-NMeTyr-L-Ile-L-Leu-D-NMePhe).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 14, Robert Eibl commented:

      This was the very first report on VLA-1 / VCAM-1 interactions measured at the single-molecule level with AFM and at the same time between two living mammalian cells. Two later AFM reports on VLA-4/VCAM-1 lack citation and discussion of my original work, although they were clearly induced or even initiated by myself; interestingly, my years of initiating and pioniering such AFM experiments as independent and unpaid guest PI and exclusive sharing of know-how was neither acknowledged, nor cited in related reviews.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      The death of “Mr. Abbott” (*) whose overlooked aortic dissection was misdiagnosed as an acute coronary syndrome, illuminates more than just the demise of the physical examination. It also illustrates Goethe`s precept “What one knows, one sees” (1).

      A patient writhing because of chest pain should immediately be suspected to have aortic dissection (2)(3). Patients with chest discomfort due to coronary events more characteristically lie motionless (3), as noted in older (4), but not newer (5) cardiology textbooks.

      Today`s highly specific imaging and biochemical tests have changed the role of physical examination from hypothesis confirmation to hypothesis generation. However, these tests have not, in the words of Dr. Joseph Bell (the model for Sherlock Holmes), changed the obligation of each physician to know “the features of disease… as precisely as you know the features, the gait, the tricks of manner of your most intimate friend” (3).

      (*) Jauhar S. The demise of the physical exam. N Engl J Med. 2006; 354: 548-551.

      (1) DeGowin RL. DeGowin & DeGowin`s Bedside Diagnostic Examination. 5th ed. New York: Macmillan, 1987; 37.

      (2) Slater EE. Aortic dissection: presentation and diagnosis. In: Doroghazi RM, Slater EE, Aortic Dissection. New York: McGraw-Hill, 1983; 62.

      (3) Sotos JG. Zebra Cards. Philadelphia: American College of Physicians, 1989; page 19 and card HE-011.

      (4) Pasternak RC, Braunwald E, Sobel BE. Acute myocardial infarction. In: Heart Disease. 3rd ed. Braunwald E (ed.). Philadelphia: WB Saunders, 1988; 1235.

      (5) Antman EM, Braunwald E. Acute myocardial infarction. In: Heart Disease. 5th ed. Braunwald E (ed.). Philadelphia: WB Saunders, 1997; 1198.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 01, Raphael Levy commented:

      I have written a blog post where I identify this influential article (cited 5000 times) as one that introduces the (misleading) idea that nanoparticles can "penetrate cell membrane". Comments very much welcome, here or at the blog:

      NANOPARTICLES & CELL MEMBRANES: HISTORY OF A (SCIENCE) FICTION? https://raphazlab.wordpress.com/2016/02/01/nanoparticles-cell-membranes-history-of-a-science-fiction/


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 05, Morten Oksvold commented:

      Please note that this article contains fraudulent data, which was concluded from an investigation by the University of Alabama at Birmingham in 2009 (!):

      http://www.uab.edu/reporterarchive/71570-uab-statement-on-protein-data-bank-issues

      The case was recently discussed at Retraction Watch: http://retractionwatch.com/2016/01/04/nature-retracts-paper-six-years-after-it-was-flagged-for-fraud/

      PNAS was informed about this case in 2009, but as far as I can see there has still not been published any retraction. In light of the fact that this single article has been cited more than 40 times since 2009, and all the wasted work and resources, correction of the literature is highly important.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Oct 27, Peter Gøtzsche commented:

      This review concludes that, “The three cholinesterase inhibitors are efficacious for mild to moderate Alzheimer’s disease.” I believe these drugs don’t work. The improvement in cognitive function was 2.7 points, in the midrange of a 70-point scale. This is less than the 4 points the FDA considers the minimally relevant clinical chan¬ge (1). We can also compare with the smallest effect that can be per¬ceived on the Hamilton scale for depression, which is 5-6 (2), although the maximum on this scale is only 52.

      The placebo controlled trials have not been effectively blinded, as cholinesterase inhibitors have conspicuous side effect. This lack of blinding can in itself easily have caused the very minor effect that was noted in the trials (3).

      A long-term trial of 565 patients with mild to moderate Alz¬heimer’s disease that compared donepezil with placebo found no meaningful effects whatsoever, and the authors concluded that do¬nepezil isn’t cost-effective, with benefits below minimally relevant thresholds (4). In contrast to other trials, it was publicly funded. This trial was excluded from the Cochrane review, for no good reason, as far as I can see. The outcomes after three years were similar on drug and placebo with respect to institutionalisation, progression of disability, and behavioural and psychological symptoms.

      The author of the Cochrane review wrote that “donepezil appears to have no serious or common side effects.” This sentence is highly misleading. The harms are both common and serious, and she documents in her review that 29% of the patients left the drug group on account of adverse events, as compared to only 18% in the placebo groups. The most common side effects of donepezil are nausea, diarrhoea, not sleeping well, vomiting, muscle cramps, feeling tired, and not wanting to eat. I believe this is not what we would want for an old person who might already have problems with not sleeping well, feeling tired, and not wanting to eat.

      The list of frequent side effects in Pfizer’s product information for Aricept (donepezil) is very long (5). Hypotension and syncope occurs in more than 1% and when old people fall, there is a considerable risk that they break their hip and die. A large Canadian cohort study showed that people who took anti-dementia drugs had almost a doubled risk of hospitalisation for syncope compared to demented people who didn’t take these drugs, and they had more pacemakers inserted and more hip fractures (6). Most astonishingly, more than half the patients who were admitted to hospital for bradycardia were retreated with the drug.

      There are many good reasons not to use anti-dementia drugs.

      1 Molnar FJ, Man-Son-Hing M, Fergusson D. Systematic review of measures of clinical significance employed in randomized controlled trials of drugs for de¬mentia. J Am Geriatr Soc 2009;57:536-46.

      2 Leucht S, Fennema H, Engel R, et al. What does the HAMD mean? J Affect Disord 2013;148:243-8.

      3 Gøtzsche PC. Deadly psychiatry and organised denial. Copenhagen: People’s Press; 2015.

      4 Courtney C, Farrell D, Gray R, et al. Long-term donepezil treatment in 565 patients with Alzheimer’s disease (AD2000): randomised double-blind trial. Lancet 2004;363:2105-15.

      5 ARICEPT ® (donepezil hydrochloride) tablets. http://labeling.pfizer.com/ShowLabeling.aspx?id=510.

      6 Syncope with cholinesterase inhibitors. Rev Prescrire 2011;31:434.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 20, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 08, Alexander Kraev commented:

      Please note that this is a peculiar case of retraction, since while there are indeed problems with certain images, the authors stated the following in the retraction notice: "Nevertheless, although we feel that the scientific conclusions of the paper (that loss of NNT impairs insulin secretion and impairs glucose tolerance in C57BL/6J mice) still stand, given the conclusion of scientific misconduct against the first author, the authors think the most responsible course is to retract the paper." It is important to understand that nuance especially in view that thousands of publications state that they used "C57BL6" without making a crucial distinction between C57BL/6J and C57BL/6N.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 12, EDWARD BERRY commented:

      The structure of the 3NPA-Arg adduct proposed here has been confirmed in the case of E. coli fumarate reductase, and a mechanism for its formation has been proposed, by Tomasiak et al. (J Biol Chem. 2011 286:3047-56) Pubmed ID 21098488 . Correction: The heterocyclic ring of carboxin is modeled with the wrong orientation in 2fbw, shown in Figure 6 here. Ruprecht et al.(J Biol Chem. 2009 284:29836-46) PMID 19710024. have deposited a corrected structure as 2wqy. The original authors agree with this correction as indicated here. Edward A. Berry 21:52, 21 May 2014 (IDT)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jul 21, Tom Kindlon commented:

      Another study raises serious questions about the use of the role emotional subscale of the SF-36 in the diagnosis of CFS

      A CDC group (Reeves et al (2005)) proposed a way to operationalise chronic fatigue syndrome (CFS) criteria including subscales of the SF-36[1,2]: "We defined substantial reduction in occupational, educational, social, or recreational activities as scores lower than the 25th percentile of published US population [] on the physical function (≤ 70), or role physical (≤ 50), or social function (≤ 75), or role emotional (≤ 66.7) subscales of the SF-36." This method has been used in numerous subsequent CDC CFS studies but not by external groups, apart from Leonard Jason and colleagues who have examined the effect of this operationalisation of the criteria.

      A newly published study looked at using the SF 36 subscales to define reduced activity in CFS (and ME)[3]. Six of the 8 subscales (Physical Functioning, Role-Physical, Bodily Pain, General Health, Vitality and Social Functioning) correlated with the sum of current hours of activity. Two subscales did not correlate (Role-Emotional and Mental Health).

      The same 6 subscales (negatively) correlated with percentage reduction in the total hours of activity. Again, two subscales did not correlate (Role-Emotional and Mental Health).

      Also, a "ROC analysis was used to assess which of the SF-36 subscales best discriminated between patients with ME and CFS and healthy controls. The ROC analysis used a plot of sensitivity versus 1-specificity for scores on the SF-36. The area under the curve (AUC) assessed the degree to which each subscale was able to discriminate between patients and controls. The closer the AUC is to 1, the better discriminatory power that SF-36 subscale has." The same 6 subscales (Physical Functioning, Role-Physical, Bodily Pain, General Health, Vitality and Social Functioning) had AUCs of 0.89 or better. By comparison, the Mental Health Functioning subscale had a AUC of 0.59. The AUC for the Role Emotional subscale was even worse at 0.47.

      Each of these results demonstrates that the Role Emotional subscale is not suitable to be used to operationalise criteria for CFS.

      References:

      [1] Reeves WC, Wagner D, Risenbaum R, et al. Chronic fatigue syndrome – a clinically empirical approach to its definition and study. BMC Med. 2005;3(19):1–9.

      [2] Ware JE, Sherbourne CD. The MOS 36-item short-form health survey (SF-36): conceptual framework and item selection. Med Care. 1992;30:473–483

      [3] Thorpe T, McManimen S, Gleason K, Stoothoff J, Newton J, Strand EB, Jason LA (2016). Assessing current functioning as a measure of significant reduction in activity level. Fatigue: Biomedicine, Health & Behavior. Published online: 19 Jul 2016 doi: 10.1080/21641846.2016.1206176


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Feb 28, Tom Kindlon commented:

      Using two MFI scales ("General Fatigue" or "Reduced Activity") to ensure patients satisfying the definition have "severe fatigue"

      (This was originally posted here http://www.biomedcentral.com/1741-7015/3/19/comments#304567 but the formatting has gone from that page)

      Initially when I read this paper, where it says "we defined severe fatigue as >= medians of the MFI general fatigue (>=13) or reduced activity (>=10) scales", I thought this referred to medians of the general population.Hearing other people commenting on it, that's how some other people have been interpreting it also. It is probably somewhat natural to do this as the sentence before reads: "We defined substantial reduction in occupational, educational, social, or recreational activities as scores lower than the 25th percentile of published US population [11] on the physical function (<=70), or role physical (<=50), or social function (<=75), or role emotional (<=66.7) subscales of the SF-36."

      However from looking at the scores for controls in other papers, these MFI scores do not look like medians for the whole US population but in fact are medians for this particular group of patients. This seems a strange way to set cut-off points for a CFS definition that is used for numerous studies into the illness, given the cohort that is being used as a basis: "This population-based case control study enrolled 227 adults identified from the population of Wichita with: (1) CFS (n = 58); (2) non-fatigued controls matched to CFS on sex, race, age and body mass index (n = 55); (3) persons with medically unexplained fatigue not CFS, which we term ISF (n = 59); (4) CFS accompanied by melancholic depression (n = 27); and (5) ISF plus melancholic depression (n= 28)." i.e. this is not a random sample of the US population but a group of people selected for a specific purpose (or purposes) (not necessarily to design a definition, but as a follow-up study of people previously diagnosed with CFS or given some other label).

      Some of the groups are of different sizes - if the relative size of these groups had been changed, with relatively more people taken from some classification groups and less people taken from other groups, the median scores would likely have been different.

      It should also be remembered that in this context the categories listed in the last paragraph refer to their classification when they evaluated years before (from 1997 to 2000), and not necessarily at the time when they were evaluated in this study (December 2002 to July 2003) (as is clear from the tables in this paper).

      I thought it would be interesting to look at MFI scores in some other papers on CFS that did not use the "empirical definition".

      I don't claim this is a definitive list but, at the same time, mean MFI scores with standard deviations only seem to be listed in a small percentage of papers. The papers use cohorts from a variety of locations: England [3], The Netherlands [4], Germany [5] and the USA (New Jersey) [6]. I did not see any ranges given which would be useful given the task at hand (selecting cut-off points for a definition).Unfortunately not all of the papers I found used the Fukuda [1] definition for CFS; some also used the Sharpe [2] definition for CFS. I indicate which definition is used in each case.

      MFI: General Fatigue (i) Sample/(ii) Sample Size/(iii) Mean/(iv) SD/ (v) (Mean - 13)/SD/ (vi) Definition

      Weatherley-Jones [3] 53 18.4 1.7 3.176470588 Sharpe (1991)

      Vermeulen (Group 1) [4] 30 18.6 1.9 2.947368421 Fukuda (1994)

      Vermeulen (Group 2) [4] 30 18.4 1.8 3 Fukuda (1994)

      Vermeulen (Group 3) [4] 30 19.1 1.4 4.357142857 Fukuda (1994)

      Gaab [5] 21 17.7 0.5 9.4 Sharpe (1991) and Fukuda (1994)

      Brimacombe [6] 65 18.41 2.02 2.678217822 Fukuda (1994)Combining these give a sample of 229 patients with a mean "General Fatigue" score of 18.45655022.

      This data suggests that a threshold of >=13 will have a very very high sensitivity. This would suggest that another measure would not be necessary (unless it was being used as an extra criterion to increase the specificity, which isn't done with this definition).

      However for completeness, I'm including the "Reduced Activity" data from the same papers:Reduced activity (MFI) (i) Sample / (ii) Sample Size / (iii) Mean Score / (iv) SE (v) (Mean-10)/SD (vi) Definition

      Weatherley-Jones [3] 53 16.1 3.1 1.967741935 Sharpe(1991)

      Gaab [5] 21 15 0.7 8.714285714 Sharpe (1991) and Fukuda(1994)

      Brimacombe [6] 65 15.93 4.55 1.340659341 Fukuda 1994

      Combining these give a sample of 139 patients with a mean Reduced Activity score of 15.85431655.

      Note: the Vermeulen paper[4] did not collect the MFI scores for Reduced Activity, just "the fatigue axes of the Multidimensional Fatigue Inventory" (which they defined as the MFI scores for General fatigue, Physical fatigue, Mental fatigue).

      It seems strange in the definition of Chronic Fatigue Syndrome defined in this paper (i.e. Reeves et al) that the "severe fatigue" criterion can be satisfied by a patient having a low score on a subscale of the MFI testing activity levels (as opposed to one of the 3 subscales measuring fatigue), especially when the function of the SF-36 is to "measure functional impairment". Just because someone is inactive doesn't mean they have severe fatigue. Allowing patients to be included if they simply have a "Reduced Activity" score of 10 or more (without necessarily having a low score on one of the fatigue axes of the MFI) risks reducing the specificity of the definition.

      References:

      [1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.

      [2] Sharpe MC, Archard LC, Banatvala JE, Borysiewicz LK, Clare AW, David A, Edwards RH, Hawton KE, Lambert HP, Lane RJ, et al. A report--chronic fatigue syndrome: guidelines for research. J R Soc Med. 1991 Feb;84(2):118-21.

      [3] Weatherley-Jones, E., Nicholl, JP., Thomas, KJ., Parry, GJ., McKendrick, MW., Green, ST., Stanley, PJ and Lynch, SPJ. A randomised, controlled, triple-blind trial of the efficacy of homeopathic treatment for chronic fatigue syndrome. Journal of Psychosomatic Research, 2004, 56, 2, 189-197.

      [4] Vermeulen, RCW and Scholte, HR. Exploratory open label, randomized study of acetyl- and propionylcarnitine in chronic fatigue syndrome. Psychosomatic Medicine, 2004, 66, 276-282.

      [5] Gaab J, Hüster D, Peisen R, Engert V, Heitz V, Schad T, Schürmeyer TH, Ehlert U. Hypothalamic-pituitary-adrenal axis reactivity in chronic fatigue syndrome and health under psychological, physiological, and pharmacological stimulation.Psychosom Med. 2002 Nov-Dec;64(6):951-62.

      [6] Brimacombe, Michael; Lange, Gudrun; Bisuchio, Kim; Ciccone, Donald S.; Natelson, Benjamin. Cognitive Function Index for Patients with Chronic Fatigue Syndrome Journal of Chronic Fatigue Syndrome, 2004, vol 12; number 4, pages 3-24


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2014 Feb 28, Tom Kindlon commented:

      Why is this definition being referred to as an "empirical definition"?

      (This was originally posted here http://www.biomedcentral.com/1741-7015/3/19/comments#301566 but the formatting has gone from that page)

      I believe most people's understanding of "empirical criteria" or an "empirical definition" would be that the data would speak for itself; it "would decide" the cut-off points through methods such as cluster analysis (for example).

      Indeed this would seem to have been William Reeves' understanding of an empirical definition. For example, in a presentation on the CDC's CFS research program (to a Task Force Meeting on the Epidemiology of Interstitial Cystitis)[1], he said: "The problem with the CFS criteria was that they were not specific enough and not empiric-based. For example, one of the criteria stated that the research subject must have at least four of eight symptoms, among them, impaired concentration or memory and postexertional worsening of physical or mental fatigue. "The accompanying symptoms need to be defined in and of themselves," Dr. Reeves said.

      The 1994 International Study Group also hypothesized that fatigue led to patients' symptoms rather than the reverse. The CDC is currently conducting population studies to develop an empiric definition of CFS that is based on statistical modeling."At the inaugural meeting of the US Department of Health and Human Services' Chronic Fatigue Syndrome Advisory Committee (CFSAC), Dr Reeves said the CDC team of research would "derive an empirical case definition based on data".[2]

      The definition presented here does not seem to have been based either on "statistical modeling" or "data". It seems to involve relatively arbitrary cut-off points; for example, of the 8 subscales of the SF-36, four are chosen and, for each of these, the 25th percentile of the published US population is chosen as a cut-off point. A patient is required to be in the bottom quartile for just one of these subscales to satisfy the criteria. Where did this cut-off point come from? There is no mention of it in the paper that suggested the use of the SF-36[3]; nor is there any mention that these particular subscales should be chosen or that one would be sufficient. One of the authors of the paper[3] has confirmed that cut-off points were never chosen nor was it decided which sub-scales would be used.

      Given that the CDC's definition of CFS tends to go on to be used in numerous studies, would it not be better to investigate which thresholds give a "better" definition e.g. with a higher specificity and sensitivity - for example, for some of the SF-36 subscales, perhaps (say) the 13th, 15th, 20th or even 30th percentiles may be more appropriate.

      The cut-off points suggested in this paper may or may not be useful. But is it really accurate to suggest that they are "empirically" derived?

      References:

      [1] Epidemiology of Interstitial Cystitis - Executive Committee Summary and Task Force Meeting Report October 29th, 2003. http://www.niddk.nih.gov/fund/reports/ic/task_force_summary.pdf

      [2] US Department of Health and Human Services - Chronic Fatigue Syndrome Advisory Committee (CFSAC). Inaugural Meeting. September 29th, 2003Meeting Summary. http://www.hhs.gov/advcomcfs/CSFAC_mins_2003.09.29R.pdf

      [3] Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER, International Chronic Fatigue Syndrome Study Group: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution. BMC Health Services Research 2003, 3:25


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2014 Feb 28, Tom Kindlon commented:

      This may not be a representative group of those who would be diagnosed in a random sample using the "standardized clinically empirical criteria"

      (This was originally posted here http://www.biomedcentral.com/1741-7015/3/19/comments#290587 but the formatting has gone from that page)

      This "empirical" method of operationalizing the CDC 1994 CFS criteria[1] has subsequently been used in a population study[2]. It found a prevalence rate for CFS of 2540 per 100,000 persons 18 to 59 years of age[2].

      This is considerably higher than the prevalence rates found in earlier studies.

      For example, a previous study using this cohort using a "previous" method of operationalizing the CDC 1994 CFS criteria[1] found a prevalence rate of 235 per 100,000[3]. Given the way the cohort in this current study was drawn up, using 58 people who had previously been diagnosed using a "previous" method of operationalizing the CDC 1994 CFS criteria, the group satisfying the new method of operationalizing the CDC 1994 CFS criteria, the "empirical" criteria, in this study may well not be the same sort of people that would show up if the method was used on a random sample of the population. So for example the results in Table 6 may not be similar to the results one can get in a random sample.

      Unfortunately the paper giving the prevalence rate for Georgia[2] does not give the same pieces of information as is in Table 6 in this study. However we do have a paper which uses a group from the Georgia cohort[4]. Table 1 of this study[4] includes similar data. Some of the numbers are somewhat similar. However one that particularly stands out is the Role Emotional score. It was 35.6 (95% CI: 26.3-44.8). That compares to the value in this paper of 55.8+/-42.2.

      Perhaps other data will be published in time. The main point of this comment is to point out or remind people that the data presented in this paper may not be representative of those that would be diagnosed using the empirical criteria.

      References:

      [1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, & Komaroff A. (1994). The chronic fatigue syndrome: A comprehensive approach to its definition and study. Annals of Internal Medicine, 121 (12):953-959. http://www.annals.org/cgi/content/full/121/12/953

      [2] Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Population Health Metrics 2007, 5:5 doi:10.1186/1478-7954-5-5http://www.pophealthmetrics.com/content/5/1/5

      [3] Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N, Minden S, Reeves WC: Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Int Med 2003, 163:1530-1536.

      [4] Nater UM, Maloney E, Boneva RS, Gurbaxani BM, Lin JM, Jones JF, Reeves WC, Heim C. Attenuated Morning Salivary Cortisol Concentrations in a Population-based Study of Persons with Chronic Fatigue Syndrome and Well Controls. J Clin Endocrinol Metab. 2007 Dec 26


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    5. On 2014 Feb 21, Tom Kindlon commented:

      Data from another population study found scores on the RE subscale are similar in CFS patients to those found in healthy controls

      (This was originally posted here http://www.biomedcentral.com/1741-7015/3/19/comments#285575 but the formatting has gone from that page)

      I previously said that I questioned the value of using the Role Emotional (RE) subscale to satisfy functional impairment criteria (http://www.biomedcentral.com/1741-7015/3/19/comments#284561). Researchers deciding whether to follow the method of operationalizing the Fukuda [1] used in this study, might be interested at looking at Table 2 in Jason et al [2].

      The subjects were also obtained from a random-digit population study. Here is what the authors said in the text on this part of the results: "A MANCOVA for the Medical Outcomes Study SF-36 Health Survey (controlling for the effects of work status) revealed significant differences in gradations of disability across the diagnostic categories of CFS only, MCS only, FM only, more than one diagnosis, and no diagnosis on seven of the eight subscales (F(4,208) = 1.82, p < .05). The role-emotional scale was the only scale that did not reveal significant differences between the groups (see Table 2). Significant post hoc tests revealed that individuals with CFS demonstrated greater disability than those with no diagnosis on the role-physical; bodily pain; vitality; and social functioning scales. Individuals with MCS demonstrated greater disability than the no diagnosis group on the physical functioning; role-physical; bodily pain; general health; vitality; social functioning; and mental health scales. Individuals with FM demonstrated greater disability than the no diagnosis group on the physical functioning; role-physical; bodily pain; and social functioning scales. In addition, individuals with more than one diagnosis demonstrated greater disability than those in the no diagnosis group on the physical functioning; role-physical; bodily pain; vitality; and social functioning scales. Means for each of the Medical Outcomes Study subscales are reported in Table 2."

      This issue of how the Fukuda criteria [1] are operationalized is not a trivial matter. Using the previous method of operationalizing the criteria, a CDC team found a prevalence for CFS of 235 per 100,000 [3]. Using the method of operationalizing the criteria outlined in this study, the prevalence rate for CFS was found to be 2.54% or 2540 per 100,000 [4] or 10.81 times the previous prevalence rate!

      References

      [1] Fukuda, K., Straus, S.E., Hickie, I., Sharpe, M.C., Dobbins, J.G., & Komaroff, A. (1994). The chronic fatigue syndrome: A comprehensive approach to its definition and study. Annals of Internal Medicine, 121 (12):953-959. http://www.annals.org/cgi/content/full/121/12/953

      [2] Jason, L.E., Taylor, R.R., & Kennedy, C.L. "Chronic Fatigue Syndrome, Fibromyalgia, and Multiple Chemical Sensitivities in a Community-Based Sample of Persons With Chronic Fatigue Syndrome-Like Symptoms." Psychosomatic Medicine 62:655-663 (2000). http://www.psychosomaticmedicine.org/cgi/reprint/62/5/655

      [3] Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N. Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Intern Med. 2003;163:1530–1536. doi: 10.1001/archinte.163.13.1530.

      [4] Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Population Health Metrics 2007, 5:5 doi:10.1186/1478-7954-5-5


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    6. On 2014 Feb 21, Tom Kindlon commented:

      MDDm should be resolved for more than 5 years before a CFS diagnosis can be given

      (This was originally posted here http://www.biomedcentral.com/1741-7015/3/19/comments#285572 but the formatting has gone from that page)

      In this paper, it says: "Following recommendations of the International CFS Study Group, only current MDDm was considered exclusionary for CFS." However, part of the specific recommendations of the International CFS Study Group [1] was that MDDm had to have been resolved for more than 5 years: "The 1994 case definition stated that any past or current diagnosis of major depressive disorder with psychotic or melancholic features, anorexia nervosa, or bulimia permanently excluded a subject from the classification of CFS ... we now recommend that if these conditions have been resolved for more than 5 years before the onset of the current chronically fatiguing illness, they should not be considered exclusionary." It might not be important to point this out for definitions for some illnesses: however if one looks at table 2, 6 of the 16 who are said to have CFS using the "current classification" of CFS, had been diagnosed with MDDm at a previous assessment which suggests it is important in this context.

      Reference:

      [1] Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER, International Chronic Fatigue Syndrome Study Group: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution.BMC Health Services Research 2003, 3:25. http://dx.doi.org/10.1186/1472-6963-3-25


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 15, George McNamara commented:

      The direct link to the supplemental files is http://bloodjournal.hematologylibrary.org/content/107/7/2643/suppl/DC1 The supplemental files includes two movies. My rule of thumb is you should make popcorn before watching movies.

      An additional movie from this project is available at http://works.bepress.com/gmcnamara/21/ Shows a triplet cell division. That is, a cell that divided three ways. I have discussed this with other researchers, a few of whom have observed triplet cell divisions as well.

      Several of the authors have moved from City of Hope - Mike Jensen is in Seattle. I am with Laurence Cooper at M.D. Anderson Cancer Center in Houston.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 14, GEORGE ANDERSON commented:

      The paper that Dr. Carter comments on should have been retracted 9 years ago. The urinary oxytocin (and AVP) data that provide the foundation of the research are fundamentally flawed, with the reported values being approximately one million times higher than prior (and subsequent) reports (see Anderson GM. Report of altered urinary oxytocin and AVP excretion in neglected orphans should be reconsidered. Journal of Autism and Developmental Disorders, 36:829-30, 2006). This was NOT due to a simple error in calculation or a misplaced decimal points. Rather, the analytical method used was non-specific. At the time, the authors defended their results as accurate and even provided some mass spectral data purporting to show that they were indeed measuring correct amounts of urinary oxytocin. In more recent research they have used a more specific method and now obtain results consistent with all other published work. However, they continue to reference this paper without mentioning the huge discrepancy. The paper and any of its conclusions should be disregarded. Just as regretable as the continued presence in the literature and continued citing of this misleading research is the fact that the editiorial board of PNAS has not seen fit to perform the retraction which is a necessary part of self-correcting science. This latter fact reflects very poorly on all papers published in PNAS as there does not seem to be any standard or threshold for retraction; the low quality of review that the paper received in the first place is also not reassuring when considering how much credence to give PNAS papers.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 19, Morten Oksvold commented:

      Please note that this article has been retracted and should therefore not be cited in the future:

      "The above article and associated erratum, published online on 11 November 2005 and 6 February 2014, respectively, in Wiley Online Library (wileyonlinelibrary.com), have been retracted by agreement between the authors, the journal Editor-in-Chief, Professor Peter Lichter, and Wiley Periodicals, Inc. In addition to what was corrected in the erratum, a university investigation involving the first and the corresponding author determined that several figures in this paper were re-used, mislabeled, manipulated, or duplicated while processing/compiling the final figures assembled from the original data sources. Therefore, the authors are retracting the paper in its entirety although they maintain that these issues did not affect the major conclusions. They apologize for any inconvenience this may have caused".

      Link: http://onlinelibrary.wiley.com/doi/10.1002/ijc.30267/full


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Nov 18, Diana Petitti commented:

      Reviewing articles about vitamin D and falls, I discovered that, while the abstract states that this was a randomized, placebo-controlled trials of vitamin D to prevent falls, all subjects were prescribed 600 mg of elemental calcium in the form of calcium carbonate (p. 1182). Thus, the trial was a randomized trial of vitamin D plus calcium versus calcium alone.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jan 05, Pablo Tamayo commented:

      A key aspect of the Gene Set Enrichment Analysis (GSEA) approach is the preservation of gene-gene dependency in estimating the significance of enrichment (i.e., coordinate expression) of a set of genes. Because we know that genes are not independent variables, modeling dependencies as done by GSEA better mirrors the underlying biology of the systems we seek to study. While simpler statistical tests may reduce computational complexity, they do so at the expense of making unrealistic assumptions not supported by the data. In our response (http://www.ncbi.nlm.nih.gov/pubmed/23070592) to the claims in http://www.ncbi.nlm.nih.gov/pubmed/20048385 we carefully considered the assumptions of the proposed “simplified” SEA method and its results. This included a comparative analysis on a large collection of 50 benchmarks. By randomizing phenotypes, we showed that gene-gene correlations produce significant variance inflation in SEA results, which in turn produce very high false positive rates and inflated p- and q-values, while GSEA does not. These results provide strong empirical evidence that gene-gene correlations cannot be ignored and agree with the extensive literature providing theoretical or empirical evidence against the gene independence assumption. See, e.g., https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3091509/ https://www.ncbi.nlm.nih.gov/pubmed/16646853 https://www.ncbi.nlm.nih.gov/pubmed/17303618


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2013 Jun 28, Rafael Irizarry commented:

      I agree with Rob that this is an important paper. The idea of analyzing differential expression for groups of genes, as opposed to individual genes, was an important step forward in the analysis of gene expression data. In one of the papers Rob links to we point out that the method would have worked just as well (or perhaps better) using simple (existing) statistical tests rather than the novel versions of the KS-test presented in the paper. Examples of some of these simpler tests are implemented in the Bioconductor limma package. The critique is not just about power, but about interpretability and ease of implementation. But these critiques should not take away from the important contribution made by this paper.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2013 Jun 16, Robert Tibshirani commented:

      This is an important paper, one that introduced the idea of analyzing the differential expression of groups of genes, rather than individual genes. The advantage is both in power and interpretability. Importantly, this group has also created and curated an impressive collection of gene sets for this purpose. See http://www.broadinstitute.org/gsea/index.jsp

      The particular test here- the KS statistic- has been criticized for lack of power and alternatives have been suggested (see eg http://arxiv.org/pdf/math/0610667.pdf and http://www.ncbi.nlm.nih.gov/pubmed/20048385.

      A response to the latter is in http://www.ncbi.nlm.nih.gov/pubmed/23070592


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 09, Tom Kindlon commented:

      Will the CDC CFS Research team (and other teams) please now look at enteroviruses in CFS

      (This was originally accepted as a comment here: http://www.biomedcentral.com/1471-2334/5/78/comments in 2007. However, the formatting has been removed meaning few may read it there. Also, many people may not read the paper on the biomedcentral site and thus not see the comment there)

      Not for the first time [1-2], a CDC-funded research team produces a paper on CFS which has a title which mentions a lack of an association with a particular infection[3]. It would be good if some of the CDC's (not inconsiderable) CFS research budget could be used to investigate enteroviruses in CFS.

      Earlier this year a study involving enteroviruses[4] resulted in much excitement in the media on the subject. It found, in a sample of CFS patients who had gastrointestinal symptoms, that 135/165 (82%) biopsies stained positive for VP1 within parietal cells, whereas 7/34 (20%) of the controls stained positive (p=<0.001). Earlier studies have demonstrated circulating antigen of enterovirus, raised antibody titres and viral RNA in the blood and muscle biopsy specimens of patients with CFS[4-8].

      John Chia does recognize that other infections could be playing a part in some CFS cases but enteroviruses are by far the most common infection he is finding in his clinic in California[9].

      References:

      [1] Gelman JH, Unger ER, Mawle AC, Nisenbaum R, Reeves WC: Chronic fatigue syndrome is not associated with expression of endogenous retroviral p15E. Molec Diagnosis 2000, 5:155-156.

      [2] Vernon SD, Shukla S, Reeves WC: Absence of Mycoplasma species DNA in chronic fatigue syndrome. J Med Microbiol 2003, 52:1027-1028.

      [3] Jones JF, Kulkarni PS, Butera ST, Reeves WC: GB virus-C--a virus without a disease: we cannot give it chronic fatigue syndrome. Jones JF, Kulkarni PS, Butera ST, Reeves WC. BMC Infect Dis 2005, 5:78

      [4] Yousef GE, Mann GF, Smith DF, et al: Chronic enterovirus infection in patients with postviral fatigue syndrome. Lancet 1988;1:146-7.

      [5] Cunningham L, Bowles NE, Lane RJM, et al: Persistence of enteroviral RNA in chronic fatigue syndrome is associated with abnormal production of equal amounts of positive and negative strands of enteroviral RNA. J Gen Virol 1990;71:1399-402.

      [6] Galbraith DN, Nairn C, Clements GB: Phylogenetic analysis of short enteroviral sequences from patients with chronic fatigue syndrome. J Gen Virol 1995;76:1701-7.

      [7] Lane RJ, Soteriou BA, Zhang H, et al: Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry 2003;74:1382-6.

      [8] Douche-Aourik F, Berlier W, Fe´asson L, et al: Detection of enterovirus to human skeletal muscle from patients with chronic inflammatory muscle disease or fibromyalgia and healthy subjects. J Med Virol 2003;71:540-7.

      [9] Chia JK, Chia A: Diverse etiologies for the chronic fatigue syndrome. Clin Infect Dis 2003;36:671-2.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Mar 16, Donald Forsdyke commented:

      Concluding that this paper showed, if anything, the very opposite of what was claimed, a commentary on this paper was submitted to Bioinformatics in 2005, but was declined for publication. The paper and correspondence with the authors was placed online (2006) at: http://post.queensu.ca/~forsdyke/bioinfo9.htm, and various updates have since been added.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 May 13, Richard E Harris commented:

      The sample size in this study was based on a power calculation using results from the Deluze et al. 1992 study as an estimate of effect size. This was the only publication using acupuncture in fibromyalgia at that time. Our power analysis indicated that we would need 30 participants (per group) to detect a 30% difference between groups at a significance level of 0.05. We enrolled from 27 to 30 per arm suggesting we had significant power to test our hypotheses.

      Regarding the drop out rate of 33%, we performed an Intention To Treat analysis which controls for some effects of drop outs. Also there was no significant difference in drop outs (or treatments received) between study arms. These make it unlikely that our results were influenced by dropouts.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 07, Randy Blakely commented:

      In this paper, the authors report an inability of an hDAT E602G mutant to transport DA or to reach the cell surface. The findings are at odds with a study from my lab (Expression studies of naturally occurring human dopamine transporter variants identifies a novel state of transporter inactivation associated with Val382Ala. Mazei-Robison MS, Blakely RD. Neuropharmacology. 2005 Nov;49(6):737-49). Although the impact of the E602G mutation warrants further analysis, discussions with Drs. Horschitz and Schloss lead to retraction of the Horschitz et al paper As the authors note in their retraction (S Horschitz, R Hummerich, T Lau, M Rietschel & P Schloss Molecular Psychiatry 11, 704-704, 27 June 2006):

      "Mazei-Robison and Blakely have published in Neuropharmacology (2005) 49, 737–749, a characterization of several naturally occurring mutants of hDAT. In contrast to our data, in their study the E602G mutant was fully active and comparable to wild-type hDAT. In order to elucidate these contradictory results, both our labs exchanged the mutant cDNAs and re-analysed the properties of the E602G mutant. Uptake experiments in both labs with HEK 293 transiently transfected with both cDNA plasmids revealed transport activity of the E602G mutant comparable to wild-type hDAT. Thus, our conclusion published in Molecular Psychiatry (2005) 10, 1104–1109 is wrong and has to be withdrawn at this point of time."

      Since the original Horschitz et al report continues to be cited inappropriately as support for a role for altered DAT (or DA signaling) in BPD, I am hoping the PubMed Commons forum will provide a suitable opportunity to redirect readers attention to the, as yet, unknown properties of the E602G mutation that may include alterations in roles of the hDAT C-terminus (membrane trafficking, interactions with regulatory proteins, DA efflux, e.g. Calmodulin kinase II interacts with the dopamine transporter C terminus to regulate amphetamine-induced reverse transport. Fog JU, Khoshbouei H, Holy M, Owens WA, Vaegter CB, Sen N, Nikandrova Y, Bowton E, McMahon DG, Colbran RJ, Daws LC, Sitte HH, Javitch JA, Galli A, Gether U. Neuron. 2006 Aug 17;51(4):417-29; Attention deficit/hyperactivity disorder-derived coding variation in the dopamine transporter disrupts microdomain targeting and trafficking regulation. Sakrikar D, Mazei-Robison MS, Mergy MA, Richtand NW, Han Q, Hamilton PJ, Bowton E, Galli A, Veenstra-Vanderweele J, Gill M, Blakely RD. J Neurosci. 2012 Apr 18;32(16):5385-97. doi: 10.1523/JNEUROSCI.6033-11.2012. Erratum in: J Neurosci. 2012 Oct 31;32(44):15643).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 05, Morten Oksvold commented:

      Please not that this article contains fraudulent data, which was concluded from an investigation by the University of Alabama at Birmingham in 2009 (!):

      http://www.uab.edu/reporterarchive/71570-uab-statement-on-protein-data-bank-issues

      The case was recently discussed at Retraction Watch: http://retractionwatch.com/2016/01/04/nature-retracts-paper-six-years-after-it-was-flagged-for-fraud/

      Biochemistry was informed about this case in 2009, but as far as I can see there has still not been published any retraction.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Mar 07, Preben Berthelsen commented:

      A foregone conclusion.

      The result of this investigation was a dead certainty even before it was conducted. The authors initiating PAC guided therapy 18 hours after the critically ill patients were admitted to intensive care units. This delay in the deployment of the PAC makes it extremely unlikely that PAC guided therapy would influence the mortality rate; it is like shutting the stable door after the horse has bolted. This study does not inform on the timely use of the pulmonary artery catheter.

      The primary sample size calculation stipulated that 5673 patients were needed to demonstrate a 5% reduction in mortality. Due to slow recruitment, the primary endpoint was changed to a 10% reduction - 1281 patients were then required. In the end, the authors report the results from 1014 patients.

      The principal clinical investigator/corresponding author M. Singer “does consultancy work for, and receives research funds from Deltex Medical, manufacturers of the CardioQ oesophageal Doppler device.”

      Preben G. Berthelsen MD

      Charlottenlund, Denmark


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 19, E M Martínez-Cáceres commented:

      In the light of the recent PubMed comment by Morten Oksvold, the referenced research study was performed entirely in our research centre by the research team led by Dr. Martínez-Cáceres at the time with Dr. Espejo as predoctoral researcher. Hence, the EAE in vivo experiments were performed in Barcelona with no involvement from Dr. Penkowa, who was engaged as an expert histopathologist. Dr. Penkowa received processed and encoded samples with which she performed some of the histopathological studies. The results were returned to us for overall analysis and submission for publication. It was agreed that Dr. Penkowa would be co-author of the published work.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Feb 01, Morten Oksvold commented:

      Please note that this article is 1 out of 15 publications for which an independent investigation initiated by the University of Copenhagen has found suspicion of scientific dishonesty. The conclusion from the report was published July 23, 2012:

      http://news.ku.dk/all_news/2012/2012.8/indications_of_fraud_in_penkowas_early_research/

      This articles should therefore not be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 29, David Mage commented:

      In the introduction the authors write: "the peak incidence of SIDS coincides with the nadir in the physiologic anaemia of infancy (PAI)." This nadir is defined as the minimum in total (T) hemoglobin (Hb)(g/dL) vs age as the infant's fetal hemoglobin (HbF) is replaced by adult hemoglobin (HbA). This gives the relation as follows: THb = HbA + HbF, where HbF decreases with age and HbA increases with age. Differentiating the equation with respect to time t since birth we obtain the relation d(THb)/dt = d(HbA)/dt + d(HbF)/dt. That is, the nadir is the point in time when the increase in HbA plus the decrease in HbF equals 0.

      However, because HbF holds oxygen more tightly than HbA does, the available oxygen (AO2) to the tissues from the blood will also have a minimum during the period between birth and the nadir in PAI. This can be seen because when the increase in HbA is equal and opposite to the decrease in HbF, d(AO2)/dt is greater than zero so the nadir in AO2 must occur earlier than the nadir in PAI.

      Of course this time differential between the nadirs will be a function of gestational age and the time interval between birth and cord clamping, that relates to the placental transfusion from mother to infant that increases the infant THb.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Nov 20, Morten Oksvold commented:

      An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

      This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

      http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

      This article should therefore no longer be cited.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 08, Mark Gijzen commented:

      New results published by others (PMCID: PMC3718677 and Morais JK, 2010) have led us to revise our hypothesis regarding the cross-reactivity of the SC24 antibody. Instead of cross-reactivity with the seed coat peroxidase, it is more likely that the antibody simply cross-reacts with the newly discovered soybean toxin SBTX, since SC24 and SBTX share sequence similarity. Our purified sample of peroxidase enzyme likely contained SBTX, since these two proteins are of the same size, 44 kD.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 23, Hilda Bastian commented:

      The conclusions of this paper (Ioannidis JP, 2005) were challenged by Goodman and Greenfield in 2007 (and responded to by Ioannidis JP, 2007). They were also challenged by Jager and Leek (Jager LR, 2014). Those authors conclude, using a different analytical approach (false discovery rate), that the literature reliably charts scientific progress. Ioannidis then responds to this discussion, challenging the data and analytical approach here: (Ioannidis JP, 2014). (I discuss this debate in a blog post.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Feb 02, Tom Kindlon commented:

      Observations on apparent changes in methods of assessing symptoms

      (This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).

      I notice that the "Symptom Inventory collects information about the presence, frequency, and intensity of .. symptoms during the month preceding the interview". However the Fukuda et al '94 definition [1] is supposed to look for "the concurrent occurrence of four or more of the following symptoms, all of which must have persisted or recurred during 6 or more consecutive months of illness and must not have predated the fatigue".

      Was there a particular reason why a time frame of one month was chosen? This would suggest that relatively short-lived symptoms would be counted. If the reasoning was that asking people detailed questions about symptom severity and frequency over a longer period would might not be as accurate, perhaps a two-stage question could be asked: firstly asking whether symptoms "have persisted or recurred during 6 or more consecutive months of illness" and then asking a more detailed question about frequency and intensity.

      I also see no mention of the requirement, that was in the initial definition [1], that the symptoms didn't predate the fatigue. Again, if this is a change, it would seem to risk reducing the specificity of the symptom criteria (i.e. increasing the chances that symptoms from other causes are counted) so perhaps again a yes/no question would be good.

      References:

      [1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Feb 02, Tom Kindlon commented:

      More symptoms could be added to a CFS Symptom Inventory

      (This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).

      Many would feel that the 8 symptoms used in the CDC '94 definition [1] were chosen in a somewhat arbitrary fashion; so it is to be welcomed that the CDC itself has started to look beyond these symptoms with the CDC CFS Symptom Inventory. The idea of a Short Form of the CDC Symptom Inventory is also interesting.

      However, it is not clear to me where the extra symptoms that are on the CDC CFS Symptom Inventory came from. For example, I didn't see some of the symptoms listed in Reeves et al [2].

      In 2001, De Becker et al [3] published data on the symptoms found in over 2500 patients. They tried to improve on the 1988 [4] and 1994 CDC criteria. They suggested a list of symptoms that could be used to strengthen the ability to select ME/CFS patients. Many of the symptoms they mentioned are not in the CDC CFS Symptom Inventory.

      So to claim that the "CDC Symptom Inventory assesses the full range of CFS associated symptoms" seems questionable. It would be interesting if in future these symptoms (that De Becker et al were suggesting) were added before statistical analyses are performed. The fatigue criteria and functional impairment criteria have become much less restrictive [5]. For example, to satisfy the fatigue criteria, the fatigue is required to be greater than or equal to the medians of the MFI general fatigue (≥ 13) or reduced activity (≥ 10) scales. So it now seems particularly important that the symptom criteria have good sensitivity and specificity or one is going to end up with a definition that leads to very heterogeneous samples.

      References:

      [1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study.Ann Int Med 1994, 121:953-959.

      [2] Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER, International Chronic Fatigue Syndrome Study Group: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution.BMC Health Services Research 2003, 3:25.http://dx.doi.org/10.1186/1472-6963-3-25

      [3] A definition-based analysis of symptoms in a large cohort of patients withchronic fatigue syndrome, P. De Becker, N. McGregor, and K. De Meirleir.Journal of Internal Medicine 2001;250:234-240

      [4] Holmes GP, Kaplan JE, Gantz NM, Komaroff AL, Schonberger LB, Straus SE, et al.: Chronic fatigue syndrome: a working case definition. Ann Intern Med 1988, 108:387-389.

      [5] Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA,Unger ER, Vernon SD, Heim C: Chronic fatigue syndrome — a clinically empirical approachto its definition and study. BMC Medicine 2005, 3:16.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 04, thomas samaras commented:

      Additional information on height, CHD and longevity is available from these publications.

      Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

      Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

      Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

      He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

      Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

      Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 02, thomas samaras commented:

      Additional information on height, CHD, and longevity is available from these recent publications.

      Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

      Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.

      Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

      Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

      He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

      Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

      Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 07, Gwinyai Masukume commented:

      Did anabolic steroids contribute to Mike Webster’s death?

      During Mike Webster’s autopsy documented in this case report, dilated cardiomyopathy was found. Mike Webster admitted to trying anabolic steroids during his sporting career: Use of anabolic steroids has been associated with the development of dilated cardiomyopathy Ahlgrim C, 2009, Kalmanovich, 2014 and cardiac dysfunction Baggish AL, 2010 that can eventually be fatal. Although the focus of this excellent case report by Omalu and colleagues was the neuropathology aspect, exploring the dilated cardiomyopathy in someone with a history of anabolic steroid use can have important public health lessons.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2013 Oct 29, Michael Eisen commented:

      According to recent Frontline documentary "League of Denial" http://www.pbs.org/wgbh/pages/frontline/league-of-denial/ this paper was the first step in a chain of events that has finally led to the NFL acknowledging that repeated head trauma can potentially cause long term problems for professional football players, and to a series of changes in the game designed to reduce head injuries.

      Note that, according to Frontline, the NFL originally disputed the finding and attacked the work and its author - see Casson IR, 2006.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 02, Prashant Sharma, MD, DM commented:

      This highly unusual case was a diagnostic challenge wherein filarial infection diagnosed in a lymph node sample provided clues to the patient's non-healing fistula. Wuchereria bancrofti filariasis is commonly diagnosed in parts of India, and parasitic infections must be considered in the differential diagnosis of non-healing chronic discharging ulcers/fistulae. Please feel free to write to me for the full article.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Mar 26, Misha Koksharov commented:

      1) It is really sad to see that almost everyone is still using IPTG even after all these years.

      2) Full-text (DOI) link is missing from Pubmed for some reason: Final manuscript, NIH-PA author manuscript.

      3) If someone wonders: it doesn't matter if it is exactly alpha-form of lactose - it will equilibrate to about 40:60 ratio of both forms in solution anyway, especially in an autoclave and this works fine.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Apr 18, Dorothy V M Bishop commented:

      As a psychologist interested in the genetics of lateralization, I frequently come across this paper, which is cited as evidence for early genetic influences on brain asymmetry. As of today, 160 citations are shown in Web of Science.

      When I read the paper a couple of years ago, I found some details that did not seem to support the conclusions of the authors. These are described in a blogpost: http://deevybee.blogspot.co.uk/2012/12/genes-brains-and-lateralisation-how.html

      I will summarise the main issue below, but I was interested to note that, since that time, other papers have appeared, using larger datasets, which have stressed the remarkable symmetry of early gene expression, notably:

      Johnson, M. B., et al (2009). Functional and evolutionary insights into human brain development through global transcriptome analysis. Neuron, 62(4), 494-509. doi: 10.1016/j.neuron.2009.03.027

      and

      Pletikos, M., Sousa, A. M. M., Sedmak, G., Meyer, K. A., Zhu, Y., Cheng, F., . . . Sestan, N. (2014). Temporal specification and bilaterality of human neocortical topographic gene expression. Neuron, 81(2), 321-332. doi: 10.1016/j.neuron.2013.11.018

      Here is a brief account of the main issue I raised about the study. Please see the blogpost for more details.

      Sun et al used a method called Serial Analysis of Gene Expression (SAGE) which compares gene expression in different tissues or – as in this case – in corresponding left and right regions of the embryonic brain. The analysis looks for specific sequences of 10 DNA base-pairs, or tags, which index particular genes. SAGE output consists of simple tables, giving the identity of each tag, its count (a measure of cellular gene expression) and an identifier and more detailed description of the corresponding gene. These tables are available for left and right sides for three brain regions (frontal, perisylvian and occipital) for 12- and 14-week old brains, and for perisylvian only for a 19-week-old brain. The perisylvian region is of particular interest because it is the brain region that will develop into the planum temporale, which has been linked with language development. One brain at each age was used to create the set of SAGE tags.

      To verify asymmetrically expressed genes the authors performed chi square tests. The chi square involves testing whether the distribution of expression on left and right is significantly different from the distribution of left vs. right expression across all tags in this brain region – which is close to 50%. In the left-right perisylvian region of a 12-week-old embryonic human brain, there were 49 genes with chi square greater than 6.63 (p < .01): 21 were more highly expressed on the left and 28 more highly expressed on the right. But for each region the authors considered several thousand tags. My analysis indicated that the number of asymmetrically expressed genes appeared to be lower than you would expect by chance – entirely consistent with the conclusions of Pletikos et al.

      Unless my analysis is mistaken, it would seem this paper should not be cited as evidence for asymmetric fetal gene expression, as it actually shows the opposite.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 10, Matthew Katz commented:

      This key RTOG trial established a role for concurrent chemoradiation as a curative treatment. It is often now combined with surgery rather than give higher radiation doses. Although the toxicities in this study were high, keep in mind the initial radiation fields treated the whole esophagus. Now we are more targeted with use of PET-CT and CT-based treatment planning. These advances and other improvements help lessen some of the side effects.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Sep 07, Gauthier Bouche commented:

      The results presented in this article match almost word-for-word the results reported in an earlier paper (Lin CY, 2004) published in 2004. Both articles have 8 authors with 7 in common. The first author of this article is the senior author of the other article and is the corresponding author for both.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 07, Morten Oksvold commented:

      This article should have been retracted after an investigation by The University of Maryland found this article to contain "compromised" data (a total of 26 articles in 11 journals were affected). The journal Cancer Research was informed in August 2016, according to Retraction Watch.

      http://retractionwatch.com/2017/04/26/university-asked-numerous-retractions-eight-months-later-three-journals-done-nothing/


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Sep 01, Matthew Katz commented:

      This EORTC trial offers hope for better outcomes for glioblastoma, a very aggressive disease. Temozolomide as a therapy and MGMT methylation status as a key prognostic factor are key advances defined by this phase III trial. In the same issue, the MGMT data were published. Hegi ME, 2005

      Five-year updated data were published in Lancet Oncol 2009 update. Stupp R, 2009


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      Two features of case 5-2005 (1) deserve comment.

      First, hyperacute (“flash”) pulmonary edema did not occur. Suggestive X-ray signs of stage 2 pulmonary edema were present initially, but not appreciated. Resting tachycardia and relative hypotension were also present initially, further suggesting a circulatory system nearing its compensatory limits. Only after normal saline administration did frank pulmonary edema become manifest. Missed diagnosis and iatrogenesis should be added to the differential diagnosis of hyperacute pulmonary edema in the case discussion.

      Second, like the proverbial elephant in the living room that is scrupulously not discussed, the claim that “the general physical [examination] disclosed no abnormalities” should have been the discussants’ focus. It stretches probability to believe that all physical signs of heart failure, advanced endocarditis, and aortic valvulopathy were initially absent, yet one discussant accepts this, and another partially excuses it. The patient’s vital signs, marked first-degree heart block, and history of hospitalization for heart disease should, from the beginning, have prompted a directed cardiovascular examination in the emergency room.

      (1) Biddinger PD, Isselbacher EM, Fan D, Shepard JA. Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 5-2005. A 53-year-old man with depression and sudden shortness of breath. N Engl J Med. 2005 Feb 17;352(7):709-716. Pubmed 15716566


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 May 14, Prof.Dr.Jogenananda Pramanik commented:

      Invited author: Dr.Mayo Wint Zaw University College of Saputra UCSA, Kuantan, Pahan, Malaysia

      In recent years medical education is changing at a rapid space. Next generation medical teachers need rigorous training in teaching medical students. Extensive inputs from IT sector seem to be urgently required to update our teaching materials. Current students expect more dynamic and advanced approach incorporating recent multimedia technology in developing teaching materials. Monotonous lectures with 2D power point slide presentations are now out of date. Automated computerized anatomy table, animated physiology packages and many other ultramodern technological support from IT sector have shown great impact on medical teaching and training programmes. Use of iPAD and cell phone for taking pictures or video records and also downloading student consult books in laptops introduced paperless academic and research set up. Health informatics, medical transcription etc., are coming up with remarkable progress in this field of medical education. We may look forward to our computer savvy Y-generation for adding up unique values to our teaching materials and help to update.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Jul 16, Prof.Dr.Jogenananda Pramanik commented:

      "We need to train our teaching work force in academic medicine"

      More than a decade passed away, since the campaign for urgent resuscitation of academic medicine was initiated worldwide. We raised our voice to train our teaching work force for a better futuristic academia in medicine (1). Lot has been said and planned for improving and modernizing academic medicine. A number of strategic modifications have been instituted aiming to develop a vision and a set of recommendations for reforming academic medicine in 21st century (2). We expected a rigorous change in this century eliminating the monotonous teaching schedule that emphasizes on parroting of old theories, facts and figures of basic sciences without any relevance to our professional needs. After long struggles and arguments in several medical education conferences, we realized the brutal fact that academic medicine's understanding will always lag behind the doing of good clinical practice (3). Presently in our University, we included small group discussion sessions; problem based learning sessions, meet the expert sessions, self-study sessions etc., in addition to regular lecture classes in our integrated medical curriculum with an ambition to develop well groomed medical graduates. We sincerely aspire that academic medicine must position itself as one aspect of the global health workforce crisis, but recognise that there are broader issues than merely improving career paths(2).

      References:

      1. Jogenananda Pramanik, BMJ. Academic medicine: who is it for? We need teachers to train teachers Feb 12, 2005; 330(7487): 361–362. doi: 10.1136/bmj.330.7487.361-c
      2. Clark J, Tugwell P. Who cares about academic medicine? BMJ 2004;329: 751-2. (2 October.) doi: 10.1136/bmj.329.7469.751
      3. William House, and David Peters: Academic medicine: who is it for? Five rescue remedies for academic medicine. BMJ. Feb 12, 2005; 330 (7487): 631. doi: 10.1136/bmj.330.7487.361-a


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Feb 02, Jan Tunér commented:

      The conclusion of this study is questionable since only 0.12 J per finger joint was applied. Energy recommendation of the World Association for Laser Therapy for finger arthritis is 4 J, 1-2 points. The discussion also fails to discuss the great differences in dosage and treatment techniques in the references.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 02, Kristina Hanspers commented:

      The pathways in figures 3a and b are available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP374 and http://www.wikipathways.org/index.php/Pathway:WP385. These pathways can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 17, Fernando Castro-Chavez commented:

      Reader,

      In this review I present the aspect of the hepatology based on my microarray findings, learning that both of the SCD genes (for the stearoyl CoA desaturases), while in the white adipose tissue were dramatically down-regulated: scd1 and scd2, in the perilipin knock out mice, however in the liver they remained normal, which means that "the liver of perilipin-/- mice was healthy and normal, even under high-fat diet when compared with the results published for the scd1-/- mice, which under high-fat diets had a darker liver, suggestive of hepatic steatosis. Scd1 is required for the biosynthesis of monounsaturated fatty acids and plays a key role in the hepatic synthesis of triglycerides and of very-low-density lipoproteins"; furthermore I make a remark on my findings of "increased expression for hemoglobin transcripts and other hemo related genes (hemo-like), and for leukocyte like (leuko-like) genes inside the white adipose tissue of the perilipin-/- mice", as well as my first report of the palindrome sequence that contaminates thousands of genes in the Genbank, and I mention this in the next terms within the body of the article: "I found with microarrays an artificial phenomenon of heterotranscription contaminating thousands of sequences in the Genbank nucleic acids database through the sequence CTCGTGCCGAATTCGGCACGAG or its derivatives".

      With my regards,

      Fernando Castro-Chavez From the Baylor College of Medicine.

      Guadalajara, Jalisco, Mexico 01/17/2018.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 23, David Keller commented:

      Further reading: Constructive suggestions for unleashing the full power of ColoGuard screening

      A proposal for risk-stratification of negative ColoGuard (MultiTarget) screening test results using the Composite Score to determine the time until next screening. The higher the Composite Score (below 183), the sooner the patient would be rescreened. Full explanation is at the following URL:

      http://www.ncbi.nlm.nih.gov/pubmed/27393107#cm27393107_16519


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.