- Feb 2018
-
europepmc.org europepmc.org
-
On 2014 Dec 03, Harri Hemila commented:
Fulltext is available at http://dx.doi.org/10.1016/0952-0600(92)90016-A
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Oct 28, Harri Hemila commented:
English translation of this paper is available at: http://www.mv.helsinki.fi/home/hemila/T2.pdf
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 17, R Relevo commented:
the citation has a typo the volume is actually 278, not 2
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 08, Brett Snodgrass commented:
Dear Reader,
The myocardial sinusoids connect to the vasa Wearn, which connect to a coronary artery.
Please see http://bit.ly/JTWearn
For additional commentary, please see. https://twitter.com/BrettSnodgrass1/status/412195032486014976
Please share if you agree or disagree with the previously proposed nomenclature and why.
Thank you kindly.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Aug 15, Abdul-Aleem Khan commented:
I wish to see this article
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 03, Sergio Dueñas commented:
How i can a found the paper abstract
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2017 May 21, Stuart RAY commented:
doi:10.1001/jama.1964.03070160046009
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Nov 30, Harri Hemila commented:
A scanned version of this paper is available at: http://www.mv.helsinki.fi/home/hemila/CT/Chakrabarti_1955_ch.pdf
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 08, Brett Snodgrass commented:
Dear Reader,
This article provides an image of a well-preserved section of the the heart that exhibits a vessel of Wearn.
For additional commentary on the normal anatomy (http://bit.ly/JTWearn) and the presentation in pathologic conditions, please see https://twitter.com/BrettSnodgrass1/status/392016004928131072
I would like to thank Elsevier for making the article by Wearn open access.
Comments and suggestions are welcome.
Thank you kindly.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the comment is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7977 and the final version from DOI
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Sep 09, Pavel Nesmiyanov commented:
That is an interesting observation. Oligofructose-enriched inulin however even increased acetaldehyde production by microbiota.
- Joossens M, de Preter V, Ballet V, Verbeke K, Rutgeerts P, Vermeire S. Effect of oligofructose-enriched inulin (OF-IN) on bacterial composition and disease activity of patients with Crohn's disease: results from a double-blinded randomised controlled trial. Gut 2012; 61: 958.
- Joossens M, de Preter V, Ballet V, Verbeke K, Rutgeerts P, Vermeire S. Effect of oligofructose-enriched inulin (OF-IN) on bacterial composition and disease activity of patients with Crohn's disease: results from a double-blinded randomised controlled trial. Gut 2012; 61: 958.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 15, Kristina Hanspers commented:
The gene regulation depicted in Fig 2 is available as a pathway in the Open Access Publication Collection at WikiPathways: http://wikipathways.org/index.php/Pathway:WP410. These pathways can be downloaded in several formats and can be used for analysis and visualization in tools like PathVisio and Cytoscape.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jul 23, Lydia Maniatis commented:
This article is illustrative of the degradation of theory and practice in vision science. The article is not new (but compare with, e.g. Graham, 2011), but many of its assumptions and the style of argument - tolerance for layers upon layers of uncorroborated assumptions and inadequate, ad hoc models - are still very current and underpin a broad swath of contemporary (arguably pseudoscientific) activity. Below are quotes from the article and my comments.
The abstract: "Light adaptation has been studied using both aperiodic and periodic stimuli. Two well-documented phenomena are described: the background-onset effect (from an aperiodic-stimulus tradition) and high-temporal-frequency linearity (from the periodic-stimulus tradition). These phenomena have been explained within two different theoretical frameworks. Here we briefly review those frameworks. We then show that the models developed to predict the phenomenon from one tradition cannot predict the phenomenon from the other tradition, but that the models from the two traditions can be merged into a class of models that predicts both phenomena."
Comment: One wonders whether the merger was ultimately successful, and whether falsifying phenomena from yet other traditions could be merged with these two, to expand the ever-expanding ad hoc circle of tradition.
Note that the piecemeal "merger" philosophy expressed by Graham and Hood seems to preclude falsification. Falsifying phenomena from another "tradition" simply lead to the summing of individual ad hoc models into a compound ad hoc model, and so on. The complexity but not the information content of the models will thus increase. (This will also likely produce internal inconsistencies that not be noticed because they will not be looked for.) The question of whether these models correspond with the facts that they are supposedly trying to explain never really arises.
All this can be garnered from the abstract: If anything, the text is even worse.
"None of the parts of the merged models, however, is necessarily correct in detail. Many modifications or substitutes would clearly work just as well at this qualitative level. …Also, one could certainly expand the model to include more parts. …Similarly, the initial gain-controlling process might be composed of several processes having somewhat different properties"
Comment: The models are arbitrary, ad hoc, incomplete on their own terms, and there is no rational criterion for choosing among an infinite number of alternatives.
"No attempt was made to fine-tune either model to predict all the details in any one set of psychophysical data…much less in all the other psychophysical results that such a model might bear on…To attempt such a project in the future might be worthwhile...particularly if the experimental results were all collected on the same subjects..."
Comment: In other words, because the models are ad hoc they may only explain the results to which they were tailored. It may (or may not??) be worth checking to see whether this is the case. I.e. testing models for correspondence with the phenomena is optional. The effects in question are too fragile and too little understood to be tested across subjects with varying methods.
"The more vaguely-stated possibility suggested by this observation, however, is that any decision rule of the kind considered here may be in principle inadequate for the suprathreshold-discrimination case. It may be impossible to explain suprathreshold discriminations without more explicit modeling of higher-level of higher-level visual processes than is necessary to explain detection (where detection is a discrimination between a stimulus and a neutral stimulus.)... Thus a simple decision rule may be suitable in the detection case simply because all the higher-level processes are reduced to such simple action THAT THEY BECOME TRANSPARENT." [caps mine].
Comment: The idea that there are certain experimental conditions in which the conscious percept consists in the reading off of the activity of "low-level" neurons (as though there was a direct qualitative correspondence between neural firing and seeing, e.g., a blank screen!) is patently absurd and has been criticized in depth and from different angles by Teller (1984).
Pretending that we take it seriously, we could refute it by noting that the presumably simplest of all stimuli - a white surface free of any imperfections - produces the perception of a three-dimensional fog. Other experiments have also shown that organizational processes are engaged even at threshold conditions, and that, indeed, they influence thresholds.
The "transparency theory" is repeated by Graham (2011) in an article in Vision Research: "It is as if the near-threshold experiments made all higher levels of visual processing transparent, therefore allowing the properties of the low-level analyzers to be seen."
This casually proposed "transparency" theory of near-threshold stimulation is apparently the basis of the widespread belief in spatial frequency channels and the extraordinary elaboration of associated assumptions. Without the transparency theory, it is not clear that even cherry-picked evidence can support this popular field of research. (If you've ever wondered at the widespread use of "Gabor patches" in vision research, this is the root cause - they are considered elemental due to the transparency theory-supported low-level neuron spatial frequency sensitivity hypothesis. I suspect many of the people using then don't even know why).
Graham and Hood (1992) also go into a little finer detail about the putative basis of transparency: " In the suprathreshold discrimination case, the observer is trying to discriminate between two sets of neural responses…both of which sets contain many non-baseline responses. In the detection case…the observer is simply trying to detect some non-baseline responses in either set (since that is the set most likely to be the non-blank stimulus). Thus a simple decision rule may be suitable in the detection case simply because all the higher-level processes are reduced to such simple action that they become transparent."
Comment: The suggestion that investigators are managing to set their low-level visual neurons at baseline at the start of experiments also seems implausible. I certainly don't think this has been explicitly discussed from the point of view of method. "However, at this moment in time, we seem to be able to explain background onset with a subtractive process…Thus, we can just leave as a marker for the future – should troubles in fully explaining the data arise – the possibility that the background-onset effect in particular (and perhaps all the results) will not be explained in detail without including more about higher-level visual processing."
Comment: Translation: We'll accept our ad hoc hypo thesis for now, but it's probably wrong. But we'll worry about that later, if and when anyone makes trouble by bothering with actual tests. Because there's always a (zero) chance that it will be corroborated.
Finally, the article also provides a good example of misleading use of references: "Quantal noise exists in the visual stimulus, as is well known (see Pelli for a current discussion.)"
Comment: From Pelli, 1990: "It will be important to test the model…For gratings in dynamic white noise, this [model] prediction has been confirmed by Pelli (1981), disconfirmed by Kersten (1984) and reconfirmed by Thomas (1985). More work is needed." But we don't need to wait for evidence to firmly believe in "quantal noise."
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jul 23, Lydia Maniatis commented:
Part two: Popper has discussed traditions such as those described and illustrated above, and concluded that they are not the kind of traditions that endow scientific activity with its progressive character. He suggested that we choose not to immunize our hypotheses with the tactics discussed above, e.g. leaving problems for the future and piling ad hoc model on top of ad hoc model, and having tolerance for logical inconsistencies. But that's a harder way than the vagueness, sloppiness and special pleading masked in technical complexity that has come to dominate contemporary vision science and in fact almost the whole of science today.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jul 23, Lydia Maniatis commented:
Part three: Here's an instant update: It seems that, a few years after this publication, the "merged models" were tested. They failed. This is to be expected with ad hoc models, but at least it shows that the authors were sincere in their attempts, though this doesn't excue sloppy reasoning at that level. They also seem inclined to continue in the same style ("adding components" to the failed models rather than rethinking their ideas). The transparency-requiring low-level channel assumptions are apparently untouchable, non-negotiable. I know it's a cliche, but it's a recipe for misguided Ptolemaic solar system-level complexity, as the authors demonstrate.
The article is "Probed-sinewave paradigm: a test of models of light-adaptation dynamics. Hood DC1, Graham N, von Wiegand TE, Chase VM" and its authors frankly acknowledge the utter failure of their hypothesis:
"Our purpose here was to explore a relatively unused paradigm, the probed-sinewave paradigm, as a vehicle for distinguishing among candidate models of light adaptation. The paradigm produced orderly data with clear features. The candidate light-adaptation models, however, were unable to predict these features and our attempts to rescue them by changing parameter values and the decision rule were unsuccessful. While it is plausible that other modifications would produce predictions closer to the data, it is hard to believe these models can be rescued without adding additional components. For discussion, we divide these possible components into those that seem to require an additional channel vs those components that can be added to the single-channel of the models in Fig. 6."
"While this discussion suggests a number of plausible directions for future work, it is not at all clear which direction or model will ultimately prove most successful. We started with a paradigm we thought would be a strong test of existing models; the test turned out to be even stronger than we expected."
So pretty much starting at zero, after all that. Performing a strong test was the right move. The wrong move was not realizing, on the basis of solid reasoning, that the theoretical foundation of the model was flimsy and that models with such flimsy foundations are bound to fail unless you are extraordinarily lucky.
Let me add that all models eventually fail, but it is the case of well-reasoned ones that these failures are informative, and necessary.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
The discussion of how to manage Mrs. P, a 60 year old woman with atrial fibrillation (1), nicely reprised Sir William Osler’s 1907 advice: “Too much stress should not be laid upon arrhythmia per se in the absence of organic disease” (2).
As presented, however, Mrs. P’s evaluation did not adequately exclude organic disease: neither her body mass index nor a general description of her habitus was provided. Although her physicians obviously had access to this information, its omission from the case record suggests that an emerging correlate of atrial fibrillation, obstructive sleep apnea (OSA), was not considered as a potential exacerbating factor in her illness.
The prevalence of OSA in American adults is estimated as 20%, most of it undiagnosed, and most of it related to obesity (3). Hypothyroidism and alcohol ingestion, both of which Mrs. P had, are two of several additional risk factors.
As recently reviewed in JAMA, the role of OSA in cardiac disorders is receiving increasing attention, in part because OSA “frequently coexists undiagnosed in patients with cardiovascular disease” (4). Several physiological mechanisms plausibly link OSA and atrial fibrillation (4), but few studies have examined their clinical links. Of highest relevance for Mrs. P, however, Kanagala et al (5) found that untreated sleep apnea doubles the likelihood of atrial fibrillation recurring within 12 months of cardioversion, when compared to OSA patients receiving positive pressure treatment.
The effectiveness, and, therefore, cost-effectiveness, of testing for OSA in patients with atrial fibrillation is unknown. However, given that OSA is itself common, serious, and treatable, a case can be made for testing patients such as Mrs. P for sleep apnea, especially if they are obese, before consigning them to a lifetime of perhaps unnecessary warfarin therapy. Certainly a stronger case can be made for taking a sleep history in all patients with atrial fibrillation.
(1) Singer DE. A 60-year-old woman with atrial fibrillation. JAMA. 2003;290:2182-9.
(2) Osler W. The Principles and Practice of Medicine. 6th ed., revised. New York: D. Appleton, 1907;835.
(3) Young T, Peppard PE, Gottlieb DJ. Epidemiology of obstructive sleep apnea: a population health perspective. Am J Respir Crit Care Med. 2002;165:1217-39.
(4) Shamsuzzaman AS, Gersh BJ, Somers VK. Obstructive sleep apnea: implications for cardiac and vascular disease. JAMA. 2003;290:1906-14.
(5) Kanagala R, Murali NS, Friedman PA, Ammash NM, Gersh BJ, Ballman KV, Shamsuzzaman AS, Somers VK. Obstructive sleep apnea and the recurrence of atrial fibrillation. Circulation. 2003;107:2589-94.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Aug 05, Fernando Castro-Chavez commented:
Dear Reader, This is where it all started, when I moved from Mexico to the U.S., at the Baylor College of Medicine (BCM), within the Texas Medical Center; we had Perilipin knock out mice able to eat as much fat and carbohydrates as they wanted, never getting obese, but remaining slender, so, we were able to determine the basic biochemical profile of these organisms, which had over expressed the pathways of Beta Oxidation, and of the Respiratory Chain, and also of the Krebs Cycle, while they had down regulated the pathways of the Unsaturation of Fats, and of the production of Cholesterol. Sincerely, Fernando Castro-Chavez.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2013 Jul 17, Toby Gibson commented:
Chk1 is an important DNA damage checkpoint protein kinase. Biochemical evidence suggests that the sites most vigorously phosphorylated by the Chk1/2 kinases match or are close to the pattern (LF)xRxx(pST)(LF). See, for example, these articles (PMID: 10648819; 10761933; 11821419; 12711320). If only one of the three specificity determining positions are lost, the kinases may still phosphorylate, but at reduced activity. This gradation in activity might have biological significance and also means that it is difficult to define motif patterns for Chk kinase substrate sites. Currently we are trying to do this for the ELM protein motif resource (http://elm.eu.org/).
In the paper that I would like to comment on here, the reported phosphorylation site at Ser47 of p73 - VgGtd(pS)S - lacks all of the strong specificity determinants (capitalised positions). It has been confounding our attempt to define a Chk phosphorylation site pattern for ELM. However, based on a close examination of the figures in the paper, we have now decided to exclude this p73 site from further consideration.
The MCB paper is open access and high resolution figures are available at both the MCB site and through PubMed.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262369/figure/f2/
Fig. 2A lower left gel. Lanes 3-4 are the same as lanes 5-6. Note also the inconsistent gap length between band pairs. This gel appears to be a bounded grey box into which band pairs have been pasted.
Fig. 2B upper left gel. This appears to be a bounded grey box in which the + lanes have been pasted in. These have vertical edges that do not correspond to the edges of the bands. The - lanes are just smooth, grey blanks.
Fig. 2B lower left gel. The band in lane 4 is the same as in lane 5. Associated dots and shadows are diagnostic despite a slight size difference.
Fig. 2B lower right gel. This is a bounded grey box into which three bands have been pasted. The band in lane 1 has been pasted over the edge line! The band in lane 3 has also been pasted over the edge line!
Fig. 2C Lower left gel. The band in lane 2 has been pasted over the edge line! This is another grey box into which bands have been pasted.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262369/figure/f3/
Fig. 3A upper gel. Bands in lanes 1-4, 6-7, 10 are identical. Maximum resolution is required to see this unambiguously.
Fig. 3B upper gel. Bands in lanes 4, 6, 9-10 are identical. Maximum resolution is required to see this.
Fig. 3B middle gel. Bands in lanes 2,4 and probably 3 are the same. Bands in lanes 6,7,9 are the same.
Fig. 3D upper right gel slice. All eight bands are identical. Maximum resolution is required to see this (it is not clear from the pdf download of the whole paper). Also these bands might be elongated versions of the reused bands listed for Fig. 3A.
Fig. 3 D lower left gel slice. Lanes 2-7 are identical to lanes labelled 8-13 of the lower right gel slice. According to the labelling above each lane, these are certainly to be understood as different experiments.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262369/figure/f4/
Fig. 4A Upper right slice. Band pair in lanes 1-2 are the same as 7-8. Band in lane 4 is the same as band in lane 6.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262369/figure/f5/
Fig. 5D lower panel. Bands 1-3 are the same as bands 6-8, except that they are the mirror image.
The paper is ten years old. Therefore it is unlikely that the raw data used to assemble these figures still exists, though it would be fascinating to make comparisons if any original data can be found.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Dec 02, S A Ostroumov commented:
This article was among TOP FULL-TEXT DOWNLOADS in 2014-2015. 67 downloads from ResearchGate, 669 views, 9 bookmarks by 26.01.2015. Full text online free: https://www.researchgate.net/publication/200594244; Full title of the journal: Rivista di Biologia / Biology Forum. 2003 (May). 96: 327-332. Abstracts in Eng. and Italian (p. 332).
Additional KEY WORDS: priorities, fundamentals, environmental sciences, biospheric sciences, life sciences, biomedical sciences, geosciences, ecosystems, biosphere, organisms, levels of life systems, man-made impact, anthropogenic, effects, terrestrial, aquatic, research topics;
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version is available at handle
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Jun 23, Chandra Boosani commented:
This article doesn't exist in the journals website as on June 23rd 2014. http://www.invasivecardiology.com/issue/30?page=1
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2016 Aug 30, Stephen Strum commented:
This is an excellent article providing an in-depth review of c-Met and its relation to hepatocyte growth factor (HGF). Authors discuss various targets of therapy (TOT) involving this receptor (c-Met) + ligand (HGF) pathway. I highly recommend spending the time to read this article.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Apr 23, Md. Shahidul Islam commented:
In human beta cells TRPM5 is almost absent while its closest relative TRPM4 is abundant. Marabita F, and Islam MS. Pancreas. 2017 Jan;46(1):97-101. Expression of Transient Receptor Potential Channels in the Purified Human Pancreatic β-Cells. PMID: 27464700 DOI: 10.1097/MPA.0000000000000685
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 02, Ivan Oransky commented:
The first author of this paper, which was retracted in 2007, was found by the Office of Research Integrity to have falsely manipulated images: http://retractionwatch.com/2014/10/31/former-nih-lab-director-faked-findings-in-three-papers-ori/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 28, DAVID SANDERS commented:
See the earlier articles "Sulfhydryl involvement in fusion mechanisms" [2000]Sanders DA, 2000 and "Ancient viruses in the fight against HIV" [2003] Sanders DA, 2003 for the prediction of the results published here.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Nov 25, S A Ostroumov commented:
I have studied this species of plants also. It was also a factor to remove some metals from water. It is a useful paper, congratulations to the authors!
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Feb 03, Tom Kindlon commented:
Which subscales of the SF-36 should be used? Results from a study in Fibromyalgia patients
(This was originally posted here: http://www.biomedcentral.com/1472-6963/3/25/comments but the formatting has been lost and some people may read the paper on PubMed Central)
This paper recommends, amongst other questionnaires, the use of the SF-36 questionnaire. But which subscales should be used? One group of researchers[1] decided to use the physical function, role physical, social function and role emotional subscales of the SF-36 to define disability, with a low score on just one of these subscales being sufficient to satisfy the criteria (i.e. there didn't need to be more than one low scores). Since then, this definition[1] has gone on to be used in numerous papers (for example, 2-5).
But is this a good way of using the SF-36 given the Fukuda definition for CFS[6] requires that there be a "substantial reduction in previous levels of occupational, educational, social, or personal activities".
Fibromyalgia patients share many similarities with CFS patients and many researchers use CFS and FMS patients together in their studies (for example [7-10]).
One study[11] recently assessed Fibromyalgia Syndrome (FS) patients using the SF-36 questionnaire. It found that patients could be broken down into two groups using the SF-36 subscales looking at mental well-being (social functioning, role limitation due to emotional health problems, and mental health). "One group demonstrated psychological dysfunction, whereas the other showed normal psychological scores. Physical well-being scores (physical functioning, role limitation due to physical health problems, bodily pain, general health, and vitality) did not differ between FS patients but were altogether below the normal range."
If this was found to be the same in other populations, it would suggest that perhaps including patients who solely have low scores on subscales assessing mental well-being such as the role emotional and social functioning subscales of SF-36, which is all the CFS definition prepared by Reeves[1] requires, would select a group of people with psychological dysfunction but not necessarily greater physical disability.
References:
[1] Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic Fatigue Syndrome – A clinically empirical approach to its definition and study. BMC Medicine 2005, 3:19
[2] Reeves WC, Heim C, Maloney EM, Youngblood LS, Unger ER, Decker MJ, Jones JF, Rye DB. Sleep characteristics of persons with chronic fatigue syndrome and non-fatigued controls: results from a population-based study. BMC Neurology 2006, 6:41
[3] Majer M, Jones JF, Unger ER, Youngblood LS, Decker MJ, Gurbaxani B, Heim C, Reeves WC. Perception versus polysomnographic assessment of sleep in CFS and non-fatigued control subjects: results from a population-based study. BMC Neurology 2007, 7:40
[4] Jones JF, Maloney EM, Boneva RS, Jones AB, Reeves WC. Complementary and alternative medical therapy utilization by people with chronic fatiguing illnesses in the United States. BMC Complementary and Alternative Medicine 2007, 7:12
[5] Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R.Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.
[6] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.
[7] Teitelbaum JE, Johnson C, St Cyr J. The use of D-ribose in chronic fatigue syndrome and fibromyalgia: a pilot study. J Altern Complement Med. 2006 Nov;12(9):857-62.
[8] Glass JM. Cognitive dysfunction in fibromyalgia and chronic fatigue syndrome: new trends and future directions. Curr Rheumatol Rep. 2006 Dec;8(6):425-9.
[9] Zachrisson O, Regland B, Jahreskog M, Jonsson M, Kron M, Gottfries CG. Treatment with staphylococcus toxoid in fibromyalgia/chronic fatigue syndrome--a randomised controlled trial. Eur J Pain. 2002;6(6):455-66.
[10] Zachrisson O, Regland B, Jahreskog M, Kron M, Gottfries CG. A rating scale for fibromyalgia and chronic fatigue syndrome (the FibroFatigue scale). J Psychosom Res. 2002 Jun;52(6):501-9.
[11] Oswald J, Salemi S, Michel BA, Sprott H. Use of the Short-Form-36 Health Survey to detect a subgroup of fibromyalgia patients with psychological dysfunction. Clin Rheumatol. 2008 Apr 1
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Feb 05, Tom Kindlon commented:
A CFS study which raises questions about the use of the Role Emotional (RE) subscale of the SF-36 to define CFS
(This was originally posted here: http://www.biomedcentral.com/1472-6963/3/25/comments but the formatting has been lost and some people may read the paper on PubMed Central)
As I mentioned in the previous comment, this paper recommends, amongst other questionnaires, the use of the SF-36 questionnaire but does not specify which subscales should be used.
One group of researchers[1] have decided to use the physical function, role physical, social function and role emotional subscales of the SF-36 to define disability, with a low score on just one of these subscales being sufficient to satisfy the criteria (i.e. there didn't need to be more than one low scores).
Since then, this definition has gone on to be used in numerous papers (such as [2-5]) as the CDC are using it as the definition they're using for their CFS studies in the US, and they probably have the largest CFS research program in the world. It was used to give the prevalence rate of 2.54% for CFS in the adult population[6]. Most recently, it was used to investigate the prevalence of the reporting of childhoold trauma in this cohort[7].
A study by Fulcher and White (2000)[8] raises questions about the use of the Role Emotional (RE) subscale of the SF-36 to select patients with CFS. The study involved 66 patients with CFS without a current psychiatric disorder, 30 healthy but sedentary controls, and 15 patients with a current major depressive disorder.
It found, amongst other things, that "the two patient groups were significantly more incapacitated than the sedentary controls on all SF-36 measures (p<0.001), except that the patients with CFS were not significantly different in emotional or mental function." Also, "the depressed subjects were significantly more incapacitated in emotional and mental functioning than the patients with CFS p<0.001)."
These results suggest that low scores on the emotional and mental functioning subscales of the SF-36 do not seem to be an intrinsic part of CFS (if they're found, they could be related to comorbid psychiatric issues). They also points out the risks of using the RE subscale alone [especially given CFS shares some characteristics with depression and so some people with depression (but not CFS) could potentially score the required 25 points on the Symptom Inventory] i.e. one could inadvertently include some people who have depression but not CFS, as CFS patients.
References
[1] Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic Fatigue Syndrome – A clinically empirical approach to its definition and study. BMC Medicine 2005, 3:19<br><br>
[2] Raison CL, Lin JM, Reeves WC. Association of peripheral inflammatory markers with chronic fatigue in a population-based sample. Brain Behav Immun. 2008 Dec 11.
[3] Welberg LA, Capuron L, Miller AH, Pagnoni G, Reeves WC. Neuropsychological performance in persons with chronic fatigue syndrome: results from a population-based study.Majer M, Psychosom Med. 2008 Sep;70(7):829-36.
[4] Nater UM, Youngblood LS, Jones JF, Unger ER, Miller AH, Reeves WC, Heim C. Alterations in diurnal salivary cortisol rhythm in a population-based sample of cases with chronic fatigue syndrome. Psychosom Med. 2008 Apr;70(3):298-305.
[5] Nater UM, Maloney E, Boneva RS, Gurbaxani BM, Lin JM, Jones JF, Reeves WC, Heim C. Attenuated morning salivary cortisol concentrations in a population-based study of persons with chronic fatigue syndrome and well controls. J Clin Endocrinol Metab. 2008 Mar;93(3):703-9.
[6] Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.
[7] Heim C, Nater UM, Maloney E, Boneva R, Jones JF, Reeves WC. Childhood trauma and risk for chronic fatigue syndrome: association with neuroendocrine dysfunction. Arch Gen Psychiatry. 2009 Jan;66(1):72-80.
[8] Fulcher KY, White PD. Strength and physiological response to exercise in patients with chronic fatigue syndrome. J Neurol Neurosurg Psychiatry. 2000 Sep;69(3):302-7.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Jun 02, thomas samaras commented:
Additional information on birthweight, height, CHD, and longevity is available from these recent publications.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
URL relocated to: http://ppdb.tc.cornell.edu/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Oct 19, David Mage commented:
The authors have done an outstanding and excellent study. However, they seem to have failed to notice here that, in Table 2, their reported male fraction of SIDS (0.612) in 260 cases (excluding matched sets) is identical to the male fraction of SIDS reported by Mage and Donner (PMID 9076695) of 41,238 male and 26,140 female in 36 SIDS data sets giving a male fraction of 0.6120. This is important to note because the consistancy of the male fraction of SIDS throughout time and among various countries supports a recessive X-linkage of susceptibility to SIDS that seems to be ignored inspite of the early conclusion of Naeye et al. in PMID 5129451, that male susceptibility to infant death "must" be X-linked.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Feb 13, Egon Willighagen commented:
The correct DOI is 10.1042/bst0320083
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
Dr. Schwartz dates the first description of hemoglobinuria (as black urine) to the 13th century AD (1).
About 400 BC, however, Hippocrates described urinary quantity, color, consistency, or sediment in 41 of 42 case reports in his Book of Epidemics (2). Twelve case reports mention black urine, a frequency so high that one wonders if glucose-6-phosphate dehydrogenase deficiency (3) and/or fava bean ingestion could have predisposed this population to hemolysis.
Inspection of the urine was important in ancient Greek medicine, but has been recently dismissed as “mostly nonsense” (4). Yet, the approach taken by Hippocrates was remarkably modern. In several patients having pigmented urine, Hippocrates checked for the appearance of a sediment after allowing the urine to sit — a maneuver that would have allowed him to distinguish hematuria from hemoglobinuria and myoglobinuria.
Such insights from Hippocrates are not surprising. As Garrison has remarked, “All that a man of genius could do for internal medicine, with no other instrument of precision than his own open mind and keen senses, he accomplished” (5).
(1) Schwartz RS. Black mornings, yellow sunsets — a day with paroxysmal nocturnal hemoglobinuria. N Engl J Med. 2004;350:537-538.
(2) Adams F. The Genuine Works of Hippocrates. Huntington, NY: Robert E. Krieger, 1972; 110-141.
(3) Tran TH, Day NP, Ly VC, Nguyen TH, Pham PL, Nguyen HP, Bethell DB, Dihn XS, Tran TH, White NJ. Blackwater fever in southern Vietnam: a prospective descriptive study of 50 cases. Clin Infect Dis. 1996;23:1274-1281.
(4) Majno G. The Healing Hand: Man and Wound in the Ancient World. Cambridge, MA: Harvard University Press, 197; 494 note 159.
(5) Garrison FH. An Introduction to the History of Medicine. 4th ed. Philadelphia: WB Saunders, 1929: 94.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 11, Harri Hemila commented:
Available at DOI.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Jun 21, Gary Goldman commented:
It is well established that in Japan, where only 1 in 5 children received varicella vaccination, that those vaccinated maintained protective immunity for 20 years. This was largely due to the vacinees' receiving exogenous exposures to children with natural or wild-type varicella that boosted cell-mediated immunity to varicella zoster virus. During the majority of the study by Kuter et al., varicella vaccine receipients were likewise being boosted through exposure to individuals with wild-type varicella--especially during annual epidemics of varicella. This had the effect of artifically elevating vaccine effectiveness because of the shedding of varicella zoster virus in the community. In communities with widespread varicella vaccination, once oppotunities for exogenous boosts became rare, single-dose varicella vaccination efficacy declined to less than 50% five years after vaccination.Goldman GS, 2005
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jan 10, Tom Kindlon commented:
Important typo in abstract:
"After pregnancy, there was no change in CFS symptoms in 21 (30%), an improvement of symptoms in 14 (20%), and a worsening of symptoms in 35 (20%) of the subjects."
should say:
"After pregnancy, there was no change in CFS symptoms in 21 (30%), an improvement of symptoms in 14 (20%), and a worsening of symptoms in 35 (50%) of the subjects."
I checked this with the full text which says: "After pregnancy, there was no change in 30%, an improvement in 20%, and a worsening in 50% of patients."
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Oct 07, Bill Cayley commented:
One of many examples showing simpler care of lacerations is just as good or better: https://lessismoreebm.wordpress.com/?s=lacerat
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 08, Michael Eisen commented:
Readers interested in this article should read the following blog post by Lior Pachter and associated comments:
https://liorpachter.wordpress.com/2015/05/26/pachters-p-value-prize/
The analyses presented there cast serious doubt on the claim made in the last paper, and highlighted in the last sentence of the abstract that "95% of cases of accelerated evolution involve only one member of a gene pair, providing strong support for a specific model of evolution, and allowing us to distinguish ancestral and derived functions".
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 08, Sean Barrett commented:
In my view, this paper should be considered to be a seminal contribution to the entire nicotine/tobacco research field.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A comment is available at: http://hdl.handle.net/10250/7981
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 23, Albert Erives commented:
This paper describes an example of what I have been calling an equivalence class of transcriptional enhancers. This is compared with other such sets in this short collection of slides: How to best approach transcriptional enhancers?. Albert Erives. figshare. http://dx.doi.org/10.6084/m9.figshare.829049
What is not well-described in this paper is how their common site organization was found based on a subset of "specialized sites" within homotypic site clusters. A specialized site is defined mathematically as a sequence matching a binding motif descriptor that identifies a single unique site within each member of a set of homotypic binding site clusters. In other words, specialized sites are identifiable and distinguishable by the existence of any motif that matches them as single components of each homotypic site cluster belonging to a set of mechanistically-equivalent enhancers. A motif that describes more than a single site in each cluster is therefore not a specialized motif. Okay, that's not the easiest thing to get across even today, but this method led to the identification of the so-called D-alpha site, which turned out to be a Su(H) binding site that had evolved over a relic Dorsal binding site, and the so-called D-beta site, which turned out to be the closest Dorsal-binding-like site to the Twist site, the distance to which we later found to encode a large component of the response to the Dorsal morphogen gradient. (See here Crocker J, 2008 and here Crocker J, 2010.) For me, the major significance of this method is that it works well in distinguishing functional sites from relic (pseudogenized), fast-evolving sequences.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Jun 02, thomas samaras commented:
Additional information on height, CHD and longevity is available from these publications.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jul 18, Jan Tunér commented:
Unfortunately, this study cannot be evaluated since the documentation of the actual laser parameters is poor. The only information given about these essential facts is "The LILT device had a wavelength of 905 nm and an average power of 0-60 mW. All LILT treatments were for 5 min per site." Which output was actually used? Pulse repetition rate? Dose? Power density?
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 04, ANDREW SU commented:
!MOVED http://biogps.org
The URL in the original paper has now been retired. This data set (together with other gene expression data sets) are now hosted at http://biogps.org.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Nov 29, Anne Niknejad commented:
erroneous link in the reference list:
↵ Zhang, H., Yang, Z., Shen, Y. & Tong, L. (2003) Science 299 , 2064–2067. Abstract/FREE Full Text
the correct link is
http://science.sciencemag.org/content/299/5615/2064.long
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 02, Ivan Oransky commented:
The first author of this paper, which was retracted in 2007, was found by the Office of Research Integrity to have falsely manipulated images: http://retractionwatch.com/2014/10/31/former-nih-lab-director-faked-findings-in-three-papers-ori/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 27, Neil Saunders commented:
Unfortunately, this database is no longer on line. I am first author and the server was not maintained after I left the University of New South Wales.
The methods described in the article have largely been supplanted by the use of NGS to sequence gut metagenomes. However, if time permits, I will release code/data on Github and update the comments here.
UPDATE 2014-07-22: now at Github - https://github.com/neilfws/archaeaEST.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 17, Raphael Levy commented:
This article is the first in the "stripy nanoparticle" series. It has been followed by over 35 articles, yet it is based on a scanning tunneling microscopy artefact.
The evidence behind the structure and special properties of “striped” nanoparticles has been challenged by Cesbron Y, 2012. The publication in 2012 of Cesbron Y, 2012 took three years and has been followed by post-publication peer review of the various existing and new stripy articles on my blog, PubPeer, etc. This specific article is discussed in particular here
A further detailed analysis of this body of work is published today in PloS One by Stirling et al; from the abstract: “through a combination of an exhaustive re-analysis of the original data with new experimental measurements of a simple control sample comprising entirely unfunctionalised particles, we conclusively show that all of the STM evidence for striped nanoparticles published to date can instead be explained by a combination of well-known instrumental artefacts, strong observer bias, and/or improper data acquisition/analysis protocols.”
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 09, Gary Ward commented:
We reported in this paper that the enhancers of invasion and motility identified in the screen do not stimulate an increase in parasite intracellular calcium levels. This conclusion was based on semiquantitative microscopy-based measurements of the fluorescence intensity of the calcium reporter Fluo-4 in individual parasites, before and after treatment with enhancer. More recent quantitative experiments on populations of parasites using the ratiometric calcium reporter Fura-2 showed that treatment with three of the four enhancers tested does in fact stimulate an increase in parasite intracellular calcium levels (Tang Q, 2014); results with the fourth were inconclusive due to spectral overlap between the compound and indicator.
The discovery that some, and perhaps all, of the enhancers identified in the screen increase parasite intracellular calcium levels provides a rationale for how this group of structurally diverse compounds can cause the same set of phenotypes, i.e, enhanced invasion, microneme secretion and motility.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 May 17, Prof.Dr.Jogenananda Pramanik commented:
Invited co-authors: Dr.Myo Wint Zaw,Dr.Lwin Lwin Cho,and Dato'Dr. Mehmood bin Abu Yusoff, Universiti College UCSA,Kuantan,Pahang,Malaysia.
Improvement in health care facilities in resource poor setting needs high moral,determination and dedicated approach. Financial constraints obviously hinder progress.However, right kind of attitude and organized human approach may overcome obstacles and will definitely show results(1). Several health care teams are working 24/7 with minimum resources to save lives at recurrent earth quakes ridden Nepal. However, lack of team based organized approach, farsighted leadership and many other man-made barriers exist to hinder improvement in health care in both developing and developed countries alike. "we believe now that the duty to help the world's poor nations is everyone's. we wish our own nation were in the lead, and someday maybe it will be. Meanwhile, we can deepen our commitments. Our limited but consistent experience shows that we will meet in the developing world a level of will, skill, and constancy that may put ours to shame. We may well find ourselves not the teachers we thought we were, but students of those who simply will not be stopped under circumstances that would have stopped us long ago".(2) References: 1.Berwick DM: BMJ. 2004 May 8;328(7448):1124-9.Lessons from developing nations on improving health care. 2. Donald M Berwick, BMJ. 2004 May 8; 328(7448): 1124–1129.doi: 10.1136/bmj.328.7448.1124,PMCID: PMC406330; Lessons from developing nations on improving health care,
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Oct 24, Peter Gøtzsche commented:
This meta-analysis is not reliable. It is not appropriate to pool all trials when small trials yield a considerably larger effect than large trials (P=0.001). The authors used rating scales for scoring the quality of trials and trial validity, but such scales have important weaknesses and should not be used (see JAMA 1999; 282: 1054-60 and the Cochrane Reviewers’ Handbook (www.cochrane.org). By using such scales, the authors rated far too many trials as being of acceptable quality. The authors are not clear about whether the trials that compared topical with oral NSAIDs compared the same or different drugs, and their finding that the old drug indomethacin was not significantly better than placebo is irrelevant since the P value depends on the sample size, and in fact, the effect obtained with indomethacin was similar to those of several of the other drugs that had significant effects. The trials reported insuffiently on harms; 56 of a total of 70 systemic adverse events occurred in a single trial, which raises the question whether this trial was more reliable than the others. The authors have consulted for various pharmaceutical companies but do not say which ones, which is an important omission, as they somewhat surprisingly report that one NSAID was better than the others. Their comparisons are questionable, however, as they were indirect, based on studies comparing active drug with placebo. In contrast to the authors, I did not find that any topical NSAID has a true effect (see London: BMJ Publications, Clinical Evidence, 2005; 14: 1498-1505). In contrast to the authors, I have no conflicts of interest and I believe that authors with financial conflicts of interest should not be authors on systematic reviews.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 28, Lydia Maniatis commented:
Part 1. I have criticized Purves and colleagues' various iterations of the “wholly empirical” account of visual perception in various comments on PubMed Commons and on PubPeer. Here, I want to present a more comprehensive and organized critique, focussing on a study that has served as a centerpiece of these accounts. I think it is important to clarify the fact that the story is profoundly inadequate at both the conceptual and the methodological levels, and fails to meet fundamental criteria of empirical science (logical consistency and testability). Such criticism (which is not welcome in the published literature) is important, because if “anything goes” in published research at even the most elite journals, then this literature cannot help to construct the conceptual infrastructure necessary for progress in the visual sciences.
Conceptual problems LACK OF THEORETICAL MOTIVATION The hypothesis that the authors claim to have tested is effectively conjured out of thin air, subsequent to an exposition that is inaccurate, inadequate, and incoherent.
The phenomenon to be explained is inadequately described. We are told, first, that the luminance of a “visual target” elicits a “brightness” percept that can vary according to “context.”
The term brightness, here, is being used to refer to the impression of white-gray-black that a surface may elicit (and which is currently referred to by researchers as its “lightness.”) However, surfaces do not necessarily, or even usually, elicit a unitary percept; they often produce the impression of double layers, e.g. a shadow overlying a solid surface. Both the shadow and the surface have a perceptual valence, a “brightness.” Indeed, it is under conditions where one “target” appears to lie within the confines of a double layer, and the other does not, that the most extreme apparent differences between equiluminant targets arise.
The logic is simple: If a surface appears to lie under a shadow, then it will appear lighter than an equiluminant target that appears to lie outside of the shadow, because a target that emits the same amount of light under a lower illumination as one under stronger illumination must have a higher light-reflecting tendency (and this is what the visual system labels using the white-gray-black code.). The phenomenon and logic of double layers is not even intimated at by these Yang and Purves (2004); rather, the impression created is that the relationship between “brightnesses” under different “contexts” is not in the least understood or even amenable to rational analysis. (In addition, the achromatic conditions being considered are rare or even non-existent in natural, daytime conditions; but the more complex phenomenon of chromatic contrast is not mentioned.)
After this casual attempt to convince readers that vision science is completely in the dark on the subject of “brightness,” the authors assert that “A growing body of evidence has shown that the visual system uses the statistics of stimulus features in natural environments to generate visual percepts of the physical world.” No empirical studies are cited or described to clarify or support this rather opaque assertion. The only citation is of a book containing, not evidence, but “models” of brain function. The authors go on to state that “if so, the visual system must incorporate these statistics as a central feature of processing relevant to brightness and other visual qualia.” (It should be noted that the terms “statistics” and “features” here contain no concrete information. The authors could be counting the stones on Brighton beach.)
Even if we gave the authors the latitude to define “statistics” and “features” any way they wish, the following sentence would still come out of the blue: “Accordingly, we propose that the perceived brightness elicited by the luminance of a target in any given context is based on the value of the target luminance in the probability distribution function of the possible values that co-occur with that contextual luminance experienced during evolution. In particular, whenever the target luminance in a given context corresponds to a higher value in the probability distribution function of the possible luminance values in that context, the brightness of the target will be greater than the brightness elicited by the same luminance in contexts in which that luminance has a lower value in the probability distribution function.”
This frequency-percept correlation, in combination with the claim that it has come about on the basis of evolution by natural selection, is the working hypothesis. It is a pure guess; it does not follow naturally from anything that has come before, nor, for that matter, from the principles of natural selection (see below). It is, frankly, bizarre. If it could be corroborated, it would be a result in need of an explanation. As it is, it has not been corroborated, or even tested, nor is it amenable to testing (see below).
THE HYPOTHESIS The hypothesis offered is said to “explain” a narrow set of lightness demonstrations. Each consists of two displays, both containing a surface of luminance x; despite being equiluminant, these surfaces differ in their appearance, one appearing lighter than the other.
The claim is as follows: The visual system has evolved to represent as lighter those surfaces that appear more frequently in one “context” than in another. Thus, in each display, the surface that appears lighter must have been encountered more often in that particular “context” during the course of evolution. It is because seeing the higher-frequency target/context combination as lighter was “optimal” this situation arose. More specifically, it is because the response “lighter” to a target in one “context” and “darker” to a target in another context, and so on for contexts in-between, has had, over evolutionary time, positive adaptive effects, that these percepts have become instantiated in the visual process.
DO ORGANISMS TRACK ABSOLUTE AND RELATIVE LIGHT INTENSITY OVER MOMENTS, HOURS, DAYS, EONS, AT ALL POINTS IN THE RETINAL IMAGE, AND WHEN DID THEY STOP DOING THIS? The hypothesis would appear to presuppose that organisms can discriminate between, and keep track of, the absolute luminances of various “targets” in various “contexts,” as they have been encountered with every glance, of every individual (or at least the ancestors of every individual), at every point in the visual image, every moment, hour, day, across the evolutionary trajectory of the species. There is no suggestion as to how these absolute luminances might be tracked, even “in effect.” Not only is it difficult to imagine what mechanism (other than a miracle) might allow such (species-wide) data collection (or its equivalent) to arise, it runs contrary to the physiology of the visual system, in which inhibitory mechanisms ensure that relative, not absolute, luminance information, is coded even at the lowest levels of the nervous system. Furthermore, given that lightness perception does not change across an individual's lifetime, nor depend on their particular visual experience, it would seem that this process of statistical accumulation must have stopped at some point during our evolution. So we have to ask, when do the authors suppose this (impossible) process to have stopped, why did it stop, and what were the relevant environments at that time and previously? (The logical assumption that the authors suppose the process has, in fact, stopped is reinforced when they refer to “instantiated” rather than developing “statistical structures.”)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 28, Lydia Maniatis commented:
Part 2. THE HYPOTHESIS IS LAMARCKIAN The hypothesis does not appear consistent with the principles of evolution on the basis of natural selection. Unless I misunderstand, it seems to require not only that stimulus frequency information be accumulated throughout the lifetime of each organism, but also that this knowledge be passed on genetically - which is a form of Lamarckism. Natural selection doesn't work that way – mutations are random, lucky shots in the dark, not the result of accumulated, recorded luminance or responses to luminance – experience only comes into play after the fact, in the sense that if they happen to be adaptive, they undergo positive selection.
In addition, the hypothesis would seem to predict that populations living in highly different environments - one living, for example, in the arctic, the other in the dark jungle – would have different lightness codes. But even fish, for example, appear to possess color perception mechanisms similar to that of humans.
There is also a more subtle problem with the proposal; it purports to explain the production of particular qualia (light, dark) but doesn't actually doesn't touch on this problem at all. The luminance/lightness connection proposed is physically arbitrary, an accident of experience. Why should there be adaptive pressure to code physical conditions on the basis of the chance frequency with which they are encountered, rather than on the basis of features and factors directly relevant to survival and reproduction (a rare event might have more powerful effects)?
THE HYPOTHESIS IS NEITHER NECESSARY NOR SUFFICIENT AND LEAVES MANY QUESTIONS UNANSWERED The hypothesis proposes to explain why two surfaces of equal luminance, in a very limited number and type of displays, produce slightly different percepts; it does not try to explain the quite regular, in many contexts, relationship between luminance and lightness, specifically that the latter rises of falls with the other under certain describable conditions (when the structure of the pattern indicates an area under homogeneous illumination). In other words, although it is the case that the two equal target luminances in the simultaneous contrast demo differ in appearance, it is also the case that continuously increasing the luminance of either one will cause a continuous increase in its lightness. Thus, the hypothesis implies that, for any given context, the frequency of the target/context combination increases with increasing luminance of the target.
The authors seem to realize this when they state that: “by definition, the percentile of target luminance for the lowest luminance value within any contextual light pattern is 0% and corresponds to the perception of maximum darkness, the percentile for the highest luminance ...is 100% [?] and corresponds to the maximum perceivable brightness.” But they seem to be confusing prediction, definition and fact. We know as a matter of FACT – from empirical experience, not definition, not hypothesis - that increasing luminance of a patch in any given setting tends to increase its lightness. But this is not a logical implication of the frequency hypothesis (and certainly not an a priori “definition.”) Even assuming it is possible, methodologically, to show that the “percentiles” coincide with this straightforward luminance/lightness relationship, the “frequency hypothesis,” lacking any discernible rationale, would not seem to possess a logical advantage over the hypothesis that there is simply an adaptive value to a regular coding of lightness and relative luminance, i.e. to coding higher luminance with higher lightness values, with corrections for the sake of accurately separating perception of surfaces and perception of apparent illumination. The authors seem to imply that their proposal is superior to such accounts because it does not require a direct relationship between luminance and lightness – but no serious alternative could require any such thing.
Given that the fairly straightforward within -context luminance/lightness relationship, the hypothesis reduces to the idea that a change in the luminance of the background of a target can change the range of the target lightness values arising in perception. Why should this be? If the entire range for a “context” is shifted upwards, for example, should we assume that that context has a higher percentile than the lower-range-producing context, and that, again, the correspondingly regular luminance/lightness relationship within that range is a coincidence of frequency? And, finally, why does the frequency argument not apply to the apparent lightness of the background? Or does it? In this case, what happens if a low-frequency target/context combination occurs on a high-frequency context? Would the frequency of a single-luminance context equal the frequency of that luminance? Do some luminances occur more frequently than others? Or would we have to evaluate the frequency of each “context” given its own various possible contexts? And what about the fact that a more global changes are known to be able to affect local lightness (rendering any particular cut-off of “context” arbitrary and uninformative).
WHAT DOES IT MEAN THAT THE PROJECTION HAS “HIGHLY-STRUCTURED STATISTICS?” The authors make a mystifying claim about the nature of the retinal projection. We are told that it consists of 2D patterns of light intensity with “highly structured statistics.” What does this mean? How can one collect and evaluate the “structured statistics” in the pattern?
One thing is certain – the pattern of light intensities in the projection is wholly unpredictable, as is the pattern of light intensities in the environment. The light reflected to the eye depends on both the characteristics of surfaces and on the light falling on them. Both change from location to location, but the latter is also unstable within locales, shadows depending on chance locations and orientations of objects, on their shapes and relative locations, the location of the sun, the presence of clouds, etc. Given that the order of the shapes, and the shapes appearing with any given glance, is also unpredictable, it is difficult to see what the authors are talking about when they refer to “highly structured statistics.” They need to explain what they mean.
Methodological problems LACK OF TESTABILITY Even if we ignore the logical, practical and theoretical problems with the hypothesis, it seems impossible to test. Even if our sole interest were the classic simultaneous contrast illusion, and even if such configurations appeared as such in nature (which they do not), how could we develop a database for which frequencies of any target luminance on any background luminance (let alone all of them) falling on the retinas of all of the individuals forming the lineage of our species (until the process is supposed to have stopped (see above)), across all of the days and environments traversed, morning, noon and night, in the sea and on the land? The hypothesis does not entail any principled relationship between luminance and lightness, unless this relationship were in turn entailed by the luminance/frequency relationship for all possible contexts; thus, it is not clear what the criteria might be for obtaining a valid sample for testing. As it is, the notion has not been properly tested even for the narrow framing of this article, because the methods for choosing samples (the details of which are relegated to supplementary, online material) is too vague, arbitrary and opaque at key points to allow any attempts at replication.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 28, Lydia Maniatis commented:
Part 3. ARBITRARY, PRE-EXISTING DATABASE Samples were obtained from a “database of natural scenes.” This database was compiled by Van Hateren and Van der Schaaf (1998) for a very different purpose, without any of the concerns (e.g. that it be representative of the patterns falling on the retinas of humans and their ancestors over evolutionary time) motivating the present study. Neither the original authors nor the authors of the present article provide any rationale for the choice of scenes http://www.kyb.tuebingen.mpg.de/?id=227. As readers, we are left with the information that the scenes were “natural,” which, for practical purposes, is no information at all. Given the variety of “natural environments” encountered within and across lifetimes, it doesn't seem credible that the frequencies being predicted would happen to arise in this randomly chosen database. At the least, the authors should provide a theoretically-motivated description of the nature of these “natural images.”
VAGUE, UNMOTIVATED, OPAQUE SAMPLING CRITERIA The tested configurations were “superimposed on images to find light patterns in which the luminance values of both the surround and target regions were approximately homogeneous.” For more detail, we are directed to the supplementary material. Clearly, “approximately homogeneous,” like “natural,” is not nearly specific enough to us to either replicate or evaluate the methodological choices being made. What particular level of “approximate homogeneity,” for example, should count as match, and why? In perception, we know that a small local change may cause a global change in a characteristic of a scene, even though the scene may still be described as “approximately” the same.
The situation is not improved by the supplementary material. With respect to the database, we are told that while it has “has several limitations (limited locales, a limited luminance range, and fewer representations of very high and low luminance values than actually occur in nature), it provides a reasonable proxy of normal visual experience.” No criteria are provided or discussed as to what should constitute a “reasonable proxy” of experience. If the authors have criteria, they are keeping them to themselves. In other words, they offer no principle for selecting a database – anyone wanting to replicate this experiment would presumably need to use this particular database, and to take it on faith that it is “reasonable.”
We are told that the configurations subtended 5 degrees of visual angle, and that this was a “dimension within the range of the relevant demonstrations and psychophysical studies.” As a rationale for their methodological choice, this statement contains essentially no information. What is the acceptable range, why, how is the specific “dimension” used motivated by their theoretical rationale, and on what basis are other “dimensions” excluded? Would their inclusion affect the frequency data?
The criteria for choosing the samples were as follows: “(i) the luminances of the relevant regions had to be approximately homogeneous (standard deviation of luminance less than a calculated fraction of the mean luminance for 90% of all samples); and (ii) the luminances of two regions labeled Lu had to be similar, as did the two regions labeled Lv (absolute difference of the mean luminance of the regions £ 250 cd/m2, or » 0.5% of the luminance range in the database).”
What do the authors mean by “a calculated fraction of the mean luminance?” What was the theoretical rationale for this and the other choices as to what to accept as a valid sample?
In the aftermath of these arbitrary and vague methodological descriptions – which combine specificity with opaqueness - we are told that the templates used as such are actually very rare in nature. Thus, “Overly stringent criteria will exclude most of the samples or segregate luminance patterns, each set having very few samples. On the other hand, overly loose criteria will collapse many different luminance patterns, obscuring the variations of interest. For the sampling configurations used, in which the luminance values of different regions were homogeneous, rigid criteria are not necessary.” Why not? We are told that “the stimulus patterns in Fig. 1 generate similar perceptual effects even when they are quite noisy.” Really? This claim is made without evidence (on the authors' say so) and in terms (“similar perceptual effects;” “quite noisy”) that fail to meet the standards of empirical science. In short, we have to take it on faith that the criteria chosen by the authors – e.g. their undisclosed “calculated fraction” - are “just right.” Still, in an excess of rigor, they “ examined standard deviations of luminance less than a calculated fraction of the mean luminance for 75%, 50%, or even 10% of all samples. As long as enough samples were obtained from the database, we found quantitatively or qualitatively similar results.” What these results were, the value of “enough” and the distinction being made here between “quantitatively similar” and “qualitatively similar” is not revealed. “Regional similarity” is treated in a similar way. The criteria are judged just right because a control (is supposed to have) produced results “quantitatively or qualitatively similar in these various conditions, as long as enough samples were obtained.” It seems fair to wonder why, if alternative criteria produced “similar” (statistically significant?) results, this broader set of criteria was not employed in the main experiment?
PERCEPTUAL EFFECTS OF SAMPLES NOT TESTED We are told that samples were chosen such that they respected the local geometry of the templates, and the luminance levels, and that these sampling configurations “generated the same brightness illusions” as the templates. This is meant to be taken on faith, not data, as no observers, other than the authors, were consulted on this matter. This is unacceptable, as the validity of samples requires that they are perceptually equivalent to the templates. A small set of photos provided of some of the samples in each case shows that they are highly heterogeneous, and not obviously “similar.” It is well-known that local changes either within a figure or outside the area of interest can produce large changes in lightness. For example, a target of luminance x lying on a surround of luminance y may appear very different in lightness from another target of the same luminance x lying on a surround of the same luminance y. This can happen if one of the two entire target/surround combinations lies within an area apparently in shadow, and the other apparently in plain view. Surely some of the “equivalent” samples in current experiment were lying under differing apparent illumination, in which case the assumption that targets were perceptually equivalent, based on the frequency of the template match, would not be valid. In short it cannot be taken as a given (on the two authors' say-so) that the samples counted are perceptually equivalent to the reference stimuli. Without this information, the predictions cannot be said to have been corroborated, even for this narrow set of cases. (In the case of White's illusion, the authors make inaccurate claims even with respect to the illusion itself, claiming that the “component” of the illusion used as a template “elicited much the same effect as the usual presentation.” This is not true. The complete figure elicits a stronger effect, and one that includes a transparency effect on the lighter side.)
OTHER DATA-FREE ASSERTIONS Our faith in the authors' judgment is recruited also with respect to the issue of “scale invariance. We're assured that “Four scales, including the scale of the original images, were tested and found to produce approximately the same conditional probability distribution functions.” Data.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 28, Lydia Maniatis commented:
Part 4. Finally, and always in keeping with the casual nature of this article, the authors are content to explain a salient feature of their data – the plateaus at the high and low ends of the distributions - as “presumably reflect[ing] the limited number of samples at these extremes.” If the shape of the distributions has theoretical significance, this offhand presumption is clearly not good enough, though apparently it was good enough for PNAS.
It should be clear that this article (and articles relying on it for their claims) sorely lacks the rigor of empirical questions and of the methods appropriate to test them, and asks the reader to take far too much on an empirically unhealthy combination of ignorance and faith.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 28, Lydia Maniatis commented:
The authors reject the idea that the perception of “brightness” is contingent on the segmentation of the visual field into “luminance patches,” claiming that their results do not “support this view.” The supporting rationale is basically unintelligible, and fails on a logical and empirical level.
On a logical level, the authors own proposal depends on the detection of areas of “approximately” homogeneous luminance, both “targets” and “contexts.” These areas are, de facto, segregated from other areas as part of the frequency-data accumulation process.
On an empirical level, the following claim fails: ““knowledge about background and foreground or edges generated by reflectance or illumination is irrelevant to a determination of the percentile of the luminance values in the relevant probability functions...concepts, like brightness, are meaningful only in a probabilistic sense, [and therefore] the statistics that generate brightness are the basis for segmentation and grouping, not the other way around.”
This statement also contains the logical problem noted previously; the empirical problem stems from the implication that, because knowledge (or inference) about foreground and background is irrelevant to the percentile of the luminance values, it is also irrelevant to “brightness” perception. But figure-ground relationships have been shown, empirically, to be key in the perception of lightness and illumination. So even if the authors' data were adequate to corroborate their claims (which it is not, in neither a narrow or a general sense) they would not be entitled to simply dismiss conflicting empirical findings.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Apr 11, Jim Woodgett commented:
This is well worth a read. Written in 1996, its message about the impact of "scarcity mentality" in science is as pertinent today as it was then.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 May 07, John Nardo commented:
This is a ghost-written and distorted report of the clinical trial. see: The citalopram CIT-MD-18 pediatric depression trial: Deconstruction of medical ghostwriting, data mischaracterisation and academic malfeasance by Jon Jureidini, Jay Amsterdam, and Leemon McHenry in the International Journal of Risk & Safety in Medicine. 2016 28[1]:33-43.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jul 19, Jon Jureidini commented:
In light of findings from our recent publication, on 5 May 2016 Jon Jureidini wrote to Dr. Freedman, editor in chief of the American Journal of Psychiatry, to request the retraction of this Forest Laboratories report of study CIT-MD-18.
Jureidini wrote 'CIT-MD-18 study clearly failed to demonstrate efficacy for citalopram in children and adolescents. However, by way of Forest-sponsored ghostwriting and data manipulation this study was misrepresented as positive, and used to gain a license for escitalopram for the treatment of adolescent depression. Subsequent to the publication of the Wagner et al. article, you published an editor’s note on its authorship and its failure to report the negative Lundbeck study of citalopram in the treatment of depression in children and adolescents (Freedman R, Roy MD, Am J Psych 2009, 166: 942-943). You also published criticism of obvious problems in the reporting of the CIT-MD-18 trial results (Martin A, et al. Am J Psych 2005, 162:817). Your journal took no further corrective action at that time. With the recent publication of our article, ‘The citalopram CIT-MD-18 pediatric depression trial: A deconstruction of medical ghostwriting, data manipulation and academic malfeasance’, in the International Journal of Risk & Safety in Medicine (2016, 28:33-43, attached) we, along with other scientists, have drawn attention to further serious misrepresentations that were published in the Wagner et al. paper. As a result of recently declassified documents from litigation, the extent of Forest Pharmaceutical’s data manipulation is only just becoming clear, and is beyond what was available to the public previously. Some of this declassified information is documented in the enclosed article; however, more will be revealed as more documents are released in the public domain in the near future. We are sure that you agree that the integrity of science depends on disinterest in hypotheses and rigorous adherence to the results of experimental testing. This is particularly important in medicine where significant harm to patients can result from the failure to embrace the ideal of evidence-based medicine.'
On this basis Jureidini asked Dr Freedman to retract the Wagner et al. article. He received no reply for over 2 months, until after a second follow up email on 12 July, Dr Freedman sent an email which cursorily stated that he would not retract the article.
We understand that retracting a paper is a major decision, and that an editor will have misgivings about doing so. We do not understand the hostility and disrespect in dealing with a legitimate request.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jul 07, Christopher Southan commented:
In honour of 15th anniversary of the Human Genome I have posted an open copy of the paper http://figshare.com/articles/Has_the_yo_yo_stopped_An_assessment_of_human_protein_coding_gene_number/1464977
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2018 Jan 08, Christopher Southan commented:
This paper has been updated in 2017 as "Last rolls of the yoyo: Assessing the human canonical protein count" https://www.ncbi.nlm.nih.gov/pubmed/28529709
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 05, Morten Oksvold commented:
Please not that this article contains fraudulent data, which was concluded from an investigation by the University of Alabama at Birmingham in 2009 (!):
http://www.uab.edu/reporterarchive/71570-uab-statement-on-protein-data-bank-issues
The case was recently discussed at Retraction Watch: http://retractionwatch.com/2016/01/04/nature-retracts-paper-six-years-after-it-was-flagged-for-fraud/
PNAS was informed about this case in 2009, but as far as I can see there has still not been published any retraction.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 23, MICHAEL TAFFE commented:
Establishing the behavioral discrimination for MDMA takes something on the order of 50-80 training exposures going by Bondareva T, 2005 from this group and Gatch MB, 2009 from another. Training doses of 1.5 mg/kg of MDMA appear to be optimal. It is not impossible that this degree of exposure might attenuate the serotonin response to MDMA. Perhaps not to the extent of a high-dose, repeated so-called "neurotoxicity" regimen but behaviorally significant (e.g., see Albaugh DL, 2011 nevertheless. If so, by the time the discrimination for MDMA was established, the subjective drug effect might be more stimulant typical, i.e., dopamine dependent. Full cocaine substitution would therefore be predicted. In contrast the cocaine trained group might not have experienced the attenuation of the serotonin response to MDMA. If this is the case then the subjective properties of the acute challenge with MDMA in cocaine trained animals would arise from a substantially different neuropharmacological effect than the effect in the MDMA-trained animals post-acquisition.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 01, Morten Oksvold commented:
Please note that this article is 1 out of 15 publications for which an independent investigation initiated by the University of Copenhagen has found suspicion of scientific dishonesty. The conclusion from the report was published July 23, 2012:
http://news.ku.dk/all_news/2012/2012.8/indications_of_fraud_in_penkowas_early_research/
This articles should therefore not be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Aug 27, Bernard Friedenson commented:
For more information please see the article entitled "Mutations in Breast Cancer Exome Sequences Predict Susceptibility to Infection and Converge on the Same Signaling Pathways" This article is available at http://la-press.com/article.php?article_id=5029
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Nov 09, Pierre Lindenbaum commented:
This software was retracted in 2015 : http://bmcevolbiol.biomedcentral.com/articles/10.1186/s12862-015-0513-z / Anonymous, 2015 "... due to the decision by the corresponding author, Gangolf Jobb, to change the license to the software described in the article. The software is no longer available to all scientists wishing to use it in certain territories. "
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Apr 02, Harri Hemila commented:
Errors in the extraction and analysis of data in the Cochrane review on vitamin C supplementation for asthma by Ram FS, 2004.
This Cochrane review (2004) by Ram FS, 2004 is an update of the 2001 Cochrane review on vitamin C and asthma by Kaur B, 2001. This 2004 Cochrane review update suffers from the same errors in the extraction and analysis of data as the 2001 version. See a summary of the errors in the 2001 Cochrane review in Pubmed Commons. Furthermore, the same errors were repeated in the 2009 Cochrane review update by Kaur B, 2009. See a summary of the main errors in the 2009 version of the Cochrane review in Pubmed Commons. The Cochrane review on vitamin C supplementation for asthma was withdrawn by Kaur B, 2013. Thus, the Cochrane review initially published in 2001 by Kaur B, 2001 misled readers for over a decade before it was withdrawn.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Nov 24, Pedro Mendes commented:
The software described in this paper is now hosted at http://www.comp-sys-bio.org/software.html
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 01, Gary Goldman commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Mar 11, Gary Goldman commented:
Jumaan et al [1], only consider the mean herpes zoster (HZ) incidence rate for each age category. However, those age categories consisting of children and adolescents (<20 years-old) comprise three widely different cohorts: (1) those still susceptible to varicella and never vaccinated (exhibiting HZ incidence of 0 cases/100,000 person-years); (2) those that have had a prior history of natural (wild-type) varicella who exhibit increasing HZ incidence rates (up to a maximum HZ incidence of 500 cases/100,000 p-y when exogenous boosting becomes rare); and (3) those vaccinated who exhibit HZ incidence rates less than typical for their age category since they have been recently boosted.
Ironically, while utilizing a single mean for a bimodal (or trimodal) distribution and claiming that Goldman has made methodological errors, Civen et al in a study published in 2009 [2], having some of the same authors as the Scientific Commentary [1], utilized methodology similar to that of Goldman [3,4], and reported nearly the same HZ incidence rates stratified by vaccine status and prior history of natural varicella. [5]
The uncorrected 2000-2006 cumulative HZ incidence rates reported by Civen et al [2] and 2000-2003 cumulative HZ incidence rates reported by Goldman [6] among those vaccinated, aged 1- to 9-years are 19 (95% C.I., 15-25)/100,000 p-y and 14 (95% C.I., 9-21)/100,000 p-y, respectively. Correcting for 50% underreporting of HZ cases, Goldman estimates an ascertainment-corrected HZ incidence rate of 28 cases/100,000 p-y which is remarkably similar to the HZ incidence rate of 27.4 (95% C.I., 22.7-32.7)/100,000 p-y reported by Tseng et al based on 172,163 vaccinated children with overall follow-up of 446,027 p-y among children <=12 years of age. [7]
The uncorrected HZ incidence rates reported by Civen et al [2] and Goldman [6] among those with a history of natural varicella, aged 1- to 9-years are 230 (95% C.I., 193-295)/100,000 p-y and 221 (95% C.I., 180-273)/100,000 p-y, respectively. Correcting for 50% under-reporting, Goldman reports an ascertainment-corrected HZ incidence rate of 446/100,000 p-y, a figure approaching that characteristic of older adults.
Finally, the uncorrected HZ incidence rates reported by Civen et al [2] and Goldman [6] among those with a history of natural varicella, aged 10- to 19-years are 69 (95% C.I., 61-77)/100,000 p-y and 61 (95% C.I., 51-72)/100,000 p-y, respectively. The ascertainment-corrected HZ incidence rate of 162/100,000 p-y demonstrates a slightly elevated rate for this age category (compared to that of Hope-Simpson and the rate prior to universal varicella vaccination).
HZ incidence rates that are ascertainment-corrected, as reported by Goldman [6], can be appropriately compared to other HZ incidence rates that are presented in other studies that similarly reflect high case ascertainment. [8] The methodology recommended by Jumaan et al [2] presents a single mean for a bimodal distribution which does not account for the widely differing HZ incidence rates between cohorts that have been administered varicella vaccine and those having a prior history of natural varicella. Six to seven years following the implementation of the universal varicella vaccination program, Goldman [3,4] showed the significant effect that a severe loss in exogenous boosting had on increasing HZ incidence in children with a prior history of natural varicella--rates approaching those characteristic of older adults. As early as 1965, Dr. Hope-Simpson anticipated this outcome with his hypothesis, “The peculiar age distribution of zoster may in part reflect the frequency with which the different age groups encounter cases of varicella and, because of the ensuing boost to their antibody production, have their attacks of zoster postponed.” [9]
References:
[1] Jumaan A, Schmid DS, Gargiullo P, Seward J. Scientific Commentary. Vaccine 2004. 22(25-26):3228-3331 author reply 3232-3236. Jumaan A, 2004
[2] Civen R, Chaves S, Jumaan A, Wu H, Mascola L, Garguiullo P, et al. The incidence and clinical characteristics of herpes zoster among children and adolescents after implementation of varicella vaccination. Pediatr Infect Dis J 2009;28(November(11)):954-959. Civen R, 2009
[3] Goldman GS. Incidence of herpes zoster among children and adolescents in a community with moderate varicella vaccination coverage. Vaccine 2003 Oct 1;21(27-30):4243-4249. Goldman GS, 2003
[4] Goldman GS. Varicella susceptibility and incidence of herpes zoster among children and adolescents in a community under active surveillance. Vaccine 2003 Oct 1;21(27-30):4238-4242. Goldman GS, 2003
[5] Goldman GS, King PG. Review of the United States universal varicella vaccination program: Herpes zoster incidence rates, cost-effectiveness, and vaccine efficacy based primarily on the Antelope Valley Varicella Active Surveillance Project data. Vaccine 2013 Mar 25;31(13):1680-1694. Goldman GS, 2013
[6] Goldman GS. Universal varicella vaccination: efficacy trends and effect on herpes zoster. Int J Toxicol 2005;24(July/August(4)):205-213. Goldman GS, 2005
[7] Tseng HF, Smith N, Marcy SM, Sy LS, Jacobsen SJ. Incidence of herpes zoster among children vaccinated with varicella vaccine in a prepaid health-care plan in the United States, 2002-2008. Pediatr Infec Dis J, 2009;28(December(12));1069-1072. Tseng HF, 2009
[8] Hook EB, Regal RR. The value of capture-recapture methods even for apparent exhaustive surveys: the need for adjustment for source of ascertainment intersection in attempted complete prevalence studies. Am J Epidemiol 1992; 135:1060-1067. Hook EB, 1992
[9] Hope-Simpson RE. The nature of herpes zoster: a long-term study and a new hypothesis. Proc R Soc Med. 1965 Jan; 58(1): 9–20. HOPE-SIMPSON RE, 1965
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 May 27, Louis-Etienne Lorenzo commented:
Link @ http://link.springer.com/article/10.1023/B:NEUR.0000030699.74642.7d#page-1
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 13, John Sotos commented:
Although interesting, this paper is hurt by the narrow possibilities it examines, and by prior work on interstellar communications it overlooks.
Specifically, it does not consider communication methods that require almost no energy from a civilization, but instead use the energy of the civilization's star. For example, page 127 of Stephen Webb's excellent book, "If the Universe is Teeming with Aliens... Where is Everybody?", mentions: (1) Frank Drake's realization that unusual chemical elements, e.g. praseodymium, could be launched into a star to change its spectrum, causing a signal and (2) Philip Morrison's suggestion that matter be placed in orbit around the star so it periodically obscures the star's light output. Both methods would be detectable at long distances, and could be modulated to give clear evidence of life (e.g. modulating in a prime number pattern). Certainly, the success of the Kepler probe proves that Morrison modulation can be detected over interstellar distances.
Thus, Rose and Wright don't ask the right question. Instead of seeking the lowest-energy insterstellar communication method, they should have been seeking the method that demands the lowest energy from a civilization. The best answer to that question seems to be modulation of stellar electromagnetic emissions. Realizing this, our civilization could launch a program called "Stellar Oscillations To Observe Sentience."
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 02, S A Ostroumov commented:
Full text free: https://www.researchgate.net/publication/200567576_On_the_biotic_self-purification_of_aquatic_ecosystems_elements_of_the_theory
ABSTRACT: On the biotic self-purification of aquatic ecosystems: elements of the theory. - Doklady Biological Sciences, 2004, Vol. 396, Numbers 1-6, pp. 206-211. This article presents a system of elements of a new theory of biotic maintaining the natural purification potential of aquatic ecosystems. The fundamental elements are formulated for a qualitative theory of the multifunctional (polyfunctional) role of the biota in improving water quality and doing self-purification of water in aquatic ecosystems. The elements of the theory covers the following: the sources of energy for the mechanisms of water self-purification; the main functional blocks of the system of self-purification; the system of the main processes that are involved; the analysis of the degree of participation of the main large taxa; the reliability of the mechanisms of water self-purification; regulation of the processes; the response of the mechanisms of water self-purification towards the external influences (man-made impacts, pollution); and some conclusions relevant to the practice of environment protection. In support of the theory, the results are given of the author's experiments which demonstrated the ability of some pollutants (surfactants, detergents, and some others) to inhibit the water filtration activity of aquatic invertebrate filter-feeders, namely, the bivalve mollusks, including mussels Mytilus galloprovincialis, Mytilus edulis, and oysters Crassostrea gigas. This paper is on the short list 'Top papers, books on aquatic ecology, ecotoxicology' at the largest global catalog, WorldCatalog [source: http://5bio5.blogspot.com/2014/09/the-series-of-publications-on-list-of.html].
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 19, S A Ostroumov commented:
A review of this article was published on WorldCatalog: http://5bio5.blogspot.com/2015/12/repost-jul-17-32-reviews-explanation-of.html
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jan 12, S A Ostroumov commented:
DOI of this article. DOI: 10.1023/B:DOBS.0000033278.12858.12
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 26, Tim D. Smith commented:
The microarray data in this paper appear to be deposited in GEO under accession number GSE1405 rather than under the accession numbers given in the text.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 23, thomas samaras commented:
Support for the findings in this study include studies of California veterans, deceased men and women in Ohio, Harvard graduates, a Sardinian village, and elderly Japanese males in Hawaii. A study of US Army officers also found a increase in mortality with increasing height after 60 years of age. A summary of findings relating height or body size to longevity is provided in an paper: Evidence from eight different types of studies showing that smaller body size is related to greater longevity, JSRR 2014.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 31, Nestor KAPUSTA commented:
This is a very nice study worth replication after so many years. NDK
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
The paper is available at DOI and handle and homepg.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Oct 28, Peter Gøtzsche commented:
Although the authors caution against “the possibility of publication bias”, they conclude that drugs, in particular SSRIs, appear effective. I don’t agree. The trials were of very poor quality, and the effect decreased so dramatically with the number of patients in the trial that any meta-analysis of these data would be grossly unreliable. The authors nonetheless meta-analysed their data and reported a relative risk of nonresponse of 0.64 (95% CI 0.57 to 0.73) on the Global Impression Scale. But they also showed in a figure that the largest trials found an effect close to zero.
Another problem is that all the scales appear to have been rated by the clinicians and not the patients. For depression trials, the standardised mean difference in trials that had both psychiatrists and patients as observers was around 0.25 when the psychiatrists evaluated the effect but only 0.05 when the patients were their own judges (1).
An additional problem is that many trials use the last observation carried forward, which would be expected to bias these trials further since the patients’ abstinence symptoms can be depression and anxiety, causing them to drop out, against which the effect of the active drug is judged (2). This is an unfair comparison.
In my opinion, drugs should not be used for social phobia. Psychotherapy works well and the patients need to learn how to cope with their anxiety rather than being emotionally numbed by drugs. It is the fact not only for benzodiazepines but also for SSRIs that about half of the patients have difficulty stopping again, as they become dependent on them (1).
1 Gøtzsche PC. Deadly psychiatry and organised denial. Copenhagen: People’s Press; 2015.
2 Rosenbaum JF, Fava M, Hoog SL, et al. Selective serotonin reuptake inhibi¬tor discontinuation syndrome: a randomised clincial trial. Biol Psychiatry 1998;44:77-87.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jul 04, Tom Kindlon commented:
The meme that people with ME/CFS can be returned to full health with graded activity/exercise programmes
(This was submitted as a response to a discussion on the BMJ site about this paper)
Collings & Newton argue that myalgic encephalomyelitis (ME) or chronic fatigue syndrome (CFS) might be considered a meme(1). However, they offer no compelling evidence to support their theory, and have ignored the hundreds of papers that been published that found an assortment of physical abnormalities in ME/CFS. Possibly some of the most convincing studies are those which found that a stereotypical collection of symptoms is found in a percentage of patients after an infection; in this regard, the BMJ published an important study, funded by the US Centers for Disease Control and Prevention (CDC), back in 2006(2).
A more interesting meme to discuss is the idea that ME/CFS is primarily maintained by maladaptive beliefs and behaviours, and that patients can be rehabilitated back to full functioning and health with rehabilitation methods such as graded exercise therapy (GET) and a form of cognitive behavioural therapy (CBT) based on graded activity/exercise. There are now dozens of studies that have found exercise abnormalities that can’t be explained by the GET and CBT models of the illness which are based on symptoms being due to deconditioning(3-6). Despite a lack of evidence, this meme has spread quickly. Humans (including doctors) seem to have difficulty accepting conditions which are not fully medically explained and in such scenarios can often see the victims as responsible for their own condition. The CBT and GET models for the illness do this: the impairment and disabling symptoms are claimed to be reversible with the therapies(3,4).
This meme is attractive to insurance companies who can use it to deny disability payments and pensions to patients who are unable to work.
The meme can be attractive to health bodies who are wondering what services to provide for such patients but who want to minimise spending on testing and drug therapies.
The meme seems to be difficult to dislodge as audits of ME/CFS services, that have provided such therapies, have reported poor results(7-10) particularly on objective measures, but the enthusiasm for such therapies does not seem to abate.
Collings and Newton mention such therapies in their Rapid Response(1) and a representative from their service previously claimed(11): “These guidelines recommend rehabilitation therapies to help patients recover their health, along with specialist medical care. We are pleased to say we can help the majority of patients whom we see, using an integrated, holistic approach provided by a team of therapists and a consultant physician working closely together. Some patients make a complete recovery, which is better news for patients than just symptom relief, as outlined by Dr Greensmith in the Gazette.”
Recovery is the key measure by which the GET/CBT model or meme should be tested. The model suggests there is no ceiling of activity, in contrast to other models such as those for pacing, so patients using CBT & GET should be able to work their way to full functioning.
The PACE Trial was supposed to be the “definitive” trial to assess such issues(12). It was a very expensive trial costing £5 million of UK taxpayers' money. What it found was though patients self-reported some improvements on subjective outcomes such as the SF-36 physical functioning (SF-36 PF) subscale and the Chalder fatigue questionnaire (CFQ), there were generally no differences on more objective measures such as for employment, disability payments, total service use and the 6-minute walking test(13-14) (this echoed what was found previously in the Belgian rehabilitation clinics and a mediation analysis of three Dutch CBT studies(7-9,15)). There were slight improvements for the GET group (but not the CBT group) on the 6-minute walking test in the PACE Trial, to an average of 379 metres, or 35 metres more than the (no therapy) specialist medical care-only group; however this is well-short of the 644 or so metres predicted by population norms(6). Such slight improvement could be predicted by the ceiling of activity model (cf. CBT and GET model), where certain patients may be below their ceiling of activity before treatment and so could do a little more (without being able to get back to full functioning as predicted by the CBT and GET model).
Unfortunately, the data for the recovery criteria promised in the PACE Trial’s published protocol have never been published(16). Such data would give a good idea for what percentage of patients the CBT/GET model holds. I estimate that the percentages who would have been counted as recovered following CBT and GET would be in single figures in the PACE Trial (based on mean and standard deviation data that has been published). Such low figures suggest that that CBT and GET model is not a good general model for ME/CFS. The post hoc recovery criteria that have been published for the PACE Trial are so broad that they do not give us proper data on whether recovery has occurred(17-33). To give an idea of how absurd the post hoc recovery criteria are as recovery criteria, patients can score worse on either the SF-36 PF or CFQ than baseline (when they were required to have disabling fatigue) and still be counted as recovered.
An appeal has recently been lodged to try to get the data on the protocol defined recovery criteria from the PACE Trial under the Freedom of Information Act(34). I hope Peter White and Queen Mary, University of London will have a change of heart and release the important data (that was promised in the published protocol) now that we have seen the preposterous speculations clinicians with authority over patients are led to when they are provided with such exaggerated claims for the biopsychosocial interventions they provide. I believe the sobering results would once and for all help kill off the inaccurate meme which so distorts the way that ME/CFS patients are viewed and treated. The field could then move forward with theories that are more plausible and evidence-based given our knowledge of the biology of the condition.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
Mr. Kraus and Dr. Suarez (1) provide facts and commentary about physician membership in Congress that should be viewed with care.
The authors calculate that non-physician members of Congressional serve a mean of 3 statistically insignificant years longer than physician members. Yet, a tenure difference of 2 years can be highly significant legislatively because committee chairmanships, from where power in Congress emanates, are few in number and are traditionally determined by strict party seniority. Statistics related to long-duration memberships would therefore tell a more important story, but applying measures of statistical significance to Congress must always be done with restraint. The only true measure of legislative significance is votes.
The speculation on why physician representation in Congress has dropped since 1889 is hopelessly incomplete. The authors discuss workforce levels, salary, duty, time, morale, and role models, but omit power, pride, passion, idealism, ego, drive, connections, expense, and, most startlingly, the electorate and its changes over 115 years. Perhaps 20th century physicians have merely heeded Osler’s comment that “Politics has been the ruin of many country doctors” (2). Given the innumerable factors contributing to electability, one might as well explain the surprisingly large proportion of gynecologists among current physician Congressmen by citing Richard Asher’s half-serious observation that gynecologists typically wear “an expression of refinement and sympathy” (3).
The authors suggest it is advantageous to have physicians in Congress to bring health care expertise to bear on health-related issues. This is a narrow view. Among the reasons not to have physicians in office is: we are a socially homogenous and privileged group functioning in a professional environment that does not generally foster development of leadership skills.
Indeed, the greatest benefit carried by medical training would not be narrow expertise on health care, but would be skepticism and the habit of asking good questions. An exception might have been the ninth President of the United States, William Henry Harrison, who was a medical student first in Richmond then Philadelphia (under Benjamin Rush, no less) before leaving to join the Army and follow the path that would take him to the White House. He is chiefly remembered now for dying of pneumonia one month after not having the medical good sense to wear an overcoat or hat while delivering his hour and forty-minute inaugural address on a very cold Washington day (4).
(1) Kraus CK, Suarez TA. Is there a doctor in the House? … or the Senate? JAMA. 2004;292:2125-2129.
(3) Asher R. An Asher Miscellany. London: British Medical Association, 1984; 86.
(2) Bryant CS. Osler: Inspirations from a Great Physician. Oxford: Oxford University Press, 1997; 179.
(4) Bumgarner JR. The Health of the Presidents. Jefferson, NC: McFarland & Co., 1993; 59-63.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
The perspective about Merck recalling rofecoxib (1) should not have appeared in a medical journal. Although ensconced under a “Business and Medicine” heading, it was purely a business article having nothing to do with medicine.
The authors, from Harvard Business School, use opaque business formulations such as a “cost of capital of 11.25 percent to discount future earnings” to calculate that Merck’s post-recall stock drop was excessive given the recall’s revenue and litigation impact. Their article then rehashes tired statistics about drug development expense, analyzes Merck’s business strategy, and concludes with patient-safety platitudes.
Where is the medicine? Similarly analyzing a multinational shoe company would be equally relevant to physicians: all patients need shoes, and poorly fitting shoes in diabetics cause considerable morbidity and sometimes mortality.
The Journal’s increasing preoccupation with business is classic mission creep, and incurs opportunity cost: uneven translation of research results to the bedside is a major failing of today’s medical system. High impact publications such as the Journal poorly serve our profession when they divert precious pages to Wall Street intrigues.
(1) Oberholzer-Gee F, Inamdar SN. Merck’s recall of rofecoxib–a strategic perspective. N Engl J Med. 2004 Nov 18;351(21):2147-9. Pubmed 15548771
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 14, Robert Tibshirani commented:
I did a thorough re-analysis of the data in this paper, and it shed serious doubt on the validity of the findings. My re-analysis was briefly summarized in NEJM at http://www.nejm.org/doi/full/10.1056/NEJM200504073521422 and in much more detail in http://www-stat.stanford.edu/~tibs/FL/report
I use this example as a teaching tool, demonstrating how the lack of reproducibility of findings is a serious problem, especially in the age of "big data".
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Oct 07, Bill Cayley commented:
One of several examples showing when "Less" is "More" when caring for someone with a migraine: https://lessismoreebm.wordpress.com/?s=migrain
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Apr 21, David Keller commented:
Attention USPSTF: the evidence demonstrates that multivitamins benefit older men
The United States Preventative Services Task Force (USPSTF) recently updated their report on multi-vitamin supplements, and again found "insufficient evidence" to recommend their general use. The USPSTF report dismissed the significant reduction in cancers seen in men in both the SU.VI.MAX and Physicians' Health Study (PHS II), partly because the lack of benefit in women caused them to doubt the results found in men. However, they failed to address the reasonable explanation offered by the SU.VI.MAX authors, which is that women have a higher baseline nutritional status than men, and thus have less to gain by adding a multivitamin supplement.
The second reason USPSTF gave for not being able to interpret the results of the PHS II and SU.VI.MAX studies was that they tested different multivitamin supplement formulations. However, the 5 antioxidants used in the SU.VI.MAX supplement are a sub-set of the micronutrients in the Centrum Silver administered in PHS II. I have pointed out elsewhere in PubMed Commons that there is a rudimentary dose-response effect evident when one compares the effects of the low-dose Centrum Silver supplement, versus the higher-dose SU.VI.MAX supplement, with regard to the significant reduction in cancer seen in men in both studies. A dose-response effect tends to corroborate the findings of the individual studies, and it also suggests the need for a dose-ranging study of the SU.VI.MAX supplement. Would increasing the doses of these 5 antioxidant nutrients reduce cancer rates and mortality even further in men? Would a significant effect in women become evident?
Lastly, the updated USPSTF report completely omitted any mention of the significant reduction in all-cause mortality seen while men were taking the SU.VI.MAX supplement.
At this time, there is consistent evidence from 2 large, prospective, randomized, placebo-controlled trials that the low-dose multivitamin supplement used in PHS II significantly reduces the incidence of cancer in men, and that the higher-dose SU.VI.MAX supplement (consisting of 5 antioxidant nutrients in higher doses than in Centrum Silver) reduces cancer rates even more in men, and adds a significant reduction in all-cause mortality. How many more studies must be done to convince the USPSTF that the results of PHS II and SU.VI.MAX are true? How many men will get cancer or die while we wait for those studies?
I propose that the USPSTF change their assessment of multivitamin supplements to reflect the significant dose-related benefits multivitamins have demonstrated for men over the age of 50, who can benefit from reduced cancer rates and overall mortality, according to the best evidence we have. The USPSTF should call for dose-ranging studies to determine whether the benefits of the five antioxidants administered in SU.VI.MAX can be increased by increasing their doses.
At the very least, the USPSTF report should be amended to state that overall mortality was significantly decreased in men taking the SU.VI.MAX supplement. The absence of that fact from their report seems inexcusable.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Mar 30, Jacob H. Hanna commented:
A corrected version of this manuscript has been republished on bioRxiv: http://biorxiv.org/content/early/2015/03/30/016816
We will not seek to republish it elsewhere in any peer-reviewed journal, as it has been 10-12 years since publication, and the study lacks any novelty at this point in time.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Mar 26, Tom Kindlon commented:
Actometer data from the trial has been released showing that there was not a statistically significant increase in activity levels in the therapeutic arm of the trial
A BMJ e-letter by me with this title can be read at: http://www.bmj.com/rapid-response/2011/11/02/actometer-data-trial-has-been-released-showing-there-was-not-statistically (or alternatively: http://www.bmj.com/content/330/7481/14?tab=responses)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Mar 26, Tom Kindlon commented:
24 Rapid Responses were posted following the publication of this paper:
Including my response below, 24 Rapid Responses were posted following the publication of this paper. They can be read here: http://www.bmj.com/content/330/7481/14?tab=responses.
Here are direct links to my other responses: "If a treatment helps some patients, should it be described as being "effective" for that condition?" http://www.bmj.com/rapid-response/2011/10/30/if-treatment-helps-some-patients-should-it-be-described-being-effective-co
"CBT has a Cohen's d value of 0.31 in this study" http://www.bmj.com/rapid-response/2011/11/01/cbt-has-cohens-d-value-031-study
"Re: CBT has a Cohen's d value of 0.31 in this study" http://www.bmj.com/rapid-response/2011/11/01/re-cbt-has-cohens-d-value-031-study
"Data on the other SF-36 subscales has been released" http://www.bmj.com/rapid-response/2011/11/02/data-other-sf-36-subscales-has-been-released
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Jan 31, peter duesberg commented:
Dear Ruediger,
Could you please send a pdf of your 2004-EuJHist-paper and of subsequent work, if available. I think our new paper, "Karyotypic evolutions of cancer species in rats during the long latencies after injection of nitroso-urea" (Mol Cytogenet, 2014) cob firs and extends much of your work. Will say more after reading your paper.
Cordially,
Peter
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
journals.physiology.org journals.physiology.org
-
On 2017 Jul 25, James M Heilman commented:
Have reviewed some of the claims in this paper and they are not supported by the associated references. For example figure 3: "Combined effect of Pritikin lifestyle intervention on blood glucose and need for oral hypoglycemic medication or insulin therapy. (Data from Refs. 38, 39, 40, 41, 43.)" 38, 40, 41, and 43 do not even mention the diet let alone support the conclusions?
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Aug 11, GianCarlo Panzica commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Aug 11, GianCarlo Panzica commented:
The staining of neurons in dorsomedial hypothalamus and in other extrahypopthalmic regions suggests that the antibody used in this study cross react with other peptides of the same family of the RF-amide peptides (Colledge, 2009a,b) Colledge WH, 2009 Colledge WH, 2009
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 11, Harri Hemila commented:
Available at DOI.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
Now at: http://www.noncode.org/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
Now at: http://www.cathdb.info/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 23, David Keller commented:
Further reading: Constructive suggestions for unleashing the full power of ColoGuard screening
A proposal for risk-stratification of negative ColoGuard (MultiTarget) screening test results using the Composite Score to determine the time until next screening. The higher the Composite Score (below 183), the sooner the patient would be rescreened. Full explanation is at the following URL:
http://www.ncbi.nlm.nih.gov/pubmed/27393107#cm27393107_16519
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 09, Sophien Kamoun commented:
Can a biologist fix a smartphone? https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0378-2
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
Apparently relocated to: http://agingmind.utdallas.edu/facedb
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Dec 06, S A Ostroumov commented:
FULL TEXT ONLINE FREE: https://www.researchgate.net/publication/8083617
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2013 Oct 28, DAVID SANDERS commented:
See the earlier articles "Sulfhydryl involvement in fusion mechanisms" [2000]Sanders DA, 2000 and "Ancient viruses in the fight against HIV" [2003] Sanders DA, 2003 for the prediction of the results published here.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 30, Scott Federhen commented:
The type strain for Bacillus velezensis is identified as CECT 5686 in the abstract, but CECT 5687 in the body of the text for this paper. CECT 5686 is correct, according to the annotation at the CECT. CECT 5687 is identified as the type strain of Bacillus malacitensis.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jun 02, Pedro Reche commented:
EPIMHC is now available at http://imed.med.ucm.es/epimhc/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2018 Jan 17, Fernando Castro-Chavez commented:
Reader,
In this review I present the aspect of the hepatology based on my microarray findings, learning that both of the SCD genes (for the stearoyl CoA desaturases), while in the white adipose tissue were dramatically down-regulated: scd1 and scd2, in the perilipin knock out mice, however in the liver they remained normal, which means that "the liver of perilipin-/- mice was healthy and normal, even under high-fat diet when compared with the results published for the scd1-/- mice, which under high-fat diets had a darker liver, suggestive of hepatic steatosis. Scd1 is required for the biosynthesis of monounsaturated fatty acids and plays a key role in the hepatic synthesis of triglycerides and of very-low-density lipoproteins"; furthermore I make a remark on my findings of "increased expression for hemoglobin transcripts and other hemo related genes (hemo-like), and for leukocyte like (leuko-like) genes inside the white adipose tissue of the perilipin-/- mice", as well as my first report of the palindrome sequence that contaminates thousands of genes in the Genbank, and I mention this in the next terms within the body of the article: "I found with microarrays an artificial phenomenon of heterotranscription contaminating thousands of sequences in the Genbank nucleic acids database through the sequence CTCGTGCCGAATTCGGCACGAG or its derivatives".
With my regards,
Fernando Castro-Chavez From the Baylor College of Medicine.
Guadalajara, Jalisco, Mexico 01/17/2018.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Dec 01, Graham Walker commented:
We just launched an interactive version of the ADHERE algorithm on MDCalc, with additional content on how and when to use it properly (reviewed by Dr Fonarow himself), next steps after applying it, and an interview with Dr Fonarow.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 02, Kristina Hanspers commented:
The pathways in figures 3a and b are available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP374 and http://www.wikipathways.org/index.php/Pathway:WP385. These pathways can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Feb 02, Jan Tunér commented:
The conclusion of this study is questionable since only 0.12 J per finger joint was applied. Energy recommendation of the World Association for Laser Therapy for finger arthritis is 4 J, 1-2 points. The discussion also fails to discuss the great differences in dosage and treatment techniques in the references.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jul 16, Prof.Dr.Jogenananda Pramanik commented:
"We need to train our teaching work force in academic medicine"
More than a decade passed away, since the campaign for urgent resuscitation of academic medicine was initiated worldwide. We raised our voice to train our teaching work force for a better futuristic academia in medicine (1). Lot has been said and planned for improving and modernizing academic medicine. A number of strategic modifications have been instituted aiming to develop a vision and a set of recommendations for reforming academic medicine in 21st century (2). We expected a rigorous change in this century eliminating the monotonous teaching schedule that emphasizes on parroting of old theories, facts and figures of basic sciences without any relevance to our professional needs. After long struggles and arguments in several medical education conferences, we realized the brutal fact that academic medicine's understanding will always lag behind the doing of good clinical practice (3). Presently in our University, we included small group discussion sessions; problem based learning sessions, meet the expert sessions, self-study sessions etc., in addition to regular lecture classes in our integrated medical curriculum with an ambition to develop well groomed medical graduates. We sincerely aspire that academic medicine must position itself as one aspect of the global health workforce crisis, but recognise that there are broader issues than merely improving career paths(2).
References:
- Jogenananda Pramanik, BMJ. Academic medicine: who is it for? We need teachers to train teachers Feb 12, 2005; 330(7487): 361–362. doi: 10.1136/bmj.330.7487.361-c
- Clark J, Tugwell P. Who cares about academic medicine? BMJ 2004;329: 751-2. (2 October.) doi: 10.1136/bmj.329.7469.751
- William House, and David Peters: Academic medicine: who is it for? Five rescue remedies for academic medicine. BMJ. Feb 12, 2005; 330 (7487): 631. doi: 10.1136/bmj.330.7487.361-a
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 May 14, Prof.Dr.Jogenananda Pramanik commented:
Invited author: Dr.Mayo Wint Zaw University College of Saputra UCSA, Kuantan, Pahan, Malaysia
In recent years medical education is changing at a rapid space. Next generation medical teachers need rigorous training in teaching medical students. Extensive inputs from IT sector seem to be urgently required to update our teaching materials. Current students expect more dynamic and advanced approach incorporating recent multimedia technology in developing teaching materials. Monotonous lectures with 2D power point slide presentations are now out of date. Automated computerized anatomy table, animated physiology packages and many other ultramodern technological support from IT sector have shown great impact on medical teaching and training programmes. Use of iPAD and cell phone for taking pictures or video records and also downloading student consult books in laptops introduced paperless academic and research set up. Health informatics, medical transcription etc., are coming up with remarkable progress in this field of medical education. We may look forward to our computer savvy Y-generation for adding up unique values to our teaching materials and help to update.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
Two features of case 5-2005 (1) deserve comment.
First, hyperacute (“flash”) pulmonary edema did not occur. Suggestive X-ray signs of stage 2 pulmonary edema were present initially, but not appreciated. Resting tachycardia and relative hypotension were also present initially, further suggesting a circulatory system nearing its compensatory limits. Only after normal saline administration did frank pulmonary edema become manifest. Missed diagnosis and iatrogenesis should be added to the differential diagnosis of hyperacute pulmonary edema in the case discussion.
Second, like the proverbial elephant in the living room that is scrupulously not discussed, the claim that “the general physical [examination] disclosed no abnormalities” should have been the discussants’ focus. It stretches probability to believe that all physical signs of heart failure, advanced endocarditis, and aortic valvulopathy were initially absent, yet one discussant accepts this, and another partially excuses it. The patient’s vital signs, marked first-degree heart block, and history of hospitalization for heart disease should, from the beginning, have prompted a directed cardiovascular examination in the emergency room.
(1) Biddinger PD, Isselbacher EM, Fan D, Shepard JA. Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 5-2005. A 53-year-old man with depression and sudden shortness of breath. N Engl J Med. 2005 Feb 17;352(7):709-716. Pubmed 15716566
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Sep 22, Natalie Clairoux commented:
Free version of this article available at http://hdl.handle.net/1866/678
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Jan 20, Patrick Schloss commented:
The source code for DOTUR can now be found at https://github.com/mothur/DOTUR
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Sep 01, Matthew Katz commented:
This EORTC trial offers hope for better outcomes for glioblastoma, a very aggressive disease. Temozolomide as a therapy and MGMT methylation status as a key prognostic factor are key advances defined by this phase III trial. In the same issue, the MGMT data were published. Hegi ME, 2005
Five-year updated data were published in Lancet Oncol 2009 update. Stupp R, 2009
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jul 16, Jonathan Eisen commented:
I have posted some additional information about this paper on Figshare (notes, journal communications, Figures, etc). See https://figshare.com/projects/Eisen_et_al_1992_Solemya_velum_symbiont_16S_paper_in_J_Bacteriology_notes/14930
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Jul 07, Morten Oksvold commented:
This article should have been retracted after an investigation by The University of Maryland found this article to contain "compromised" data (a total of 26 articles in 11 journals were affected). The journal Cancer Research was informed in August 2016, according to Retraction Watch.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Feb 27, Ivan Oransky commented:
This paper has been retracted, the second retraction for three of its authors: http://retractionwatch.com/2015/02/27/prominent-geneticist-david-latchmans-group-notches-second-retraction/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jun 29, Ivan Oransky commented:
This paper has been retracted, one of three by the same group: http://retractionwatch.com/2014/06/23/cancer-genetics-group-retracts-three-papers-for-inappropriate-presentation-of-data/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Dec 01, Graham Walker commented:
There's an easy-to-use tool for the Myeloma International Staging System at MDCalc, as well as the Revised Myeloma International Staging System, each with supplemental content on how to use them clinically, next steps, and info about the creators.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Sep 07, Gauthier Bouche commented:
The results presented in this article match almost word-for-word the results reported in an earlier paper (Lin CY, 2004) published in 2004. Both articles have 8 authors with 7 in common. The first author of this article is the senior author of the other article and is the corresponding author for both.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 31, Morten Oksvold commented:
Please note that this article contains falsified data and has been retracted after an investigation by ORI:
https://ori.hhs.gov/content/case-summary-thiruchelvam-mona
Unfortunately the retraction note is hidden in the journal (not included here), and the article is still cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Jul 26, Tetsuya Asakawa commented:
The full text link is wrong, with links to another paper.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 May 04, Arnaud Chiolero MD PhD commented:
A fantastic paper, addressing a very important topic.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Aug 10, Matthew Katz commented:
This key RTOG trial established a role for concurrent chemoradiation as a curative treatment. It is often now combined with surgery rather than give higher radiation doses. Although the toxicities in this study were high, keep in mind the initial radiation fields treated the whole esophagus. Now we are more targeted with use of PET-CT and CT-based treatment planning. These advances and other improvements help lessen some of the side effects.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Oct 07, Bill Cayley commented:
One of several examples showing that sometimes in obstetric care "less" is "more": https://lessismoreebm.wordpress.com/tag/obstetric-gynegologic/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Dec 10, Kath Wright commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Apr 18, Dorothy V M Bishop commented:
As a psychologist interested in the genetics of lateralization, I frequently come across this paper, which is cited as evidence for early genetic influences on brain asymmetry. As of today, 160 citations are shown in Web of Science.
When I read the paper a couple of years ago, I found some details that did not seem to support the conclusions of the authors. These are described in a blogpost: http://deevybee.blogspot.co.uk/2012/12/genes-brains-and-lateralisation-how.html
I will summarise the main issue below, but I was interested to note that, since that time, other papers have appeared, using larger datasets, which have stressed the remarkable symmetry of early gene expression, notably:
Johnson, M. B., et al (2009). Functional and evolutionary insights into human brain development through global transcriptome analysis. Neuron, 62(4), 494-509. doi: 10.1016/j.neuron.2009.03.027
and
Pletikos, M., Sousa, A. M. M., Sedmak, G., Meyer, K. A., Zhu, Y., Cheng, F., . . . Sestan, N. (2014). Temporal specification and bilaterality of human neocortical topographic gene expression. Neuron, 81(2), 321-332. doi: 10.1016/j.neuron.2013.11.018
Here is a brief account of the main issue I raised about the study. Please see the blogpost for more details.
Sun et al used a method called Serial Analysis of Gene Expression (SAGE) which compares gene expression in different tissues or – as in this case – in corresponding left and right regions of the embryonic brain. The analysis looks for specific sequences of 10 DNA base-pairs, or tags, which index particular genes. SAGE output consists of simple tables, giving the identity of each tag, its count (a measure of cellular gene expression) and an identifier and more detailed description of the corresponding gene. These tables are available for left and right sides for three brain regions (frontal, perisylvian and occipital) for 12- and 14-week old brains, and for perisylvian only for a 19-week-old brain. The perisylvian region is of particular interest because it is the brain region that will develop into the planum temporale, which has been linked with language development. One brain at each age was used to create the set of SAGE tags.
To verify asymmetrically expressed genes the authors performed chi square tests. The chi square involves testing whether the distribution of expression on left and right is significantly different from the distribution of left vs. right expression across all tags in this brain region – which is close to 50%. In the left-right perisylvian region of a 12-week-old embryonic human brain, there were 49 genes with chi square greater than 6.63 (p < .01): 21 were more highly expressed on the left and 28 more highly expressed on the right. But for each region the authors considered several thousand tags. My analysis indicated that the number of asymmetrically expressed genes appeared to be lower than you would expect by chance – entirely consistent with the conclusions of Pletikos et al.
Unless my analysis is mistaken, it would seem this paper should not be cited as evidence for asymmetric fetal gene expression, as it actually shows the opposite.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 18, Kristina Hanspers commented:
The pathway in figure 1a is available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2566. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Mar 26, Misha Koksharov commented:
1) It is really sad to see that almost everyone is still using IPTG even after all these years.
2) Full-text (DOI) link is missing from Pubmed for some reason: Final manuscript, NIH-PA author manuscript.
3) If someone wonders: it doesn't matter if it is exactly alpha-form of lactose - it will equilibrate to about 40:60 ratio of both forms in solution anyway, especially in an autoclave and this works fine.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 26, Bill Cayley commented:
a good example of when "less" is "more": https://lessismoreebm.wordpress.com/2015/06/27/how-little-is-enough-the-evidence-for-post-vasectomy-testing/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the comment is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7981
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 02, Prashant Sharma, MD, DM commented:
This highly unusual case was a diagnostic challenge wherein filarial infection diagnosed in a lymph node sample provided clues to the patient's non-healing fistula. Wuchereria bancrofti filariasis is commonly diagnosed in parts of India, and parasitic infections must be considered in the differential diagnosis of non-healing chronic discharging ulcers/fistulae. Please feel free to write to me for the full article.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jun 02, Pedro Reche commented:
PEPVAC is now available at http://imed.med.ucm.es/PEPVAC/.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 29, Michael Eisen commented:
According to recent Frontline documentary "League of Denial" http://www.pbs.org/wgbh/pages/frontline/league-of-denial/ this paper was the first step in a chain of events that has finally led to the NFL acknowledging that repeated head trauma can potentially cause long term problems for professional football players, and to a series of changes in the game designed to reduce head injuries.
Note that, according to Frontline, the NFL originally disputed the finding and attacked the work and its author - see Casson IR, 2006.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jan 07, Gwinyai Masukume commented:
Did anabolic steroids contribute to Mike Webster’s death?
During Mike Webster’s autopsy documented in this case report, dilated cardiomyopathy was found. Mike Webster admitted to trying anabolic steroids during his sporting career: Use of anabolic steroids has been associated with the development of dilated cardiomyopathy Ahlgrim C, 2009, Kalmanovich, 2014 and cardiac dysfunction Baggish AL, 2010 that can eventually be fatal. Although the focus of this excellent case report by Omalu and colleagues was the neuropathology aspect, exploring the dilated cardiomyopathy in someone with a history of anabolic steroid use can have important public health lessons.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Nov 24, Ivan Oransky commented:
The second author of this paper has agreed to retract it and five others following a finding of misconduct by the Office of Research Integrity: http://retractionwatch.com/2014/11/20/former-vanderbilt-scientist-faked-nearly-70-images-will-retract-6-papers-ori/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2015 Jun 02, thomas samaras commented:
Additional information on height, CHD, and longevity is available from these recent publications.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 04, thomas samaras commented:
Additional information on height, CHD and longevity is available from these publications.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Mar 01, Mante S Nieuwland commented:
We've failed to replicate the results of this paper in a recent multi-lab effort. Biorxiv pre-print of our paper is available on http://www.biorxiv.org/content/early/2017/02/25/111807
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2017 Apr 27, Mante S Nieuwland commented:
For more in-depth discussion on why this effect may be hard to replicate, and the problems with the original study, see our newest paper in LCN https://osf.io/preprints/psyarxiv/ayd3t
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 21, Morten Oksvold commented:
Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:
https://ori.hhs.gov/content/case-summary-dasmahapatra-girija
This article should therefor not be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Feb 02, Tom Kindlon commented:
More symptoms could be added to a CFS Symptom Inventory
(This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).
Many would feel that the 8 symptoms used in the CDC '94 definition [1] were chosen in a somewhat arbitrary fashion; so it is to be welcomed that the CDC itself has started to look beyond these symptoms with the CDC CFS Symptom Inventory. The idea of a Short Form of the CDC Symptom Inventory is also interesting.
However, it is not clear to me where the extra symptoms that are on the CDC CFS Symptom Inventory came from. For example, I didn't see some of the symptoms listed in Reeves et al [2].
In 2001, De Becker et al [3] published data on the symptoms found in over 2500 patients. They tried to improve on the 1988 [4] and 1994 CDC criteria. They suggested a list of symptoms that could be used to strengthen the ability to select ME/CFS patients. Many of the symptoms they mentioned are not in the CDC CFS Symptom Inventory.
So to claim that the "CDC Symptom Inventory assesses the full range of CFS associated symptoms" seems questionable. It would be interesting if in future these symptoms (that De Becker et al were suggesting) were added before statistical analyses are performed. The fatigue criteria and functional impairment criteria have become much less restrictive [5]. For example, to satisfy the fatigue criteria, the fatigue is required to be greater than or equal to the medians of the MFI general fatigue (≥ 13) or reduced activity (≥ 10) scales. So it now seems particularly important that the symptom criteria have good sensitivity and specificity or one is going to end up with a definition that leads to very heterogeneous samples.
References:
[1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study.Ann Int Med 1994, 121:953-959.
[2] Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER, International Chronic Fatigue Syndrome Study Group: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution.BMC Health Services Research 2003, 3:25.http://dx.doi.org/10.1186/1472-6963-3-25
[3] A definition-based analysis of symptoms in a large cohort of patients withchronic fatigue syndrome, P. De Becker, N. McGregor, and K. De Meirleir.Journal of Internal Medicine 2001;250:234-240
[4] Holmes GP, Kaplan JE, Gantz NM, Komaroff AL, Schonberger LB, Straus SE, et al.: Chronic fatigue syndrome: a working case definition. Ann Intern Med 1988, 108:387-389.
[5] Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA,Unger ER, Vernon SD, Heim C: Chronic fatigue syndrome — a clinically empirical approachto its definition and study. BMC Medicine 2005, 3:16.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Feb 02, Tom Kindlon commented:
Observations on apparent changes in methods of assessing symptoms
(This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).
I notice that the "Symptom Inventory collects information about the presence, frequency, and intensity of .. symptoms during the month preceding the interview". However the Fukuda et al '94 definition [1] is supposed to look for "the concurrent occurrence of four or more of the following symptoms, all of which must have persisted or recurred during 6 or more consecutive months of illness and must not have predated the fatigue".
Was there a particular reason why a time frame of one month was chosen? This would suggest that relatively short-lived symptoms would be counted. If the reasoning was that asking people detailed questions about symptom severity and frequency over a longer period would might not be as accurate, perhaps a two-stage question could be asked: firstly asking whether symptoms "have persisted or recurred during 6 or more consecutive months of illness" and then asking a more detailed question about frequency and intensity.
I also see no mention of the requirement, that was in the initial definition [1], that the symptoms didn't predate the fatigue. Again, if this is a change, it would seem to risk reducing the specificity of the symptom criteria (i.e. increasing the chances that symptoms from other causes are counted) so perhaps again a yes/no question would be good.
References:
[1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
Apparently relocated to: http://www.lbgi.fr/balibase/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jul 11, Pedro Reche commented:
This tool isnow available at http://imed.med.ucm.es/Methylator
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2013 Oct 23, Hilda Bastian commented:
The conclusions of this paper (Ioannidis JP, 2005) were challenged by Goodman and Greenfield in 2007 (and responded to by Ioannidis JP, 2007). They were also challenged by Jager and Leek (Jager LR, 2014). Those authors conclude, using a different analytical approach (false discovery rate), that the literature reliably charts scientific progress. Ioannidis then responds to this discussion, challenging the data and analytical approach here: (Ioannidis JP, 2014). (I discuss this debate in a blog post.)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2013 Nov 09, Subhash Thakre commented:
This article is an effort to assess the quality and strengths of study findings. it has also addressed the issue in various corollary. I liked it very much.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 08, Mark Gijzen commented:
New results published by others (PMCID: PMC3718677 and Morais JK, 2010) have led us to revise our hypothesis regarding the cross-reactivity of the SC24 antibody. Instead of cross-reactivity with the seed coat peroxidase, it is more likely that the antibody simply cross-reacts with the newly discovered soybean toxin SBTX, since SC24 and SBTX share sequence similarity. Our purified sample of peroxidase enzyme likely contained SBTX, since these two proteins are of the same size, 44 kD.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Nov 20, Morten Oksvold commented:
An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.
This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:
http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/
This article should therefore no longer be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Aug 29, David Mage commented:
In the introduction the authors write: "the peak incidence of SIDS coincides with the nadir in the physiologic anaemia of infancy (PAI)." This nadir is defined as the minimum in total (T) hemoglobin (Hb)(g/dL) vs age as the infant's fetal hemoglobin (HbF) is replaced by adult hemoglobin (HbA). This gives the relation as follows: THb = HbA + HbF, where HbF decreases with age and HbA increases with age. Differentiating the equation with respect to time t since birth we obtain the relation d(THb)/dt = d(HbA)/dt + d(HbF)/dt. That is, the nadir is the point in time when the increase in HbA plus the decrease in HbF equals 0.
However, because HbF holds oxygen more tightly than HbA does, the available oxygen (AO2) to the tissues from the blood will also have a minimum during the period between birth and the nadir in PAI. This can be seen because when the increase in HbA is equal and opposite to the decrease in HbF, d(AO2)/dt is greater than zero so the nadir in AO2 must occur earlier than the nadir in PAI.
Of course this time differential between the nadirs will be a function of gestational age and the time interval between birth and cord clamping, that relates to the placental transfusion from mother to infant that increases the infant THb.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 01, Morten Oksvold commented:
Please note that this article is 1 out of 15 publications for which an independent investigation initiated by the University of Copenhagen has found suspicion of scientific dishonesty. The conclusion from the report was published July 23, 2012:
http://news.ku.dk/all_news/2012/2012.8/indications_of_fraud_in_penkowas_early_research/
This articles should therefore not be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Feb 19, E M Martínez-Cáceres commented:
In the light of the recent PubMed comment by Morten Oksvold, the referenced research study was performed entirely in our research centre by the research team led by Dr. Martínez-Cáceres at the time with Dr. Espejo as predoctoral researcher. Hence, the EAE in vivo experiments were performed in Barcelona with no involvement from Dr. Penkowa, who was engaged as an expert histopathologist. Dr. Penkowa received processed and encoded samples with which she performed some of the histopathological studies. The results were returned to us for overall analysis and submission for publication. It was agreed that Dr. Penkowa would be co-author of the published work.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Mar 07, Preben Berthelsen commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Mar 07, Preben Berthelsen commented:
A foregone conclusion.
The result of this investigation was a dead certainty even before it was conducted. The authors initiating PAC guided therapy 18 hours after the critically ill patients were admitted to intensive care units. This delay in the deployment of the PAC makes it extremely unlikely that PAC guided therapy would influence the mortality rate; it is like shutting the stable door after the horse has bolted. This study does not inform on the timely use of the pulmonary artery catheter.
The primary sample size calculation stipulated that 5673 patients were needed to demonstrate a 5% reduction in mortality. Due to slow recruitment, the primary endpoint was changed to a 10% reduction - 1281 patients were then required. In the end, the authors report the results from 1014 patients.
The principal clinical investigator/corresponding author M. Singer “does consultancy work for, and receives research funds from Deltex Medical, manufacturers of the CardioQ oesophageal Doppler device.”
Preben G. Berthelsen MD
Charlottenlund, Denmark
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 05, Morten Oksvold commented:
Please not that this article contains fraudulent data, which was concluded from an investigation by the University of Alabama at Birmingham in 2009 (!):
http://www.uab.edu/reporterarchive/71570-uab-statement-on-protein-data-bank-issues
The case was recently discussed at Retraction Watch: http://retractionwatch.com/2016/01/04/nature-retracts-paper-six-years-after-it-was-flagged-for-fraud/
Biochemistry was informed about this case in 2009, but as far as I can see there has still not been published any retraction.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jul 27, DATTATRAY PAWAR commented:
What is the use of guidelines if no one has free access to them?
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Aug 07, Randy Blakely commented:
In this paper, the authors report an inability of an hDAT E602G mutant to transport DA or to reach the cell surface. The findings are at odds with a study from my lab (Expression studies of naturally occurring human dopamine transporter variants identifies a novel state of transporter inactivation associated with Val382Ala. Mazei-Robison MS, Blakely RD. Neuropharmacology. 2005 Nov;49(6):737-49). Although the impact of the E602G mutation warrants further analysis, discussions with Drs. Horschitz and Schloss lead to retraction of the Horschitz et al paper As the authors note in their retraction (S Horschitz, R Hummerich, T Lau, M Rietschel & P Schloss Molecular Psychiatry 11, 704-704, 27 June 2006):
"Mazei-Robison and Blakely have published in Neuropharmacology (2005) 49, 737–749, a characterization of several naturally occurring mutants of hDAT. In contrast to our data, in their study the E602G mutant was fully active and comparable to wild-type hDAT. In order to elucidate these contradictory results, both our labs exchanged the mutant cDNAs and re-analysed the properties of the E602G mutant. Uptake experiments in both labs with HEK 293 transiently transfected with both cDNA plasmids revealed transport activity of the E602G mutant comparable to wild-type hDAT. Thus, our conclusion published in Molecular Psychiatry (2005) 10, 1104–1109 is wrong and has to be withdrawn at this point of time."
Since the original Horschitz et al report continues to be cited inappropriately as support for a role for altered DAT (or DA signaling) in BPD, I am hoping the PubMed Commons forum will provide a suitable opportunity to redirect readers attention to the, as yet, unknown properties of the E602G mutation that may include alterations in roles of the hDAT C-terminus (membrane trafficking, interactions with regulatory proteins, DA efflux, e.g. Calmodulin kinase II interacts with the dopamine transporter C terminus to regulate amphetamine-induced reverse transport. Fog JU, Khoshbouei H, Holy M, Owens WA, Vaegter CB, Sen N, Nikandrova Y, Bowton E, McMahon DG, Colbran RJ, Daws LC, Sitte HH, Javitch JA, Galli A, Gether U. Neuron. 2006 Aug 17;51(4):417-29; Attention deficit/hyperactivity disorder-derived coding variation in the dopamine transporter disrupts microdomain targeting and trafficking regulation. Sakrikar D, Mazei-Robison MS, Mergy MA, Richtand NW, Han Q, Hamilton PJ, Bowton E, Galli A, Veenstra-Vanderweele J, Gill M, Blakely RD. J Neurosci. 2012 Apr 18;32(16):5385-97. doi: 10.1523/JNEUROSCI.6033-11.2012. Erratum in: J Neurosci. 2012 Oct 31;32(44):15643).
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Aug 19, Bill Cayley commented:
An example of when less is better: https://lessismoreebm.wordpress.com/2015/06/30/acetaminophen-aspirin-and-caffeine-versus-sumatriptan-succinate-in-the-early-treatment-of-migraine-results-from-the-asset-trial/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 May 04, Arthur Yin Fan commented:
This study has a significant flaw--the sample size is over small, and could not make sure the acupuncture's efficacy--the design of four groups, should have 800 patients.
The second, the drop out rate 33%, makes the result is not trust-able.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 May 13, Richard E Harris commented:
The sample size in this study was based on a power calculation using results from the Deluze et al. 1992 study as an estimate of effect size. This was the only publication using acupuncture in fibromyalgia at that time. Our power analysis indicated that we would need 30 participants (per group) to detect a 30% difference between groups at a significance level of 0.05. We enrolled from 27 to 30 per arm suggesting we had significant power to test our hypotheses.
Regarding the drop out rate of 33%, we performed an Intention To Treat analysis which controls for some effects of drop outs. Also there was no significant difference in drop outs (or treatments received) between study arms. These make it unlikely that our results were influenced by dropouts.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Mar 16, Donald Forsdyke commented:
Concluding that this paper showed, if anything, the very opposite of what was claimed, a commentary on this paper was submitted to Bioinformatics in 2005, but was declined for publication. The paper and correspondence with the authors was placed online (2006) at: http://post.queensu.ca/~forsdyke/bioinfo9.htm, and various updates have since been added.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 21, Morten Oksvold commented:
Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:
https://ori.hhs.gov/content/case-summary-dasmahapatra-girija
This article should therefor not be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jun 01, Ivan Oransky commented:
This paper has been corrected: http://retractionwatch.com/2014/05/28/failure-to-cite-leads-to-ignoble-end-for-xenon-paper-and-a-correction/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 09, Tom Kindlon commented:
Will the CDC CFS Research team (and other teams) please now look at enteroviruses in CFS
(This was originally accepted as a comment here: http://www.biomedcentral.com/1471-2334/5/78/comments in 2007. However, the formatting has been removed meaning few may read it there. Also, many people may not read the paper on the biomedcentral site and thus not see the comment there)
Not for the first time [1-2], a CDC-funded research team produces a paper on CFS which has a title which mentions a lack of an association with a particular infection[3]. It would be good if some of the CDC's (not inconsiderable) CFS research budget could be used to investigate enteroviruses in CFS.
Earlier this year a study involving enteroviruses[4] resulted in much excitement in the media on the subject. It found, in a sample of CFS patients who had gastrointestinal symptoms, that 135/165 (82%) biopsies stained positive for VP1 within parietal cells, whereas 7/34 (20%) of the controls stained positive (p=<0.001). Earlier studies have demonstrated circulating antigen of enterovirus, raised antibody titres and viral RNA in the blood and muscle biopsy specimens of patients with CFS[4-8].
John Chia does recognize that other infections could be playing a part in some CFS cases but enteroviruses are by far the most common infection he is finding in his clinic in California[9].
References:
[1] Gelman JH, Unger ER, Mawle AC, Nisenbaum R, Reeves WC: Chronic fatigue syndrome is not associated with expression of endogenous retroviral p15E. Molec Diagnosis 2000, 5:155-156.
[2] Vernon SD, Shukla S, Reeves WC: Absence of Mycoplasma species DNA in chronic fatigue syndrome. J Med Microbiol 2003, 52:1027-1028.
[3] Jones JF, Kulkarni PS, Butera ST, Reeves WC: GB virus-C--a virus without a disease: we cannot give it chronic fatigue syndrome. Jones JF, Kulkarni PS, Butera ST, Reeves WC. BMC Infect Dis 2005, 5:78
[4] Yousef GE, Mann GF, Smith DF, et al: Chronic enterovirus infection in patients with postviral fatigue syndrome. Lancet 1988;1:146-7.
[5] Cunningham L, Bowles NE, Lane RJM, et al: Persistence of enteroviral RNA in chronic fatigue syndrome is associated with abnormal production of equal amounts of positive and negative strands of enteroviral RNA. J Gen Virol 1990;71:1399-402.
[6] Galbraith DN, Nairn C, Clements GB: Phylogenetic analysis of short enteroviral sequences from patients with chronic fatigue syndrome. J Gen Virol 1995;76:1701-7.
[7] Lane RJ, Soteriou BA, Zhang H, et al: Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry 2003;74:1382-6.
[8] Douche-Aourik F, Berlier W, Fe´asson L, et al: Detection of enterovirus to human skeletal muscle from patients with chronic inflammatory muscle disease or fibromyalgia and healthy subjects. J Med Virol 2003;71:540-7.
[9] Chia JK, Chia A: Diverse etiologies for the chronic fatigue syndrome. Clin Infect Dis 2003;36:671-2.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.pnas.org www.pnas.org
-
On 2013 Jun 16, Robert Tibshirani commented:
This is an important paper, one that introduced the idea of analyzing the differential expression of groups of genes, rather than individual genes. The advantage is both in power and interpretability. Importantly, this group has also created and curated an impressive collection of gene sets for this purpose. See http://www.broadinstitute.org/gsea/index.jsp
The particular test here- the KS statistic- has been criticized for lack of power and alternatives have been suggested (see eg http://arxiv.org/pdf/math/0610667.pdf and http://www.ncbi.nlm.nih.gov/pubmed/20048385.
A response to the latter is in http://www.ncbi.nlm.nih.gov/pubmed/23070592
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2013 Jun 28, Rafael Irizarry commented:
I agree with Rob that this is an important paper. The idea of analyzing differential expression for groups of genes, as opposed to individual genes, was an important step forward in the analysis of gene expression data. In one of the papers Rob links to we point out that the method would have worked just as well (or perhaps better) using simple (existing) statistical tests rather than the novel versions of the KS-test presented in the paper. Examples of some of these simpler tests are implemented in the Bioconductor limma package. The critique is not just about power, but about interpretability and ease of implementation. But these critiques should not take away from the important contribution made by this paper.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2013 Nov 12, James Hadfield commented:
Who would run a differential gene expression experiment today and NOT look at gene set enrichment analysis? It is difficult to remember the impact this paper had on the field and what we were doing just five years earlier with the first microarrays!
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2017 Jan 05, Pablo Tamayo commented:
A key aspect of the Gene Set Enrichment Analysis (GSEA) approach is the preservation of gene-gene dependency in estimating the significance of enrichment (i.e., coordinate expression) of a set of genes. Because we know that genes are not independent variables, modeling dependencies as done by GSEA better mirrors the underlying biology of the systems we seek to study. While simpler statistical tests may reduce computational complexity, they do so at the expense of making unrealistic assumptions not supported by the data. In our response (http://www.ncbi.nlm.nih.gov/pubmed/23070592) to the claims in http://www.ncbi.nlm.nih.gov/pubmed/20048385 we carefully considered the assumptions of the proposed “simplified” SEA method and its results. This included a comparative analysis on a large collection of 50 benchmarks. By randomizing phenotypes, we showed that gene-gene correlations produce significant variance inflation in SEA results, which in turn produce very high false positive rates and inflated p- and q-values, while GSEA does not. These results provide strong empirical evidence that gene-gene correlations cannot be ignored and agree with the extensive literature providing theoretical or empirical evidence against the gene independence assumption. See, e.g., https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3091509/ https://www.ncbi.nlm.nih.gov/pubmed/16646853 https://www.ncbi.nlm.nih.gov/pubmed/17303618
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 21, Morten Oksvold commented:
Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:
https://ori.hhs.gov/content/case-summary-dasmahapatra-girija
This article should therefor not be cited.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2014 Aug 18, Nicholas J L Brown commented:
cf. http://www.ncbi.nlm.nih.gov/pubmed/23855896
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
On 2013 Oct 28, DAVID SANDERS commented:
See the earlier articles "Sulfhydryl involvement in fusion mechanisms" [2000]Sanders DA, 2000 and "Ancient viruses in the fight against HIV" [2003] Sanders DA, 2003 for the prediction of the results published here.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Nov 18, Diana Petitti commented:
Reviewing articles about vitamin D and falls, I discovered that, while the abstract states that this was a randomized, placebo-controlled trials of vitamin D to prevent falls, all subjects were prescribed 600 mg of elemental calcium in the form of calcium carbonate (p. 1182). Thus, the trial was a randomized trial of vitamin D plus calcium versus calcium alone.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jul 16, Bill Cayley commented:
A good example of when a "less-medical" approach is better: https://lessismoreebm.wordpress.com/2015/07/16/nonsurgical-management-of-partial-adhesive-small-bowel-obstruction-with-oral-therapy-a-randomized-controlled-trial/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 19, Morten Oksvold commented:
Please note that this article has been retracted and should therefore not be cited in the future:
"The above article and associated erratum, published online on 11 November 2005 and 6 February 2014, respectively, in Wiley Online Library (wileyonlinelibrary.com), have been retracted by agreement between the authors, the journal Editor-in-Chief, Professor Peter Lichter, and Wiley Periodicals, Inc. In addition to what was corrected in the erratum, a university investigation involving the first and the corresponding author determined that several figures in this paper were re-used, mislabeled, manipulated, or duplicated while processing/compiling the final figures assembled from the original data sources. Therefore, the authors are retracting the paper in its entirety although they maintain that these issues did not affect the major conclusions. They apologize for any inconvenience this may have caused".
Link: http://onlinelibrary.wiley.com/doi/10.1002/ijc.30267/full
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 11, Harri Hemila commented:
Available at http://dx.doi.org/10.1016/0378-1119(92)90625-Y
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Dec 30, Mike KLYMKOWSKY commented:
the "text" link points to a completely unrelated paper
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Oct 13, Ivan Oransky commented:
This paper has been subjected to a significant correction for duplicate publication: http://retractionwatch.com/2014/10/09/u-illinois-chancellor-earns-mega-correction-for-duplicate-publication/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Feb 25, Jim Woodgett commented:
[This entry is incorrectly cited by PubMed. The correct page numbers are 10992-11000.]
Nevermind - It's the correct shortening/abbreviation 10992-1000. Looks odd but is correct. My mistake. Thanks @clathrin @michaelhoffman
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Mar 12, Ivan Oransky commented:
This paper has been retracted, the second retraction from the group: http://retractionwatch.com/2015/03/12/second-cell-bio-retraction-from-upitt-investigation-of-tweaked-images/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Oct 14, GEORGE ANDERSON commented:
The paper that Dr. Carter comments on should have been retracted 9 years ago. The urinary oxytocin (and AVP) data that provide the foundation of the research are fundamentally flawed, with the reported values being approximately one million times higher than prior (and subsequent) reports (see Anderson GM. Report of altered urinary oxytocin and AVP excretion in neglected orphans should be reconsidered. Journal of Autism and Developmental Disorders, 36:829-30, 2006). This was NOT due to a simple error in calculation or a misplaced decimal points. Rather, the analytical method used was non-specific. At the time, the authors defended their results as accurate and even provided some mass spectral data purporting to show that they were indeed measuring correct amounts of urinary oxytocin. In more recent research they have used a more specific method and now obtain results consistent with all other published work. However, they continue to reference this paper without mentioning the huge discrepancy. The paper and any of its conclusions should be disregarded. Just as regretable as the continued presence in the literature and continued citing of this misleading research is the fact that the editiorial board of PNAS has not seen fit to perform the retraction which is a necessary part of self-correcting science. This latter fact reflects very poorly on all papers published in PNAS as there does not seem to be any standard or threshold for retraction; the low quality of review that the paper received in the first place is also not reassuring when considering how much credence to give PNAS papers.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-