10,000 Matching Annotations
  1. Mar 2025
    1. Reviewer #1 (Public review):

      Summary:

      Machii et al. reported a possible molecular mechanism underlying the parallel evolution of lip hypertrophy in African cichlids. The multifaceted approach taken in this manuscript is highly valued, as it uses histology, proteomics, and transcriptomics to reveal how phylogenetically distinct thick-lips have evolved in parallel. Findings from histology and proteomics connected to wnt signaling through the transcriptome are very exciting.

      Strengths:

      There is consistency between the results and it is possible to make a strong argument from the results.

      Comments on revised version:

      The issues I pointed out in the previous review have been carefully answered, and all issues have been addressed. The main points of the manuscript are clear, and the conclusions are easy to understand. The enlarged lips are a notable example of convergent evolution in African cichlids.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript focuses on the olfactory system of Pieris brassicae larvae and the importance of olfactory information in their interactions with the host plant Brassica oleracea and the major parasitic wasp Cotesia glomerata. The authors used CRISPR/Cas9 to knockout odorant receptor co-receptors (Orco), and conducted a comparative study on the behavior and olfactory system of the mutant and wild-type larvae. The study found that Orco-expressing olfactory sensory neurons in antennae and maxillary palps of Orco knockout (KO) larvae disappeared, and the number of glomeruli in the brain decreased, which impairs the olfactory detection and primary processing in the brain. Orco KO caterpillars show weight loss and loss of preference for optimal food plants; KO larvae also lost weight when attacked by parasitoids with the ovipositor removed, and mortality increased when attacked by untreated parasitoids. On this basis, the authors further studied the responses of caterpillars to volatiles from plants attacked by the larvae of the same species and volatiles from plants on which the caterpillars were themselves attacked by parasitic wasps. Lack of OR-mediated olfactory inputs prevents caterpillars from finding suitable food sources and from choosing spaces free of enemies.

      Strengths:

      The findings help to understand the important role of olfaction in caterpillar feeding and predator avoidance, highlighting the importance of odorant receptor genes in shaping ecological interactions.

      Weaknesses:

      There are the following major concerns:

      (1) Possible non-targeted effects of Orco knockout using CRISPR/Cas9 should be analyzed and evaluated in Materials and Methods and Results.

      (2) Figure 1E: Only one olfactory receptor neuron was marked in WT. There are at least three olfactory sensilla at the top of the maxillary palp. Therefore, to explain the loss of Orco-expressing neurons in the mutant (Figure 1F), a more rigorous explanation of the photo is required.

      (3) In Figure 1G, H, the four glomeruli are circled by dotted lines: their corresponding relationship between the two figures needs to be further clarified.

      (4) Line 130: Since the main topic in this study is the olfactory system of larvae, the experimental results of this part are all about antennal electrophysiological responses, mating frequency, and egg production of female and male adults of wild type and Orco KO mutant, it may be considered to include this part in the supplementary files. It is better to include some data about the olfactory responses of larvae.

      (5) Line 166: The sentences in the text are about the choice test between " healthy plant vs. infested plant", while in Fig 3C, it is "infested plant vs. no plant". The content in the text does not match the figure.

      (6) Lines 174-178: Figure 3A showed that the body weight of Orco KO larvae in the absence of parasitic wasps also decreased compared with that of WT. Therefore, in the experiments of Figure 3A and E, the difference in the body weight of Orco KO larvae in the presence or absence of parasitic wasps without ovipositors should also be compared. The current data cannot determine the reduced weight of KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (7) Lines 179-181: Figure 3F shows that the survival rate of larvae of Orco KO mutant decreased in the presence of parasitic wasps, and the difference in survival rate of larvae of WT and Orco KO mutant in the absence of parasitic wasps should also be compared. The current data cannot determine whether the reduced survival of the KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (8) In Figure 4B, why do the compounds tested have no volatiles derived from plants? Cruciferous plants have the well-known mustard bomb. In the behavioral experiments, the larvae responses to ITC compounds were not included, which is suggested to be explained in the discussion section.

      (9) The custom-made setup and the relevant behavioral experiments in Figure 4C need to be described in detail (Line 545).

      (10) Materials and Methods Line 448: 10 μL paraffin oil should be used for negative control.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #1 (Public review):

      The study introduces an open-source, cost-effective method for automating the quantification of male social behaviors in Drosophila melanogaster. It combines machine-learning-based behavioral classifiers developed using JAABA (Janelia Automatic Animal Behavior Annotator) with inexpensive hardware constructed from off-the-shelf components. This approach addresses the limitations of existing methods, which often require expensive hardware and specialized setups. The authors demonstrate that their new "DANCE" classifiers accurately identify aggression (lunges) and courtship behaviors (wing extension, following, circling, attempted copulation, and copulation), closely matching manually annotated ground-truth data. Furthermore, DANCE classifiers outperform existing rule-based methods in accuracy. Finally, the study shows that DANCE classifiers perform as well when used with low-cost experimental hardware as with standard experimental setups across multiple paradigms, including RNAi knockdown of the neuropeptide Dsk and optogenetic silencing of dopaminergic neurons.

      The authors make creative use of existing resources and technology to develop an inexpensive, flexible, and robust experimental tool for the quantitative analysis of Drosophila behavior. A key strength of this work is the thorough benchmarking of both the behavioral classifiers and the experimental hardware against existing methods. In particular, the direct comparison of their low-cost experimental system with established systems across different experimental paradigms is compelling. While JAABA-based classifiers have been previously used to analyze aggression and courtship (Tao et al., J. Neurosci., 2024; Sten et al., Cell, 2023; Chiu et al., Cell, 2021; Isshi et al., eLife, 2020; Duistermars et al., Neuron, 2018), the demonstration that they work as well without expensive experimental hardware opens the door to more low-cost systems for quantitative behavior analysis.

      Although the study provides a detailed evaluation of DANCE classifier performance, its conclusions would be strengthened by a more comprehensive analysis. The authors assess classifier accuracy using a bout-level comparison rather than a frame-level analysis, as employed in previous studies (Kabra et al., Nat Methods, 2013). They define a true positive as any instance where a DANCE-detected bout overlaps with a manually annotated ground-truth bout by at least one frame. This criterion may inflate true positive rates and underestimate false positives, particularly for longer-duration courtship behaviors. For example, a 15-second DANCE-classified wing extension bout that overlaps with ground truth for only one frame would still be considered a true positive. A frame-level analysis performance would help address this possibility.

      In summary, this work provides a practical and accessible approach to quantifying Drosophila behavior, reducing the economic barriers to the study of the neural and molecular mechanisms underlying social behavior.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    3. Reviewer #3 (Public review):

      The preprint by Yadav et al. describes a new setup to quantify a number of aggression and mating behaviors in Drosophila melanogaster. The investigation of these behaviors requires the analysis of a large number of videos to identify each kind of behavior displayed by a fly. Several approaches to automatize this process have been published before, but each of them has its limitations. The authors set out to develop a new setup that includes very low-cost, easy-to-acquire hardware and open-source machine-learning classifiers to identify and quantify the behavior.

      Strengths:

      (1) The study demonstrates that their cheap, simple, and easy-to-obtain hardware works just as well as custom-made, specialized hardware for analyzing aggression and mating behavior. This enables the setup to be used in a wide range of settings, from research with limited resources to classroom teaching.

      (2) The authors used previously published software to train new classifiers for detecting a range of behaviors related to aggression and mating and to make them freely available. The classifiers are very positively benchmarked against a manually acquired ground truth as well as existing algorithms.

      (3) The study demonstrates the applicability of the setup (hardware and classifiers) to common methods in the field by confirming a number of expected phenotypes with their setup.

      Weaknesses:

      (1) When measuring the performance of the duration-based classifiers, the authors count any bout of behavior as true positive if it overlaps with a ground-truth positive for only 1 frame - despite the minimal duration of a bout is 10 frames, and most bouts are much longer. That way, true positives could contain cases that are almost totally wrong as long there was an overlap of a single frame. For the mating behaviors that are classified in ongoing bouts, I think performance should be evaluated based on the % of correctly classified frames, not bouts.

      (2) In the methods part, only one of the pre-existing algorithms (MateBook), is described. Given that the comparison with those algorithms is a so central part of the manuscript, each of them should be briefly explained and the settings used in this study should be described.

      Taken together, this work can greatly facilitate research on aggression and mating in Drosophila. The combination of low-cost, off-the-shelf hardware and open-source, robust software enables researchers with very little funding or technical expertise to contribute to the scientific process and also allows large-scale experiments, for example in classroom teaching with many students, or for systematic screenings.

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    2. Reviewer #1 (Public Review):

      Summary:

      In this manuscript, Quach et al. report a detailed investigation into the defense mechanisms of Caenorhabditis elegans in response to predatory threats from Pristionchus pacificus. Based on principles from predatory imminence and prey refuge theories, the authors delineate three defense modes (pre-encounter, post-encounter, and circa-strike) corresponding to increasing levels of threat proximity. These modes are observed in a controlled but naturalistic setup and are quantified by multiple behavioral outputs defined in time and/or space domains allowing nuanced phenotypic assays. The authors demonstrate that C. elegans displays graded defense behavioral responses toward varied lethality of threats and that only life-threatening predators trigger all three defense modes. The study also offers a narrative on the behavioral strategies and underlying molecular regulation, focusing on the roles of SEB-3 receptors and NLP-49 peptides in mediating responses in these defense modes. They found that the interplay between SEB-3 and NLP-49 peptides appears complex, as evidenced by the diverse outcomes when either or both genes are manipulated in various behavioral modes.

      Strengths:

      The paper presents an interesting story, with carefully designed experiments and necessary controls, and novel findings and implications about predator-induced defensive behaviors and underlying molecular regulation in this important model organism. The design of experiments and description of findings are easy to follow and well-motivated. The findings contribute to our understanding of stress response systems and offer broader implications for neuroethological studies across species.

      Weaknesses:

      Although overall the study is well designed and movitated, the paper could benefit from further improvements on some of the methods descriptions and experiment interpretations.

    1. Reviewer #1 (Public review):

      Summary:

      This paper describes molecular dynamics simulations (MDS) of the dynamics of two T-cell receptors (TCRs) bound to the same major histocompatibility complex molecule loaded with the same peptide (pMHC). The two TCRs (A6 and B7) bind to the pMHC with similar affinity and kinetics, but employ different residue contacts. The main purpose of the study is to quantify via MDS the differences in the inter- and intra-molecular motions of these complexes, with a specific focus on what the authors describe as catch-bond behavior between the TCRs and pMHC, which could explain how T-cells can discriminate between different peptides in the presence of weak separating force.

      Strengths:

      The authors present extensive simulation data that indicates that, in both complexes, the number of high-occupancy inter-domain contacts initially increases with applied load, which is generally consistent with the authors' conclusion that both complexes exhibit catch-bond behavior, although to different extents. In this way, the paper expands our understanding of peptide discrimination by T-cells. The conclusions of the study are generally well supported by data. Further, the paper makes predictions about the relative strength of the catch-bond response of the two TCRs, which could be tested experimentally through protein mutagenesis and force application in Atomic Force Microscopy.

    2. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    3. Reviewer #3 (Public review):

      Summary:

      The paper by Chang-Gonzalez et al. is a molecular dynamics (MD) simulation study of the dynamic recognition (load-induced catch bond) by the T cell receptor (TCR) of the complex of peptide antigen (p) and the major histocompatibility complex (pMHC) protein. The methods and simulation protocols are essentially identical as those employed in a previous study by the same group (Chang-Gonzalez et al., eLife 2024). In the current manuscript the authors compare the binding of the same pMHC complex to two different TCRs, B7 and A6 which was investigated in the previous paper. While the binding is more stable for both TCRs under load (of about 10-15 pN) than in the absence of load, the main difference is that B7 shows a smaller amount of stable contacts with the pMHC than A6.

      Strengths:

      The topic is interesting because of the relevance of mechanosensing in biological processes including cellular immunology. The MD simulations provide strong evidence that different TCRs can respond mechanically in a different way upon binding the same pMHC complex. These findings are useful for interpreting how mechanical force is employed for modulating different function of T cells.

    1. Joint public review

      Summary:

      The authors examine the eigenvalue spectrum of the covariance matrix of neural recordings in the whole-brain larval zebrafish during hunting and spontaneous behavior. They find that the spectrum is approximately power law, and, more importantly, exhibits scale-invariance under random subsampling of neurons. This property is not exhibited by conventional models of covariance spectra, motivating the introduction of the Euclidean random matrix model. The authors show that this tractable model captures the scale invariance they observe. They also examine the effects of subsampling based on anatomical location or functional relationships. Finally, they discuss the benefit of neural codes which can be subsampled without significant loss of information.

      Strengths:

      With large-scale neural recordings becoming increasingly common, neuroscientists are faced with the question: how should we analyze them? To address that question, this paper proposes the Euclidean random matrix model, which embeds neurons randomly in an abstract feature space. This model is analytically tractable and matches two nontrivial features of the covariance matrix: approximate power law scaling, and invariance under subsampling. It thus introduces an important conceptual and technical advance for understanding large-scale simultaneously recorded neural activity.

      Comment:

      Are there quantitative comparisons of the collapse indices for the null models in Figure 2 and the data covariance in 2F? If so, this could be potentially useful to report.

    1. Reviewer #1 (Public review):

      Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

      The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents certain weaknesses that could be improved. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice.

      Comments on revised version:

      Some of the recommendations provided by this Reviewer in the first version of the manuscript have been successfully addressed in the revision. However, others, particularly those related to human translation, remain unresolved due to the lack of additional samples for analysis. Since the revised title now indicates that the mechanisms described were primarily observed in mice, it seems reasonable to defer addressing this issue to future studies.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #1 (Public review):

      Summary:

      This paper explores how diverse forms of inhibition impact firing rates in models for cortical circuits. In particular, the paper studies how the network operating point affects the balance of direct inhibition from SOM inhibitory neurons to pyramidal cells, and disinhibition from SOM inhibitory input to PV inhibitory neurons. This is an important issue as these two inhibitory pathways have largely been studies in isolation. A combination of analytical calculations and direct numerical simulations provide convincing evidence that the interplay of these inhibitory circuits can separately control network gain and stability.

      Strengths

      The paper has improved in revision, and the intuitive summary statements added to the end of each results section are quite helpful. The addition of numerical simulations to extend the conclusions beyond the linear range of network behavior are also quite helpful.

      Weaknesses

      None

    2. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    3. Reviewer #3 (Public review):

      Summary:

      Bos et al study a computational model of cortical circuits with excitatory (E) and two subtypes of inhibition - parvalbumin (PV) and somatostatin (SOM) expressing interneurons. They perform stability and gain analysis of simplified models with nonlinear transfer functions when SOM neurons are perturbed. Their analysis suggests that in a specific setup of connectivity, instability and gain can be untangled, such that SOM modulation leads to both increase in stability and gain, in contrast to the typical direction in neuronal networks where increased gain results in decreased stability.

      Strengths:

      - Analysis of the canonical circuit in response to SOM perturbations. Through numerical simulations and mathematical analysis, the authors have provided a rather comprehensive picture of how SOM modulation may affect response changes.<br /> - Shedding light on two opposing circuit motifs involved in the canonical E-PV-SOM circuitry - namely, direct inhibition (SOM -> E) vs disinhibition (SOM -> PV -> E). These two pathways can lead to opposing effects, and it is often difficult to predict which one results from modulating SOM neurons. In simplified circuits, the authors show how these two motifs can emerge and depend on parameters like connection weights.<br /> - Suggesting potentially interesting consequences for cortical computation. The authors suggest that certain regimes of connectivity may lead to untangling of stability and gain, such that increases in network gain are not compromised by decreasing stability. They also link SOM modulation in different connectivity regimes to versatile computations in visual processing in simple models.

      Weaknesses:

      - Computationally, the analysis is solid, but it's very similar to previous studies (del Molino et al, 2017). Many studies in the past few years have done the perturbation analysis of a similar circuitry with or without nonlinear transfer functions (some of them listed in the references). This study applies the same framework to SOM perturbations, which is a useful computational analysis, in view of the complexity of the high-dimensional parameter space.<br /> - A general weakness of the paper is a lack of direct comparison to biological parameters or experiments. How different experiments can be reconciled by the results obtained here, and what new circuit mechanisms can be revealed? In its current form, the paper reads as a general suggestion that different combinations of gain modulation and stability can be achieved in a circuit model equipped with many parameters (12 parameters). This is potentially interesting but not surprising, given the high dimensional space of possible dynamical properties. A more interesting result would have been to relate this to biology, by providing reasoning why it might be relevant to certain circuits (and not others), or to provide some predictions or postdictions, which are currently not very strong in the manuscript.<br /> - Tuning curves are simulated for an individual orientation (same for all neurons), not considering the heterogeneity of neuronal networks with multiple orientation selectivity (and other visual features) - making the model too simplistic.

    1. Reviewer #1 (Public review):

      Summary:

      In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift diffusion model, they further find that the best fitting model has different attentional discounts on the taste and health attributes, and that the attentional discount on the health information was larger for the hungry participants.

      Strengths:

      The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 8 different variants of the DDM, including recent models like the maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

      Weaknesses:

      While I do appreciate the within-participant design, it does raise a small concern about potential demand effects. The authors' results would have been more compelling if they had replicated when only analyzing the first session from each participant. However, the authors did demonstrate that there was no effect of order on the results, which helps to alleviate this concern.

    2. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.

    3. Reviewer #3 (Public review):

      Summary:

      This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry, and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

      Strengths:

      This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

      The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

      In summary the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

      Weaknesses:

      Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

      On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

      On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) to consuming a drink versus nothing, or (c) both.

      Comments on revisions:

      The authors addressed all my comments appropriately and I have no further requests. Thank you for the added discussion of findings and extra analyses.

    1. Reviewer #1 (Public Review):

      The authors recorded from multiple mossy cells (MCs) of the dentate gyrus in slices or in vivo using anesthesia. They recorded MC spontaneous activity during spontaneous sharp waves (SWs) detected in area CA3 (in vitro) or in CA1 ( in vivo). They find variability of the depolarization of MCs in response to a SW. They then used deep learning to parse out more information. They conclude that CA3 sends different "information" to different MCs. However, this is not surprising because different CA3 neurons project to different MCs and it was not determined if every SW reflected the same or different subsets of CA3 activity.

      The strengths include recording up to 5 MCs at a time. The major concerns are in the finding that there is variability. This seems logical, not surprising. Also it is not clear how deep learning could lead to the conclusion that CA3 sends different "information" to different MCs. It seems already known from the anatomy because CA3 neurons have diverse axons so they do not converge on only one or a few MCs. Instead they project to different MCs. Even if they would, there are different numbers of boutons and different placement of boutons on the MC dendrites, leading to different effects on MCs. There also is a complex circuitry that is not taken into account in the discussion or in the model used for deep learning. CA3 does not only project to MCs. It also projects to hilar and other dentate gyrus GABAergic neurons which have complex connections to each other, MCs, and CA3. Furthermore, MCs project to MCs, the GABAergic neurons, and CA3. Therefore at any one time that a SW occurs, a very complex circuitry is affected and this could have very different effects on MCs so they would vary in response to the SW. This is further complicated by use of slices where different parts of the circuit are transected from slice to slice.

      It is also not discussed if SWs have a uniform frequency during the recording session. If they cluster, or if MC action potentials occur just before a SW, or other neurons discharge before, it will affect the response of the MC to the SW. If MC membrane potential varies, this will also effect the depolarization in response to the SW.

      In vivo, the SWs may be quite different than in vivo but this is not discussed. The circuitry is quite different from in vitro. The effects of urethane could have many confounding influences.

      Furthermore, how much the in vitro and in vivo SWs tell us about SWs in awake behaving mice is unclear.

      Also, methods and figures are hard to understand.

    2. Reviewer #2 (Public Review):

      • A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

      • An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

      Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

      • An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

      • A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

    3. Reviewer #3 (Public Review):

      Compared to the pyramidal cells of the CA1 and CA3 regions of the hippocampus, and the granule cells of the dentate gyrus (DG), the computational role(s) of mossy cells of the DG have received much less attention over the years and are consequently not well understood. Mossy cells receive feedforward input from granule cells and feedback from CA3 cells. One significant factor is the compression of the large number of CA3 cells that input onto a much smaller population of mossy cells, which then send feedback connections to the granule cell layer. The present paper seeks to understand this compression in terms of neural coding, and asks whether the subthreshold activity of a small number of mossy cells can predict above chance levels the shapes of individual SWs produced by the CA3 cells. Using elegant multielectrode intracellular recordings of mossy cells, the authors use deep learning networks to show that they can train the network to "predict" the shape of a SW that preceded the intracellular activity of the mossy cells. Putatively, a single mossy cell can predict the shape of SWs above chance. These results are interesting, but there are some conceptual issues and questions about the statistical tests that must be addressed before the results can be considered convincing.

      Strengths<br /> (1) The paper uses technically challenging techniques to record from multiple mossy cells at the same time, while also recording SWs from the LFP of the CA3 layer. The data appear to be collected carefully and analyzed thoughtfully.<br /> (2) The question of how mossy cells process feedback input from CA3 is important to understand the role of this feedback pathway in hippocampal processing.<br /> (3) Given the concerns expressed below about proper statistical testing are resolved, the data appear supportive of the main conclusions of the authors and suggest that, to some degree, the much smaller population of mossy cells can conserve the information present in the larger population of CA3 cells, presumably by using a more compressed, dense population code.

      Weaknesses<br /> (4) Some of the statistical tests appear inappropriate because they treat each CA3 SW and associated Vm from a mossy cell as independent samples. This violates the assumptions of statistical tests such as the Kolmogorov-Smirnov tests of Figure 3C and Fig 3E. Although there is large variability among the SWs recorded and among the Vm's, they cannot be considered independent measurements if they derive from the same cell and same recording site of an individual animal. This becomes especially problematic when the number of dependent samples adds up to the tens of thousands, providing highly inflated numbers of samples that artificially reduce the p values. Techniques such as mixed-effects models are being increasingly used to factor out the effects of within cell and within animal correlations in the data. The authors need to do something similar to factor out these contributions in order to perform statistical tests, throughout the manuscript when this problem occurs.<br /> (5) A separate statistical problem occurs when comparing real data against a shuffled, surrogate data set. From the methods, I gather that Figure 3C combined data from 100 surrogate shuffles to compare to the real data. It is inappropriate to do a classic statistical test of data against such shuffles, because the number of points in the pooled surrogate data sets are not true samples from a population. It is a mathematical certainty that one can eventually drive a p value to < 0.05 just by increasing the number of shuffles sufficiently. Thus, the p value is determined by the number of computer shuffles allowed by the time and processing power of a computer, rather than by sampling real data from the population. Figures such as 4C and 5A are examples that test data against shuffle appropriately, as a single value is determined to be within or outside the 95% confidence interval of the shuffle, and this determination is not directly affected by the number of shuffles performed.<br /> (6) The last line of the Discussion states that this study provides "important insights into the information processing of neural circuits at the bottleneck layer," but it is not clear what these insights are. If the statistical problems are addressed appropriately, then the results do demonstrate that the information that is reflected in SWs can be reconstructed by cells in the MC bottleneck, but it is not certain what conceptual insights the authors have in mind. They should discuss more how these results further our understanding of the function of the feedback connection from CA3 to the mossy cells, discuss any limitations on their interpretation from recording LFPs rather than the single-unit ensemble activity (where the information is really encoded).<br /> 7) In Figure 1C, the maximum of the MC response on the first inset precedes the SW, and the onset of the Vm response may be simultaneous with SW. This would suggest that the SW did not drive the mossy cell, but this was a coincident event. How many SW-mossy cell recordings are like this? Do the authors have a technical reason to believe that these are events in which the mossy cell is driven by the CA3 cells active during the SW?

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript described a structure-guided approach to graft important antigenic loops of the neuraminidase to a homotypic but heterologous NA. This approach allows the generation of well-expressed and thermostable recombinant proteins with antigenic epitopes of choice to some extent. The loop-grafted NA was designated hybrid.

      Strengths:

      The hybrid NA appeared to be more structurally stable than the loop-donor protein while acquiring its antigenicity. This approach is of value when developing a subunit NA vaccine which is difficult to express. So that antigenic loops could be potentially grafted to a stable NA scaffold to transfer strain-specific antigenicity.

      Weaknesses:

      However, major revisions to better organize the text, and figure and make clarifications on a number of points, are needed. There are a few cases in which a later figure was described first, data in the figures were not sufficiently described, or where there were mismatched references to figures.

      More importantly, the hybrid proteins did not show any of the advantages over the loop-donor protein in the format of VLP vaccine in mouse studies, so it's not clear why such an approach is needed to begin with if the original protein is doing fine.

    2. Reviewer #2 (Public review):

      In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

      Major points

      (1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

      (2) The rationale regarding the PR8 hybrid is not well described and should be described better.

      (3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

      (4) Figure 5A and 7A: Negative controls are missing.

      (5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Wu et al. introduce a novel approach to reactivate the Muller glia cell cycle in the mouse retina by simultaneously reducing p27Kip1 and increasing cyclin D1 using a single AAV vector. The approach effectively promotes Muller glia proliferation and reprogramming without disrupting retinal structure or function. Interestingly, reactivation of the Muller glia cell cycle downregulates IFN pathway, which may contribute to the induced retinal regeneration. The results presented in this manuscript may offer a promising approach for developing Müller glia cell-mediated regenerative therapies for retinal diseases.

      Comments on revisions:

      The authors have revised the manuscript and addressed my concerns.

    2. Reviewer #2 (Public review):

      This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

      The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

    1. Reviewer #1 (Public review):

      Summary:

      Mehmet Mahsum Kaplan et al. demonstrate that Meis2 expression in neural crest-derived mesenchymal cells is crucial for whisker follicle (WF) development, as WF fails to develop in wnt1-Cre;Meis2 cKO mice. Advanced imaging techniques effectively support the idea that Meis2 is essential for proper WF development and that nerves, while affected in Meis2 cKO, are dispensable for WF development and not the primary cause of WF developmental failure. The study also reveals that although Meis2 significantly downregulates Foxd1 in the mesenchyme, this is not the main reason for WF development failure. The paper presents valuable data on the role of mesenchymal Meis2 in WF development. However, it is still not known what is the molecular mechanisms that link Meis2 to impact the epithelial compartment.

      Strengths:

      (1) The authors describe a novel molecular mechanism involving Mesenchymal Meis2 expression, which plays a crucial role in early WF development.<br /> (2) They employ multiple advanced imaging techniques to illustrate their findings beautifully.<br /> (3) The study clearly shows that nerves are not essential for WF development.

      Weaknesses:

      The paper lacks clarity on how Meis2 loss, along with the observed general reduction in proliferation and changes in extracellular matrix and cell adhesion, leads specifically to the loss of whisker follicles. Future studies addressing this gap, perhaps with methods enabling higher cell recovery or epithelial cell inclusion in the sequenced cells, could provide valuable insights into the specific roles of Meis2 in this context.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

      Strengths:

      The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

      Comments on revised version:

      In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

      In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

      Additional comments:

      The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

    1. Reviewer #1 (Public Review):

      Summary:

      In this work, the authors present a novel, multi-layer computational model of motor control to produce realistic walking behaviour of a Drosophila model in the presence of external perturbations and under sensory and motor delays. The novelty of their model of motor control is that it is modular, with divisions inspired by the fly nervous system, with one component based on deep learning while the rest are based on control theory. They show that their model can produce realistic walking trajectories. Given the mostly reasonable assumptions of their model, they convincingly show that the sensory and motor delays present in the fly nervous system are the maximum allowable for robustness to unexpected perturbations.

      Their fly model outputs torque at each joint in the leg, and their dynamics model translates these into movements, resulting in time-series trajectories of joint angles. Inspired by the anatomy of the fly nervous system, their fly model is a modular architecture that separates motor control at three levels of abstraction:<br /> (1) oscillator-based model of coupling of phase angles between legs,<br /> (2) generation of future joint-angle trajectories based on the current state and inputs for each leg (the trajectory generator), and<br /> (3) closed-loop control of the joint-angles using torques applied at every joint in the model (control and dynamics).

      These three levels of abstraction ensure coordination between the legs, future predictions of desired joint angles, and corrections to deviations from desired joint-angle trajectories. The parameters of the model are tuned in the absence of external perturbations using experimental data of joint angles of a tethered fly. A notable disconnect from reality is that the dynamics model used does not model the movement of the body and ground contacts as is the case in natural walking, nor the movement of a ball for a tethered fly, but instead something like legs moving in the air for a tethered fly.

      In order to validate the realism of the generated simulated walking trajectories, the authors compare various attributes of simulated to real tethered fly trajectories and show qualitative and quantitative similarities, including using a novel metric coined as Kinematic Similarity (KS). The KS score of a trajectory is a measure of the likelihood that the trajectory belongs to the distribution of real trajectories estimated from the experimental data. While such a metric is a useful tool to validate the quality of simulated data, there is some room for improvement in the actual computation of this score. For instance, the KS score is computed for any given time-window of walking simulation using a fraction of information from the joint-angle trajectories. It is unclear if the remaining information in joint-angle trajectories that are not used in the computation of the KS score can be ignored in the context of validating the realism of simulated walking trajectories.

      The authors validate simulated walking trajectories generated by the trained model under a range of sensorimotor delays and external perturbations. The trained model is shown to generate realistic joint-angle trajectories in the presence of external perturbations as long as the sensorimotor delays are constrained within a certain range. This range of sensorimotor delays is shown to be comparable to experimental measurements of sensorimotor delays, leading to the conclusion that the fly nervous system is just fast enough to be robust to perturbations.

      Strengths:

      This work presents a novel framework to simulate Drosophila walking in the presence of external perturbations and sensorimotor delay. Although the model makes some simplifying assumptions, it has sufficient complexity to generate new, testable hypotheses regarding motor control in Drosophila. The authors provide evidence for realistic simulated walking trajectories by comparing simulated trajectories generated by their trained model with experimental data using a novel metric proposed by the authors. The model proposes a crucial role in future predictions to ensure robust walking trajectories against external perturbations and motor delay. Realistic simulations under a range of prediction intervals, perturbations, and motor delays generating realistic walking trajectories support this claim. The modular architecture of the framework provides opportunities to make testable predictions regarding motor control in Drosophila. The work can be of interest to the Drosophila community interested in digitally simulating realistic models of Drosophila locomotion behaviors, as well as to experimentalists in generating testable hypotheses for novel discoveries regarding neural control of locomotion in Drosophila. Moreover, the work can be of broad interest to neuroethologists, serving as a benchmark in modelling animal locomotion in general.

      Weaknesses:

      As the authors acknowledge in their work, the control and dynamics model makes some simplifying assumptions about Drosophila physics/physiology in the context of walking. For instance, the model does not incorporate ground contact forces and inertial effects of the fly's body. It is not clear how these simplifying assumptions would affect some of the quantitative results derived by the authors. The range of tolerable values of sensorimotor delays that generate realistic walking trajectories is shown to be comparable with sensorimotor delays inferred from physiological measurements. It is unclear if this comparison is meaningful in the context of the model's simplifying assumptions. The authors propose a novel metric coined as Kinematic Similarity (KS) to distinguish realistic walking trajectories from unrealistic walking trajectories. Defining such an objective metric to evaluate the model's predictions is a useful exercise, and could potentially be applied to benchmark other computational animal models that are proposed in the future. However, the KS score proposed in this work is calculated using only the first two PCA modes that cumulatively account for less than 50% of the variance in the joint angles. It is not obvious that the information in the remaining PCA modes may not change the log-likelihood that occurs in the real walking data.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    2. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    1. Reviewer #1 (Public review):

      The authors introduces DIPx, a deep learning framework for predicting synergistic drug combinations for cancer treatment using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset. While the approach is innovative, I have following concerns and comments, and hopefully will improve the study's rigor and applicability, making it a more powerful tool in real clinical world.

      (1) In the abstract: "We trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set, while Test Set 2 contained combinations absent from the training set, thus indicating the model's ability to handle novel combinations". Test Set 1 comprises combinations already present in the training set, likely leading overfitting issue. The model might show inflated performance metrics on this test set due to prior exposure to these combinations, not accurately reflecting its true predictive power on unknown data, which is crucial for discovering new drug synergies. The testing approach reduces the generalizability of the model's findings to new, untested scenarios.

      (2) The model struggles with predicting synergies for drug combinations not included in its training data (showing only Spearman correlation 0.26 in Test Set 2). This limits its potential for discovering new therapeutic strategies. Utilizing techniques such as transfer learning or expanding the training dataset to encompass a wider range of drug pairs could help to address this issue.

      (3) The use of pan-cancer datasets, while offering broad applicability, may not be optimal for specific cancer subtypes with distinct biological mechanisms. Developing subtype-specific models or adjusting the current model to account for these differences could improve prediction accuracy for individual cancer types.

      (4) Line 127, "Since DIPx uses only molecular data, to make a fair comparison, we trained TAJI using only molecular features and referred to it as TAJI-M.". TAJI was designed to use both monotherapy drug-response and molecular data, and likely won't be able to reach maximum potential if removing monotherapy drug-response from the training model. It would be critical to use the same training datasets and then compare the performances. From the Figure 6 of TAJI's paper (Li et al., 2018, PMID: 30054332) , i.e., the mean Pearson correlation for breast cancer and lung cancer are around 0.5 - 0.6.

      The following 2 concerns had been include in the Discussion section which are great:

      (1) Training and validating the model using cell lines may not fully capture the heterogeneity and complexity of in vivo tumors. To increase clinical relevance, it would be beneficial to validate the model using primary tumor samples or patient-derived xenografts.

      (2) The Pathway Activation Score (PAS) is derived exclusively from primary target genes, potentially overlooking critical interactions involving non-primary targets. Including these secondary effects could enhance the model's predictive accuracy and comprehensiveness.

      Comments on revisions:

      The authors replied to my concerns but they did not address my comments/concerns. Especially for my concern #1: They trained and validated DIPx in the AstraZeneca-Sanger (AZS) DREAM Challenge dataset using two separate test sets: Test Set 1 comprised the combinations already present in the training set. Therefore, test Set 1 comprises combinations already present in the training set, likely leading overfitting issue but they claimed "There is no danger overfitting here" in their "Author Response" letter.

      All my other concerns are unchanged too.

    2. Reviewer #2 (Public review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

      In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

      (1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

    3. Reviewer #3 (Public review):

      Summary:

      Predicting how two different drugs act together by looking at their specific gene targets and pathways is crucial for understanding the biological significance of drug combinations. This study incorporates drug-specific pathway activation scores (PASs) to estimate synergy scores as one of the key advancements for synergy prediction. The new algorithm, Drug synergy Interaction Prediction (DIPx), developed in this study, uses gene expression, mutation profiles, and drug synergy data to train the model and predict synergy between two drugs. Comprehensive comparisons with another best-performing algorithm, TAIJI-M, highlight the potential of its capabilities.

      Strengths:

      DIPx uses target and driver genes to elucidate pathway activation scores (PASs) to predict drug synergy. This approach integrates gene expression, mutation profiles, and drug synergy data to capture information about the functional interactions between drug targets, thereby providing a potential biological explanation for the synergistic effects of combined drugs. DIPx's performance was tested using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset, especially in Test Set 1, where the Spearman correlation coefficient between predicted and observed drug synergy was 0.50 (95% CI: 0.47-0.53). DIPx's ability to handle novel combinations, as evidenced by its performance in Test Set 2, indicates its potential for predictions of new and untested drug combinations.

      Weaknesses:

      While the DIPx algorithm shows promise in predicting drug synergy based on pathway activation scores, it's essential to consider its limitations. One limitation is that the availability of training data for specific drug combinations may influence its predictive capability. Further testing and experimental validation of the predictions in future studies would be necessary to fully assess the algorithm's generalizability and robustness.

    1. Reviewer #1 (Public review):

      Summary:

      Jocher, Janssen, et al examine the robustness of comparative functional genomics studies in primates that make use of induced pluripotent stem cell-derived cells. Comparative studies in primates, especially amongst the great apes, are generally hindered by the very limited availability of samples, and iPSCs, which can be maintained in the laboratory indefinitely and defined into other cell types, have emerged as promising model systems because they allow the generation of data from tissues and cells that would otherwise be unobservable.

      Undirected differentiation of iPSCs into many cell types at once, using a method known as embryoid body differentiation, requires researchers to manually assign all cell types in the dataset so they can be correctly analysed. Typically, this is done using marker genes associated with a specific cell type. These are defined a priori, and have historically tended to be characterised in mice and humans and then employed to annotate other species. Jocher, Janssen, et al ask if the marker genes and features used to define a given cell type in one species are suitable for use in a second species, and then quantify the degree of usefulness of these markers. They find that genes that are informative and cell type specific in a given species are less valuable for cell type identification in other species, and that this value, or transferability, drops off as the evolutionary distance between species increases.

      This paper will help guide future comparative studies of gene expression in primates (and more broadly) as well as add to the growing literature on the broader challenges of selecting powerful and reliable marker genes for use in single-cell transcriptomics.

      Strengths:

      Marker gene selection and cell type annotation is a challenging problem in scRNA studies, and successful classification of cells often requires manual expert input. This can be hard to reproduce across studies, as, despite general agreement on the identity of many cell types, different methods for identifying marker genes will return different sets of genes. The rise of comparative functional genomics complicates this even further, as a robust marker gene in one species need not always be as useful in a different taxon. The finding that so many marker genes have poor transferability is striking, and by interrogating the assumption of transferability in a thorough and systematic fashion, this paper reminds us of the importance of systematically validating analytical choices. The focus on identifying how transferability varies across different types of marker genes (especially when comparing TFs to lncRNAs), and on exploring different methods to identify marker genes, also suggests additional criteria by which future researchers could select robust marker genes in their own data.

      The paper is built on a substantial amount of clearly reported and thoroughly considered data, including EBs and cells from four different primate species - humans, orangutans, and two macaque species. The authors go to great lengths to ensure the EBs are as comparable as possible across species, and take similar care with their computational analyses, always erring on the side of drawing conservative conclusions that are robustly supported by their data over more tenuously supported ones that could be impacted by data processing artefacts such as differences in mappability, etc. For example, I like the approach of using liftoff to robustly identify genes in non-human species that can be mapped to and compared across species confidently, rather than relying on the likely incomplete annotation of the non-human primate genomes. The authors also provide an interactive data visualisation website that allows users to explore the dataset in depth, examine expression patterns of their own favourite marker genes and perform the same kinds of analyses on their own data if desired, facilitating consistency between comparative primate studies.

      Weaknesses and recommendations:

      (1) Embryoid body generation is known to be highly variable from one replicate to the next for both technical and biological reasons, and the authors do their best to account for this, both by their testing of different ways of generating EBs, and by including multiple technical replicates/clones per species. However, there is still some variability that could be worth exploring in more depth. For example, the orangutan seems to have differentiated preferentially towards cardiac mesoderm whereas the other species seemed to prefer ectoderm fates, as shown in Figure 2C. Likewise, Supplementary Figure 2C suggests a significant unbalance in the contributions across replicates within a species, which is not surprising given the nature of EBs, while Supplementary Figure 6 suggests that despite including three different clones from a single rhesus macaque, most of the data came from a single clone. The manuscript would be strengthened by a more thorough exploration of the intra-species patterns of variability, especially for the taxa with multiple biological replicates, and how they impact the number of cell types detected across taxa, etc.

      The same holds for the temporal aspect of the data, which is not really discussed in depth despite being a strength of the design. Instead, days 8 and 16 are analysed jointly, without much attention being paid to the possible differences between them. Are EBs at day 16 more variable between species than at day 8? Is day 8 too soon to do these kinds of analyses? Are markers for earlier developmental progenitors better/more transferable than those for more derived cell types?

      (2) Closely tied to the point above, by necessity the authors collapse their data into seven fairly coarse cell types and then examine the performance of canonical marker genes (as well as those discovered de novo) across the species. However some of the clusters they use are somewhat broad, and so it is worth asking whether the lack of specificity exhibited by some marker genes and driving their conclusions is driven by inter-species heterogeneity within a given cluster.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

      Strengths:

      To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

      Weaknesses:

      However, several critical points need to be addressed.

      (1) Use of Liftoff for GTF Annotation

      The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

      (2) Transcript Filtering and Potential Biases

      The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

      (3) Data Integration with Harmony

      The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

    1. Reviewer #1 (Public review):

      Summary:

      This is an important and very well-presented set of experiments following up on prior work from the lab investigating knock-down (KD) of EMC10 in restoration of neuronal and cognitive deficits in 22q11.2 Del models, including now both human iPSCs and a mouse model in vivo now with ASOs.

      The valuable progress in this current manuscript is the development of ASOs, and the proof of efficacy in vivo in mouse of the ASO in knock-down of EMC10 and amelioration of in vivo behavioral phenotypes.

      The experiments include: iPSC studies demonstrating elevations of EMC10 in a solid collection of paired iPSC lines. These studies also provide evidence of manipulation of EMC10 by overexpression and inhibition of miRNAs that exist in the 22q11 interval. The iPSC studies also nicely demonstrate rescue of impairments with KD of EMC10 in neuronal arborization as well as KCl induced neuronal activity. The major in vivo contributions reflect impressive demonstration of efficacy of two ASOs in vivo on both KD of EMC10 in vivo and through improvement in behavioral abnormalities in the 22q11 mouse in a range of different behaviors, including social behavior and learning behaviors.

      Overall, there are many strengths reflected in this study, including in particular the synergy between in vitro studies in human cell models and in vivo studies in the well characterized mouse model. The experiments are generally rigorously performed and well powered, and nicely presented. The claims with regard to the mechanisms of EMC10 elevations and the importance of restoration of EMC10 expression to neuronal morphology and behavior are well supported by the data. The work may be further supported in future studies, by investigation of rescue by ASOs of circuit dysfunction in vivo or ex vivo through electrophysiology in the mouse model. Also, in future studies, investigation of the mechanism by which EMC10, an ER protein involved in protein processing, may function in the observed neuronal abnormalities; however, these studies are clearly for future investigations.

      The potential impact of the work is found in the potential value of the ASO approach to the treatment of 22q11, or the pre-clinical evidence that knock-down of this protein may lead to some amelioration of cognitive symptoms. Overall, a very convincing and complementary set of experiments to support EMC10 KD as a therapeutic strategy.

      Review of revision: The authors have addressed the questions from the prior review.

    1. Reviewer #2 (Public review):

      This manuscript by Yu et al. demonstrates that activation of caspase-3 is essential for synapse elimination by microglia, but not by astrocytes. This study also reveals that caspase-3 activation-mediated synapse elimination is required for retinogeniculate circuit refinement and eye-specific territories segregation in dLGN in an activity-dependent manner. Inhibition of synaptic activity increases caspase-3 activation and microglial phagocytosis, while caspase-3 deficiency blocks microglia-mediated synapse elimination and circuit refinement in the dLGN. The authors further demonstrate that caspase-3 activation mediates synapse loss in AD, loss of caspase-3 prevented synapse loss in AD mice. Overall, this study reveals that caspase-3 activation is an important mechanism underlying the selectivity of microglia-mediated synapse elimination during brain development and in neurodegenerative diseases.

      A previous study (Gyorffy B. et al., PNSA 2018) has shown that caspase-3 signal correlates with C1q tagging of synapses (mostly using in vitro approaches), which suggests that caspase-3 would be an underlying mechanism of microglial selection of synapses for removal. The current study provides convincing in vivo evidence demonstrating that caspase-3 activation is essential for microglial elimination of synapses during both brain development and neurodegeneration.

    1. Reviewer #2 (Public review):

      The authors investigated the similarity (or lack thereof) of neural dynamics while monkeys reached to and manipulated one of 4 objects in each trial, compared to observing similar movements performed by experimenters. They focused on mirror neurons (MNs) and rather convincingly showed that MNs dynamics are dissimilar during executing vs. observing actions. The manuscript has improved quite significantly compared to the previous version and I congratulate the authors for that. However, there are still a few points I would like to raise that I think will improve the manuscript scientifically and make it more pleasant to read.

      - I appreciate the nicely compiled literature review which provides the context for the manuscript.<br /> - Message: The takeaway message of the paper is inconsistent and changes throughout the paper. To me, the main takeaway is that observation and execution subspaces progress during the trial (Fig 4), and that they are distinct processes and rather dissimilar, as stated in #440-441, #634-635, etc. But the title of the paper implies the opposite. Some of the interpretations of the results (e.g., Fig 8) also imply similarity of dynamics.<br /> - Readability: I have many issues with the readability/organisation of the paper. Unfortunately, I still find the quality of data presentation low. Below I list a few points:<br /> (1) In 5 sessions out of 9, there are fewer than 20 neurons categorised as AE. This means this population is under-sampled in the data which makes applying any neural population techniques questionable. Moreover, the relevance of the AE analysis is also sometimes unclear: In Fig 4, the AE-related panels are just referred to once in the paper. Yet AE results are presented right next to the main results throughout the paper.<br /> (2) Figures are low resolution and pixelated. There are some faded horizontal and vertical lines in Fig1B that are barely visible. Moreover, it may be my personal preference, but I think Fig1 is more confusing than helpful. Although panel A shows some planes rotating, indicating time-varying dynamics, I couldn't understand what more panel B is trying to convey. The arrow of time is counterclockwise, but the planes progress clockwise (i > ii > iii). Similarly, panel C just seems to show some points being projected to orthogonal subspaces (even though later in the paper we'll see that observation and execution subspaces are not orthogonal), and the CCA subspace illustrated in the same high-d space, which mathematically may be inaccurate, as CCA projects the data to a new space.<br /> In Fig 2A, the objects are too small and pixelated as well. I suggest an overhaul of the figures to make the paper more accessible.<br /> (3) Clarity of the text: The manuscript text could be more concise, to the point, avoiding repetitions, self-consistent, and simply readable. To name a few issues: Single letter acronyms were used to refer to trial epochs (I/G/M/H). M alone has been re-defined 13 different times in the text as in: ...Movement (M)..., excluding every related figure. The acronym (I) refers to the instruction epoch, the high-d space in Fig 1, and panel I of some figures. The acronym MN for Mirror Neurons was defined 4 separate times in the text yet spelled out as Mirror Neuron more than 2 dozen times. CD is defined in the caption of Fig 3 and never used, despite condition-dependent being a common term in the text. Many sentences, e.g., "In contrast, throughout..." in #265-#269, and "To summarize,..." in #270-#275, are too long with difficult wording. To get the point from these sentences, I had to read them many times, and go back and forth between them and the figure. Rewriting such sentences makes the manuscript much more accessible.<br /> - Figure 3: It appears that the condition independent signal has been calculated by subtracting the average of the 4 neural trajectories in Fig 3A, corresponding to different objects. Whereas #133 suggests that it should be calculated by subtracting the average firing rate of different conditions. Assuming I got the methods right, dynamics being "knotted" (#234) after removing the condition independent signal could be because they are similar, so subtracting the condition independent signal leaves us with the noise component. This matters for the manuscript especially since this is the reason for performing the more sensitive instantaneous subspaces.<br /> - Decoding results: I appreciate that the authors improved the decoding results in this version of the manuscript. Now it is much more interesting. However oddly, it appears that only data from 1 monkey is shown. #370 says the results from the other 2 are similar. The decoding data from every monkey must be shown. If the results are similar, they must be at least in Supplements. Currently, only 1 session (out of 3) in the Observation condition seems to decode the object type. This effect, if consistent across animals and session, is very interesting on its own and challenges other claims in the paper.<br /> - Figure8: I reiterate the issue #7 in my previous review. I appreciate the authors clearing some methods, but my concern persists. As per line #839, spiking activity has been smoothed with a 50ms kernel. Thus, unless trial data is concatenated, I suspect the 100ms window used for this analysis is too short (small sample size), thus the correlation values (CCs) might be spurious. References cited in this section use a smaller smoothing kernel (30ms) and a much longer window (~450ms).<br /> Moreover, I don't know why the authors chose to show correlation values in 3D space! Values of Fig8C-red are impossible to know. Furthermore, the manuscript insists on CC values of the Hold period being high, which is probably correct. But I wonder why the focus on the Hold period? I think the most relevant epoch for analysing the MNs is the Movement where the actual action happens. Interestingly, in the movement epoch, the CC values are visibly low. The reason why Hold results are more important and why the CCs in Movement are so low should be clarified in the text. Especially, statements like that in #661 seem particularly unjustified.

    2. Reviewer #3 (Public review):

      In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

      Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

    3. Reviewer #4 (Public review):

      Summary:

      In this study, the authors explore the neural dynamics of mirror neurons in the premotor cortex, focusing on the relationship between neural activity during action execution and observation. The study presents a rich dataset from three monkeys, with recordings from two regions per monkey. The authors use a method to analyze instantaneous neural subspaces and track their temporal evolution. Consistent with prior literature, they report that execution and observation subspaces remain largely distinct throughout the trial. However, after applying canonical correlation analysis, they observe a notable alignment between execution and observation activities, suggesting the presence of shared neural codes. The study is well-designed, and the analyses are thoroughly documented, occasionally overly so in the main text. While most findings are compelling, I find the conclusions drawn from Figure 8 less convincing. Specifically, I am skeptical about the application of CCA in this context and the subsequent interpretations regarding execution-observation similarity, which is a central claim of the manuscript.

      • The authors cite Safaie et al. 2023 as a precedent for applying CCA to align neural population dynamics. However, in that study, CCA was used to align neural dynamics across different animals, a justifiable approach given that neural trajectories exist in separate neural state spaces for each animal. Here, CCA is applied to align execution and observation activities within the same neural state space of the same MNs. I find this application of CCA less well-justified, as it may overestimate execution-observation similarity.<br /> • The control conditions presented in Figures 8C and 8D are somewhat reassuring, as they show that the similarity introduced by CCA is not universally high. However, these controls appear to be limited to the Hold epoch. It remains unclear whether the same holds true for the Go and Movement epochs.<br /> • In Figure 5, the authors display low-dimensional representations of four objects across task epochs during execution (A) and observation (B). The diagonals of the matrices reveal clear differences between execution and observation configurations across all four epochs. The authors suggest using CCA to align these configurations; however, this alignment seems to require time-specific application of CCA for each epoch (as demonstrated in Figure 8 for the Hold epoch). The need for time-specific adjustments likely depends on the fact that execution and observation subspaces are continuously shifting over time (as authors show in Figure 4), but this approach appears to be a strained attempt to demonstrate similarity between execution and observation codes.<br /> • The authors themselves offer an alternative hypothesis (line 730): that "PM MN population activity during action observation, rather than representing movements made by another individual similar to one's own movements, instead may represent different movements one might execute oneself in response to those made by another individual". This interpretation appears more congruent with the data presented.<br /> • In the end, I am left with a sense of ambiguity: which analysis should be considered more reliable, the negligible correspondence between execution and observation activity depicted in Figure 7, or the considerable similarity shown in Figure 8? The authors should address this apparent contradiction and provide a clearer discussion to reconcile these findings.

    1. Reviewer #1 (Public review):

      Summary:

      From a forward genetic mosaic mutant screen using EMS, the authors identify mutations in glucosylceramide synthase (GlcT), a rate-limiting enzyme for glycosphingolipid (GSL) production, that result in EE tumors. Multiple genetic experiments strongly support the model that the mutant phenotype caused by GlcT loss is due to by failure of conversion of ceramide into glucosylceramide. Further genetic evidence suggests that Notch signaling is comprised in the ISC lineage and may affect the endocytosis of Delta. Loss of GlcT does not affect wing development or oogenesis, suggesting tissue-specific roles for GlcT. Finally, an increase in goblet cells in UGCG knockout mice, not previously reported, suggests a conserved role for GlcT in Notch signaling in intestinal cell lineage specification.

      Strengths:

      Overall, this is a well-written paper with multiple well-designed and executed genetic experiments that support a role for GlcT in Notch signaling in the fly and mammalian intestine. I do, however, have a few comments below.

      Weaknesses:

      (1) The authors bring up the intriguing idea that GlcT could be a way to link diet to cell fate choice. Unfortunately, there are no experiments to test this hypothesis.

      (2) Why do the authors think that UCCG knockout results in goblet cell excess and not in the other secretory cell types?

      (3) The authors should cite other EMS mutagenesis screens done in the fly intestine.

      (4) The absence of a phenotype using NRE-Gal4 is not convincing. This is because the delay in its expression could be after the requirement for the affected gene in the process being studied. In other words, sufficient knockdown of GlcT by RNA would not be achieved until after the relevant signaling between the EB and the ISC occurred. Dl-Gal4 is problematic as an ISC driver because Dl is expressed in the EEP.

      (5) The difference in Rab5 between control and GlcT-IR was not that significant. Furthermore, any changes could be secondary to increases in proliferation.

    2. Reviewer #2 (Public review):

      Summary:

      This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

      Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

      Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

      Strengths:

      The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

      The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

      Weaknesses:

      This study is not, however, without caveats and several specific conclusions are not fully convincing.

      First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

      Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

      Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

    3. Reviewer #3 (Public review):

      Summary:

      In this paper, Tang et al report the discovery of a Glycoslyceramide synthase gene, GlcT, which they found in a genetic screen for mutations that generate tumorous growth of stem cells in the gut of Drosophila. The screen was expertly done using a classic mutagenesis/mosaic method. Their initial characterization of the GlcT alleles, which generate endocrine tumors much like mutations in the Notch signaling pathway, is also very nice. Tang et al checked other enzymes in the glycosylceramide pathway and found that the loss of one gene just downstream of GlcT (Egh) gives similar phenotypes to GlcT, whereas three genes further downstream do not replicate the phenotype. Remarkably, dietary supplementation with a predicted GlcT/Egh product, Lactosyl-ceramide, was able to substantially rescue the GlcT mutant phenotype. Based on the phenotypic similarity of the GlcT and Notch phenotypes, the authors show that activated Notch is epistatic to GlcT mutations, suppressing the endocrine tumor phenotype and that GlcT mutant clones have reduced Notch signaling activity. Up to this point, the results are all clear, interesting, and significant. Tang et al then go on to investigate how GlcT mutations might affect Notch signaling, and present results suggesting that GlcT mutation might impair the normal endocytic trafficking of Delta, the Notch ligand. These results (Fig X-XX), unfortunately, are less than convincing; either more conclusive data should be brought to support the Delta trafficking model, or the authors should limit their conclusions regarding how GlcT loss impairs Notch signaling. Given the results shown, it's clear that GlcT affects EE cell differentiation, but whether this is via directly altering Dl/N signaling is not so clear, and other mechanisms could be involved. Overall the paper is an interesting, novel study, but it lacks somewhat in providing mechanistic insight. With conscientious revisions, this could be addressed. We list below specific points that Tang et al should consider as they revise their paper.

      Strengths:

      The genetic screen is excellent.

      The basic characterization of GlcT phenotypes is excellent, as is the downstream pathway analysis.

      Weaknesses:

      (1) Lines 147-149, Figure 2E: here, the study would benefit from quantitations of the effects of loss of brn, B4GalNAcTA, and a4GT1, even though they appear negative.

      (2) In Figure 3, it would be useful to quantify the effects of LacCer on proliferation. The suppression result is very nice, but only effects on Pros+ cell numbers are shown.

      (3) In Figure 4A/B we see less NRE-LacZ in GlcT mutant clones. Are the data points in Figure 4B per cell or per clone? Please note. Also, there are clearly a few NRE-LacZ+ cells in the mutant clone. How does this happen if GlcT is required for Dl/N signaling?

      (4) Lines 222-225, Figure 5AB: The authors use the NRE-Gal4ts driver to show that GlcT depletion in EBs has no effect. However, this driver is not activated until well into the process of EB commitment, and RNAi's take several days to work, and so the author's conclusion is "specifically required in ISCs" and not at all in EBs may be erroneous.

      (5) Figure 5C-F: These results relating to Delta endocytosis are not convincing. The data in Fig 5C are not clear and not quantitated, and the data in Figure 5F are so widely scattered that it seems these co-localizations are difficult to measure. The authors should either remove these data, improve them, or soften the conclusions taken from them. Moreover, it is unclear how the experiments tracing Delta internalization (Fig 5C) could actually work. This is because for this method to work, the anti-Dl antibody would have to pass through the visceral muscle before binding Dl on the ISC cell surface. To my knowledge, antibody transcytosis is not a common phenomenon.

      (6) It is unclear whether MacCer regulates Dl-Notch signaling by modifying Dl directly or by influencing the general endocytic recycling pathway. The authors say they observe increased Dl accumulation in Rab5+ early endosomes but not in Rab7+ late endosomes upon GlcT depletion, suggesting that the recycling endosome pathway, which retrieves Dl back to the cell surface, may be impaired by GlcT loss. To test this, the authors could examine whether recycling endosomes (marked by Rab4 and Rab11) are disrupted in GlcT mutants. Rab11 has been shown to be essential for recycling endosome function in fly ISCs.

      (7) It remains unclear whether Dl undergoes post-translational modification by MacCer in the fly gut. At a minimum, the authors should provide biochemical evidence (e.g., Western blot) to determine whether GlcT depletion alters the protein size of Dl.

      (8) It is unfortunate that GlcT doesn't affect Notch signaling in other organs on the fly. This brings into question the Delta trafficking model and the authors should note this. Also, the clonal marker in Figure 6C is not clear.

      (9) The authors state that loss of UGCG in the mouse small intestine results in a reduced ISC count. However, in Supplementary Figure C3, Ki67, a marker of ISC proliferation, is significantly increased in UGCG-CKO mice. This contradiction should be clarified. The authors might repeat this experiment using an alternative ISC marker, such as Lgr5.

    1. Reviewer #1 (Public review):

      Summary:

      The authors propose a transformer-based model for the prediction of condition - or tissue-specific alternative splicing and demonstrate its utility in the design of RNAs with desired splicing outcomes, which is a novel application. The model is compared to relevant existing approaches (Pangolin and SpliceAI) and the authors clearly demonstrate its advantage. Overall, a compelling method that is well thought out and evaluated.

      Strengths:

      (1) The model is well thought out: rather than modeling a cassette exon using a single generic deep learning model as has been done e.g. in SpliceAI and related work, the authors propose a modular architecture that focuses on different regions around a potential exon skipping event, which enables the model to learn representations that are specific to those regions. Because each component in the model focuses on a fixed length short sequence segment, the model can learn position-specific features. Another difference compared to Pangolin and SpliceAI which are focused on modeling individual splice junctions is the focus on modeling a complete alternative splicing event.

      (2) The model is evaluated in a rigorous way - it is compared to the most relevant state-of-the-art models, uses machine learning best practices, and an ablation study demonstrates the contribution of each component of the architecture.

      (3) Experimental work supports the computational predictions.

      (4) The authors use their model for sequence design to optimize splicing outcomes, which is a novel application.

      Weaknesses:

      No weaknesses were identified by this reviewer, but I have the following comments:

      (1) I would be curious to see evidence that the model is learning position-specific representations.

      (2) The transformer encoders in TrASPr model sequences with a rather limited sequence size of 200 bp; therefore, for long introns, the model will not have good coverage of the intronic sequence. This is not expected to be an issue for exons.

      (3) In the context of sequence design, creating a desired tissue- or condition-specific effect would likely require disrupting or creating motifs for splicing regulatory proteins. In your experiments for neuronal-specific Daam1 exon 16, have you seen evidence for that? Most of the edits are close to splice junctions, but a few are further away.

      (4) For sequence design, of tissue- or condition-specific effect in neuronal-specific Daam1 exon 16 the upstream exonic splice junction had the most sequence edits. Is that a general observation? How about the relative importance of the four transformer regions in TrASPr prediction performance?

      (5) The idea of lightweight transformer models is compelling, and is widely applicable. It has been used elsewhere. One paper that came to mind in the protein realm:<br /> Singh, Rohit, et al. "Learning the language of antibody hypervariability." Proceedings of the National Academy of Sciences 122.1 (2025): e2418918121.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

      For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

      TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

      In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

      Strengths:

      (1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

      (2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

      Weaknesses:

      (1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

      (2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

      (3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

      (4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

      (5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

      (6) L214, ablations of individual features are missing.

      (7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

      (8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

      (9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

      (10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

    1. Reviewer #1 (Public review):

      Summary

      Fleming et al. present the first, proteomics-based attempt to identify the possible mechanism of action of ALS-linked DNAJC7 molecular chaperone in pathology. Impressively, it is the first report of DNAJC7 interactome studies, using a suitable iPSC-derived lower motor neuron model. Using a co-immunoprecipitation approach the authors identified that the interactome of DNAJC7 is predominantly composed of proteins engaged in response to stress, but also that this interactome is enriched in RNA-binding proteins. The authors also created a DNAJC7 haploinsufficiency cellular model and show the resulting increased insolubility of HNRNPU protein which causes disruptions in its functionality as shown by analysis of its transcriptional targets. Finally, this study uses pharmacological agents to test the effect of decreased DNAJC7 expression on cell response to proteotoxic stress and finds evidence that DNAJC7 regulates the activation of Heat shock factor 1 (HSF1) protein upon stress conditions.

      Strengths

      (1)This study uses the best so far model to study the interactome and possible mechanism of action of DNAJC7 molecular chaperone in an iPSC-derived cellular model of motor neurons. Furthermore, the authors also looked into available transcriptome databases of ALS patient samples to further test whether their findings may yield relevance to pathology.

      (2) The extent to which the authors are explicit about the sample sizes, protocols, and statistical tests used throughout this manuscript, should be applauded. This will help the whole field in their efforts to reliably replicate the results in this study.

      Weaknesses

      (1) The most significant caveat of interactome experiments inherently comes from the method of choice. It is possible that by using the co-purification approach of DNAJC7 IP the resulting pool of binding partners is depleted in proteins that interact with DNAJC7 weakly or transiently. An alternative approach presumably more sensitive towards weaker binders could use the TurboID-based proximity-labeling method.

      (2) The authors mention in Results (and Figure 2D) that HNRNPA1 was identified as DNAJC7-interacting protein in their co-IP experiments, however, an identifier for this protein cannot be found in Figure 1C and Table S1 listing the proteomics results. Could the authors appropriately update Figure 1C and Table S1, or if HNRNPA1 wasn't really a hit then remove it from listed HNRNPs?

      (3) No further validation of DNAJC7-interacting proteins from the heat-shock protein (HSP) family. Current validation of mass spectrometry-identified proteins comes from IP-western blots with antibodies against HSPs. It would be interesting to further inspect possible interactions of these proteins by inspecting co-localization with immunocytochemistry.

      (4) Similarly, the observation of DNAJC7 haploinsufficiency causing an increase in HNRNPU insolubility could be also easily further confirmed by checking for the emergence of "puncta" under a fluorescence microscope, in addition to provided WB experiments from MN lysates.

      (5) I would like to recommend the authors to also provide with this manuscript a complete dataset (possibly in the form of a table, presented similarly as Table S1) resulting from experiments presented in Figures 2F and S2D. The information on upregulated and downregulated targets in their DNAJC7 haploinsufficiency model would be a valuable resource for the field and enable further investigations.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

      The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

      Strengths:

      The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

      This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

      Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

      Weaknesses:

      Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

      A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

      It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

      The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

      The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

    3. Reviewer #3 (Public review):

      Summary:

      Fleming et al sought to better understand DNAJC7's function in motor neurons as mutations in this gene have been associated with amyotrophic lateral sclerosis (ALS). The research question is relevant and important. The authors use an induced pluripotent stem cell (iPSC) line to derive motor neurons (iMNs) finding that DNAJC7 interacts with RNA-binding proteins (RBP) in wild-type cells and a truncated mutant DNAJC7[R156*] disrupts the RBP, hnRNPU, by promoting its accumulation into insoluble fractions. Given that DNAJC7 is predicted to regulate stress responses, the authors then find that DNAJC7[R156*] expression sensitizes the iMNs to proteosomal stress by disrupting the expression of the key heat stress response regulator, HSF1. These findings support that loss-of-function mutations in DNAJC7 will indeed sensitize motor neurons to proteotoxic stress, potentially driving ALS. The association with RBPs, which routinely are found to be disrupted in ALS, is of interest and warrants further study.

      Strengths:

      (1) The research question is relevant and important. The authors provide interesting data that DNAJC7 mutations impact two important features in ALS, the dysregulation of RNA binding proteins and the sensitivity of motor neurons to proteotoxic stress.

      (2) The authors provide solid data to support their findings and the assays are appropriate.

      Weaknesses:

      (1) The authors rely on a single iPSC line throughout the text, using the same line to make the mutation-carrying cells. iPSCs are highly variable and at minimum 3 lines, typically 5 lines, should be used to define consistent findings. This work would be greatly strengthened if 3 or more lines were used to confirm consistent effects. This is particularly concerning given that iPSCs were differentiated using growth factors versus genetic induction. Growth-factor-based differentiations are more variable.

      (2) The authors argue that HSF1 and its targets are downregulated in sporadic ALS and mutant C9orf72 ALS. The first concern is that these transcriptomics data were derived from cortical tissue which does not contain motor neurons (Pineda et al. 2024 Cell 187: 1971-1989.e1916). The second concern is that the inclusion of C9orf72 mutant tissue is not well justified as (1) this mutation is associated with an upregulation of HSF1 and its targets in patients (Mordes et al, Acta Neuropathol Commun 2018 6(1):55; Lee et al Neuron 2023 111(9):1381-1390) and (2) the C9orf72 mutation is associated with a ALS/FTD spectrum disorder defined by TDP-43 pathology. Disease mechanisms associated with this spectrum disorder may not overlap with traditional ALS which is typically defined by SOD1 pathology.

      (3) As a whole, the findings are mechanistically disjointed, and additional experiments or discussion would help to connect the dots a bit more.

    1. Reviewer #1 (Public review):

      Summary:

      The study shows that Zizyphi spinosi semen (ZSS), particularly its non-extracted simple crush powder, has significant therapeutic effects on neurodegenerative diseases. It removes Aβ, tau, and α-synuclein oligomers, restores synaptophysin levels, enhances BDNF expression and neurogenesis, and improves cognitive and motor functions in mouse AD, FTD, DLB, and PD models. Additionally, ZSS powder reduces DNA oxidation and cellular senescence in normal-aged mice, increases synaptophysin, BDNF, and neurogenesis, and enhances cognition to levels comparable to young mice.

      Weaknesses:

      (1) While the study demonstrates that ZSS has protective effects across a wide range of animal models, including AD, FTD, DLB, PD, and both young and aged mice, it is broad and lacks a detailed investigation into the underlying mechanisms. This is the most significant concern.

      (2) The authors highlight that the non-extracted simple crush powder of ZSS shows more substantial effects than its hot water extract and extraction residue. However, the manuscript provides very limited data comparing the effects of these three extracts.

      (3) The authors have not provided a rationale for the dosing concentrations used, nor have they tested the effects of the treatment in normal mice to verify its impact under physiological conditions.

      (4) Regarding the assessment of cognitive function in mice, the authors only utilized the Morris Water Maze (MWM) test, which includes a five-day spatial learning training phase followed by a probe trial. The authors focused solely on the learning phase. However, it is relevant to note that data from the learning phase primarily reflects the learning ability of the mice, while the probe trial is more indicative of memory. Therefore, it is essential that probe trial data be included for a more comprehensive analysis. A justification should be included to explain why the latency of 1st is about 50s not 60s.

      (5) The BDNF immunohistochemical staining in the manuscript appears to be non-specific.

      (6) The central pathological regions in PD are the substantia nigra and striatum. Please replace the staining results from the cortex and hippocampus with those from these regions in the PD model.

    2. Reviewer #2 (Public review):

      Summary:

      The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

      Strengths:

      The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

      Weaknesses:

      The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

    3. Reviewer #3 (Public review):

      ZSS has been widely used in Traditional Chinese Medicine as a sleep-promoting herb. This study tests the effects of ZSS powder and extracts on AD, PD, and aging, and broad protective effects were revealed in mice.

      However, this work did not include a mechanistic study or target data on ZSS were included, and PK data were also not involved. Mechanisms or targets and PK study are suggested. A human PK study is preferred over mice or rats. E.g. which main active ingredients and the concentration in plasma, in this context, to study the pharmacological mechanisms of ZSS.

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to provide imaging methods for users of the field of human layer-fMRI. This is an emerging field with 240 papers published so far. Different than implied in the manuscript, 3T is well represented among those papers. E.g. see the papers below that are not cited in the manuscript. Thus, the claim on the impact of developing 3T methodology for wider dissemination is not justified. Specifically, because some of the previous papers perform whole brain layer-fMRI (also at 3T) in more efficient, and more established procedures.

      The authors implemented a sequence with lots of nice features. Including their own SMS EPI, diffusion bipolar pulses, eye-saturation bands, and they built their own reconstruction around it. This is not trivial. Only a few labs around the world have this level of engineering expertise. I applaud this technical achievement. However, I doubt that any of this is the right tool for layer-fMRI, nor does it represent an advancement for the field. In the thermal noise dominated regime of sub-millimeter fMRI (especially at 3T) it is established to use 3D readouts over 2D (SMS) readouts. While it is not trivial to implement SMS, the vendor implementations (as well as the CMRR and MGH implementations) are most widely applied across the majority of current fMRI studies already. The author's work on this does not serve any previous shortcomings in the field.

      The mechanism to use bi-polar gradients to increase the localization specificity is doubtful to me. In my understanding, killing the intra-vascular BOLD should make it less specific. Also, the empirical data do not suggest a higher localization specificity to me.

      Embedding this work in the literature of previous methods is incomplete. Recent trends of vessel signal manipulation with ABC or VAPER are not mentioned. Comparisons with VASO are outdated and incorrect.

      The reproducibility of the methods and the result is doubtful (see below).

      I don't think that this manuscript is in the top 50% of the 240 layer-fmri papers out there.

      3T layer-fMRI papers that are not cited:

      Taso, M., Munsch, F., Zhao, L., Alsop, D.C., 2021. Regional and depth-dependence of cortical blood-flow assessed with high-resolution Arterial Spin Labeling (ASL). Journal of Cerebral Blood Flow and Metabolism. https://doi.org/10.1177/0271678X20982382

      Wu, P.Y., Chu, Y.H., Lin, J.F.L., Kuo, W.J., Lin, F.H., 2018. Feature-dependent intrinsic functional connectivity across cortical depths in the human auditory cortex. Scientific Reports 8, 1-14. https://doi.org/10.1038/s41598-018-31292-x

      Lifshits, S., Tomer, O., Shamir, I., Barazany, D., Tsarfaty, G., Rosset, S., Assaf, Y., 2018. Resolution considerations in imaging of the cortical layers. NeuroImage 164, 112-120. https://doi.org/10.1016/j.neuroimage.2017.02.086

      Puckett, A.M., Aquino, K.M., Robinson, P.A., Breakspear, M., Schira, M.M., 2016. The spatiotemporal hemodynamic response function for depth-dependent functional imaging of human cortex. NeuroImage 139, 240-248. https://doi.org/10.1016/j.neuroimage.2016.06.019

      Olman, C.A., Inati, S., Heeger, D.J., 2007. The effect of large veins on spatial localization with GE BOLD at 3 T: Displacement, not blurring. NeuroImage 34, 1126-1135. https://doi.org/10.1016/j.neuroimage.2006.08.045

      Ress, D., Glover, G.H., Liu, J., Wandell, B., 2007. Laminar profiles of functional activity in the human brain. NeuroImage 34, 74-84. https://doi.org/10.1016/j.neuroimage.2006.08.020

      Huber, L., Kronbichler, L., Stirnberg, R., Ehses, P., Stocker, T., Fernández-Cabello, S., Poser, B.A., Kronbichler, M., 2023. Evaluating the capabilities and challenges of layer-fMRI VASO at 3T. Aperture Neuro 3. https://doi.org/10.52294/001c.85117

      Scheeringa, R., Bonnefond, M., van Mourik, T., Jensen, O., Norris, D.G., Koopmans, P.J., 2022. Relating neural oscillations to laminar fMRI connectivity in visual cortex. Cerebral Cortex. https://doi.org/10.1093/cercor/bhac154

      Strengths:

      See above. The authors developed their own SMS sequence with many features. This is important to the field. And does not leave sequence development work to view isolated monopoly labs. This work democratises SMS.<br /> The questions addressed here are of high relevance to the field: getting tools with good sensitivity, user-friendly applicability, and locally specific brain activity mapping is an important topic in the field of layer-fMRI.

      Weaknesses:

      (1) I feel the authors need to justify why flow-crushing helps localization specificity. There is an entire family of recent papers that aims to achieve higher localization specificity by doing the exact opposite. Namely, MT or ABC fRMRI aims to increase the localization specificity by highlighting the intravascular BOLD by means of suppressing non-flowing tissue. To name a few:

      Priovoulos, N., de Oliveira, I.A.F., Poser, B.A., Norris, D.G., van der Zwaag, W., 2023. Combining arterial blood contrast with BOLD increases fMRI intracortical contrast. Human Brain Mapping hbm.26227. https://doi.org/10.1002/hbm.26227.

      Pfaffenrot, V., Koopmans, P.J., 2022. Magnetization Transfer weighted laminar fMRI with multi-echo FLASH. NeuroImage 119725. https://doi.org/10.1016/j.neuroimage.2022.119725

      Schulz, J., Fazal, Z., Metere, R., Marques, J.P., Norris, D.G., 2020. Arterial blood contrast ( ABC ) enabled by magnetization transfer ( MT ): a novel MRI technique for enhancing the measurement of brain activation changes. bioRxiv. https://doi.org/10.1101/2020.05.20.106666

      Based on this literature, it seems that the proposed method will make the vein problem worse, not better. The authors could make it clearer how they reason that making GE-BOLD signals more extra-vascular weighted should help to reduce large vein effects.

      The empirical evidence for the claim that flow crushing helps with the localization specificity should be made clearer. The response magnitude with and without flow crushing looks pretty much identical to me (see Fig, 6d).<br /> It's unclear to me what to look for in Fig. 5. I cannot discern any layer patterns in these maps. It's too noisy. The two maps of TE=43ms look like identical copies from each other. Maybe an editorial error?

      The authors discuss bipolar crushing with respect to SE-BOLD where it has been previously applied. For SE-BOLD at UHF, a substantial portion of the vein signal comes from the intravascular compartment. So I agree that for SE-BOLD, it makes sense to crush the intravascular signal. For GE-BOLD however, this reasoning does not hold. For GE-BOLD (even at 3T), most of the vein signal comes from extravascular dephasing around large unspecific veins and the bipolar crushing is not expected to help with this.

      (2) The bipolar crushing is limited to one single direction of flow. This introduces a lot of artificial variance across the cortical folding pattern. This is not mentioned in the manuscript. There is an entire family of papers that perform layer-fmri with black-blood imaging that solves this with a 3D contrast preparation (VAPER) that is applied across a longer time period, thus killing the blood signal while it flows across all directions of the vascular tree. Here, the signal cruising is happening with a 2D readout as a "snap-shot" crushing. This does not allow the blood to flow in multiple directions.<br /> VAPER also accounts for BOLD contaminations of larger draining veins by means of a tag-control sampling. The proposed approach here does not account for this contamination.

      Chai, Y., Li, L., Huber, L., Poser, B.A., Bandettini, P.A., 2020. Integrated VASO and perfusion contrast: A new tool for laminar functional MRI. NeuroImage 207, 116358. https://doi.org/10.1016/j.neuroimage.2019.116358

      Chai, Y., Liu, T.T., Marrett, S., Li, L., Khojandi, A., Handwerker, D.A., Alink, A., Muckli, L., Bandettini, P.A., 2021. Topographical and laminar distribution of audiovisual processing within human planum temporale. Progress in Neurobiology 102121. https://doi.org/10.1016/j.pneurobio.2021.102121

      If I would recommend anyone to perform layer-fMRI with blood crushing, it seems that VAPER is the superior approach. The authors could make it clearer why users might want to use the unidirectional crushing instead.

      (3) The comparison with VASO is misleading.<br /> The authors claim that previous VASO approaches were limited by TRs of 8.2s. The authors might be advised to check the latest literature of the last years.<br /> Koiso et al. has performed whole brain layer-fMRI VASO at 0.8mm at 3.9 seconds (with reliable activation) and 2.7 seconds (with unconvincing activation pattern, though), and 2.3 (without activation).<br /> Also, whole brain layer-fMRI BOLD at 0.5mm and 0.7mm has been previously performed by the Juelich group at TRs of 3.5s (their TR definition is 'fishy' though).

      Koiso, K., Müller, A.K., Akamatsu, K., Dresbach, S., Gulban, O.F., Goebel, R., Miyawaki, Y., Poser, B.A., Huber, L., 2023. Acquisition and processing methods of whole-brain layer-fMRI VASO and BOLD: The Kenshu dataset. Aperture Neuro 34. https://doi.org/10.1101/2022.08.19.504502

      Yun, S.D., Pais‐Roldán, P., Palomero‐Gallagher, N., Shah, N.J., 2022. Mapping of whole‐cerebrum resting‐state networks using ultra‐high resolution acquisition protocols. Human Brain Mapping. https://doi.org/10.1002/hbm.25855

      Pais-Roldan, P., Yun, S.D., Palomero-Gallagher, N., Shah, N.J., 2023. Cortical depth-dependent human fMRI of resting-state networks using EPIK. Front. Neurosci. 17, 1151544. https://doi.org/10.3389/fnins.2023.1151544

      The authors are correct that VASO is not advised as a turn-key method for lower brain areas, incl. Hippocampus and subcortex. However, the authors use this word of caution that is intended for inexperienced "users" as a statement that this cannot be performed. This statement is taken out of context. This statement is not from the academic literature. It's advice for the 40+ user base that want to perform layer-fMRI as a plug-and-play routine tool in neuroscience usage. In fact, sub-millimeter VASO is routinely being performed by MRI-physicists across all brain areas (including deep brain structures, hippocampus etc). E.g. see Koiso et al. and an overview lecture from a layer-fMRI workshop that I had recently attended: https://youtu.be/kzh-nWXd54s?si=hoIJjLLIxFUJ4g20&t=2401

      Thus, the authors could embed this phrasing into the context of their own method that they are proposing in the manuscript. E.g. the authors could state whether they think that their sequence has the potential to be disseminated across sites, considering that it requires slow offline reconstruction in Matlab?<br /> Do the authors think that the results shown in Fig. 6c are suggesting turn-key acquisition of a routine mapping tool? In my humble opinion it looks like random noise, with most of the activation outside the ROI (in white matter).

      (4) The repeatability of the results is questionable.<br /> The authors perform experiments about the robustness of the method (line 620). The corresponding results are not suggesting any robustness to me. In fact the layer profiles in Fig. 4c vs. Fig 4d are completely opposite. Location of peaks turn into locations of dips and vice versa.<br /> The methods are not described in enough detail to reproduce these results.<br /> The authors mention that their image reconstruction is done "using in-house MATLAB code" (line 634). They do not post a link to github, nor do they say if they share this code.

      It is not trivial to get good phase data for fMRI. The authors do not mention how they perform the respective coil-combination.<br /> No data are shared for reproduction of the analysis.

      (5) The application of NODRIC is not validated.<br /> Previous applications of NORDIC at 3T layer-fMRI have resulted in mixed success. When not adjusted for the right SNR regime it can result in artifactual reductions of beta scores, depending on the SNR across layers. The authors could validate their application of NORDIC and confirm that the average layer-profiles are unaffected by the application of NORDIC. Also, the NORDIC version should be explicitly mentioned in the manuscript.

      Akbari, A., Gati, J.S., Zeman, P., Liem, B., Menon, R.S., 2023. Layer Dependence of Monocular and Binocular Responses in Human Ocular Dominance Columns at 7T using VASO and BOLD (preprint). Neuroscience. https://doi.org/10.1101/2023.04.06.535924

      Knudsen, L., Guo, F., Huang, J., Blicher, J.U., Lund, T.E., Zhou, Y., Zhang, P., Yang, Y., 2023. The laminar pattern of proprioceptive activation in human primary motor cortex. bioRxiv. https://doi.org/10.1101/2023.10.29.564658

      Comments on revisions:

      Among all the concerns mentioned above, I think there is only one of the specific issues that was sufficiently addressed.<br /> The authors implemented a combination of three consecutive-dimensional flow crushers. Other concerns were not sufficiently addressed to change my confidence level of the study.<br /> - While the abstract is still focusing on the utility of using 3T, they do not give credit to early 3T layer-fMRI papers leading the way to larger coverage and connectivity applications.<br /> - While the author's choice of using custom SMS 2D readout is justified for them. I do not think that this very method will utilize widespread 3T whole brain connectivity experiments across the global 3T community. This lowers the impact of the paper.<br /> - The images in Fig. 5 are still suspiciously similar. To the level that the noise pattern outside the brain is identical across large parts of the maps with and without PR.<br /> - Maybe it's my ignorance, but I still do not agree why flow crushing focuses the local BOLD responses to small vessels.<br /> - While my feel of a misleading representation of the literature had been accompanied by explicit references, the authors claim that they cannot find them?!? Or claim that they are about something else (which they are not, in my viewpoint).<br /> Data and software are still not shared (not even example data, or nii data).

    2. Reviewer #2 (Public review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

      Strengths:

      The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

      That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

      The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

      The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

      I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

      Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

      The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

      Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

    3. Reviewer #3 (Public review):

      Summary:

      The authors are looking for a spatially specific functional brain response to visualise non-invasively with 3T (clinical field strength) MRI. They propose a velocity-nulled weighting to remove signal from draining veins in a submillimeter multiband acquisition.

      Strengths:

      - This manuscript addresses a real need in the cognitive neuroscience community interested in imaging responses in cortical layers in-vivo in humans.<br /> - An additional benefit is the proposed implementation at 3T, a widely available field strength.

      Weaknesses:

      - The comparison in Figure 4 for different b-values shows % signal changes. However, as the baseline signal changes with added diffusion weighting, this is rather uninformative. A plot of t-values against cortical depth would be more insightful.<br /> - Surprisingly, the %-signal change for a b-value of 0 is below 1% for 3/4 participants, even at the cortical surface. This raises some doubts about the task or ROI definition. A finger-tapping task should reliably engage the primary motor cortex, even at 3T, and even in individual participants.<br /> - The double peak patter in the BOLD weighted images in Figure 4 is unexpected given the existing literature on BOLD responses as a function of cortical depth.<br /> - Although I'd like to applaud the authors for their ambition with the connectivity analysis, the low significance threshold used in these maps (z=1,64) leads to concerns about the SNR of the underlying data.

      I remain unconvinced of the conclusion that the developed VN fMRI exhibited layer specificity - the double peak which is taken as a marker of specificity is not absent in the BOLD responses either, and overall BOLD and VN response profiles as a function of cortical depth are quite similar.

    1. Reviewer #1 (Public review):

      Summary:

      In this study, Millard and colleagues investigated if the analgesic effect of nicotine on pain sensitivity, assessed with two pain models, is mediated by Peak Alpha Frequency (PAF) recorded with resting state EEG. The authors found indeed that nicotine (4 mg, gum) reduced pain ratings during phasic heat pain but not cuff pressor algometry compared to placebo conditions. Nicotine also increased PAF (globally). However, mediation analysis revealed that the reduction in pain ratings elicited by the phasic heat pain after taking nicotine was not mediated by the changes in PAF. Also, the authors only partially replicated the correlation between PAF and pain sensitivity at baseline (before nicotine treatment). At the group-level no correlation was found, but an exploratory analysis showed that the negative correlation (lower PAF, higher pain sensitivity) was present in males but not in females. The authors discuss the lack of correlation.<br /> In general, the study is rigorous, methodology is sound and the paper is well written. Results are compelling and sufficiently discussed.

      Strengths:

      Strengths of this study are the pre-registration, proper sample size calculation and data analysis. But also the presence of the analgesic effect of nicotine and the change in PAF.

      Weaknesses:

      It would even be more convincing if they had manipulated PAF directly.

    2. Reviewer #2 (Public review):

      Summary:

      The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

      Strengths:

      I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

      Weaknesses:

      The weakness of the study revolves around two aspects:

      (1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

      (2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

      Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

    3. Reviewer #3 (Public review):

      In this manuscript, Millard et al. investigate the effects of nicotine on pain sensitivity and peak alpha frequency (PAF) in resting state EEG. To this end, they ran a randomized, double-blind, placebo-controlled experiment involving 62 healthy adults that received either 4 mg nicotine gum (n=29) or placebo (n=33). Prolonged heat and pressure were used as pain models. Resting state EEG and pain intensity (assessed with a visual analog scale) were measured before and after the intervention. Additionally, several covariates (sex at birth, depression and anxiety symptoms, stress, sleep quality, among others) were recorded. Data was analyzed using ANCOVA-equivalent two-wave latent change score models, as well as repeated measures analysis of variance. Results do not show experimentally relevant changes of PAF or pain intensity scores for neither of the prolonged pain models due to nicotine intake.

      The main strengths of the manuscript are its solid conceptual framework and the thorough experimental design. The researchers make a good case in the introduction and discussion for the need to further investigate the association of PAF and pain sensitivity. Furthermore, they proceed to carefully describe every aspect of the experiment in great detail, which is excellent for reproducibility purposes. Finally, they analyze the data from different and provide an extensive report of their results.

      There are relevant weaknesses to highlight. Firstly, authors preregistered the study and the analysis plan, but the preregistration does not contain an estimation of the expected effect sizes or the rationale for the selected the sample size. Furthermore, the authors interpret their results in a way that is not supported by the evidence (which is notorious in the abstract and the first paragraph of the discussion). Even though some of the differences are statistically significant (e.g., global PAF, pain intensity ratings during heat pain), these differences are far from being experimentally or clinically relevant. The effect sizes observed are not sufficiently large to consider that pain sensitivity was modulated by the nicotine intake, which puts into question all the answers to the research questions posed in the study. The authors attempt to nuance this throughout the discussion, but in a way that is not compatible with the main claims.

    1. Reviewer #1 (Public review):

      Summary:

      This work investigated the role of CXXC-finger protein 1 (CXXC1) in regulatory T cells. CXXC1-bound genomic regions largely overlap with Foxp3-bound regions and regions with H3K4me3 histone modifications in Treg cells. CXXC1 and Foxp3 interact with each other, as shown by co-immunoprecipitation. Mice with Treg-specific CXXC1 knockout (KO) succumb to lymphoproliferative diseases between 3 to 4 weeks of age, similar to Foxp3 KO mice. Although the immune suppression function of CXXC1 KO Treg is comparable to WT Treg in an in vitro assay, these KO Tregs failed to suppress autoimmune diseases such as EAE and colitis in Treg transfer models in vivo. This is partly due to the diminished survival of the KO Tregs after transfer. CXXC1 KO Tregs do not have an altered DNA methylation pattern; instead, they display weakened H3K4me3 modifications within the broad H3K4me3 domains, which contain a set of Treg signature genes. These results suggest that CXXC1 and Foxp3 collaborate to regulate Treg homeostasis and function by promoting Treg signature gene expression through maintaining H3K4me3 modification.

      Strengths:

      Epigenetic regulation of Treg cells has been a constantly evolving area of research. The current study revealed CXXC1 as a previously unidentified epigenetic regulator of Tregs. The strong phenotype of the knockout mouse supports the critical role CXXC1 plays in Treg cells. Mechanistically, the link between CXXC1 and the maintenance of broad H3K4me3 domains is also a novel finding.

      Weaknesses:

      The authors addressed the reviewer's critiques fully in the revised manuscript.

    2. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    3. Reviewer #3 (Public review):

      In the report entitled "CXXC-finger protein 1 associates with FOXP3 to stabilize homeostasis and suppressive functions of regulatory T cells", the authors demonstrated that Cxxc1-deletion in Treg cells leads to the development of severe inflammatory disease with impaired suppressive function. Mechanistically, CXXC1 interacts with Foxp3 and regulates the expression of key Treg signature genes by modulating H3K4me3 deposition. Their findings are interesting and significant.

      Comments on revisions:

      In the revised manuscript, the authors have responded well to all the concerns reviewers raised. The manuscript has further improved.

    1. Reviewer #1 (Public review):

      In this study, the authors developed a mathematical model to predict human biological ages using physiological traits. This model provides a way to identify environmental and genetic factors that impact aging and lifespan.

      Strength:

      (1) The topic addressed by the authors - human age predication using physiological traits - is an extremely interesting, important, and challenging question in the aging field. One of the biggest challenges is the lack of well-controlled data from a large number of humans. However, the authors took this challenge and tried their best to extract useful information from available data.<br /> (2) Some of the findings can provide valuable guidelines for future experimental design for human and animal studies. For example, it was found that this mathematical model can best predict age when all different organ and physiological systems are sampled. This finding makes scenes in general, but can be, and have been, neglected when people use molecular markers to predict age. Most of those studies have used only one molecular trait or different traits from one tissue.

      Weakness:

      (1) As I mentioned above, the Biobank data used here are not designed for this current study, so there are many limitations for model development using these data, e.g., missing data points and irrelevant measurements for aging. This is a common caveat for human studies and has been discussed by the authors.<br /> (2) There is no validation dataset to verify the proposed model. The authors suggested that human biological age can be predicted with a high accuracy using 12 simple physiological measurements. It will be super useful and convincing if another biobank dataset containing those 12 traits can be applied to the current model.

      Comments on revisions:

      In this revision, the authors improved the manuscript by adding discussion of two main weaknesses about human data limitation and model validation. My several other specific concerns and suggestions are all properly resolved.

    1. Reviewer #2 (Public review):

      The fledgling field of epitranscriptomics has encountered various technical roadblocks with implications as to the validity of early epitranscriptomics mapping data. As a prime example, the low specificity of (supposedly) modification-specific antibodies for the enrichment of modified RNAs, has been ignored for quite some time and is only now recognized for its dismal reproducibility (between different labs), which necessitates the development of alternative methods for modification detection. Furthermore, early attempts to map individual epitranscriptomes using sequencing-based techniques are largely characterized by the deliberate avoidance of orthogonal approaches aimed at confirming the existence of RNA modifications that have been originally identified.

      Improved methodology, the inclusion of various controls, and better mapping algorithms as well as the application of robust statistics for the identification of false-positive RNA modification calls have allowed revisiting original (seminal) publications whose early mapping data allowed making hyperbolic claims about the number, localization and importance of RNA modifications, especially in mRNA. Besides the existence of m6A in mRNA, the detectable incidence of RNA modifications in mRNAs has drastically dropped.

      As for m5C, the subject of the manuscript submitted by Zhou et al., its identification in mRNA goes back to Squires et al., 2012 reporting on >10.000 sites in mRNA of a human cancer cell line, followed by intermittent findings reporting on pretty much every number between 0 to > 100.000 m5C sites in different human cell-derived mRNA transcriptomes. The reason for such discrepancy is most likely of a technical nature. Importantly, all studies reporting on actual transcript numbers that were m5C-modified relied on RNA bisulfite sequencing, an NGS-based method, that can discriminate between methylated and non-methylated Cs after chemical deamination of C but not m5C. RNA bisulfite sequencing has a notoriously high background due to deamination artifacts, which occur largely due to incomplete denaturation of double-stranded regions (denaturing-resistant) of RNA molecules. Furthermore, m5C sites in mRNAs have now been mapped to regions that have not only sequence identity but also structural features of tRNAs. Various studies revealed that the highly conserved m5C RNA methyltransferases NSUN2 and NSUN6 do not only accept tRNAs but also other RNAs (including mRNAs) as methylation substrates, which in combination account for most of the RNA bisulfite-mapped m5C sites in human mRNA transcriptomes. Is m5C in mRNA only a result of the Star activity of tRNA or rRNA modification enzymes, or is their low stoichiometry biologically relevant?

      In light of the short-comings of existing tools to robustly determine m5C in transcriptomes, other methods, like DRAM-seq, aiming to map m5C independently of ex situ RNA treatment with chemicals, are needed to arrive at a more solid "ground state", from which it will be possible to state and test various hypotheses as to the biological function of m5C, especially in lowly abundant RNAs such as mRNA.

      Importantly, the identification of >10.000 sites containing m5C increases through DRAM-Seq, increases the number of potential m5C marks in human cancer cells from a couple of 100 (after rigorous post-hoc analysis of RNA bisulfite sequencing data) by orders of magnitude. This begs the question, whether or not the application of these editing tools results in editing artefacts overstating the number of actual m5C sites in the human cancer transcriptome.

      [Editors' note: earlier reviews have been provided here: https://doi.org/10.7554/eLife.98166.3.sa1; https://doi.org/10.7554/eLife.98166.2.sa1; https://doi.org/10.7554/eLife.98166.1.sa1]

    1. Reviewer #1 (Public review):

      Summary:

      Tamoxifen resistance is a common problem in partially ER-positive patients undergoing endocrine therapy, and this manuscript has important research significance as it is based on clinical practical issues. The manuscript discovered that the absence of FRMD8 in breast epithelial cells can promote the progression of breast cancer, thus proposing the hypothesis that FRMD8 affects tamoxifen resistance and validated this hypothesis through a series of experiments. The manuscript has certain theoretical reference value.

      Strengths:

      At present, research on the role of FRMD8 in breast cancer is very limited. This manuscript leverages the MMTV-Cre+;Frmd8fl/fl;PyMT mouse model to study the role of FRMD8 in tamoxifen resistance, and single-cell sequencing technology discovered the interaction between FRMD8 and ESR1. At the mechanistic level, this manuscript has demonstrated two ways in which FRMD8 affects ERα, providing some new insights into the development of ER-positive breast cancer in patients who are resistant to tamoxifen.

      Limitations:

      Whether FRMD8 can become a biomarker should be verified in large clinical samples or clinical data.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript presents a valuable finding on the impact of FRMD8 loss on tumor progression and the resistance to tamoxifen therapy. The author conducted systematic experiments to explore the role of FRMD8 in breast cancer and its potential regulatory mechanisms, confirming that FRMD8 could serve as a potential target to revere tamoxifen resistance.

      The research is logically coherent and persuasive. The results support their conclusions and have achieved the research objectives.

    1. Reviewer #1 (Public review):

      Summary:

      The article entitled "Pu.1/Spi1 dosage controls the turnover and maintenance of microglia in zebrafish and mammals" by Wu et al., identifies a role for the master myeloid developmental regulator Pu.1 in the maintenance of microglial populations in the adult. Using a non-homologous end joining knock-in strategy, the authors generated a pu.1 conditional allele in zebrafish, which reports wildtype expression of pu.1 with EGFP and truncated expression of pu.1 with DsRed after Cre-mediated recombination. When crossed to existing pu.1 and spi-b mutants, this approach allowed the authors to target a single allele for recombination and induce homozygous loss-of-function microglia in adults. This identified that although there is no short-term consequence to loss of pu.1, microglia lacking any functional copy of pu.1 are depleted over the course of months, even when spi-b is fully functional. The authors go on to identify reduced proliferation, increased cell death, and higher expression of tp53 in the pu.1 deficient microglia, as compared to the wild-type EGFP+ microglia. To extend these findings to mammals, the authors generated a conditional Pu.1 allele in mice and performed similar analyses, finding that loss of a single copy of Pu.1 resulted in similar long-term loss of Pu.1-deficient microglia. The conclusions of this paper are overall well supported by the data.

      Strengths:

      The genetic approaches here for visualizing the recombination status of an endogenous allele are very clever, and by comparing the turnover of wildtype and mutant cells in the same animal the authors can make very convincing arguments about the effect of chronic loss of pu.1. Likely this phenotype would be either very subtle or nonexistent without the point of comparison and competition with the wildtype cells.

      Using multiple species allows for more generalizable results, and shows conservation of the phenomena at play.

      The demonstration of changes to proliferation and cell death in concert with higher expression of tp53 is compelling evidence for the authors' argument.

      Weaknesses:

      This paper is very strong. It would benefit from further investigating the specific relationship between pu.1 and tp53 specifically. Does pu.1 interact with the tp53 locus? Specific molecular analysis of this interaction would strengthen the mechanistic findings.

    2. Reviewer #2 (Public review):

      Summary:

      In the presented work by Wu et al, the authors investigate the role of the transcription factor Pu.1 in the survival and maintenance of microglia, the tissue-resident macrophage population in the brain. To this end, they generated a sophisticated new conditional pu.1 allele in zebrafish using CRISPR-mediated genome editing which allows visual detection of expression of the mutant allele through a switch from GFP to dsRed after Cre-mediated recombination. Using EdU pulse-chase labelling, they first estimated the daily turnover rate of microglia in the adult zebrafish brain which was found to be higher than rates previously estimated for mice and humans. After conditional deletion of pu.1 in coro1a positive cells, they do not find a difference in microglia number at 2 and 8 days or 1-month post-injection of Tamoxifen. However, at 3 months post-injection, a strong decrease in mutant microglia could be detected. While no change in microglia number was detected at 1mpi, an increase in apoptotic cells and decreased proliferation as observed. RNA-seq analysis of WT and mutant microglia revealed an upregulation of tp53, which was shown to play a role in the depletion of pu.1 mutant microglia as deletion in tp53-/- mutants did not lead to a decrease in microglia number at 3mpi. Through analysis of microglia number in pU.1 mutants, the authors further show that the depletion of microglia in the conditional mutants is dependent on the presence of WT microglia. To show that the phenomenon is conserved between species, similar experiments were also performed in mice.

      This work expands on previous in vitro studies using primary human microglia. The majority of conclusions are well supported by the data, addition of controls and experimental details would strengthen the conclusions and rigor of the paper.

      Strengths:

      Generation of an elegantly designed conditional pu.1 allele in zebrafish that allows for the visual detection of expression of the knockout allele.

      The combination of analysis of pu.1 function in two model systems, zebrafish and mouse, strengthens the conclusions of the paper.

      Confirmation of the functional significance of the observed upregulation of tp53 in mutant microglia through double mutant analysis provides some mechanistic insight.

      Weaknesses:

      (1) The presented RNA-Seq analysis of mutant microglia is underpowered and details on how the data was analyzed are missing. Only 9-15 cells were analyzed in total (3 pools of 3-5 cells each). Further, the variability in relative gene expression of ccl35b.1, which was used as a quality control and inclusion criterion to define pools consisting of microglia, is extremely high (between ~4 and ~1600, Figure S7A).

      (2) The authors conclude that the reduction of microglia observed in the adult brain after cKO of pu.1 in the spi-b mutant background is due to apoptosis (Lines 213-215). However, they only provide evidence of apoptosis in 3-5 dpf embryos, a stage at which loss of pu.1 alone does lead to a complete loss of microglia (Figure 2E). A control of pu.1 KI/d839 mutants treated with 4-OHT should be added to show that this effect is indeed dependent on the loss of spi-b. In addition, experiments should be performed to show apoptosis in the adult brain after cKO of pu.1 in spi-b mutants as there seems to be a difference in the requirement of pu.1 in embryonic and adult stages.

      (3) The number of microglia after pu.1 knockout in zebrafish did only show a significant decrease 3 months after 4-OHT injection, whereas microglia were almost completely depleted already 7 days after injection in mice. This major difference is not discussed in the paper.

      (4) Data is represented as mean +/-.SEM. Instead of SEM, standard deviation should be shown in all graphs to show the variability of the data. This is especially important for all graphs where individual data points are not shown. It should also be stated in the figure legend if SEM or SD is shown.

    1. Reviewer #1 (Public review):

      Summary:

      It is well known that neurons in the medial prefrontal cortex (mPFC) are involved in higher cognitive functions such as executive planning, motivational processing, and internal state-mediated decision-making. These internal states often correlate with the emotional states of the brain. While several studies point to the role of mPFC in regulating behavior based on such emotional states, the diversity of information processing in its sub-populations remains a less explored territory. In this study, the authors try to address this gap by identifying and characterizing some of these sub-populations in mice using a combination of projection-specific imaging, function-based tagging of neurons, multiple behavioral assays, and ex-vivo patch clamp recordings.

      Strengths:

      The authors targeted mPFC projections to the nucleus accumbens (NAc) and basolateral amygdala (BLA). Using the open field task (OFT), the authors identified four relevant behavioral states as well as neurons active while the animal was in the center region ("center-ON neurons"). By characterizing single-unit activity and using dimensionality reduction, the authors show differentiated coding of behavioral events at both the projection and functional levels. They further substantiate this effect by showing higher sensitivity of mPFC-BLA center-ON neurons during time spent in the open arms of the elevated plus maze (EPM). The authors then pivoted to the three-chamber social interaction (SI) assay to show the different subsets of neurons encode preference for social stimulus over non-social. This reveals an interesting diversity in the function of these sub-populations on multiple levels. Lastly, the authors used the tube test as a manipulation of the anxiety state of mice and compared behavioral differences before/after the OFT and social interaction tasks. This experiment revealed that "losers" of the tube test spend less time in the center of the open field while "winners" show a stronger preference for the familiar mouse over the object. Using patch-clamp experiments, the authors also found that "winners" exhibit stronger synaptic transmission in the mPFC-NAc projection while "losers" exhibit stronger synaptic transmission in the mPFC-BLA projection. Given the popularity of the tube test assay in rank determination, this provides useful insights into possible effects on anxiety levels and synaptic plasticity. Overall, the many experiments performed by the authors reveal interesting differences in mPFC neurons relative to their involvement in high or low anxiety behaviors, social preference, and social rank.

      Weaknesses:

      The authors focused primarily on female mice without commenting on the effect that sex differences would have on their results. While the authors have identified relevant behavioral states across the various behavioral tasks, there is still a missing link between them and "emotional states" - the phrase used by them emphatically throughout the manuscript. The authors have neither provided adequate references to satisfy this gap nor shared any data pertaining to relevant readouts such as cortisol levels. Both the projection-specific recordings and patch-clamp experiments, including histology reports in the manuscript, would provide essential information for anyone trying to replicate the results, especially since it's known that sub-populations in the BLA and NAc can have vastly different functions. The population-level analysis in the manuscript requires more rigor to reduce bias and statistical controls for establishing the significance of their results. Lastly, the tube test is used as a manipulation of the "emotional state" in several of the experiments. While the tube test can cause a temporary spike in anxiety of the participating mice, it is not known to produce a sustained effect - unless there are additional interventions such as forced social defeat. Thus, additional controls for these experiments are essential to support claims based on changes in the emotional state of mice. Apart from the methodology, the manuscript could also be improved with the addition of clear scatter points in all the plots along with detailed measures of the statistical tests such as exact p values and size of groups being compared.

    2. Reviewer #2 (Public review):

      Summary:

      The goal of this proposal was to understand how two separate projection neurons from the medial prefrontal cortex, those innervating the basolateral amygdala (BLA ) and nucleus accumbens (NAc), contribute to the encoding of emotional behaviors. The authors record the activity of these different neuron classes across three different behavioral environments. They propose that, although both populations are involved in emotional behavior, the two populations have diverging activity patterns in certain contexts. A subset of projections to the NAc appears particularly important for social behavior. They then attempt to link these changes to the emotional state of the animal and changes in synaptic connectivity.

      Strengths:

      The behavioral data builds on previous studies of these projection neurons supporting distinct roles in behavior and extend upon previous work by looking at the heterogeneity within different projection neurons across contexts.

      Weaknesses:

      The diversity of neurons mediating these projections and their targeting within the BLA and NAc is not explored. These are not homogeneous structures and so one possibility is that some of the diversity within their findings may relate to targeting of different sub-structures within each region. The electrophysiological data have significant experimental confounds and more methodological information is required to support other conclusions related to these data.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript investigates the distinct contributions of mPFC→BLA and mPFC→NAc pathways in emotional regulation, with implications for understanding anxiety, exploration, and social preference behaviors. Using Ca2+ imaging, optogenetics, and patch-clamp recording, the authors demonstrate pathway-specific roles in encoding emotional states of opposite valence. They further identify subsets of neurons ("center-ON") with heightened activity under anxiety-inducing conditions. These findings challenge the traditional view of functional similarity between these pathways and provide valuable insights into neural circuit dynamics relevant to emotional disorders.

      The study is well-designed and addresses an important topic, but several methodological and interpretational issues require clarification to strengthen the conclusions.

      Weaknesses:

      Major Weaknesses:

      (1) The manuscript does not clearly and consistently specify the sex of the mice used for behavioral and imaging experiments. Given the known influence of sex on emotional behaviors and neural activity, this omission raises concerns about the generalizability of the findings. The authors should make clear throughout the manuscript whether male, female, or mixed-sex cohorts were used and provide a rationale for their choice. If only one sex was used, the potential limitations of this approach should be explicitly discussed.

      (2) Mice lacking "center-ON" neurons were excluded from analysis, yet the manuscript draws broad conclusions about the encoding of emotional states by mPFC pathways. It is critical to justify this exclusion and discuss how it may limit the generalizability of the findings. The inclusion of data or contextualization for animals without center-ON neurons would strengthen the interpretation.

      (3) The manuscript lacks baseline activity comparisons for mPFC→BLA and mPFC→NAc pathways across subjects. Providing baseline data would contextualize the observed activity changes during behavior testing and help rule out inter-individual variability as a confounding factor.

      (4) Extensive behavioral testing across multiple paradigms may introduce stress and fatigue in the animals, which could confound the induction of emotional states. The authors should describe the measures taken to minimize these effects (e.g., recovery periods, randomized testing order) and discuss their potential impact on the results.

      (5) Grooming is described as a "non-anxiety" behavior, which conflicts with its established role as a stress-relieving behavior that may indicate anxiety. This discrepancy requires clarification, as the distinction is central to the conclusions about the mPFC→BLA pathway's role in differentiating anxiety-related and non-anxiety behaviors.

      (6) While the study highlights pathway-specific neural activity, it lacks a cohesive integration of these findings with the behavioral data. Quantifying the overlap or decorrelation of neuronal activity patterns across tasks would solidify claims about the specialization of mPFC→NAc and mPFC→BLA pathways. Likewise, the discussion should be expanded to place these findings in light of prior studies that have probed the roles of these pathways in social/emotion/valence-related behaviors.

      Minor Weaknesses:

      (1) The manuscript does not explicitly state whether the same mice were used across all behavioral assays. This information is critical for evaluating the validity of group comparisons. Additionally, more detail on sample sizes per assay would improve the manuscript's transparency.

      (2) In Figure 2G, the difference between BLA and NAc activity during exploratory behaviors (sniffing) is difficult to discern. Adjusting the scale or reformatting the figure would better illustrate the findings.

      (3) While the characteristics of the first social stimulus (M1) are specified, there is no information about the second social stimulus (M2). This omission makes it difficult to fully interpret the findings from the three-chamber test.

      (4) The methods section lacks detailed information about statistical approaches and animal selection criteria. Explicitly outlining these procedures would improve reproducibility and clarity.

    1. Reviewer #1 (Public review):

      Summary:

      The authors in this study extensively investigate how telomere length (TL) regulates hTERT expression via non-telomeric binding of the telomere-associated protein TRF2. They conclusively show that TRF2 binding to long telomeres results in a reduction in its binding to the hTERT promoter. In contrast, short telomeres restore TRF2 binding in the hTERT promoter, recruiting repressor complexes like PRC2, and suppressing hTERT expression. The study presents several significant findings revealing a previously unknown mechanism of hTERT regulation by TRF2 in a TL-dependent manner

      Strengths:

      (1) A previously unknown mechanism linking telomere length and hTERT regulation through the non-telomeric TRF2 protein has been established strengthening the telomere biology understanding.

      (2) The authors used both cancer cell lines and iPSCs to showcase their hypothesis and multiple parameters to validate the role of TRF2 in hTERT regulation.

      (3) Comprehensive integration of the recent literature findings and implementation in the current study.

      (4) In vivo validation of the findings.

      (5) Rigorous controls and well-designed assays have been use.

      Weaknesses:

      (1) The authors should comment on the cell proliferation and morphology of the engineered cell lines with ST or LT.

      (2) Also, the entire study uses engineered cell lines, with artificially elongated or shortened telomeres that conclusively demonstrate the role of hTERT regulation by TRF2 in telomere-length dependent manner, but using ALT negative cell lines with naturally short telomere length vs those with long telomeres will give better perspective. Primary cells can also be used in this context.

      (3) The authors set up time-dependent telomere length changes by dox induction, which may differ from the gradual telomere attrition or elongation that occurs naturally during aging, disease progression, or therapy. This aspect should be explored.

      (4) How does the hTERT regulation by TRF2 in a TL-dependent manner affect the ETS binding on hTERT mutant promoter sites?

      (5) Stabilization of the G-quadruplex structures in ST and LT conditions along with the G4 disruption experimentation (demonstrated by the authors) will strengthen the hypothesis.

      (6) The telomere length and the telomerase activity are not very consistent (Figure 2A, and S1A, Figure 4B and S3). Please comment.

      (7) Please comment on the other telomere-associated proteins or regulatory pathways that might contribute to hTERT expression based on telomere length.

    2. Reviewer #2 (Public review):

      Summary:

      Telomeres are key genomic structures linked to everything from aging to cancer. These key structures at the end of chromosomes protect them from degradation during replication and rely on a complex made up of human telomerase RNA gene (hTERC) and human telomerase reverse transcriptase (hTERT). While hTERC is expressed in all cells, the amount of hTERT is tightly controlled. The main hypothesis being tested is whether telomere length itself could regulate the hTERT enzyme. The authors conducted several experiments with different methods to alter telomere length and measured the binding of key regulatory proteins to this gene. It was generally observed that the shortening of telomere length leads to the recruitment of factors that reduce hTERT expression and lengthening of telomeres has the opposite effect. To rule out direct chromatin looping between telomeres and hTERT as driving this effect artificial constructs were designed and inserted a significant distance away and similar results were obtained.

      Overall, the claims of telomere length-dependent regulation of hTERT are supported throughout the manuscript.

      Strengths:

      The paper has several important strengths. Firstly, it uses several methods and cell lines that consistently demonstrate the same directionality of the findings. Secondly, it builds on established findings in the field but still demonstrates how this mechanism is separate from that which has been observed. Specifically, designing and implementing luciferase assays in the CCR5 locus supports that direct chromatin looping isn't necessary to drive this effect with TRF2 binding. Another strength of this paper is that it has been built on a variety of other studies that have established principles such as G4-DNA in the hTERT locus and TRF2 binding to these G4 sites.

      Weaknesses:

      The largest technical weakness of the paper is that minimal replicates are used for each experiment. I understand that these kinds of experiments are quite costly, and many of the effects are quite large, however, experiments such as the flow cytometry or the IPSC telomere length and activity assays appear to be based on a single sample, and several are based upon two maximum three biological replicates. If samples were added the main effects would likely hold, and many of the assays using GAPDH as a control would result in significant differences between the groups. This unnecessarily weakens the strength of the claims.

      Another detail that weakens the confidence in the claims is that throughout the manuscript there are several examples of the control group with zero variance between any of the samples: e.g. Figure 2K, Figure 3N, and Figure 6G. It is my understanding that a delta delta method has been used for calculation (though no exact formula is reported and would assist in understanding). If this is the case, then an average of the control group would be used to calculate that fold change and variance would exist in the group. The only way I could understand those control group samples always set to 1 is if a tube of cells was divided into conditions and therefore normalized to the control group in each case. A clearer description in the figure legend and methods would be required if this is what was done and repeated measures ANOVA and other statistics should accompany this.

      A final technical weakness of the paper is the data in Figure 5 where the modified hTERT promoter was inserted upstream of the luciferase gene. Specifically, it is unclear why data was not directly compared between the constructs that could and could not form G4s to make this point. For this reason, the large variance in several samples, and minimal biological replicates, this data was the least convincing in the manuscript (though other papers from this laboratory and others support the claim, it is not convincing standalone data).

      The second largest weakness of the paper is formatting.

      When I initially read the paper without a careful reading of the methods, I thought that the authors did not have appropriate controls meaning that if a method is applied to lengthen, there should be one that is not lengthened, and when a method is applied to shorten, one which is not shortened should be analysed as well. In fact, this is what the authors have done with isogenic controls. However, by describing all samples as either telomere short or telomere long, while this simplifies the writing and the colour scheme, it makes it less clear that each experiment is performed relative to an unmodified. I would suggest putting the isogenic control in one colour, the artificially shortened in another, and the artificially lengthened in another.

      Similarly, the graphs, in general, should be consistent with labelling. Figure 2 was the most confusing. I would suggest one dotted line with cell lines above it, and then the method of either elongation or shortening below it. I.e. HT1080 above, hTERC overexpression below, MDAMB-231 above guanine terminal repeats below, like was done on the right. Figure 2 readability would also be improved by putting hTERT promoter GAPDH (-ve control) under each graph that uses this (Panel B and Panel C not just Panel C). All information is contained in the manuscript but one must currently flip between figure legends, methods, and figures to understand what was done and this reduces clarity for the reader.

    1. for - Christine Wamsler - Lund University - homepage - from - youtube - Mindfulness World Community - Awareness, Care and Sustainability for Our Earth - https://hyp.is/GCUJ1APHEfCcr_vvv3lAFw/www.youtube.com/watch?v=CTUc_0GroGM

      research areas - sustainable cities - collaborative governance - city-citizen collaboration - citizen participation - sustainability and wellbeing - sustainability transformation - inner development goals - inner transformation - inner transition - existential sustainability

    1. Reviewer #1 (Public review):

      Summary:

      This paper introduces a new class of machine learning models for capturing how likely a specific nucleotide in a rearranged IG gene is to undergo somatic hypermutation. These models modestly outperform existing state-of-the-art efforts, despite having fewer free parameters. A surprising finding is that models trained on all mutations from non-functional rearrangements give divergent results from those trained on only silent mutations from functional rearrangements.

      Strengths:

      (1) The new model structure is quite clever and will provide a powerful way to explore larger models.

      (2) Careful attention is paid to curating and processing large existing data sets.

      (3) The authors are to be commended for their efforts to communicate with the developers of previous models and use the strongest possible versions of those in their current evaluation.

      Weaknesses:

      (1) 10x/single cell data has a fairly different error profile compared to bulk data. A synonymous model should be built from the same `briney` dataset as the base model to validate the difference between the two types of training data.

      (3) The decision to test only kernels of 7, 9, and 11 is not described. The selection/optimization of embedding size is not explained. The filters listed in Table 1 are not defined.

    2. Reviewer #2 (Public review):

      This work offers an insightful contribution for researchers in computational biology, immunology, and machine learning. By employing a 3-mer embedding and CNN architecture, the authors demonstrate that it is possible to extend sequence context without exponentially increasing the model's complexity.

      Key findings include:

      (1) Efficiency and Performance: Thrifty CNNs outperform traditional 5-mer models and match the performance of significantly larger models like DeepSHM.

      (2) Neutral Mutation Data: A distinction is made between using synonymous mutations and out-of-frame sequences for model training, with evidence suggesting these methods capture different aspects of SHM, or different biases in the type of data.

      (3) Open Source Contributions: The release of a Python package and pre-trained models adds practical value for the community.

      However, readers should be aware of the limitations. The improvements over existing models are modest, and the work is constrained by the availability of high-quality out-of-frame sequence data. The study also highlights that more complex modeling techniques, like transformers, did not enhance predictive performance, which underscores the role of data availability in such studies.

    3. Reviewer #3 (Public review):

      Summary:

      Modeling and estimating sequence context biases during B cell somatic hypermutation is important for accurately modeling B cell evolution to better understand responses to infection and vaccination. Sung et al. introduce new statistical models that capture a wider sequence context of somatic hypermutation with a comparatively small number of additional parameters. They demonstrate their model's performance with rigorous testing across multiple subjects and datasets. Prior work has captured the mutation biases of fixed 3-, 5-, and 7-mers, but each of these expansions has significantly more parameters. The authors developed a machine-learning-based approach to learn these biases using wider contexts with comparatively few parameters.

      Strengths:

      Well-motivated and defined problem. Clever solution to expand nucleotide context. Complete separation of training and test data by using different subjects for training vs testing. Release of open-source tools and scripts for reproducibility.

      Weaknesses:

      This study could be improved with better descriptions of dataset sequencing technology, sequencing depth, etc but this is a minor weakness.

    1. Reviewer #1 (Public review):

      In this manuscript, Purzner and colleagues examine the role of Ezh2 in cerebellar development and tumorigenesis using animal models of SHH medulloblastoma (MB). While Ezh2 plays a relatively minor role in granule neuron development and SHH MB, the authors demonstrate that Ezh2 inhibition, when combined with enforced cell cycle exit, promotes MB cell differentiation and potentially reduces malignancy. Overall, this study is solid and provides valuable insights into Ezh2 regulation in cerebellar development and SHH-MB tumorigenesis.

      Strengths:

      The authors investigate the role of Ezh2 in granule neuronal differentiation during cerebellar development and medulloblastoma (MB) progression, integrating multi-omics for a comprehensive epigenetic analysis. The use of Ezh2 conditional knockout (cKO) mice and combination therapy with Ezh2 and CDK4/6 inhibitors shows a promising strategy to induce terminal differentiation in MB cells, with potential therapeutic implications. Additionally, analysis of human SHH-MB samples reveals that higher EZH2 expression correlates with worse survival, indicating the clinical relevance.

      Weaknesses:

      The study does not fully explore compensatory mechanisms of PRC2 given that the phenotype of Ezh2 conditional knockout (cKO) in GNP development and MB tumor formation is relatively mild.

    2. Reviewer #2 (Public review):

      Summary:

      This study used an unbiased approach to evaluate epigenetic dynamics during the differentiation of granule neuron precursors, the cell of origin for Shh-MB. These profiling findings led to the focus on H3K27me3 dynamics, which correlate with the remodeling of epigenetic landscape associated with neuronal differentiation gene activation.

      Strengths:

      Depletion of EZH2, an enzymatic subunit of PRC2, resulted in premature neuronal differentiation in the developing cerebellum.

      Weaknesses:

      Little information is shown about the specific genetic programs disrupted by EZH2 depletion. This is a crucial weakness as existing PRC2 inhibitors do not effectively cross the blood-brain barrier. Further studies are necessary to identify downstream targets of PRC2 that could be targeted to induce neuronal differentiation in MB cells.

    1. Reviewer #1 (Public review):

      Summary:

      This study provides valuable and comprehensive information about the SARS-CoV-2 seroprevalence during 2021 and 2022 in different regions of Bolivia. Moreover, data on immune responses against the SARS-CoV-2 variants based on neutralization tests denotes the presence of several virus variants circulating in the Bolivian population. Evidence for seroprevalence data provided by the authors is solid, across the study period, while data regarding variant circulation is limited to the early stages of the pandemic.

      Strengths:

      The major strength of this study is that it provided nationwide seroprevalence estimates from infection and/or vaccination based on antibodies against both spike and the nucleocapsid protein in a large representative sample of sera collected at two time points from all departments of Bolivia, gaining insight into COVID-19 epidemiology. On the other hand, data from virus neutralization assays inferred the circulation during the study period of four SARS-CoV-2 variants in the population. Overall, the study results provide an overview of the level of viral transmission and vaccination and insights into the spread across the country of SARS-CoV-2 variants.

      Weaknesses:

      The assessment of a Lambda variant that circulated in several neighboring countries (Peru, Chile, and Argentina), which had a significant impact on the COVID-19 pandemic in the region, may have strengthened the study to contrast Gamma spread. In addition, even though neutralizing antibodies can certainly reveal previous infections of SARSCOV2 variants in the population, it is of limited value to infer from this information some potential timing estimates of specific variant circulation, considering the heterogeneous effects that past infections, vaccinations, or a combination of both could have on the level of variant-specific neutralizing antibodies and/or their cross-neutralization capacity.

      An appraisal of whether the authors achieved their aims, and whether the results support their conclusions.

      The conclusions of this paper are well supported by data, particularly regarding seroprevalence that reliably reflects the epidemiology of COVID-19 in Bolivia, and seroprevalence trends in other low- and middle-income countries.

      A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community.

      Since this is the first study that has been conducted to assess indicators of immunity against SARS-CoV-2 in the population of Bolivia at a nationwide scale, seroprevalence data provided by geographic regions at two time points can be useful as a reference for potential retrospective global meta-analysis and to further explore and compare the risk factors for infection, variant distribution, and the impact on infection and vaccination, gaining deeper insights into understanding the evolution of the COVID-19 pandemic in Bolivia and in the region.

    2. Reviewer #3 (Public review):

      Summary:

      This study attempts to reconstruct the history of the COVID-19 epidemic, with its successive waves of viral variants from SARS-CoV-2 seroprevalence during 2021 and 2022 among blood donors in different regions of Bolivia. By using serological tests "specific" for the various variants the authors try to achieve a "colour" vision that is not provided by standard "black-and-white" serology.

      Strengths and Weaknesses:<br /> I am not an expert on the performance of SARS-CoV-2 serological tests, so may overlook certain weaknesses. Instead I tried to assess whether the authors, in this manuscript, have managed to substantiate their claims that "seroprevalence studies are a valuable adjunct to active surveillance because they allow analysis of the level of immunity of a population to a specific pathogen without the need for prospective testing" , and that "genomic surveillance and serology offer distinct yet complementary insights thus far." I think they succeeded, as they paint a credible and interesting history of the epidemic in Bolivia using (to me) novel methodology that certainly will stimulate extensive discussion, controversies, and follow-up studies (for which the authors might make some suggestions).

    1. Reviewer #1 (Public review):

      Summary:

      This study demonstrates the significant role of secretory leukocyte protease inhibitor (SLPI) in regulating B. burgdorferi-induced periarticular inflammation in mice. They found that SLPI-deficient mice showed significantly higher B. burgdorferi infection burden in ankle joints compared to wild-type controls. This increased infection was accompanied by infiltration of neutrophils and macrophages in periarticular tissues, suggesting SLPI's role in immune regulation. The authors strengthened their findings by demonstrating a direct interaction between SLPI and B. burgdorferi through BASEHIT library screening and FACS analysis. Further investigation of SLPI as a target could lead to valuable clinical applications.

      The conclusions of this paper are mostly well supported by data. And the authors were responsive to the reviewers' comments.

      Comments on revised version:

      The authors have thoroughly addressed the previous concerns and improved the manuscript. The revisions have strengthened both the conclusions. I have no additional suggestions for improvement and recommend this manuscript for publication.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

      Strengths:

      Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

      Weaknesses:

      (a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

      Comments on revised verson:

      Several of the points were addressed in the revised manuscript, but the following issues remain:

      Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

      Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

      Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

      Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

      Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

    3. Reviewer #3 (Public review):

      Summary:

      The authors investigated the role of secretory leukocyte protease inhibitors (SLPI) in developing Lyme disease in mice infected with Borrelia burgdorferi. Using a combination of histological, gene expression, and flow cytometry analyses, they demonstrated significantly higher bacterial burden and elevated neutrophil and macrophage infiltration in SLPI-deficient mouse ankle joints. Furthermore, they also showed direct interaction of SLPI with B. burgdorferi, which likely depletes the local environment of SLPI and causes excessive protease activity. These results overall suggest ankle tissue inflammation in B. burgdorferi-infected mice is driven by unchecked protease activity.

      Strengths:

      Utilizing a comprehensive suite of techniques, this is the first study showing the importance of anti-protease-protease balance in the development of periarticular joint inflammation in Lyme disease.

      Weaknesses:

      Due to the limited sample availability, the authors investigated the serum level of SLPI in both Lyme arthritis patients and patients with earlier disease manifestations. This limitation is thoroughly discussed in the manuscript.

      Comments on revised version:

      I thank the authors for considering my comments carefully.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, authors have tried to repurpose cipargamin (CIP), a known drug against Plasmodium and Toxoplasma against Babesia. They proved the efficacy of CIP on Babesia in nanomolar range. In silico analyses revealed the drug resistance mechanism through a single amino acid mutation at amino acid position 921 on the ATP4 gene of Babesia. Overall, the conclusions drawn by the authors are well justified by their data. I believe this study opens up a novel therapeutic strategy against babesiosis.

      Strengths:

      Authors have carried out a comprehensive study. All the experiments performed were carried out methodically and logically.

    2. Reviewer #3 (Public review):

      Summary:

      The authors aim to establish that cipargamin can be used for the treatment of infection caused by Babesia organisms.

      Strengths:

      The study provides strong evidence that cipargamin is effective against various Babesia species. In vitro growth assays were used to establish that cipargamin is effective against Babesia bovis and Babesia gibsoni. Infection of mice with Babesia microti demonstrated that cipargamin is as effective as the combination of atovaquone plus azithromycin. Cipargamin protected mice from lethal infection with Babesia rodhaini. Mutations that confer resistance to cipargamin were identified in the gene encoding ATP4, a P-type Na ATPase that is found in other apicomplexan parasites, thereby validating ATP4 as the target of cipargamin. A 7-day treatment of cipagarmin, when combined with a single dose of tafenoquine, was sufficient to eradicate Babesia microti in a mouse model of severe babesiosis caused by lack of adaptive immunity.

      Weaknesses:

      Cipargamin was tested in vivo at a single dose administered daily for 7 days. Despite the prospect of using cipargamin for the treatment of human babesiosis, there was no attempt to identify the lowest dose of cipagarmin that protects mice from Babesia microti infection. In the SCID mouse model, cipargamin was tested in combination with tafenoquine but not with atovaquone and/or azithromycin, although the latter combination is often used as first-line therapy for human babesiosis caused by Babesia microti.

    1. Reviewer #1 (Public review):

      Summary:

      As our understanding of the immune system increases it becomes clear that murine models of Immunity cannot always prove an accurate model system for human immunity. However, mechanistic studies in humans are necessarily limited. To bridge this gap many groups have worked on developing humanised mouse models in which human immune cells are introduced into mice allowing their fine manipulation. However, since human immune cells will attack murine tissues, it has proven complex to establish a human-like immune system in mice. To help address this Vecchione et al, have previously developed several models using human cell transfer into mice with or without human thymic fragments that allow negative selection of autoreactive cells. In this report they focus on the examination of the function of the B-helper CD4 T-cell subsets T-follicular helper (Tfh) and T-peripheral helper (Tph) cells. They demonstrate that these cells are able to drive both autoantibody production and can also induce B-cell independent autoimmunity.

      Strengths:

      A strength of this paper is that currently there is no well-established model for Tfh or Tph in HIS mice and that currently there is no clear murine Tph equivalent making new models for the study of this cell type of value. Equally, since many HIS mice struggle to maintain effective follicular structures Tfh models in HIS mice are not well established giving additional value to this model.

      Weaknesses:

      A weakness of the paper is that the models seem to lack a clear ability to generate germinal centres in which Tfh may exert some of their key functions. In some cases, the definition of Tph-like does not seem to differentiate well between Tph and highly activated CD4 T-cells in general, partly since the literature around these cells has not fully resolved this point.

    2. Reviewer #2 (Public review):

      Summary:

      Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to use humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

      In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

      Strengths:

      (1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debateble, these description is valuable knowledge for this field of research.

      (2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

      Weaknesses:

      (1) In this manuscript, such as Fig. 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

      The authors added the data about FOXP3 expression among Tfh/Tph cells in the revised manuscript. This improved our data interpretation.

      (2) The definition of "Disease" discussed after Fig. 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

      The authors appropriately modified the manuscript and provided sufficient information about the definition of diseases.

      (3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Fig. 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

      The authors correctly cited their previous findings about the TCR repertoire variation. This strengthened the discussion of this study.

    1. Reviewer #1 (Public review):

      This paper by Ionescu et al. applies novel brain connectivity measures based on fMRI and serotonin PET both at baseline and following ecstasy use in rats. There are multiple strengths to this manuscript. First, the use of connectivity measures using temporal correlations of 11C-DASB PET, especially when combined with resting state fMRI, is highly novel and powerful. The effects of ecstasy on molecular connectivity of the serotonin network and salience network are also quite intriguing.

      The authors discussed their use of high-dose (1.3%) isolfurane in the context of a recent consensus paper on rat fMRI (Grandjean et al., "A Consensus Protocol for Functional Connectivity Analysis in the Rat Brain.") which found that medetomidine combined with low dose isoflurane provided optimal control of physiology and fMRI signal. The authors acknowledge their suboptimal anaesthetic regimen, which was chosen before the publication of the consensus paper. This likely explains, in part, why fMRI ICs in figure 2A appear fairly restricted.

      The PET ICs appear less bilateral than the fMRI ICs, which the authors attribute to lower SNR.

    2. Reviewer #2 (Public review):

      Summary:

      The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

      Strengths:

      Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

      Provides relevant information on the multivariate organization of serotoninergic system in the brain.

      Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

      Comments on revisions:

      I thank the authors for carefully addressing my comments and in particular for the interesting insights added to the discussion.

      I have just one last remark pertaining to the point of the sample size: rats undergoing the MDMA acute challenge constitute a relatively small sample (N=11); I feel there is a certain risk the results presented might not be particularly replicable. Could the authors prove the stability of their (main) results by randomly iterating the individuals included in their sample (e.g. via permutation tests)? Alternatively, including at least a justification of the sample size in the context of the available evidence would be valuable.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript aimed to study the role of Rudhira (also known as Breast Carcinoma Amplified Sequence 3), an endothelium-restricted microtubules-associated protein, in regulating of TGFβ signaling. The authors demonstrate that Rudhira is a critical signaling modulator for TGFβ signaling by releasing Smad2/3 from cytoskeletal microtubules and how that Rudhira is a Smad2/3 target gene. Taken together, the authors provide a model of how Rudhira contributes to TGFβ signaling activity to stabilize the microtubules, which is essential for vascular development.

      Strengths:

      The study used different methods and techniques to achieve aims and support conclusions, such as Gene Ontology analysis, functional analysis in culture, immunostaining analysis, and proximity ligation assay. This study provides unappreciated additional layer of TGFβ signaling activity regulation after ligand-receptor interaction.

      Weaknesses:

      (1) It is unclear how current findings provide a better understanding of Rudhira KO mice, which the authors published some years ago.

      (2) Why do they use HEK cells instead of SVEC cells in Fig 2 and 4 experiments?

      (3) A model shown in Fig 5E needs improvement to grasp their findings easily.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide a compelling method for characterizing communication within brain networks. The study engages important, biologically pertinent, concerns related to the balance of dynamics and structure in assessing the focal points of brain communication. The methods are clear, and seem broadly applicable, although they require some forethought about data and modeling choices.

      Strengths:

      The study is well-developed, providing overall clear exposition of relevant methods, as well as in-depth validation of the key network structural and dynamical assumptions. The questions and concerns raised in reading the text were always answered in time, with straightforward figures and supplemental materials.

      Weaknesses:

      In earlier drafts of the work, the narrative structure at times conflicts with the interpretability, however, this was greatly improved during revisions. The only remaining limitation for broad applicability lies in the full observability required in the current paradigm, however, the authors point at avenues for relaxing this assumption, which could be fruitful next steps for researchers aiming to deploy this work to EM or two-photon based datasets.

    1. Reviewer #1 (Public review):

      Summary:

      The paper addresses the problem of optimising the mapping of serum antibody responses against a known antigen. It uses the croEM analysis of polyclonal Fabs to antibody genes, with the ultimate aim of getting complete and accurate antibody sequences. The method, commonly termed EMPEM, is becoming increasingly used to understand responses in convalescent sera and optimisation of the workflows and provision of openly available tools is of genuine value to a growing number of people.

      The authors do not address the experimental aspects of the methods and do not present novel computational tools, rather they use a series of established computational methods to provide workflows that simplify the interpretation of the EM map in terms of the sequences of dominant antibodies.

      Strengths:

      The paper is well-written and clearly argued. The tests constructed seem appropriate and fair and demonstrate that the workflow works pretty well. For a small subset (~17%) of the EMPEM maps analysed the workflow was able to get convincing assignments of the V-genes.

    2. Reviewer #2 (Public review):

      In this manuscript, the authors seek to demonstrate that it is possible to sequence antibody variable domains from cryoEM reconstructions in combination with bottom-up LC-MSMS. In particular, they extract de novo sequences from single particle-cryo-EM-derived maps of antibodies using the "deep-learning tool ModelAngelo", which are run through the program Stitch to try to select the top scoring V-gene and construct a placeholder sequence for the CDR3 of both the heavy and light chain of the antibody under investigation. These reconstructed variable domains are then used as templates to guide the assembly of de novo peptides from LC-MS/MS data to improve the accuracy of the candidate sequence.

      Using this approach the authors claim to have demonstrated that "cryoEM reconstructions of monoclonal antigen-antibody complexes may contain sufficient information to accurately narrow down candidate V-genes and that this can be integrated with proteomics data to improve the accuracy of candidate sequences".

    1. Reviewer #2 (Public review):

      Summary:

      Mehta et al., in constructing E. coli strains unable to synthesize polyamines, noted that strains deficient in putrescine synthesis showed decreased movement on semisolid agar. They show that strains incapable of synthesizing putrescine have decreased expression of Type I pilin and, hence, decreased ability to perform pilin-dependent surface motility.

      Strengths:

      The authors characterize the specific polyamine pathways that are important for this phenomenon. RNAseq provides a detailed overview of gene expression in the strain lacking putrescine. They rule out potential effects of pilin phase variation on the phenotype. The data suggest homeostatic control of polyamine synthesis and metabolic changes in response to putrescine.

      Weaknesses:

      The authors do not, in the end, uncover the molecular details of pilin expression per se, but that would require significantly more analyses and data; the mechanisms of pilin regulation are complicated and still not completely understood.

    2. Reviewer #3 (Public review):

      Summary:

      This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

      Strengths:

      The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

      Weakness:

      The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

    1. Reviewer #1 (Public review):

      Summary:

      In this interesting and original paper, the authors examine the effect that heat stress can have on the ability of bacterial cells to evade infection by lytic bacteriophages. Briefly, the authors show that heat stress increases the tolerance of Klebsiella pneumoniae to infection by the lytic phage Kp11. They also argue that this increased tolerance facilitates the evolution of genetically encoded resistance to the phage. In addition, they show that heat can reduce the efficacy of phage therapy. Moreover, they define a likely mechanistic reason for both tolerance and genetically encoded resistance. Both lead to a reorganization of the bacterial cell envelope, which reduces the likelihood that phage can successfully inject their DNA.

      Strengths:

      I found large parts of this paper well-written and clearly presented. I also found many of the experiments simple yet compelling. For example, the experiments described in Figure 3 clearly show that prior heat exposure can affect the efficacy of phage therapy. In addition, the experiments shown in Figures 4 and 6 clearly demonstrate the likely mechanistic cause of this effect. The conceptual Figure 7 is clear and illustrates the main ideas well. I think this paper would work even without its central claim, namely that tolerance facilitates the evolution of resistance. The reason is that the effect of environmental stressors on stress tolerance has to my knowledge so far only been shown for drug tolerance, not for tolerance to an antagonistic species.

      Weaknesses:

      I did not detect any weaknesses that would require a major reorganization of the paper, or that may require crucial new experiments. However, the paper needs some work in clarifying specific and central conclusions that the authors draw. More specifically, it needs to improve the connection between what is shown in some figures, how these figures are described in the caption, and how they are discussed in the main text. This is especially glaring with respect to the central claim of the paper from the title, namely that tolerance facilitates the evolution of resistance. I am sympathetic to that claim, especially because this has been shown elsewhere, not for phage resistance but for antibiotic resistance. However, in the description of the results, this is perhaps the weakest aspect of the paper, so I'm a bit mystified as to why the authors focus on this claim. As I mentioned above, the paper could stand on its own even without this claim.

      More specific examples where clarification is needed:

      (1) A key figure of the paper seems to be Figure 2D, yet it was one of the most confusing figures. This results from a mismatch between the accompanying text starting on line 92 and the figure itself. The first thing that the reader notices in the figure itself is the huge discrepancy between the number of viable colonies in the absence of phage infection at the two-hour time point. Yet this observation is not even mentioned in the main text. The exclusive focus of the main text seems to be on the right-hand side of the figure, labeled "+Phage". It is from this right-hand panel that the authors seem to conclude that heat stress facilitates the evolution of resistance. I find this confusing, because there is no difference between the heat-treated and non-treated cells in survivorship, and it is not clear from this data that survivorship is caused by resistance, not by tolerance/persistence. (The difference between tolerance and resistance has only been shown in the independent experiments of Figure 1B.) Figure 2F supports the resistance claim, but it is not one of the strongest experiments of the paper, because the author simply only used "turbidity" as an indicator of resistance. In addition, the authors performed the experiments described therein at small population sizes to avoid the presence of resistance mutations. But how do we know that the turbidity they describe does not result from persisters?

      I see three possibilities to address these issues. First, perhaps this is all a matter of explaining and motivating this particular experiment better. Second, the central claim of the paper may require additional experiments. For example, is it possible to block heat induced tolerance through specific mutations, and show that phage resistance does not evolve as rapidly if tolerance is blocked? A third possibility is to tone down the claim of the paper, and make it about heat tolerance rather than the evolution of heat resistance.

      A minor but general point here is that in Figure 2D and in other figures, the labels "-phage" and "+phage" do not facilitate understanding, because they suggest that cells in the "-phage" treatment have not been exposed to phage at all, but that is not the case. They have survived previous phage treatment and are then replated on media lacking phage.

      (2) Another figure with a mismatch between text and visual materials is Figure 5, specifically Figures 5B-F. The figure is about two different mutants, and it is not even mentioned in the text how these mutants were identified, for example in different or the same replicate populations. What is more, the two mutants are not discussed at all in the main text. That is, the text, starting on line 221 discusses these experiments as if there was only one mutant. This is especially striking as the two mutants behave very differently, as, for example, in Figure 5C. Implicitly, the text talks about the mutant ending in "...C2", and not the one ending in "...C1". To add to the confusion, the text states that the (C2) mutant shows a change in the pspA gene, but in Figure 5f, it is the other (undiscussed) mutant that has a mutation in this gene. Only pspA is discussed further, so what about the other mutants? More generally, it is hard to believe that these were the only mutants that occurred in the genome during experimental evolution. It would be useful to give the reader a 2-3 sentence summary of the genetic diversity that experimental evolution generated.

    2. Reviewer #2 (Public review):

      Summary:

      An initial screening of pretreatment with different stress treatments of K. pneumoniae allowed the identification of heat stress as a protection factor against the infection of the lytic phage Kp11. Then experiments prove that this is mediated not by an increase of phage-resistant bacteria but due to an increase in phage transient tolerant population, which the authors identified as bacteriophage persistence in analogy to antibiotic persistence. Then they proved that phage persistence mediated by heat shock enhanced the evolution of bacterial resistance against the phage. The same trait was observed using other lytic phages, their combinations, and two clinical strains, as well as E. coli and two T phages, hence the phenomenon may be widespread in enterobacteria.

      Next, the elucidation of heat-induced phage persistence was done, determining that phage adsorption was not affected but phage DNA internalization was impaired by the heat pretreatment, likely due to alterations in the bacterial envelope, including the downregulation of envelope proteins and of LPS; furthermore, heat treated bacteria were less sensitive to polymyxins due to the decrease in LPS.

      Finally, cyclic exposure to heat stress allowed the isolation of a mutant that was both resistant to heat treatment, polymyxins, and lytic phage, that mutant had alterations in PspA protein that allowed a gain of function and that promoted the reduction of capsule production and loss of its structure; nevertheless this mutant was severely impaired in immune evasion as it was easily cleared from mice blood, evidencing the tradeoffs between phage/heat and antibiotic resistance and the ability to counteract the immune response.

      Strengths:

      The experimental design and the sequence in which they are presented are ideal for the understanding of their study and the conclusions are supported by the findings, also the discussion points out the relevance of their work particularly in the effectiveness of phage therapy, and allows the design of strategies to improve their effectiveness.

      Weaknesses:

      In its present form, it lacks the incorporation of some relevant previous work that explored the role of heat stress in phage susceptibility, antibiotic susceptibility, tradeoffs between phage resistance and resistance against other kinds of stress, virulence, etc., and the fact that exposure to lytic phages induces antibiotic persistence.

    3. Reviewer #3 (Public review):

      PspA, a key regulator in the phage shock protein system, functions as part of the envelope stress response system in bacteria, preventing membrane depolarization and ensuring the envelope stability. This protein has been associated in the Quorum Sensing network and biofilm formation. (Moscoso M., Garcia E., Lopez R. 2006. Biofilm formation by Streptococcus pneumoniae: role of choline, extracellular DNA, and capsular polysaccharide in microbial accretion. J. Bacteriol. 188:7785-7795; Vidal JE, Ludewick HP, Kunkel RM, Zähner D, Klugman KP. The LuxS-dependent quorum-sensing system regulates early biofilm formation by Streptococcus pneumoniae strain D39. Infect Immun. 2011 Oct;79(10):4050-60.)

      It is interesting and very well-developed.

      (1) Could the authors develop experiments about the relationship between Quorum Sensing and this protein?

      (2) It would be interesting to analyze the link to phage infection and heat stress in relation to Quorum. The authors could study QS regulators or AI2 molecules.

      (3) Include the proteins or genes in a table or figure from lytic phage Kp11 (GenBank: ON148528.1).

    1. Reviewer #1 (Public review):

      This manuscript presents an interesting exploration of the potential activation mechanisms of DLK following axonal injury. While the experiments are beautifully conducted and the data are solid, I feel that there is insufficient evidence to fully support the conclusions made by the authors.

      In this manuscript, the authors exclusively use the puc-lacZ reporter to determine the activation of DLK. This reporter has been shown to be induced when DLK is activated. However, there is insufficient evidence to confirm that the absence of reporter activation necessarily indicates that DLK is inactive. As with many MAP kinase pathways, the DLK pathway can be locally or globally activated in neurons, and the level of DLK activation may depend on the strength of the stimulation. This reporter might only reflect strong DLK activation and may not be turned on if DLK is weakly activated.

      As noted by the authors, DLK has been implicated in both axon regeneration and degeneration. Following axotomy, DLK activation can lead to the degeneration of distal axons, where synapses are located. This raises an important question: how is DLK activated in distal axons? The authors might consider discussing the significance of this "synapse connection-dependent" DLK activation in the broader context of DLK function and activation mechanisms.

    2. Reviewer #2 (Public review):

      Summary:

      The authors study a panel of sparsely labeled neuronal lines in Drosophila that each form multiple synapses. Critically, each axonal branch can be injured without affecting the others, allowing the authors to differentiate between injuries that affect all axonal branches versus those that do not, creating spared branches. This is a highly powerful model. Axonal injuries are known to cause Wnd (mammalian DLK)-dependent retrograde signals to the cell body, culminating in a transcriptional response. This work identifies a fascinating new phenomenon that this injury response is not all-or-none. If even a single branch remains uninjured, the injury signal is not activated in the cell body. The authors rule out that this could be due to changes in the abundance of Wnd (perhaps if incrementally activated at each injured branch) by Wnd, Hiw's known negative regulator. Thus there is both a yet-undiscovered mechanism to regulate Wnd signaling, and more broadly a mechanism by which the neuron can integrate the degree of injury it has sustained. It will now be important to tease apart the mechanism(s) of this fascinating phenomenon. But even absent a clear mechanism, this is a new biology that will inform the interpretation of injury signaling studies across species.

      Strengths:

      - A conceptually beautiful series of experiments that reveal a fascinating new phenomenon is described, with clear implications (as the authors discuss in their Discussion) for injury signaling in mammals.<br /> - Suggests a new mode of Wnd regulation, independent of Hiw.

      Weaknesses:

      -The use of a somatic transcriptional reporter for Wnd activity is powerful, however, the reporter indicates whether the transcriptional response was activated, not whether the injury signal was received. It remains possible that Wnd is still activated in the case of a spared branch, but that this activation is either local within the axons (impossible determine in the absence of a local reporter) or that the retrograde signal was indeed generated but it was somehow insufficient to activate transcription when it entered the cell body. This is more of a mechanistic detail (and likely an extreme technical challenge to assess) and should not detract from the overall importance of the study

      -That the protective effect of a spared branch is independent of Hiw, the known negative regulator of Wnd, is fascinating. But this leaves open a key question: what is the signal?

      Comments on revisions:

      I appreciate your discussion about the potential bi-modal regulation of the puckered transcriptional reporter and think that readers would benefit from a short discussion of this.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript seeks to understand how nerve injury-induced signaling to the nucleus is influenced, and it establishes a new location where these principles can be studied. By identifying and mapping specific bifurcated neuronal innervations in the Drosophila larvae, and using laser axotomy to localize the injury, the authors find that sparing a branch of a complex muscular innervation is enough to impair Wallenda-puc (analogous to DLK-JNK-cJun) signaling that is known to promote regeneration. It is only when all connections to the target are disconnected that cJun-transcriptional activation occurs.

      Overall, this is a thorough and well-performed investigation of the mechanism of spared-branch influence on axon injury signaling. The findings on control of wnd are important because this is a very widely used injury signaling pathway across species and injury models. The authors present detailed and carefully executed experiments to support their conclusions. Their effort to identify the control mechanism is admirable and will be of aid to the field as they continue to try to understand how to promote better regeneration of axons.

      Strengths:

      The paper does a very comprehensive job of investigating this phenomenon at multiple locations and through both pinpoint laser injury as well as larger crush models. They identify a non-hiw based restraint mechanism of the wnd-puc signaling axis that presumably is originating from the spared terminal. They also present a large list of tests they performed to identify the actual restraint mechanism from the spared branch, which has ruled out many of the most likely explanations. This is an extremely important set of information to report, to guide future investigators in this and other model organisms on mechanisms by which regeneration signaling is controlled (or not).

      Weaknesses:

      While there are many questions raised by these results that are not answered here, including the pathways upstream and downstream of DLK and how the binary switch control of DLK/puc signaling is executed, the model built in this manuscript is valuable to future work going after these important questions.

      Because the conclusions of the paper are focused on a single (albeit well validated) reporter in different types of motor neurons, it is hard to determine whether the mechanism of spared branch inhibition of regeneration requires wnd-puc (DLK/cJun) signaling, or whether this is a binary/threshold response in all contexts (for example, sensory axons or interneurons). However, the author points out in the response that there are sensory neuron examples where a spared connection does not block DLK activation. As such, it may not be a universal mechanism but could provide a model for better understanding of DLK control across different contexts.

      Comments on revisions:

      The new panels in Figure 1E do not have Y-axis labels. (mean puc-lacZ intensity?)

    1. Reviewer #1 (Public review):

      Summary:

      The authors of this study set out to find RNA binding proteins in the CNS in cell-type specific sequencing data and discover that the cardiomyopathy-associated protein RBM20 is selectively expressed in olfactory bulb glutamatergic neurons and PV+ GABAergic neurons. They make an HA-tagged RBM20 allele to perform CLIP-seq to identify RBM20 binding sites and find direct targets of RBM20 in olfactory bulb glutmatergic neurons. In these neurons, RBM20 binds intronic regions. RBM20 has previously been implicated in splicing, but when they selectively knockout RBM20 in glutamatergic neurons they do not see changes in splicing, but they do see changes in RNA abundance, especially of long genes with many introns, which are enriched for synapse-associated functions. These data show that RBM20 has important functions in gene regulation in neurons, which was previously unknown, and they suggest it acts through a mechanism distinct from what has been studied before in cardiomyocytes.

      Strengths:

      The study finds expression of the cardiomyopathy-associated RNA binding protein RBM20 in specific neurons in the brain, opening new windows into its potential functions there.

      The study uses CLIP-seq to identify RBM20 binding RNAs in olfactory bulb neurons.

      Conditional knockout of RBM20 in glutamatergic or PV neurons allows the authors to detect mRNA expression that is regulated by RBM20.

      The data include substantial controls and quality control information to support the rigor of the findings.

      Weaknesses:

      The authors do not fully identify the mechanism by which RBM20 acts to regulate RNA expression in neurons, though they do provide data suggesting that neuronal RBM20 does not regulate alternate splicing in neurons, which is an interesting contrast to its proposed mechanism of function in cardiomyocytes. Discovery of the RNA regulatory functions of RBM20 in neurons is left as a question for future studies.

      The study does not identify functional consequences of the RNA changes in the conditional knockout cells, so this is also a question for the future.

    2. Reviewer #2 (Public review):

      Summary:

      The group around Prof. Scheiffele has made seminal discoveries reg. alternative splicing that is reflected by a current ERC advanced grant and landmark papers in eLife (2015), Science (2016), and Nature Neuroscience (2019). Recently, the group investigated proteins that contain an RRM motif in the mouse cortex. One of them, termed RBM20, was originally thought be muscle-specific and involved in alternative splicing in cardiomyocytes. However, upon close inspection, RBP20 is expressed in a particular set of interneurons (PV positive cells of the somatosensory cortex) in the cortex as well as in mitral cells of the olfactory bulb (OB). Importantly, they used CLIP to identify targets in the OB and heart. Next and quite importantly, they generated a knock-in mouse line with a His-biotin acceptor peptide and a HA epitope to perform specific biochemistry. Not surprisingly, this allowed them to specifically identify transcripts with long introns, however, most of the intronic binding sites were very distant to the splice sites. Closer GO term inspection revealed that RBM20 specifically regulates synapse-related transcripts. In order to get in vivo insight into its function in the brain, the authors generated both global as well as conditional KO mice. Surprisingly, there were no significant differences in in RBM20 PV interneurons, however, 409 transcripts were deregulated in in OB glutamatergic neurons. Here, CLIP sites were mostly found to be very distant from differentially expressed exons. Furthermore, loss-of-function RBM20 primarily yields loss of transcripts, whereas upregulation appears to be indirect. Together, these results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Strengths:

      The quality of the data and the figures is high, impressive and convincing. The reported results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Weaknesses:

      In their revised manuscript, the authors significantly improved the intro and results section, which is now much better suited for the general public and allows better to follow the logic of the experiments. Also, the discussion has now been expanded doing better justice to the importance of the findings presented.

      In my opinion, the revised manuscript clearly improved and represents a timely and important study, which provides major new insight into the expression and possible function of RBM20 in tissues outside of muscle.

    3. Reviewer #3 (Public review):

      Summary:

      The authors identified RBM20 expression in neural tissues using cell type-specific transcriptomic analysis. This discovery was further validated through in vitro and in vivo approaches, including RNA fluorescent in situ hybridization (FISH), open-source datasets, immunostaining, western blotting, and gene-edited RBM20 knockout (KO) mice. CLIP-seq and RiboTRAP data demonstrated that RBM20 regulates common targets in both neural and cardiac tissues, while also modulating tissue-specific targets. Furthermore, the study revealed that neuronal RBM20 governs long pre-mRNAs encoding synaptic proteins.

      Strengths:

      • Utilization of a large dataset combined with experimental evidence to identify and validate RBM20 expression in neural tissues.<br /> • Global and tissue-specific RBM20 KO mouse models provide robust support for RBM20 localization and expression.<br /> • Employing heart tissue as a control highlights the unique findings in neural tissues.

      Weaknesses:

      • Lack of physiological functional studies to explore RBM20's role in neural tissues.<br /> • Data quality requires improvement for stronger conclusions.

      Comments on revisions:

      The authors have effectively addressed most of my concerns, which has significantly improved the quality and reliability of the data. While sufficient functional data were not provided, the current findings offer valuable and novel insights into the expression of RBM20 in neurons. I have no further concerns.

    1. Reviewer #1 (Public review):

      Summary:

      The aim of this paper is to develop a simple method to quantify fluctuations in the partitioning of cellular elements. In particular, they propose a flow-cytometry-based method coupled with a simple mathematical theory as an alternative to conventional imaging-based approaches.

      Strengths:

      The approach they develop is simple to understand and its use with flow-cytometry measurements is clearly explained. Understanding how the fluctuations in the cytoplasm partition vary for different kinds of cells is particularly interesting.

      Weaknesses:

      The theory only considers fluctuations due to cellular division events. This seems a large weakness because it is well known that fluctuations in cellular components are largely affected by various intrinsic and extrinsic sources of noise and only under particular conditions does partitioning noise become the dominant source of noise.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present a combined experimental and theoretical workflow to study partitioning noise arising during cell division. Such quantifications usually require time-lapse experiments, which are limited in throughput. To bypass these limitations, the authors propose to use flow-cytometry measurements instead and analyse them using a theoretical model of partitioning noise. The problem considered by the authors is relevant and the idea to use statistical models in combination with flow cytometry to boost statistical power is elegant. The authors demonstrate their approach using experimental flow cytometry measurements and validate their results using time-lapse microscopy. However, while I appreciate the overall goal and motivation of this work, I was not entirely convinced by the strength of this contribution. The approach focuses on a quite specific case, where the dynamics of the labelled component depend purely on partitioning. As such it seems incompatible with studying the partitioning noise of endogenous components that exhibit production/turnover. The description of the methods was partly hard to follow and should be improved. In addition, I have several technical comments, which I hope will be helpful to the authors.

      Comments:

      (1) In the theoretical model, copy numbers are considered to be conserved across generations. As a consequence, concentrations will decrease over generations due to dilution. While this consideration seems plausible for the considered experimental system, it seems incompatible with components that exhibit production and turnover dynamics. I am therefore wondering about the applicability/scope of the presented approach and to what extent it can be used to study partitioning noise for endogenous components. As presented, the approach seems to be limited to a fairly small class of experiments/situations.

      (2) Similar to the previous comment, I am wondering what would happen in situations where the generations could not be as clearly identified as in the presented experimental system (e.g., due to variability in cell-cycle length/stage). In this case, it seems to be challenging to identify generations using a Gaussian Mixture Model. Can the authors comment on how to deal with such situations? In the abstract, the authors motivate their work by arguing that detecting cell divisions from microscopy is difficult, but doesn't their flow cytometry-based approach have a similar problem?

      (3) I could not find any formal definition of division asymmetry. Since this is the most important quantity of this paper, it should be defined clearly.

      (4) The description of the model is unclear/imprecise in several parts. For instance, it seems to me that the index "i" does not really refer to a cell in the population, but rather a subpopulation of cells that has undergone a certain number of divisions. Furthermore, why is the argument of Equation 11 suddenly the fraction f as opposed to the component number? I strongly recommend carefully rewriting and streamlining the model description and clearly defining all quantities and how they relate to each other.

      (5) Similarly, I was not able to follow the logic of Section D. I recommend carefully rewriting this section to make the rationale, logic, and conclusions clear to the reader.

      (6) Much theoretical work has been done recently to couple cell-cycle variability to intracellular dynamics. While the authors neglect the latter for simplicity, it would be important to further discuss these approaches and why their simplified model is suitable for their particular experiments.

      (7) In the discussion the authors note that the microscopy-based estimates may lead to an overestimation of the fluctuations due to limited statistics. I could not follow that reasoning. Due to the gating in the flow cytometry measurements, I could imagine that the resulting populations are more stringently selected as compared to microscopy. Could that also be an explanation? More generally, it would be interesting to see how robust the results are in terms of different gating diameters.

      (8) It would be helpful to show flow cytometry plots including the identified subpopulations for all cell lines, currently, they are shown only for HCT116 cells. More generally, very little raw data is shown.

      (9) The title of the manuscript could be tailored more to the considered problem. At the moment it is very generic.

    1. Reviewer #1 (Public review):

      Summary:

      This study was motivated by the general claim that delayed development of cognitive control can be beneficial for learning, and investigated this claim in the specific domain of conceptual development. A comprehensive set of computational model simulations showed that delaying the onset of semantic control produces faster learning with only minimal effects on conceptual abstraction. The simulations also showed that control was most effective at intermediate levels between modality-specific "spokes" and the multimodal "hub". A meta-analysis of developmental data was consistent with the claim of delayed onset of semantic control: young children show substantially better semantic knowledge than the ability to constrain that knowledge to a specific task at hand.

      Strengths:

      The computational modelling is based on a very well-established model of semantic cognition, which means that the simulations allow exploring the specific issues under investigation here in the context of a model that accounts for a very large set of semantic cognition phenomena. The simulations are comprehensive - manipulating different parameters of the model provides important insights into how (and why) it works.

      In addition to simulations exploring delayed maturation, there is an exploration of where semantic control is most effective, yielding the interesting result that control is most effective when it targets intermediate levels of semantic processing. To my knowledge, this is a novel finding and a concrete prediction for future testing.

      The meta-analysis is designed in a very clever way that allows extracting evidence of semantic control from a large body of prior work. The results are quite clear and compelling in showing that semantic knowledge is acquired before children are able to use task demands to constrain the use of that knowledge.

      Weaknesses:

      Computational models of cognition inherently require simplification in order to focus on the mechanisms under investigation. However, it is also important to keep these simplifications in mind because they limit the generality of the inferences that can be made from the simulation results. Two aspects are important in this context:

      (1) The multimodal structure was orthogonal to the surface similarity structure of the concepts to be learned. It is certainly true that multimodal structure does not perfectly mirror surface similarity, but closely related things tend to be perceptually similar. There are exceptions (whales, penguins, etc.), but they are *exceptional*, not typical. It may be that the somewhat extreme dissociation of multimodal and surface similarity structures creates demands that are not faced in natural conceptual development.

      (2) Much of the benefit of delayed semantic control seems to be because the model is not penalised for activating task-irrelevant features. This blurs the distinction between being aware of a feature and making a response based on that feature. A full model that also includes a response layer could become a lot more complicated and more difficult to understand, so maybe there is an advantage to using a simpler architecture.

      In addition, there is a bit of a misalignment between the model simulations and the meta-analysis. In the model, there are distinct modality-specific "spokes" and control is required in order to focus on modality/spoke in a task-appropriate way. The meta-analysis does not compare a task-defined selection of a modality; it compares the selection of taxonomic vs thematic relations, both of which are multimodal. One way to resolve this is to say that taxonomic and thematic relations are also represented in distinct sub-systems of semantic knowledge and semantic control is needed to select between them in a task-appropriate way.

      This is particularly relevant to the inference at the bottom of p. 38: "taxonomic and thematic relationships ...[are]... both being encoded within the same system of representation", which seems in direct contradiction to the present results, or at least to the logic of combining these simulations with this meta-analysis. The simulations are based on semantic control being used to select/constrain the correct distinct sub-system (modality-specific spoke); the meta-analysis is based on semantic control being used to select/constrain the correct relationship type. If these two things are analogous in some way, then the relationship type has to be something like a distinct sub-system.

    2. Reviewer #2 (Public review):

      Summary:

      This paper investigates the idea that the protracted maturation of the prefrontal cortex - often viewed as a developmental limitation - may actually confer advantages for conceptual learning in children. The authors focus on semantic control processes, which govern the context-sensitive application of conceptual knowledge, and are closely associated with late-developing regions of the prefrontal cortex.

      Drawing on a computational model, the paper formally tests whether delayed maturation of semantic control promotes the acquisition of conceptual knowledge. The simulations demonstrate that when semantic control and anatomical connectivity mature later, conceptual learning is accelerated without compromising the integrity of the learned representations. Notably, the benefit is most apparent when control connections target intermediate layers in the computational model, suggesting a nuanced interplay between control processes and the underlying conceptual network.

      To validate these computational insights in a human developmental context, the authors conduct a meta-analysis of the classic triadic matching task - a paradigm where participants decide which of two choices best matches a reference concept based on either taxonomic or thematic relations. Critically, when these relations conflict, semantic control is required to select the context-appropriate match. Results indicate that context-sensitive semantic control develops more slowly than basic conceptual knowledge, showing marked improvements between 3 and 6 years of age.

      Overall, the paper argues that the delayed development of prefrontal cortex-based control processes allows for a period of less constrained learning, ultimately enhancing conceptual acquisition. The findings challenge the traditional view of late PFC maturation as solely disadvantageous and instead position it as an adaptive feature for building robust conceptual frameworks in early childhood.

      Strengths:

      (1) Novel Theoretical Contribution<br /> The paper offers a compelling, counterintuitive argument that a developmental lag in the maturation of control processes might be beneficial for semantic learning. This stands in contrast to the conventional framing of late prefrontal cortex (PFC) development as purely disadvantageous (e.g., a "necessary but unfortunate" constraint).

      (2) Well-Grounded Computational Approach<br /> The authors propose a neural network model that is both theoretically driven (hub-and-spoke framework) and systematically tested under various conditions (different timelines for control onset, and different connectivity patterns). Their simulations replicate and extend previous findings about how insulating the multimodal hub from direct control inputs helps preserve abstract conceptual representations.

      (3) Neuro-anatomical basis<br /> The paper connects its computational claims to empirical neuroanatomy, particularly the lack of direct structural connectivity between ventral ATL (the "hub") and the PFC in humans. This lends biological plausibility to the argument that control signals likely reach the ATL via intermediate regions (e.g., posterior temporal cortex).

      (4) Meta-Analysis of Triadic Match-to-Sample<br /> The authors leverage decades of developmental data on conceptual matching tasks, reframing them in terms of semantic control vs. semantic representation. Their analysis nicely illustrates that children can identify semantic relationships (taxonomic or thematic) at age 2 if the task does not require them to select between conflicting semantic relations. In contrast, the ability to choose a task-relevant relation only emerges more robustly in 3-6 years. This developmental pattern aligns with the computational model's predictions.

      Weaknesses:

      The contribution of the paper might be considered rather specialist, and might not appeal to a broad public, which should be typical of a generalist journal. Moreover, the scope of the model is fairly narrow - its relatively small, controlled training environment raises questions about scalability to more naturalistic, high-dimensional data. Finally, the meta-analysis does not test directly the model predictions in terms of specific outcomes of the task, error patterns, or model fit, but only the developmental pattern which was an already observed phenomenon that in part motivated the hypothesis and the model itself.

    1. Reviewer #1 (Public review):

      Summary:

      Pavel et al. analyzed a cohort of atrial fibrillation (AF) patients from the University of Illinois at Chicago, identifying TTN truncating variants (TTNtvs) and TTN missense variants (TTNmvs). They reported a rare TTN missense variant (T32756I) associated with adverse clinical outcomes in AF patients. To investigate its functional significance, the authors modeled the TTN-T32756I variant using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). They demonstrated that mutant cells exhibit aberrant contractility, increased activity of the cardiac potassium channel KCNQ1 (Kv7.1), and dysregulated calcium homeostasis. Interestingly, these effects occurred without compromising sarcomeric integrity. The study further identified increased binding of the titin-binding protein Four-and-a-Half Lim domains 2 (FHL2) with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I iPSC-aCMs.

      Strengths:

      This work has translational potential, suggesting that targeting KCNQ1 or FHL2 could represent a novel therapeutic strategy for improving cardiac function. The findings may also have broader implications for treating patients with rare, disease-causing variants in sarcomeric proteins and underscore the importance of integrating genomic analysis with experimental evidence to advance AF research and precision medicine.

      Weaknesses:

      (1) Variant Identification: It is unclear how the TTN missense variant (T32756I) was identified using REVEL, as none of the patients' parents reportedly carried the mutation or exhibited AF symptoms. Are there other TTN variants identified in the three patients carrying TTN-T32756I? Clarification on this point is necessary.

      (2) Patient-Specific iPSC Lines: Since the TTN-T32756I variant was modeled using only one healthy iPSC line, it is unclear whether patient-specific iPSC-derived atrial cardiomyocytes would exhibit similar AF-related phenotypes. This limitation should be addressed.

      (3) Hypertension as a Confounding Factor: The three patients carrying TTN-T32756I also have hypertension. Could the hypertension associated with this variant contribute secondarily to AF? The authors should discuss or rule out this possibility.

      (4) FHL2 and KCNQ1-KCNE1 Interaction: Immunostaining data demonstrating the colocalization of FHL2 with the KCNQ1-KCNE1 (MinK) complex in TTN-T32756I iPSC-aCMs are needed to strengthen the mechanistic findings.

      (5) Functional Characterization of FHL2-KCNQ1-KCNE1 Interaction: Additional functional assays are necessary to characterize the interaction between FHL2 and the KCNQ1-KCNE1 complex in TTN-T32756I iPSC-aCMs to further validate the proposed mechanism.

    2. Reviewer #2 (Public review):

      Summary:

      The authors present data from a single-center cohort of African-American and Hispanic/Latinx individuals with atrial fibrillation (AF). This study provides insight into the incidences and clinical impact of missense variants in the Titin (TTN) gene in this population. In addition, the authors identified a single amino acid TTN missense variant (TTN-T32756I) that was further studied using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). These studies demonstrated that the Four-and-a-Half Lim domains 2 (FHL2), has increased binding with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I-iPSC-aCMs, enhancing the slow delayed rectifier potassium current (Iks) and is a potential mechanism for atrial fibrillation. Finally, the authors demonstrate that suppression of FHL2 could normalize the Iks current.

      Strengths:

      The strengths of this manuscript/study are listed below:

      (1) This study includes a previously underrepresented population in the study of the genetic and mechanistic basis of AF.<br /> (2) The authors utilize current state-of-the-art methods to investigate the pathogenicity of a specific TTN missense variant identified in this underrepresented patient population.<br /> (3) The findings of this study identify a potential therapeutic for treating atrial fibrillation.

      Weaknesses:

      (1) The authors do not include a non-AF group when evaluating the incidence and clinical significance of TTN missense variants in AF patients.

      (2) The authors do not provide evidence that TTN-T32756I-iPSC-aCMs are arrhythmogenic only that there is an increase in the Iks current and associated action potential changes. More specifically, the authors report "compared to the WT, TTN-T32756I-iPSC-aCMs exhibited increased arrhythmic frequency" yet is it is unclear what they are referring to by "arrhythmic frequency".

      (3) There seem to be discrepancies regarding the impact of the TTN-T32756I variant on mechanical function. Specifically, the authors report "both reduced contraction and abnormal relaxation in TTN-T32756I-iPSC-aCMs" yet, separately report "the contraction amplitude of the mutant was also increased . . . suggesting an increased contractile force by the TTN-T32756I-iPSC-aCMs and TTN-T32756I-iPSC-CMs exhibited similar calcium transient amplitudes as the WT."

    3. Reviewer #3 (Public review):

      Summary:

      The authors describe the abnormal contractile function and cellular electrophysiology in an iPSC model of atrial myocytes with a titin missense variant. They provide contractility data by sarcomere length imaging, calcium imaging, and voltage clamp of the repolarizing current iKs. While each of the findings is separately interesting, the paper comes across as too descriptive because there is no merging of the data to support a cohesive mechanistic story/statement, especially from the electrophysiological standpoint. There is definitely not enough support for the title "A Titin Missense Variant Causes Atrial Fibrillation", since there is no strong causative evidence at all. There is some interesting clinical data regarding the variant of interest and its association with HF hospitalization, which may lead to future important discoveries regarding atrial fibrillation.

      Strengths:

      The manuscript is well written and there is a wide range of experimental techniques to probe this atrial fibrillation model.

      Weaknesses:

      (1) While the clinical data is interesting, it is extremely important to rule out heart failure with preserved EF as a confounder. HFpEF leads to AF due to increased atrial remodeling, so the fact that patients with this missense variant have increased HF hospitalizations does not necessarily directly support the variant as causative of AF. It could be that the variant is actually associated directly with HFpEF instead, and this needs to be addressed and corrected in the analyses.

      (2) All of the contractility and electrophysiologic data should be done with pacing at the same rate in both control and missense variant groups, to control for the effect of cycle length on APD and calcium loading. A claim of shorter APD cannot be claimed when the firing rate of one set of cells is much faster than the other, since shorter APD is to be expected with a faster rate. Similarly, contractility is affected by diastolic interval because of the influence of SR calcium content on the myocyte power stroke. So the cells need to be paced at the same rate in the IonOptix for any direct comparison of contractility. The authors should familiarize themselves with the concept of electrical restitution.

      (3) It is interesting that the firing rate of the myocytes is faster with the missense variant. This should lead to a hypothesis and investigation of abnormal automaticity or triggered activity, which may also explain the increased contractility since all these mechanisms are related to the calcium clock and calcium loading of the SR. See #2 above for suggestions on how to adequately probe calcium handling. Such an investigation into impulse initiation mechanisms would be very powerful in supporting the primary statement of the paper since these are actual mechanisms thought to cause AF.

      (4) The claim of shortened APD without correcting for cycle length is problematic. However, the general concept of linking shortened APD in isolated cells alone to AF causation is more problematic. To have a setup for reentry, there must be a gradient of APD from short to long, and this can only be demonstrated at the tissue level, not really at the cellular level, so reentry should not be invoked here. If shortened APD is demonstrated with correction of the cycle length problem, restitution curves can be made showing APD shortening at different cycle lengths. If restitution is abnormal (i.e. the APD does not shorten normally in relation to the diastolic interval), this may lead to triggered activity which is an arrhythmogenic mechanism. This would also tie in well with the finding of abnormally elevated iKs current since iKs is a repolarizing current directly responsible for restitution.

    1. Reviewer #1 (Public review):

      Polymers of orthophosphate of varying lengths are abundant in prokaryotes and some eukaryotes where they regulate many cellular functions. Though they exist in metazoans, few tools exist to study their function. This study documents the development of tools to extract, measure, and deplete inorganic polyphosphates in *Drosophila*. Using these tools, the authors show:

      (1) that polyP levels are negligible in embryos and larvae of all stages while they are feeding. They remain high in pupae but their levels drop in adults.

      (2) that many cells in tissues such as the salivary glands, oocytes, haemocytes, imaginal discs, optic lobe, muscle, and crop, have polyP that is either cytoplasmic or nuclear (within the nucleolus).

      (3) that polyP is necessary in plasmatocytes for blood clotting in Drosophila.

      (4) that ployP controls the timing of eclosion.

      The tools developed in the study are innovative, well-designed, tested, and well-documented. I enjoyed reading about them and I appreciate that the authors have gone looking for the functional role of polyP in flies, which hasn't been demonstrated before. The documentation of polyP in cells is convincing as its role in plasmatocytes in clotting. Its control of eclosion timing, however, could result from non-specific effects of expressing an exogenous protein in all cells of an animal. The RNAseq experiments and their associated analyses on polyP-depleted animals and controls have not been discussed in sufficient detail. In its current form, the data look to be extremely variable between replicates and I'm therefore unsure of how the differentially regulated genes were identified.

      It is interesting that no kinases and phosphatases have been identified in flies. Is it possible that flies are utilising the polyP from their gut microbiota? It would be interesting to see if these signatures go away in axenic animals.

    2. Reviewer #2 (Public review):

      Summary:

      The authors of this paper note that although polyphosphate (polyP) is found throughout biology, the biological roles of polyP have been under-explored, especially in multicellular organisms. The authors created transgenic Drosophila that expressed a yeast enzyme that degrades polyP, targeting the enzyme to different subcellular compartments (cytosol, mitochondria, ER, and nucleus, terming these altered flies Cyto-FLYX, Mito-FLYX, etc.). The authors show the localization of polyP in various wild-type fruit fly cell types and demonstrate that the targeting vectors did indeed result in the expression of the polyP degrading enzyme in the cells of the flies. They then go on to examine the effects of polyP depletion using just one of these targeting systems (the Cyto-FLYX). The primary findings from the depletion of cytosolic polyP levels in these flies are that it accelerates eclosion and also appears to participate in hemolymph clotting. Perhaps surprisingly, the flies seemed otherwise healthy and appeared to have little other noticeable defects. The authors use transcriptomics to try to identify pathways altered by the cyto-FLYX construct degrading cytosolic polyP, and it seems likely that their findings in this regard will provide avenues for future investigation. And finally, although the authors found that eclosion is accelerated in pupae of Drosophila expressing the Cyto-FLYX construct, the reason why this happens remains unexplained.

      Strengths:

      The authors capitalize on the work of other investigators who had previously shown that expression of recombinant yeast exopolyphosphatase could be targeted to specific subcellular compartments to locally deplete polyP, and they also use a recombinant polyP binding protein (PPBD) developed by others to localize polyP. They combine this with the considerable power of Drosophila genetics to explore the roles of polyP by depleting it in specific compartments and cell types to tease out novel biological roles for polyP in a whole organism. This is a substantial advance.

      Weaknesses:

      Page 4 of the Results (paragraph 1): I'm a bit concerned about the specificity of PPBD as a probe for polyP. The authors show that the fusion partner (GST) isn't responsible for the signal, but I don't think they directly demonstrate that PPBD is binding only to polyP. Could it also bind to other anionic substances? A useful control might be to digest the permeabilized cells and tissues with polyphosphatase prior to PPBD staining and show that the staining is lost.

      In the hemolymph clotting experiments, the authors collected 2 ul of hemolymph and then added 1 ul of their test substance (water or a polyP solution). They state that they added either 0.8 or 1.6 nmol polyP in these experiments (the description in the Results differs from that of the Methods). I calculate this will give a polyP concentration of 0.3 or 0.6 mM. This is an extraordinarily high polyP concentration and is much in excess of the polyP concentrations used in most of the experiments testing the effects of polyP on clotting of mammalian plasma. Why did the authors choose this high polyP concentration? Did they try lower concentrations? It seems possible that too high a polyP concentration would actually have less clotting activity than the optimal polyP concentration.

    3. Reviewer #3 (Public review):

      Summary:

      Sarkar, Bhandari, Jaiswal, and colleagues establish a suite of quantitative and genetic tools to use Drosophila melanogaster as a model metazoan organism to study polyphosphate (polyP) biology. By adapting biochemical approaches for use in D. melanogaster, they identify a window of increased polyP levels during development. Using genetic tools, they find that depleting polyP from the cytoplasm alters the timing of metamorphosis, accelerating eclosion. By adapting subcellular imaging approaches for D. melanogaster, they observe polyP in the nucleolus of several cell types. They further demonstrate that polyP localizes to cytoplasmic puncta in hemocytes, and further that depleting polyP from the cytoplasm of hemocytes impairs hemolymph clotting. Together, these findings establish D. melanogaster as a tractable system for advancing our understanding of polyP in metazoans.

      Strengths:

      (1) The FLYX system, combining cell type and compartment-specific expression of ScPpx1, provides a powerful tool for the polyP community.

      (2) The finding that cytoplasmic polyP levels change during development and affect the timing of metamorphosis is an exciting first step in understanding the role of polyP in metazoan development, and possible polyP-related diseases.

      (3) Given the significant existing body of work implicating polyP in the human blood clotting cascade, this study provides compelling evidence that polyP has an ancient role in clotting in metazoans.

      Limitations:

      (1) While the authors demonstrate that HA-ScPpx1 protein localizes to the target organelles in the various FLYX constructs, the capacity of these constructs to deplete polyP from the different cellular compartments is not shown. This is an important control to both demonstrate that the GTS-PPBD labeling protocol works, and also to establish the efficacy of compartment-specific depletion. While not necessary to do this for all the constructs, it would be helpful to do this for the cyto-FLYX and nuc-FLYX.

      (2) The cell biological data in this study clearly indicates that polyP is enriched in the nucleolus in multiple cell types, consistent with recent findings from other labs, and also that polyP affects gene expression during development. Given that the authors also generate the Nuc-FLYX construct to deplete polyP from the nucleus, it is surprising that they test how depleting cytoplasmic but not nuclear polyP affects development. However, providing these tools is a service to the community, and testing the phenotypic consequences of all the FLYX constructs may arguably be beyond the scope of this first study.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript uses a diverse isolate collection of Streptococcus pneumoniae from hospital patients in the Netherlands to understand the population-level genetic basis of growth rate variation in this pathogen, which is a key determinant of S. pneumoniae within-host fitness. Previous efforts have studied this phenomenon in strain-specific comparisons, which can lack the statistical power and scope of population-level studies. The authors collected a rigorous set of in vitro growth data for each S. pneumoniae isolate and subsequently paired growth curve analysis with whole-genome analyses to identify how phylogenetics, serotype, and specific genetic loci influence in vitro growth. While there were noticeable correlations between capsular serotype and phylogeny with growth metrics, they did not identify specific loci associated with altered in vitro growth, suggesting that these phenotypes are controlled by the collective effect of the entire genetic background of a strain. This is an important finding that lays the foundation for additional, more highly-powered studies that capture more S. pneumoniae genetic diversity to identify these genetic contributions.

      Strengths:

      (1) The authors were able to completely control the experimental and genetic analyses to ensure all isolates underwent the same analysis pipeline to enhance the rigor of their findings.

      (2) The isolate collection captures an appreciable amount of S. pneumoniae diversity and, importantly, enables disentangling the contributions of the capsule and phylogenetic background to growth rates.

      (3) This study provides a population-level, rather than strain-specific, view of how genetic background influences the growth rate in S. pneumoniae. This is an advance over previous studies that have only looked at smaller sets of strains.

      (4) The methods used are well-detailed and robust to allow replication and extension of these analyses. Moreover, the manuscript is very well written and includes a thoughtful and thorough discussion of the strengths and limitations of the current study.

      Weaknesses:

      (1) As acknowledged by the authors, the genetic diversity and sample size of this newly collected isolate set are still limited relative to the known global diversity of S. pneumoniae, which evidently limits the power to detect loci with smaller/combinatorial contributions to growth rate (and ultimately infection).

      (2) The in vitro growth data is limited to a single type of rich growth medium, which may not fully reflect the nutritional and/or selective pressures present in the host.

      (3) The current study does not use genetic manipulation or in vitro/in vivo infection models to experimentally test whether alteration of growth rates as observed in this study is linked to virulence or successful infection. The availability of a naturally diverse collection with phylogenetic and serotype combinations already identified as interesting by the authors provides a strong rationale for wet-lab studies of these phenotypes.

    2. Reviewer #2 (Public review):

      Summary:

      The study by Chaguza et al. presents a novel perspective on pneumococcal growth kinetics, suggesting that the overall genetic background of Streptococcus pneumoniae, rather than specific loci, plays a more dominant role in determining growth dynamics. Through a genome-wide association study (GWAS) approach, the authors propose a shift in how we understand growth regulation, differing from earlier findings that pinpointed individual genes, such as wchA or cpsE, as key regulators of growth kinetics. This study highlights the importance of considering the cumulative impact of the entire genetic background rather than focusing solely on individual genetic loci.

      The study emphasizes the cumulative effects of genetic variants, each contributing small individual impacts, as the key drivers of pneumococcal growth. This polygenic model moves away from the traditional focus on single-gene influences. Through rigorous statistical analyses, the authors persuasively advocate for a more holistic approach to understanding bacterial growth regulation, highlighting the complex interplay of genetic factors across the entire genome. Their findings open new avenues for investigating the intricate mechanisms underlying bacterial growth and adaptation, providing fresh insights into bacterial pathogenesis.

      Strengths:

      This study exemplifies a holistic approach to unraveling key factors in bacterial pathogenesis. By analyzing a large dataset of whole-genome sequences and employing robust statistical methodologies, the authors provide strong evidence to support their main findings. Which is a leap forward from previous studies focused on a relatively smaller number of strains. Their integration of genome-wide association studies (GWAS) highlights the cumulative, polygenic influences on pneumococcal growth kinetics, challenging the traditional focus on individual loci. This comprehensive strategy not only advances our understanding of bacterial growth regulation but also establishes a foundation for future research into the genetic underpinnings of bacterial pathogenesis and adaptation. The amount of data generated and corresponding approaches to analyze the data are impressive as well as convincing. The figures are convincing and comprehensible too.

      Weaknesses:

      Despite the strong outcomes of the GWAS approach, this study leaves room for differing interpretations. A key point of contention lies in the title, which initially gives the impression that the research addresses growth kinetics under both in vitro and in vivo conditions. However, the study is limited to in vitro growth kinetics, with the assumption that these findings are equally applicable to in vivo scenarios-a premise that is not universally valid. To more accurately reflect the study's scope and avoid potential misrepresentation, the title should explicitly specify "in vitro" growth kinetics. This clarification would better align the title with the study's actual focus and findings.

      This study suggests that the entire genetic background significantly influences bacterial growth kinetics. However, to transform these predictions into established facts, extensive experimental validation is necessary. This would involve "bench experiments" focusing on generating and studying mutant variants of serotypes or strains with diverse genomic variations, such as targeted deletions. The growth phenotypes of these mutants should be analyzed, complemented by complementation assays to confirm the specific roles of the deleted regions. These efforts would provide critical empirical evidence to support the findings from the GWAS approach and enhance understanding of the genetic basis of bacterial growth kinetics.

      In the discussion section, the authors state that "the influence of serotype appeared to be higher than the genetic background for the average growth rate" (lines 296-298). Alongside references 13-15, this emphasizes the important role of capsular variability, which is a key determinant of serotypes, in influencing growth kinetics. However, this raises the question: why isn't a specific locus like cps, which is central to capsule biogenesis, considered a strong influencer of growth kinetics in this study?

      One plausible explanation could be the absence of "elevated signals" for cps in the GWAS analysis. GWAS relies on identifying loci with statistically significant associations to phenotypes. The lack of such signals for cps may indicate that its contribution, while biologically important, does not stand out genome-wide. This might be due to the polygenic nature of growth kinetics, where the overall genetic background exerts a cumulative effect, potentially diluting the apparent influence of individual loci like cps in statistical analyses.

    3. Reviewer #3 (Public review):

      This study provides insights into the growth kinetics of a diverse collection of Streptococcus pneumoniae, identifying capsule and lineage differences. It was not able to identify any specific loci from the genome-wide association studies (GWAS) that were associated with the growth features. It does provide a useful study linking phenotypic data with large-scale genomic population data. The methods for the large part were appropriately written in sufficient detail, and data analysis was performed with rigour. The interpretation of the results was supported by the data, although some additional explanation of the significance of e.g. ancestral state reconstruction would be useful. Efforts were made to make the underlying data fully accessible to the readers although some of the supplementary material could be formatted and explained a bit better.

    1. Reviewer #1 (Public review):

      Summary:

      This work integrates two timepoints from the Adolescent Brain Cognitive Development (ABCD) Study to understand how neuroimaging, genetic, and environmental data contribute to the predictive power of mental health variables in predicting cognition in a large early adolescent sample. Their multimodal and multivariate prediction framework involves a novel opportunistic stacking model to handle complex types of information to predict variables that are important in understanding mental health-cognitive performance associations.

      Strengths:

      The authors are commended for incorporating and directly comparing the contribution of multiple imaging modalities (task fMRI, resting state fMRI, diffusion MRI, structural MRI), neurodevelopmental markers, environmental factors, and polygenic risk scores in a novel multivariate framework (via opportunistic stacking), as well as interpreting mental health-cognition associations with latent factors derived from partial least squares. The authors also use a large well-characterized and diverse cohort of adolescents from the ABCD Study. The paper is also strengthened by commonality analyses to understand the shared and unique contribution of different categories of factors (e.g., neuroimaging vs mental health vs polygenic scores vs sociodemographic and adverse developmental events) in explaining variance in cognitive performance

      Weaknesses:

      The paper is framed with an over-reliance on the RDoC framework in the introduction, despite deviations from the RDoC framework in the methods. The field is also learning more about RDoC's limitations when mapping cognitive performance to biology. The authors also focus on a single general factor of cognition as the core outcome of interest as opposed to different domains of cognition. The authors could consider predicting mental health rather than cognition. Using mental health as a predictor could be limited by the included 9-11 year age range at baseline (where many mental health concerns are likely to be low or not well captured), as well as the nature of how the data was collected, i.e., either by self-report or from parent/caregiver report.

    2. Reviewer #2 (Public review):

      Summary:

      This paper by Wang et al. uses rich brain, behaviour, and genetics data from the ABCD cohort to ask how well cognitive abilities can be predicted from mental-health-related measures, and how brain and genetics influence that prediction. They obtain an out-of-sample correlation of 0.4, with neuroimaging (in particular task fMRI) proving the key mediator. Polygenic scores contributed less.

      Strengths:

      This paper is characterized by the intelligent use of a superb sample (ABCD) alongside strong statistical learning methods and a clear set of questions. The outcome - the moderate level of prediction between the brain, cognition, genetics, and mental health - is interesting. Particularly important is the dissection of which features best mediate that prediction and how developmental and lifestyle factors play a role.

      Weaknesses:

      There are relatively few weaknesses to this paper. It has already undergone review at a different journal, and the authors clearly took the original set of comments into account in revising their paper. Overall, while the ABCD sample is superb for the questions asked, it would have been highly informative to extend the analyses to datasets containing more participants with neurological/psychiatric diagnoses (e.g. HBN, POND) or extend it into adolescent/early adult onset psychopathology cohorts. But it is fair enough that the authors want to leave that for future work.

      In terms of more practical concerns, much of the paper relies on comparing r or R2 measures between different tests. These are always presented as point estimates without uncertainty. There would be some value, I think, in incorporating uncertainty from repeated sampling to better understand the improvements/differences between the reported correlations.

      The focus on mental health in a largely normative sample leads to the predictions being largely based on the normal range. It would be interesting to subsample the data and ask how well the extremes are predicted.

      A minor query - why are only cortical features shown in Figure 3?

    1. Reviewer #1 (Public review):

      Summary:

      The current study by Xing et al. establishes the methodology (machine vision and gaze pose estimation) and behavioral apparatus for examining social interactions between pairs of marmoset monkeys. Their results enable unrestrained social interactions under more rigorous conditions with detailed quantification of position and gaze. It has been difficult to study social interactions using artificial stimuli, as opposed to genuine interactions between unrestrained animals. This study makes an important contribution for studying social neuroscience within a laboratory setting that will be valuable to the field.

      Strengths:

      Marmosets are an ideal species for studying primate social interactions due to their prosocial behavior and the ease of group housing within laboratory environments. They also predominantly orient their gaze through head movements during social monitoring. Recent advances in machine vision pose estimation set the stage for estimating 3D gaze position in marmosets but require additional innovation beyond DeepLabCut or equivalent methods. A six-point facial frame is designed to accurately fit marmoset head gaze. A key assumption in the study is that head gaze is a reliable indicator of the marmoset's gaze direction, which will also depend on the eye position. Overall, this assumption has been well supported by recent studies in head-free marmosets. Thus the current work introduces an important methodology for leveraging machine vision to track head gaze and demonstrates its utility for use with interacting marmoset dyads as a first step in that study.

      Weaknesses:

      One weakness that should be easily addressed is that no data is provided to directly assess how accurate the estimated head gaze is based on calibrations of the animals, for example, when they are looking at discrete locations like faces or video on a monitor. This would be useful to get an upper bound on how accurate the 3D gaze vector is estimated to be, for planned use in other studies. Although the accuracy appears sufficient for the current results, it would be difficult to know if it could be applied in other contexts where more precision might be necessary.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes novel technique development and experiments to track the social gaze of marmosets. The authors used video tracking of multiple cameras in pairs of marmosets to infer head orientation and gaze and then studied gaze direction as a function of distance between animals, relationships, and social conditions/stimuli.

      Strengths:

      Overall the work is interesting and well done. It addresses an area of growing interest in animal social behavior, an area that has largely been dominated by research in rodents and other non-primate species. In particular, this work addresses something that is uniquely primate (perhaps not unique, but not studied much in other laboratory model organisms), which is that primates, like humans, look at each other, and this gaze is an important social cue of their interactions. As such, the presented work is an important advance and addition to the literature that will allow more sophisticated quantification of animal behaviors. I am particularly enthusiastic with how the authors approach the cone of uncertainty in gaze, which can be both due to some error in head orientation measurements as well as variable eye position.

      Weaknesses:

      There are a few technical points in need of clarification, both in terms of the robustness of the gaze estimate, and possible confounds by gaze to non-face targets which may have relevance but are not discussed. These are relatively minor, and more suggestions than anything else.

    1. Reviewer #1 (Public review):

      The current manuscript by Bendeker et al. (2024) presents a new platform, MorphoCellSorter, for performing population wide microglial morphological analyses. This method adds to the many programs/platforms available to determine characteristics of microglial morphology; however, MorphoCellSorter is unique in that it uses Andrew's plotting to rank populations of cells together (in control and experimental groups) and present "big picture" views of how entire populations of microglia alter under different conditions. In their ranking system, Bendeker et al. (2024) use PCA to determine which of the morphological characteristics most define microglial populations, avoiding user subjective biases to determine these parameters. Compared to "expert" evaluators, MorphoCellSorter appears to perform consistently and accurately, including in different types of tissue preservation methods and in live cells, a key feature of the program. In addition, the researchers point out that this platform can be used across a wide array of imaging techniques and most microscopes that are available in a basic research lab. There are minor concerns about the platform's utility in analyzing embryonic microglia and primary microglial cultures, but overall, this platform will be another useful tool for microglial researchers to consider using in future studies. Furthermore, the method of morphological assessment aligns with the current direction of the field in identifying microglial cells in more nuanced ways.

      In their current revision, the authors have done an excellent job responding to concerns and have updated the manuscript accordingly.

    2. Reviewer #2 (Public review):

      The authors introduce MorphCellSorter, an open-source tool available on GitHub, designed for automated morphometric analysis of microglia. Current understanding suggests that microglia represent a heterogeneous population, especially in non-steady adult states, better characterized as a continuum rather than distinct cell groups.

      This tool was developed to classify microglia along this continuum. Using stained brain sections and microscope imaging, individual microglia are binarized and processed with MorphCellSorter, which categorizes them based on 20 morphological parameters. Notably, the tool is versatile, as it can be applied to both fluorescent and brightfield brain sections, as demonstrated by the authors. Additionally, it has been tested across various setups (both fixed and live tissues) and biological contexts (including embryonic stages, Alzheimer's disease models, stroke, and primary cell cultures), showcasing its versatility and adaptability. Overall, the study is well-conceived and could have some value in the field.

      Numerous similar tools already exist, and the number is likely to grow, especially with advancements in AI. These tools have limited scientific utility as they provide descriptive rather than informative outputs. Microglial morphology varies due to external influences (such as developmental stages and injuries), but the significance of these variations remains largely hypothetical.

    1. Reviewer #1 (Public review):

      Summary:

      This paper shows that the synthetic opioid fentanyl induces respiratory depression in rodents. This effect is revised by the opioid receptor antagonist naloxone, as expected. Unexpectedly, the peripherally restricted opioid receptor antagonist naloxone methiodide also blocks fentanyl-induced respiratory depression.

      Strengths:

      The paper reports compelling physiology data supporting the induction of respiratory distress in fentanyl-treated animals. Evidence suggesting that naloxone methiodide reverses this respiratory depression is compelling. This is further supported by pharmacokinetic data suggesting that naloxone methiodide does not penetrate into the brain, nor is it metabolized into brain-penetrant naloxone.

      Weaknesses:

      The paper would be further strengthened by establishing the functional significance of the altered neural activity detected in the nTS (as measured by cFos and GcAMP/photometry) in the context of opioid-induced respiratory depression.

    2. Reviewer #2 (Public review):

      Summary:

      In this article, Ruyle and colleagues assessed the contribution of central and peripheral mu opioid receptors in mediating fentanyl-induced respiratory depression using both nalaxone and nalaxone methiodide, which does not cross the blood brain barrier. Both compounds prevented and reversed fentanyl-induced respiratory depression to a comparable degree. The advantage of peripheral treatments is that they circumvent the withdrawal-like effects of nalaxone. Moreover, neurons located in the nucleus of the solitary tract are no longer activated by fentanyl when nalaxone methiodide is administered, suggesting that these responses are mediated by peripheral mu opioid receptors. The results delineate a role for peripheral mu opioid receptors in fentanyl-derived respiratory depression and identify a potentially advantageous approach to treating overdoses without inflicting withdrawal on the patients.

      Strengths:

      The strengths of the article include the intravenous delivery of all compounds, which increases the translational value of the article. The authors address both prevention and reversal of fentanyl-derived respiratory depression. The experimental design and data interpretation are rigorous and appropriate controls were used in the study. Multiple doses were screened in the study and the approaches were multipronged. The authors demonstrated activation of NTS cells using multiple techniques and the study links peripheral activation of mu opioid receptors to central activation of NTS cells. Both males and females were used in the experiments. The authors demonstrate the peripheral restriction of nalaxone methiodide.

      Weaknesses:

      Nalaxone is already broadly used to prevent overdoses from opioids so in some respects, the effects reported here are somewhat incremental.

      Comments on the latest version:

      I think the authors have adequately addressed previous critiques and I don't have any additional comments.

    3. Reviewer #3 (Public review):

      Summary

      This manuscript outlines a series of very exciting and game-changing experiments examining the role of peripheral MORs in OIRD. The authors outline experiments that demonstrate a peripherally restricted MOR antagonist (NLX Methiodide) can rescue fentanyl-induced respiratory depression and this effect coincides with a lack of conditioned place aversion. This approach would be a massive boon to the OUD community, as there are a multitude of clinical reports showing that naloxone rescue post fentanyl over-intoxication is more aversive than the potential loss-of-life to the individuals involved. This important study reframes our understanding of successful overdose rescue with a potential for reduced aversive withdrawal effects.

      Strengths:

      Strengths include the plethora of approaches arriving at the same general conclusion, the inclusion of both sexes, and the result that a peripheral approach for OIRD rescue may side-step severe negative withdrawal symptoms of traditional NLX rescue.

      Weaknesses:

      All weaknesses were addressed.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript co-authored by Pál Barzó et al is very clear and very well written, demonstrating the electrophysiological and morphological properties of the human cortical layer 2/3 pyramidal cells across a wide age range, from age 1 month to 85 years using whole-cell patch clamp. To my knowledge, this is the first study that look at the cross-age differences biophysical and morphological properties of human cortical pyramidal cells. The community will also appreciate the significant effort involved in recording data from 485 cells, given the challenges associated with collecting data from human tissue. Understanding the electrophysiological properties of individual cells, which are essential for brain function, is crucial for comprehending human cortical circuits. I think this research enhances our knowledge of how biophysical properties change over time in the human cortex. I also think that by building models of human single cells at different ages using these data, we can develop more accurate representations of brain function. This, in turn, provides valuable insights into human cortical circuits and function and helps in predicting changes in biophysical properties in both health and disease.

      Strengths:

      The strength of this work lies in demonstrating how the electrophysiological and morphological features of human cortical layer 2/3 pyramidal cells change with age, offering crucial insights into brain function throughout life.

      Comments on revisions:

      Thanks to the authors for addressing my comments and providing greater clarity in the methodology. The analysis is much clearer now. I also appreciate their additional data analysis, particularly on morphology, which strengthens the paper.

    2. Reviewer #2 (Public review):

      Summary:

      In this study, Barzo and colleagues aim to establish an appraisal for the development of basal electrophysiology of human layer 2/3 pyramidal cells across life and compare their morphological features at the same ages.

      Strengths:

      The authors have generates recordings from an impressive array of patient samples, allowing them to directly compare the same electrophysiological features as a function of age and other biological features. These data are extremely robust and well organised.

      The authors group patient ages into developmentally organised bins, which are elaborated on in supplementary analysis - exemplifying the importance of determining early postnatal development on human neuron function

      Weaknesses:

      The author's use of (perhaps) arbitrary categorisation of spine morphology could limit the full usefulness of these data.

      Overall, the authors achieve their aims by assessing the physiological and morphological properties of human L2/3 pyramidal neurons across life. Their findings have extremely important ramifications for our understanding of human brain development and implications for how different neuronal properties may influence life and disease associated with neurological conditions.

      Comments on revisions:

      Overall, the authors have satisfied my concerns. I fully appreciate their candour with their data and the potential limitations. I especially appreciate their supplementary data inclusions which I believe truly strengthen their conclusions and are a valuable resource for the field,

      I agree whole-heartedly with the authors assertion that it is perhaps better to use the most sophisticated equipment, not always being most appropriate. However, statistical rigour should still be standard. As such, my one remaining concern relates to inappropriate replicate choice of spine morphology data in figure 6. I commend the authors inclusion of additional reconstructions and morphology data from further cells in this data set. However, to me, these still represent data from 3 cells and 1 patient/age - as to the best of my interpretation. I feel it would be more helpful to plot cell averages +/- SD for each cell - even if side-by-side with data from all spines. Likewise, it is unclear what statistical test was performed on these data and did it take into account the fact that these values are a) from 3 technical replicates per group, or b) that many of the data sets consist of many zero-values (would a categorical test be more appropriate?).

    3. Reviewer #3 (Public review):

      Summary:

      To understand the specificity of age-dependent changes in the human neocortex, this paper investigated the electrophysiological and morphological characteristics of pyramidal cells in a wide age range from infants to the elderly.

      The results show that some electrophysiological characteristics change with age, particularly in early childhood. In contrast, the larger morphological structures, such as the spatial extent and branching frequency of dendrites, remained largely stable from infancy to old age. On the other hand, the shape of dendritic spines is considered immature in infancy, i.e., the proportion of mushroom-shaped spines increases with age.

      Strengths:

      Whole-cell recordings and intracellular staining of pyramidal cells in defined areas of the human neocortex allowed the authors to compare quantitative parameters of electrophysiological and morphological properties between finely divided age groups.

      They succeeded in finding symmetrical changes specific to both infants and the elderly, and asymmetrical changes specific to either infants or the elderly. The similarity of pyramidal cell characteristics between areas is unexpected.

      Weaknesses:

      Human L2/3 pyramidal cells are thought to be heterogeneous, as L2/3 has expanded to a high degree during the evolution from rodents to humans. However, the diversity (subtyping) is not revealed in this paper.

      Comments on revisions:

      I believe that the current version has been sufficiently revised based on my comments.

    1. Reviewer #1 (Public Review):

      Summary:

      Shi and colleagues report the use of modified Cre lines in which the coding region of Cre is disrupted by rox-STOP-rox or lox-STOP-lox sequences to prevent the expression of functional protein in the absence of Dre or Cre activity, respectively. The main purpose of these tools is to enable intersectional or tamoxifen-induced Cre activity with minimal or no leaky activity from the second, Cre-expressing allele. It is a nice study but lacks some functional data required to determine how useful these alleles will be in practice, especially in comparison with the figure line that stimulated their creation.

      Strengths:

      The new tools can reduce Cre leak in vivo.

      Weaknesses:

      (1) Activity of R26-loxCre line. As the authors point out, the greatest value of this approach is to accomplish a more complete Cre-mediated gene deletion using CreER transgenes that are combined with low-efficiency floxed alleles using their R26-loxCre line that is similar to the iSure Cre reported by Benedito and colleagues. The data in Figure 5 show strong activity at the Confetti locus, but the design of the newly reported R26-loxCre line lacks a WPRE sequence that was included in the iSure-Cre line to drive very robust protein expression. Thus while the line appears to have minimal leak, as the design would predict, the question of how much of a deletion increase is obtained over simple use of the CreER transgene alone is a key question for use by investigators. This is further addressed in Figure 6 where it is compared with Alb-CreER alone to recombine the Ctnnb1 floxed allele. They demonstrate that recombination frequency is clearly improved, but the western blot in Figure 6E does not look like there was a large amount of remaining b-catenin to remove. These data are certainly promising, but the most valuable experiment for such a new tool would be a head-to-head comparison with iSure (or the latest iSure version from the Benedito lab) using the same CreER and target floxed allele. At the very least a comparision of Cre protein expression between the two lines using identical CreER activators is needed.

      (2) In vivo analysis of mCre activities. Why did the authors not use the same driver to compare mCre 1, 4, 7, and 10? The study in Figure 2 uses Alb-roxCre for 1 and 7 and Cdh5-roxCre for 4 and 10, with clearly different levels of activity driven by the two alleles in vivo. Thus whether mCre1 is really better than mCre4 or 10 is not clear.

      (3) Technical details are lacking. The authors provide little specific information regarding the precise way that the new alleles were generated, i.e. exactly what nucleotide sites were used and what the sequence of the introduced transgenes is. Such valuable information must be gleaned from schematic diagrams that are insufficient to fully explain the approach.

    2. Reviewer #2 (Public Review):

      Summary:

      This work presents new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      Strengths:

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells, and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      Weaknesses:

      The scenario where the lines would demonstrate their full potential compared to existing models has not been tested. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. Therefore, a demonstration of the efficient deletion of multiple floxed alleles in a mosaic fashion would be a valuable addition.

      In addition, a drawback of this line is the constitutive expression of Cre. When combined with the confetti line, the reporter cassette will continue flipping, potentially leading to misleading lineage tracing results. Constitutive expression of Cre is also associated with toxicity, as discussed by the authors in the introduction. These drawbacks should be acknowledged.

    3. Reviewer #3 (Public Review):

      Summary:

      The authors report a new version of the iSuRe-Cre approach, which was originally developed by Rui Benedito's group in Spain (https://doi.org/10.1038/s41467-019-10239-4). Shi et al claim that their approach shows reduced leakiness compared to the iSuRe-Cre line. Shi et al elaborate strongly about the leakiness of iSuRe-Cre mice, although leakiness is rather minor according to the original publication and the senior author of the study wrote in a review a few years ago that there is no leakiness (https://doi.org/10.1016/j.jbc.2021.100509). Furthermore, a new R26-roxCre-tdT mouse line was established after extensive testing, which enables efficient expression of the Cre recombinase after activation of the Dre recombinase.

      Strengths:

      The authors carefully evaluated the efficiency and leakiness of the new strains and demonstrated the applicability by marking peri-central hepatocytes in an intersectional genetics approach, amongst others. I can only find very few weaknesses in the paper, which represents the result of an enormous effort. Carefully conducted technical studies have considerable value. However, I would have preferred to see a study, which uses the wonderful new tools to address a major biological question, rather than a primarily technical report, which describes the ongoing efforts to further improve Cre and Dre recombinase-mediated recombination.

      Weaknesses:

      Very high levels of Cre expression may cause toxic effects as previously reported for the hearts of Myh6-Cre mice. Thus, it seems sensible to test for unspecific toxic effects, which may be done by bulk RNA-seq analysis, cell viability, and cell proliferation assays. It should also be analyzed whether the combination of R26-roxCre-tdT with the Tnni3-Dre allele causes cardiac dysfunction, although such dysfunctions should be apparent from potential changes in gene expression.

      The R26-GFP or R26-tdT reporters, Alb-roxCre1-tdT, Cdh5-roxCre4-tdT, Alb-roxCre7-GFP, and Cdh5-roxCre10-GFP demonstrate no leakiness without Dre-rox recombination (Figure S1-S2). Is there any leakiness when the inducible DreER allele is introduced but no tamoxifen treatment is applied? This should be documented. The same also applies to loxCre mice.

      The enhanced efficiency of loxCre and roxCre systems holds promise for reducing the necessary tamoxifen dosage, potentially reducing toxicity and side effects. In Figure 6, the author demonstrates an enhanced recombination efficiency of loxCre mice, which makes it possible to achieve efficient deletion of Ctnnb1 with a single dose of tamoxifen, whereas a conventional driver (Alb-CreER) requires five dosages. It would be very helpful to include a dose-response curve for determining the minimum dosage required in Alb-CreER; R26-loxCre-tdT; Ctnnb1flox/flox mice for efficient recombination.

      In the liver panel of Figure 4F, tdT signals do not seem to colocalize with the VE-cad signals, which is odd. Is there any compelling explanation?

      The authors claim that "virtually all tdT+ endothelial cells simultaneously expressed YFP/mCFP" (right panel of Figure 5D). Well, it seems that the abundance of tdT is much lower compared to YFP/mCFP. If the recombination of R26-Confetti was mainly triggered by R26-loxCre-tdT, the expression of tdT and YFP/mCFP should be comparable. This should be clarified.

      In several cases, the authors seem to have mixed up "R26-roxCre-tdT" with "R26-loxCre-tdT". There are errors in #251 and #256. Furthermore, in the passage from line #278 to #301. In the lines #297 and #300 it should probably read "Alb-CreER; R26-loxCre-tdT;Ctnnb1flox/flox"" rather than "Alb-CreER;R26-tdT2;Ctnnb1flox/flox".

    1. Reviewer #3 (Public review):

      Summary:

      The authors are interested in the relative importance of PRL versus GH and their interactive signaling in breast cancer. After examining GHR-PRLR interactions in response to ligands, they suggest that a reduction in cell surface GHR in response to PRL may be a mechanism whereby PRL can sometimes be protective against breast cancer.

      Strengths:

      The strengths of the study include the interesting question being addressed and the application of multiple complementary techniques, including dSTORM, which is technically very challenging, especially when using double labeling. Thus, dSTORM is used to analyze co-clustering of GHR and PRLR, and, in response to PRL, rapid internalization of GHR and increased cell surface PRLR. Conclusions from Proximity ligation assays are that some GHR and PRLR are within 40 nm (≈ 4 plasma membranes) of each other and that upon ligand stimulation, they move apart. Intact receptor knockin and knockout approaches and receptor constructs without the Jak2 binding domain demonstrate a) a requirement for the PRLR for there to be PRL- driven internalization of GHR, and b) that Jak2-PRLR interactions are necessary for stability of the GHR-PRLR colocalizations.

      Weaknesses:

      Although improved over the first version, the manuscript still suffers from a lack of detail, which in places makes it difficult to evaluate the data and would make it very difficult for the results to be replicated by others.

      Comments on revised version:

      Points for improvement of the manuscript:

      (1) There is still insufficient detail about the proximity ligation assay. For example, PLAs that use reagents from Sigma (as now reported) require primary antibodies from two different species and yet both the anti-PRLR and anti-GHR used for dSTORM were mouse monoclonals. On line 356 it says that the ECD antibodies were used for microscopy and the PLA is microscopy. Were instead the ICD antibodies used for the PLA? If so, how do we know that one or more of the proteins in the very strong "non-specific" bands seen on Figure 5A are not what is being localized? Could you do a Western blot of just cell membrane proteins? There needs to be further clarity/explanation.

      (2) Although the manuscript now shows a Western blot using the antibodies against intracellular regions of the receptor, a full Western blot is not provided for the antibodies against the S2 extracellular domain used for the dSTORM. While I haven't checked the papers showing characterization of the anti-GHR, I did re-check reference 70, which the authors say shows full characterization of the PRLR antibody, and this does not show a full Western (only portions of gels). How do we know that this antibody is not recognizing some other cell surface molecule, the surface expression of which increases upon stimulation of the cells with PRL? Is there only one band when blotting whole cell extracts with either the GHR or PRLR ECD antibodies so we can be sure of specificity? Figure S2 helps some, but these are different cells and the relative expression of the PRLR versus some other potential cell surface protein in these engineered cells may well be completely different.

    1. Joint Public Review:

      The Lee et al. study has been revised in response to reviewer comments. It presents a valuable investigation into the role of the Hippo signaling pathway (specifically wts-1/LATS and yap) in age-dependent neurodegeneration and microtubule dynamics in C. elegans TRNs. The authors convincingly demonstrated that disruption of wts-1/LATS leads to age-associated neuronal abnormalities and enhanced microtubule stabilization, with a genetic link to yap. While the study was praised for its well-conducted and well-controlled approaches, reviewers raised concerns about the specificity of the Hippo pathway's effects to TRNs, the correlation of Hpo signaling decline in TRNs with age, and the mechanistic link between Hpo-mediated gene expression and microtubule regulation. The authors addressed the TRN specificity by suggesting the unique microtubule structure of these neurons might contribute to their susceptibility. They acknowledged the difficulty in detecting Hpo signaling decline specifically in aged TRNs but noted increased YAP-1 nuclear localization in other tissues. Importantly, the authors provided evidence suggesting that YAP-TEAD-mediated transcriptional regulation is responsible for neuronal degeneration, as loss of yap-1 or egl-44 restored the wts-1 mutant phenotype. However, the specific transcriptional targets of YAP-1 regulating microtubule stability remain unidentified, representing a key limitation. The authors also discussed the possibility of non-cell-autonomous effects of YAP-1 and offered explanations for the seemingly moderate impairment of the touch response despite structural damage. Finally, they attributed the shorter lifespan of wts-1 and wts-1; yap-1 mutants to roles of wts-1 beyond TRNs and potential synergistic effects of yap-1. Overall, the study provides significant insights into the Hippo pathway's role in neuronal aging and microtubule dynamics, while acknowledging remaining mechanistic gaps.

    1. Reviewer #1 (Public review):

      Summary:

      Summary of what author's were trying to achieve: In the manuscript by Hoisington et al., the authors utilized a novel conditional neuronal prosap2-interacting protein 1 (Prosapip1) knockout mouse to delineate the effects of both neuronal and dorsal hippocampal (dHP)-specific knockout of Prosapip1 impacts biochemical and electrophysiological neuroadaptations within the dHP that may mediate behaviors associated with this brain region.

      Strengths:

      (1) Methodological Strengths

      a) The generation and use of a conditional neuronal knockout of Prosapip1 is a strength. These mice will be useful for anyone interested in studying or comparing and contrasting the effects of loss of Prosapip1 in different brain regions or in non-neuronal tissues.<br /> b) The use of biochemical, electrophysiological, and behavioral approaches are a strength. By providing data across multiple domains, a picture begins to emerge about the mechanistic role for Prosapip1. While questions still remain, the use of the 3 domains is a strength.<br /> c) The use of both global, constitutive neuronal loss of Prosapip1 and postnatal dHP-specific knockout of Prosapip1 help support and validate the behavioral conclusions.

      (2) Strengths of the results

      a) It is interesting that loss of Prosapip1 leads to specific alterations in the expression of GluN2B and PSD95 but not GluA1 or GluN2A in a post homogenization fraction that the author's term a "synaptic" fraction. Therefore, these results suggest protein-specific modulation of glutamatergic receptors within a "synaptic" fraction.<br /> b) The electrophysiological data demonstrate an NMDAR-dependent alteration in measures of hippocampal synaptic plasticity, including long-term potentiation (LTP) and NMDAR input/output. These data correspond with the biochemical data demonstrating a biochemical effect on GluN2B localization. Therefore, the conclusion that loss of Prosapip1 influences NMDAR function is well supported.<br /> c) The behavioral data suggest deficits in memory in particular novel object recognition and spatial memory, in the Prosapip1 knockout mice. These data are strongly bolstered by both the pan neuronal knockout and the dHP Cre transduction.

      The authors highlight potential future studies to further the understanding of Prosapip1.

    2. Reviewer #2 (Public review):

      The authors provide valuable findings characterizing a Prosapip1 conditional knockout mouse and the effects of knockout on hippocampal excitatory transmission, NMDAR transmission, and several learning behaviors. Furthermore, the authors selectively and conditionally knockout Prosapip1 in the dorsal hippocampus and show that it is required for the same spatial learning and memory assessed in the conditional knockout mice. The study uncovers how Prosapip1 is involved PSD organization and is a functional and critical player in dorsal Hippocampal LTP via its interaction with GluN2B subunits. The study is well controlled, detailed, and data in the paper match the conclusions.

      Comments on revisions:

      The authors have addressed all concerns.

    1. Reviewer #1 (Public review):

      Summary:

      This study addresses the issue of rapid skill learning and whether individual sequence elements (here: finger presses) are differentially represented in human MEG data. The authors use a decoding approach to classify individual finger elements, and accomplish an accuracy of around 94%. A relevant finding is that the neural representations of individual finger elements dynamically change over the course of learning. This would be highly relevant for any attempts to develop better brain machine interfaces - one now can decode individual elements within a sequence with high precision, but these representations are not static but develop over the course of learning.

      Strengths:

      The work follows a large body of work from the same group on the behavioural and neural foundations of sequence learning. The behavioural task is well established a neatly designed to allow for tracking learning and how individual sequence elements contribute. The inclusion of short offline rest periods between learning epochs has been influential because it has revealed that a lot, if not most of the gains in behaviour (ie speed of finger movements) occur in these so-called micro-offline rest periods.

      The authors use a range of new decoding techniques, and exhaustively interrogate their data in different ways, using different decoding approaches. Regardless of the approach, impressively high decoding accuracies are observed, but when using a hybrid approach that combines the MEG data in different ways, the authors observe decoding accuracies of individual sequence elements from the MEG data of up to 94%.

      Weaknesses:

      A formal analysis and quantification of how head movement may have contributed to the results should be included in the paper or supplemental material. The type of correlated head movements coming from vigorous key presses aren't necessarily visible to the naked eye, and even if arms etc are restricted, this will not preclude shoulder, neck or head movement necessarily; if ICA was conducted, for example, the authors are in the position to show the components that relate to such movement; but eye-balling the data would not seem sufficient. The related issue of eye movements is addressed via classifier analysis. A formal analysis which directly accounts for finger/eye movements in the same analysis as the main result (ie any variance related to these factors) should be presented.

      This reviewer recommends inclusion of a formal analysis that the intra-vs inter parcels are indeed completely independent. For example, the authors state that the inter-parcel features reflect "lower spatially resolved whole-brain activity patterns or global brain dynamics". A formal quantitative demonstration that the signals indeed show "complete independence" (as claimed by the authors) and are orthogonal would be helpful

    2. Reviewer #2 (Public review):

      Summary:

      The current paper consists of two parts. The first part is the rigorous feature optimization of the MEG signal to decode individual finger identity performed in a sequence (4-1-3-2-4; 1~4 corresponds to little~index fingers of the left hand). By optimizing various parameters for the MEG signal, in terms of (i) reconstructed source activity in voxel- and parcel-level resolution and their combination, (ii) frequency bands, and (iii) time window relative to press onset for each finger movement, as well as the choice of decoders, the resultant "hybrid decoder" achieved extremely high decoding accuracy (~95%). This part seems driven almost by pure engineering interest in gaining as high decoding accuracy as possible.<br /> In the second part of the paper, armed with the successful 'hybrid decoder,' the authors asked more scientific questions about how neural representation of individual finger movement that is embedded in a sequence, changes during a very early period of skill learning and whether and how such representational change can predict skill learning. They assessed the difference in MEG feature patterns between the first and the last press 4 in sequence 41324 at each training trial and found that the pattern differentiation progressively increased over the course of early learning trials. Additionally, they found that this pattern differentiation specifically occurred during the rest period rather than during the practice trial. With a significant correlation between the trial-by-trial profile of this pattern differentiation and that for accumulation of offline learning, the authors argue that such "contextualization" of finger movement in a sequence (e.g., what-where association) underlies the early improvement of sequential skill. This is an important and timely topic for the field of motor learning and beyond.

      Strengths:

      Each part has its own strength. For the first part, the use of temporally rich neural information (MEG signal) has a significant advantage over previous studies testing sequential representations using fMRI. This allowed the authors to examine the earliest period (= the first few minutes of training) of skill learning with finer temporal resolution. Through the optimization of MEG feature extraction, the current study achieved extremely high decoding accuracy (approx. 94%) compared to previous works. For the second part, the finding of the early "contextualization" of the finger movement in a sequence and its correlation to early (offline) skill improvement is interesting and important. The comparison between "online" and "offline" pattern distance is a neat idea.

      Weaknesses:

      Despite the strengths raised, the specific goal for each part of the current paper, i.e., achieving high decoding accuracy and answering the scientific question of early skill learning, seems not to harmonize with each other very well. In short, the current approach, which is solely optimized for achieving high decoding accuracy, does not provide enough support and interpretability for the paper's interesting scientific claim. This reminds me of the accuracy-explainability tradeoff in machine learning studies (e.g., Linardatos et al., 2020). More details follow.

      There are a number of different neural processes occurring before and after a key press, such as planning of upcoming movement and ahead around premotor/parietal cortices, motor command generation in primary motor cortex, sensory feedback related processes in sensory cortices, and performance monitoring/evaluation around the prefrontal area. Some of these may show learning-dependent change and others may not.

      Given the use of whole-brain MEG features with a wide time window (up to ~200 ms after each key press) under the situation of 3~4 Hz (i.e., 250~330 ms press interval) typing speed, these different processes in different brain regions could have contributed to the expression of the "contextualization," making it difficult to interpret what really contributed to the "contextualization" and whether it is learning related. Critically, the majority of data used for decoder training has the chance of such potential overlap of signal, as the typing speed almost reached a plateau already at the end of the 11th trial and stayed until the 36th trial. Thus, the decoder could have relied on such overlapping features related to the future presses. If that is the case, a gradual increase in "contextualization" (pattern separation) during earlier trials makes sense, simply because the temporal overlap of the MEG feature was insufficient for the earlier trials due to slower typing speed.

      Several direct ways to address the above concern, at the cost of decoding accuracy to some degree, would be either using the shorter temporal window for the MEG feature or training the model with the early learning period data only (trials 1 through 11) to see if the main results are unaffected would be some example.

    3. Reviewer #3 (Public review):

      Summary:

      One goal of this paper is to introduce a new approach for highly accurate decoding of finger movements from human magnetoencephalography data via dimension reduction of a "multi-scale, hybrid" feature space. Following this decoding approach, the authors aim to show that early skill learning involves "contextualization" of the neural coding of individual movements, relative to their position in a sequence of consecutive movements. Furthermore, they aim to show that this "contextualization" develops primarily during short rest periods interspersed with skill training, and correlates with a performance metric which the authors interpret as an indicator of offline learning.

      Strengths:

      A strength of the paper is the innovative decoding approach, which achieves impressive decoding accuracies via dimension reduction of a "multi-scale, hybrid space". This hybrid-space approach follows the neurobiologically plausible idea of concurrent distribution of neural coding across local circuits as well as large-scale networks. A further strength of the study is the large number of tested dimension reduction techniques and classifiers.

      Weaknesses:

      A clear weakness of the paper lies in the authors' conclusions regarding "contextualization". Several potential confounds, which partly arise from the experimental design (mainly the use of a single sequence) and which are described below, question the neurobiological implications proposed by the authors, and provide a simpler explanation of the results. Furthermore, the paper follows the assumption that short breaks result in offline skill learning, while recent evidence, described below, casts doubt on this assumption.

      Specifically:<br /> The authors interpret the ordinal position information captured by their decoding approach as a reflection of neural coding dedicated to the local context of a movement (Figure 4). One way to dissociate ordinal position information from information about the moving effectors is to train a classifier on one sequence, and test the classifier on other sequences that require the same movements, but in different positions (Kornysheva et al., Neuron 2019). In the present study, however, participants trained to repeat a single sequence (4-1-3-2-4). As a result, ordinal position information is potentially confounded by the fixed finger transitions around each of the two critical positions (first and fifth press). Across consecutive correct sequences, the first keypress in a given sequence was always preceded by a movement of the index finger (=last movement of the preceding sequence), and followed by a little finger movement. The last keypress, on the other hand, was always preceded by a ring finger movement, and followed by an index finger movement (=first movement of the next sequence). Figure 4 - supplement 2 shows that finger identity can be decoded with high accuracy (>70%) across a large time window around the time of the keypress, up to at least {plus minus}100 ms (and likely beyond, given that decoding accuracy is still high at the boundaries of the window depicted in that figure). This time window approaches the keypress transition times in this study. Given that distinct finger transitions characterized the first and fifth keypress, the classifier could thus rely on persistent (or "lingering") information from the preceding finger movement, and/or "preparatory" information about the subsequent finger movement, in order to dissociate the first and fifth keypress. Currently, the manuscript provides little evidence that the context information captured by the decoding approach is more than a by-product of temporally extended, and therefore overlapping, but independent neural representations of consecutive keypresses that are executed in close temporal proximity - rather than a neural representation dedicated to context.<br /> During the review process, the authors pointed out that a "mixing" of temporally overlapping information from consecutive keypresses, as described above, should result in systematic misclassifications and therefore be detectable in the confusion matrices in Figures 3C and 4B, which indeed do not provide any evidence that consecutive keypresses are systematically confused. However, such absence of evidence (of systematic misclassification) should be interpreted with caution, and, of course, provides no evidence of absence. The authors also pointed out that such "mixing" would hamper the discriminability of the two ordinal positions of the index finger, given that "ordinal position 5" is systematically followed by "ordinal position 1". This is a valid point which, however, cannot rule out that "contextualization" nevertheless reflects the described "mixing".

      During the review process, the authors responded to my concern that training of a single sequence introduces the potential confound of "mixing" described above, which could have been avoided by training on several sequences, as in Kornysheva et al. (Neuron 2019), by arguing that Day 2 in their study did include control sequences. However, the authors' findings regarding these control sequences are fundamentally different from the findings in Kornysheva et al. (2019), and do not provide any indication of effector-independent ordinal information in the described contextualization - but, actually, the contrary. In Kornysehva et al. (Neuron 2019), ordinal, or positional, information refers purely to the rank of a movement in a sequence. In line with the idea of competitive queuing, Kornysheva et al. (2019) have shown that humans prepare for a motor sequence via a simultaneous representation of several of the upcoming movements, weighted by their rank in the sequence. Importantly, they could show that this gradient carries information that is largely devoid of information about the order of specific effectors involved in a sequence, or their timing, in line with competitive queuing. They showed this by training a classifier to discriminate between the five consecutive movements that constituted one specific sequence of finger movements (five classes: 1st, 2nd, 3rd, 4th, 5th movement in the sequence) and then testing whether that classifier could identify the rank (1st, 2nd, 3rd, etc) of movements in another sequence, in which the fingers moved in a different order, and with different timings. Importantly, this approach demonstrated that the graded representations observed during preparation were largely maintained after this cross-decoding, indicating that the sequence was represented via ordinal position information that was largely devoid of information about the specific effectors or timings involved in sequence execution. This result differs completely from the findings in the current manuscript. Dash et al. report a drop in detected ordinal position information (degree of contextualization in figure 5C) when testing for contextualization in their novel, untrained sequences on Day 2, indicating that context and ordinal information as defined in Dash et al. is not at all devoid of information about the specific effectors involved in a sequence. In this regard, a main concern in my public review, as well as the second reviewer's public review, is that Dash et al. cannot tell apart, by design, whether there is truly contextualization in the neural representation of a sequence (which they claim), or whether their results regarding "contextualization" are explained by what they call "mixing" in their author response, i.e., an overlap of representations of consecutive movements, as suggested as an alternative explanation by Reviewer 2 and myself.

      Such temporal overlap of consecutive, independent finger representations may also account for the dynamics of "ordinal coding"/"contextualization", i.e., the increase in 2-class decoding accuracy, across Day 1 (Figure 4C). As learning progresses, both tapping speed and the consistency of keypress transition times increase (Figure 1), i.e., consecutive keypresses are closer in time, and more consistently so. As a result, information related to a given keypress is increasingly overlapping in time with information related to the preceding and subsequent keypresses. The authors seem to argue that their regression analysis in Figure 5 - figure supplement 3 speaks against any influence of tapping speed on "ordinal coding" (even though that argument is not made explicitly in the manuscript). However, Figure 5 - figure supplement 3 shows inter-individual differences in a between-subject analysis (across trials, as in panel A, or separately for each trial, as in panel B), and, therefore, says little about the within-subject dynamics of "ordinal coding" across the experiment. A regression of trial-by-trial "ordinal coding" on trial-by-trial tapping speed (either within-subject, or at a group-level, after averaging across subjects) could address this issue. Given the highly similar dynamics of "ordinal coding" on the one hand (Figure 4C), and tapping speed on the other hand (Figure 1B), I would expect a strong relationship between the two in the suggested within-subject (or group-level) regression. Furthermore, learning should increase the number of (consecutively) correct sequences, and, thus, the consistency of finger transitions. Therefore, the increase in 2-class decoding accuracy may simply reflect an increasing overlap in time of increasingly consistent information from consecutive keypresses, which allows the classifier to dissociate the first and fifth keypress more reliably as learning progresses, simply based on the characteristic finger transitions associated with each. In other words, given that the physical context of a given keypress changes as learning progresses - keypresses move closer together in time, and are more consistently correct - it seems problematic to conclude that the mental representation of that context changes. To draw that conclusion, the physical context should remain stable (or any changes to the physcial context should be controlled for).

      A similar difference in physical context may explain why neural representation distances ("differentiation") differ between rest and practice (Figure 5). The authors define "offline differentiation" by comparing the hybrid space features of the last index finger movement of a trial (ordinal position 5) and the first index finger movement of the next trial (ordinal position 1). However, the latter is not only the first movement in the sequence, but also the very first movement in that trial (at least in trials that started with a correct sequence), i.e., not preceded by any recent movement. In contrast, the last index finger of the last correct sequence in the preceding trial includes the characteristic finger transition from the fourth to the fifth movement. Thus, there is more overlapping information arising from the consistent, neighbouring keypresses for the last index finger movement, compared to the first index finger movement of the next trial. A strong difference (larger neural representation distance) between these two movements is, therefore, not surprising, given the task design, and this difference is also expected to increase with learning, given the increase in tapping speed, and the consequent stronger overlap in representations for consecutive keypresses. Furthermore, initiating a new sequence involves pre-planning, while ongoing practice relies on online planning (Ariani et al., eNeuro 2021), i.e., two mental operations that are dissociable at the level of neural representation (Ariani et al., bioRxiv 2023).

      A further complication in interpreting the results stems from the visual feedback that participants received during the task. Each keypress generated an asterisk shown above the string on the screen. It is not clear why the authors introduced this complicating visual feedback in their task, besides consistency with their previous studies. The resulting systematic link between the pattern of visual stimulation (the number of asterisks on the screen) and the ordinal position of a keypress makes the interpretation of "contextual information" that differentiates between ordinal positions difficult. During the review process, the authors reported a confusion matrix from a classification of asterisks position based on eye tracking data recorded during the task, and concluded that the classifier performed at chance level and gaze was, thus, apparently not biased by the visual stimulation. However, the confusion matrix showed a huge bias that was difficult to interpret (a very strong tendency to predict one of the five asterisk positions, despite chance-level performance). Without including additional information for this analysis (or simply the gaze position as a function of the number of astersisk on the screen) in the manuscript, this important control anaylsis cannot be properly assessed, and is not available to the public.

      The authors report a significant correlation between "offline differentiation" and cumulative micro-offline gains. However, this does not address the question whether there is a trial-by-trial relation between the degree of "contextualization" and the amount of micro-offline gains - i.e., the question whether performance changes (micro-offline gains) are less pronounced across rest periods for which the change in "contextualization" is relatively low. The single-subject correlation between contextualization changes "during" rest and micro-offline gains (Figure 5 - figure supplement 4) addresses this question, however, the critical statistical test (are correlation coefficients significantly different from zero) is not included. Given the displayed distribution, it seems unlikely that correlation coefficients are significantly above zero.

      The authors follow the assumption that micro-offline gains reflect offline learning. However, there is no compelling evidence in the literature, and no evidence in the present manuscript, that micro-offline gains (during any training phase) reflect offline learning. Instead, emerging evidence in the literature indicates that they do not (Das et al., bioRxiv 2024), and instead reflect transient performance benefits when participants train with breaks, compared to participants who train without breaks, however, these benefits vanish within seconds after training if both groups of participants perform under comparable conditions (Das et al., bioRxiv 2024). During the review process, the authors argued that differences in the design between Das et al. (2024) on the one hand (Experiments 1 and 2), and the study by Bönstrup et al. (2019) on the other hand, may have prevented Das et al. (2024) from finding the assumed (lasting) learning benefit by micro-offline consolidation. However, the Supplementary Material of Das et al. (2024) includes an experiment (Experiment S1) whose design closely follows the early learning phase of Bönstrup et al. (2019), and which, nevertheless, demonstrates that there is no lasting benefit of taking breaks for the acquired skill level, despite the presence of micro-offline gains.

      Along these lines, the authors' claim, based on Bönstrup et al. 2020, that "retroactive interference immediately following practice periods reduces micro-offline learning", is not supported by that very reference. Citing Bönstrup et al. (2020), "Regarding early learning dynamics (trials 1-5), we found no differences in microscale learning parameters (micro-online/offline) or total early learning between both interference groups." That is, contrary to Dash et al.'s current claim, Bönstrup et al. (2020) did not find any retroactive interference effect on the specific behavioral readout (micro-offline gains) that the authors assume to reflect consolidation.

      The authors conclude that performance improves, and representation manifolds differentiate, "during" rest periods (see, e.g., abstract). However, micro-offline gains (as well as offline contextualization) are computed from data obtained during practice, not rest, and may, thus, just as well reflect a change that occurs "online", e.g., at the very onset of practice (like pre-planning) or throughout practice (like fatigue, or reactive inhibition). That is, the definition of micro-offline gains (as well as offline contextualization) conflates online and "offline" processes. This becomes strikingly clear in the recent Nature paper by Griffin et al. (2025), who computed micro-offline gains as the difference in average performance across the first five sequences in a practice period (a block, in their terminology) and the last five sequences in the previous practice period. Averaging across sequences in this way minimises the chance to detect online performance changes, and inflates changes in performance "offline". The problem that "offline" gains (or contextualization) is actually computed from data entirely generated online, and therefore subject to processes that occur online, is inherent in the very definition of micro-offline gains, whether, or not, they computed from averaged performance.

      A simple control analysis based on shuffled class labels could lend further support to the authors' complex decoding approach. As a control analysis that completely rules out any source of overfitting, the authors could test the decoder after shuffling class labels. Following such shuffling, decoding accuracies should drop to chance-level for all decoding approaches, including the optimized decoder. This would also provide an estimate of actual chance-level performance (which is informative over and beyond the theoretical chance level). During the review process, the authors reported this analysis to the reviewers. Given that readers may consider following the presented decoding approach in their own work, it would have been important to include that control analysis in the manuscript to convince readers of its validity.

      Furthermore, the authors' approach to cortical parcellation raises questions regarding the information carried by varying dipole orientations within a parcel (which currently seems to be ignored?) and the implementation of the mean-flipping method (given that there are two dimensions - space and time - it is unclear what the authors refer to when they talk about the sign of the "average source", line 477).

    1. Reviewer #1 (Public review):

      Summary:

      In this work, the authors investigate the functional difference between the most commonly expressed form of PTH, and a novel point mutation in PTH identified in a patient with chronic hypocalcemia and hyperphosphatemia. The value of this mutant form of PTH as a potential anabolic agent for bone is investigated alongside PTH(1-84), which is a current anabolic therapy. The authors have achieved the aims of the study.

      Strengths:

      The work is novel, as it describes the function of a novel, naturally occurring, variant of PTH in terms of its ability to dimerise, to lead to cAMP activation, to increase serum calcium, and its pharmacological action compared to normal PTH.

      Comments on revisions: No further recommendations for revisions. Acceptable as the paper stands.

      [Editors' note: the original reviews are here, https://doi.org/10.7554/eLife.97579.1.sa1]

    1. Reviewer #1 (Public review):

      Summary:

      In this paper, the authors have performed an antigenic assay for human seasonal N1 neuraminidase using antigens and mouse sera from 2009-2020 (with one avian N1 antigen). This shows two distinct antigen groups. There is poorer reactivity with sera from 2009-2012 against antigens from 2015-2019, and poorer reactivity with sera from 2015-2020 against antigens from 2009-2013. There is a long branch separating these two groups. However, 321 and 423 are the only two positions that are consistently different between the two groups. Therefore these are the most likely cause of these antigenic differences.

      Strengths:

      (1) A sensible rationale was given for the choice of sera, in terms of the genetic diversity.

      (2) There were two independent batches of one of the antigens used for generating sera, which demonstrated the level of heterogeneity in the experimental process.

      (3) Replicate of the Wisconsin/588/2019 antigen (as H1 and H6) is another useful measure of heterogeneity.

      (4) The presentation of the data, e.g. Figure 2, clearly shows two main antigenic groups.

      (5) The most modern sera are more recent than other related papers, which demonstrates that has been no major antigenic change.

      Weaknesses:

      (1) Issues with experimental methods<br /> As I am not an experimentalist, I cannot comment fully on the experimental methods. However, I note that BALB/c mice sera were used, whereas outbred ferret sera are typically used in influenza antigenic characterisation, so the antigenic difference observed may not be relevant in humans. Similarly, the mice were immunised with an artificial NA immunogen where the typical approach would be to infect the ferret with live virus intra-nasally.

      (2) Five mice sera were generated per immunogen and then pooled, but data was not presented that demonstrated these sera were sufficiently homogenous that this approach is valid.

      (3) There were no homologous antigens for most of the sera. This makes the responses difficult to interpret as the homologous titre is often used to assess the overall reactivity of a serum. The sequence of the antigens used is not described, which again makes it difficult to interpret the results.

      (4) To be able to untangle the effects of the individual substitutions at 321, 386, and 432, it would have been useful to have included the naturally occurring variants at these positions, or to have generated mutants at these positions. Gao et al clearly show an antigenic difference with ferret sera correlated separately with N386K and I321V/K432E.

      (5) The challenge experiments in Gao et al showed that NI titre was not a good correlate of protection, so that limits the interpretation of these results.

      Issues with the computational methods

      (6) The NAI titres were normalised using the ELISA results, and the motivation for this is not explained. It would be nice to see the raw values.

      (7) It is not clear what value the random forest analysis adds here, given that positions 321 and 432 are the only two that consistently differ between the two groups.

      (8) As with the previous N2 paper, the metric for antigenic distance (the root mean square of the difference between the titres for two sera) is not one that would be consistent when different sera are included. More usual metrics of distance are Archetti-Horsfall, fold down from homologous, or fold down from maximum.

      (9) Antigenic cartography of these data is fraught. I wonder whether 2 dimensions are required for what seems like a 1-dimensional antigenic difference - certainly, the antigens, excluding the H5N1, are in a line. The map may be skewed by the high reactivity Brisbane/18 antigen. It is not clear if the column bases (normalisation factors for calculating antigenic distance) have been adjusted to account for the lack of homologous antigens. It is typical to present antigenic maps with a 1:1 x:y ratio.

      Issues with interpretation

      (10) Figure 2 shows the NAI titres split into two groups for the antigens, however, A/Brisbane is an outlier in the second antigenic group with high reactivity.

      (11) Following Gao et al, I think you can claim that it is more likely that the antigenic change is due to K432E than I321V, based on a comparison of the amino acid change.

      Appraisal:

      Taking into account the limitations of the experimental techniques (which I appreciate are due to resource constraints), this paper meets its aim of measuring the antigenic relationships between 2009-2020 seasonal N1s, showing that there were two main groups. The authors discovered that the difference between the two antigenic groups was likely attributable to positions 321 and 432, as these were the only two positions that were consistently different between the two groups. They came to this finding by using a random forest model, but other simpler methods could have been used.

      Impact:

      This paper contributes to the growing literature on the potential benefit of NA in the influenza vaccine.

    2. Reviewer #2 (Public review):

      Summary:

      In this study, Catani et al. have immunized mice with 17 recombinant N1 neuraminidases (NAs) from human isolates circulating between 2009-2020 to investigate antigenic diversity. NA inhibition (NAI) titers revealed two groups that were antigenically and phylogenetically distinct. Machine learning was used to estimate the antigenic distances between the N1 NAs and mutations at residues K432E and I321V were identified as key determinants of N1 NA antigenicity.

      Strengths:

      Observation of mutations associated with N1 antigenic drift.

      Weaknesses:

      Validation that K432E and I321V are responsible for antigenic drift was not determined in a background strain with native K432 and I321 or the restitution of antibody binding by reversion to K432 and I321 in strains that evaded sera.

    1. Reviewer #1 (Public review):

      Summary:

      Shi and colleagues report the use of modified Cre lines in which the coding region of Cre is disrupted by rox-STOP-rox or lox-STOP-lox sequences to prevent the expression of functional protein in the absence of Dre or Cre activity, respectively. The main purpose of these tools is to enable intersectional or tamoxifen-induced Cre activity with minimal or no leaky activity from the second, Cre-expressing allele. It is a nice study but lacks some functional data required to determine how useful these alleles will be in practice, especially in comparison with the figure line that stimulated their creation.

      Strengths:

      The new tools can reduce Cre leak in vivo.

      Comments on revisions:

      The major improvement in my mind is the inclusion of Supp Fig 7 where the authors compare their loxCre to iSureCre. The discussion is somewhat improved, but still fails to discuss significant issues such as Cre toxicity in detail. As noted by most reviewers, without a biological question the paper is entirely a technical description of a a couple of new tools. However, I do feel that these tools will be of use to the field.

    2. Reviewer #2 (Public review):

      This work present new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      The study and the new models have also some limitations. The demonstration of efficient deletion of multiple floxed alleles in a mosaic fashion, a scenario where the lines would demonstrate their full potential compared to existing models, has not been tested in the current study. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. In addition, as discussed by the authors, a limitation of this line is the constitutive expression of Cre, which is associated with toxicity in some cases.

    3. Reviewer #3 (Public review):

      Shi et al describe a new set of tools to facilitate Cre or Dre-recombinase-mediated recombination in mice. The strategies are not completely novel but have been pursued previously by the lab, which is world-leading in this field, and by others. The authors report a new version of the iSuRe-Cre approach, which was originally developed by Rui Benedito's group in Spain. Shi et al describe that their approach shows reduced leakiness compared to the iSuRe-Cre line. Furthermore, a new R26-roxCre-tdT mouse line was established after extensive testing, which enables efficient expression of the Cre recombinase after activation of the Dre recombinase. The authors carefully evaluated efficiency and leakiness of the new line and demonstrated the applicability by marking peri-central hepatocytes in an intersectional genetics approach. The paper represents the result of enormous, carefully executed efforts. Although I would have preferred to see a study, which uses the wonderful new tools to address a major biological question, carefully conducted technical studies have a considerable value for the scientific community, justifying publication.

      It seems very likely that the new mouse lines generated in this study will enhance the precision of genetic manipulation in distinct cell types and greatly facilitate future work in numerous laboratories. The authors expertly have eradicated weaknesses from the initial submission. One minor issue remains. The authors did not investigate potential toxic effects that might be caused by high level expression of a combination of "foreign" genes such as recombinases and fluorescence reporters. The authors refer to published studies about toxic effects, speculating that they can only be prevented by removing recombinases in an additional step. Although this is a valid argument, I would have appreciated to see an assessment of putative toxic effects by RNA-sequencing, since different combinations of recombinases and fluorescence reporters sometimes can generate unexpected effects. However, this minor issue does not compromise the value of this important study.

    1. Reviewer #1 (Public review):

      Summary:

      In this article, Chunharas and colleagues compared the representational differences of orientation information during a sensory task and a working memory task. By reanalyzing data from a previous fMRI study and applying representational similarity analysis (RSA), they observed that orientation information was represented differently in the two tasks: during visual perception, orientation representation resembled the veridical model, which captures the known naturalistic statistics of orientation information; whereas during visual working memory, a categorical model, which assumes different psychological distances between orientations, better explained the data, particularly in more anterior retinotopic regions. The authors suggest fundamental differences in the representational geometry of visual perception and working memory along the human retinotopic cortex.

      Strengths:

      Examining the differences in representational geometry between perception and working memory has important implications for the understanding of the nature of working memory. This study presents a carefully-executed reanalysis of previous data to address this question. The authors developed a novel method (model construction combined with RSA) to examine the representational geometry of orientation information under different tasks, and the control analyses provide rich, convincing support for their claims.

      Weaknesses:

      Although the control analyses are convincing, I still have alternative explanations for some of the results. I'm also concerned about the low sample size (n = 6 in the fMRI experiment). Overall, I think additional analyses may help to further clarify the issues and strengthen the claims.

      (1) The central claim of the current study is that orientation information is represented in a veridical manner during the sensory task, and in a categorical manner during working memory. However, In the sensory task, a third type of representational geometry was observed, especially in brain regions from V3AB and beyond. These regions showed a symmetric pattern in which oblique orientations (45 and 135 degrees) appeared more similar to each other. In fact, a similar pattern can even be found in V1-V3, although the effect looked weaker. The authors raised two possible explanations for this in the discussion, one being that participants might have used verbal labels (e.g., diagonal) for both orientations, and the other being a lack of attention to orientation. Either way, this suggests that a veridical model may not be the best fit for these ROIs. How would this symmetric model explain the sensory data, in comparison to the veridical model?

      (2) If the symmetric model also explains the sensory data well, I wonder whether this result challenges the authors' central claim, or instead suggests that the sensory task is not ideal for the purpose of the study. One way to address this issue might be to use the sample period of the working memory task as the perception task, as some other studies have been doing (e.g., Kwak & Curtis, 2022). This epoch of data might function as a stronger version of the attention task as the authors discussed in the discussion. What would the representational geometry look like in the sample period? I would also like to note that the current analyses used 5.6-13.6 s after stimulus onset for the memory task, which I think may reflect a mix of sample- and delay-related activity.

      (3) When comparing the veridical and categorical models, it is important to first show the significance of each model before making comparisons. For instance, was the veridical model significant in different ROIs in the memory task? And was either model significant in IPS1-3 in the two tasks? I'm asking about this because the two models appear to be both significant in the memory task, whereas only the veridical model was significant in the sensory task (with overall lower correlation coefficients than the categorical model in the memory task).

      (4) The current study has a low sample size of six participants. With such a small sample, it would be helpful to show results from individual participants. For example, I appreciate that Figures 2D and 3C showed individual data points, but additionally showing the representational geometry plot (i.e., Figure 1C) for each subject could better illustrate the robustness of the effect. Alternatively, the original paper from which the fMRI data were drawn actually had two fMRI experiments with similar task designs. I wonder if the authors could replicate these patterns using data from the second experiment with seven participants. This might provide even stronger support for the current findings with a more reasonable sample size.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors examined the representational geometry of orientation representations during visual perception and working memory along the visual hierarchy. Using representational similarity analysis, they found that similarity was relatively evenly distributed among all orientations during perception, while higher around oblique orientations during WM. There were some noticeable differences along the visual hierarchy. IPS showed the most pronounced oblique orientation preferences during WM but no clear patterns during perception, likely due to the different task demands for the WM orientation task and the perception contrast discrimination task. The authors proposed two models to capture the differences. The veridical model estimated the representational geometry in perception by assuming an efficient coding framework, while the categorical model estimated the pattern in WM using psychological distances to measure the differences among orientations (including estimates from a separate psychophysical study performed outside the scanner). Therefore, I think this work is valuable and advances our understanding of the transition from perception to memory.

      Strengths:

      The use of RSA to identify representational biases goes beyond simply relying on response patterns and helps identify how representational formats change from perception to WM. The study nicely leverages ideas about efficient coding to explain perceptual representations that are more veridical, while leaning on ideas about abstractions of percepts that are more categorical-psychological in nature (but see (1) below). Moreover, the match between memory biases of orientation and the patterns estimated with RSA were compelling (but see (2) below). I found the analyses showing how RSA and decoding (eg, cross-generalization) are associated and how/why they may differ to be particularly interesting.

      Weaknesses:

      (1) The idea that later visual maps (ie, IPS0) encode perceptions of orientation in a veridical form and then in a categorical form during WM is an attractive idea. However, the support is somewhat weakened by a few issues. The RSA plots in Figure 1C for IPS0 appear to show a similar pattern, but just of lower amplitude during perception. But in the model fits either for orientation statistics or estimated from the psychophysics task, the Veridical model fits best for perception and the Categorical model fits best for memory in IPS0. By my eye, the modeled RSMs in Figures 2 & 3 do not look like the observed ones in Figure 1C. Those modeled RSMs look way more categorical than the observed IPS0. They look like something in between.

      (2) My biggest concern is the omission of the in-scanner behavioral data. Yes, on the one hand, they used the N=17 outside the scanner psychophysics dataset for the analyses in Figure 3. On the other hand, they do not even mention the behavioral data collected in the scanner along with the BOLD data. Those data had clear oblique effects if I recall correctly. Why use the data from the psychophysics experiment? Also, perhaps a missed opportunity; I wonder if the Veridical/Categorical models fit a single subject's RSA data matches that subject's behavioral biases. That would really be compelling if found.

      The data were collected (reanalysis of published study) without consideration for the aims of the current study, and are therefore not optimized to test their goals. The biggest issue is that "The distractors are really distracting me." I'm somewhat concerned about how the distractors may have impacted the results. I honestly did not notice that the authors were using delay periods that had 11s of distractor stimuli until way into the paper. On the one hand, the "patterns" of the model fits across the ROIs appear to be qualitatively similar. That's good if you want to pool data like the authors did. But, while the authors state on line 350 "..we also confirmed that the presence of distractors during the delay did not impact the pattern of results in the memory task (Supplementary Figure 5)." When looking at Supplementary Figure 5, I noticed that there are a couple of exceptions to this. In the Gratings distractor data, V1 shows a better fit to the Veridical model, while V4 and IPS0 shows no better fit to either model. And in the Noise distractor data, neither model fits better for any ROI. At first glance, I was concerned, but then looking at the No distractor data, the pattern is identical to that of the combined data. Thus, this can be seen as a glass half full/empty issue as almost all of the ROIs show a similar pattern, but still it would concern me if I were leading this study. This gets me to my key question, why even use the distractor trials at all, where the interpretation can get dicey? For instance, the authors have shown in this exact data that the impact of distraction affects the fidelity of representations differently along the visual hierarchy (Rademaker, 2019), consistent with several other studies (eg., Bettencourt & Xu, 2016; Lorenc, 2018; Hallenbeck et al., 2022) and with one of the author's preprints (Rademaker & Serences, 2024). My guess is that without the full dataset, some of the RSA analyses are underpowered. If that is the case, I'm fine with it, but it might be nice to state that.

    1. Reviewer #1 (Public review):

      Summary:

      This work tried to map the synaptic connectivity between the inputs and outputs of the song premotor nucleus, HVC in zebra finches to understand how sensory (auditory) to motor circuits interact to coordinate song production and learning. The authors optimized the optogenetic technique via AAV to manipulate auditory inputs from a specific auditory area one-by-one and recorded synaptic activity from a neuron with whole-cell recording from slice preparation with identification of the projection area by retrograde neuronal tracing. This thorough and detailed analysis provides compelling evidence of synaptic connections between 4 major auditory inputs (3 forebrain and 1 thalamic region) within three projection neurons in the HVC; all areas give monosynaptic excitatory inputs and polysynaptic inhibitory inputs, but proportions of projection to each projection neuron varied. They also find specific reciprocal connections between mMAN and Av. Taken together the authors provide the map of the synaptic connection between intercortical sensory to motor areas which is suggested to be involved in zebra finch song production and learning.

      Strengths:

      The authors optimized optogenetic tools with eGtACR1 by using AAV which allow them to manipulate synaptic inputs in a projection-specific manner in zebra finches. They also identify HVC cell types based on projection area. With their technical advance and thorough experiments, they provided detailed map synaptic connections.

      Weaknesses:

      As it is the study in brain slice, the functional implication of synaptic connectivity is limited. Especially as all the experiments were done in the adult preparation, there could be a gap in discussing the functions of developmental song learning.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes synaptic connectivity in the Songbird cortex's four main classes of sensory neuron afferents onto three known classes of projection neurons of the pre-motor cortical region HVC. HVC is a region associated with the generation of learned bird songs. Investigators here use all male zebra finches to examine the functional anatomy of this region using patch clamp methods combined with optogenetic activation of select neuronal groups.

      Strengths:

      The quality of the recordings is extremely high and the quantity of data is on a very significant scale, this will certainly aid the field.

      Weaknesses:

      The authors could make the figures a little easier to navigate. Most of the figures use actual anatomical images but it would be nice to have this linked with a zebra finch atlas in more of a cartoon format that accompanied each fluro image. Additionally, for the most part, figures showing the labeling lack scale bar values (in um). These should be added not just shown in the legends.

      The authors could make it clear in the abstract that this is all male zebra finches - perhaps this is obvious given the bird song focus, but it should be stated. The number of recordings from each neuron class and the overall number of birds employed should be clearly stated in the methods (this is in the figures, but it should say n=birds or cells as appropriate).

      The authors should consider sharing the actual electrophysiology records as data.

    3. Reviewer #3 (Public review):

      Nucleus HVC is critical both for song production as well as learning and arguably, sitting at the top of the song control system, is the most critical node in this circuit receiving a multitude of inputs and sending precisely timed commands that determine the temporal structure of song. The complexity of this structure and its underlying organization seem to become more apparent with each experimental manipulation, and yet our understanding of the underlying circuit organization remains relatively poorly understood. In this study, Trusel and Roberts use classic whole-cell patch clamp techniques in brain slices coupled with optogenetic stimulation of select inputs to provide a careful characterization and quantification of synaptic inputs into HVC. By identifying individual projection neurons using retrograde tracer injections combined with pharmacological manipulations, they classify monosynaptic inputs onto each of the three main classes of glutamatergic projection neurons in HVC (RA-, Area X- and Av-projecting neurons). This study is remarkable in the amount of information that it generates, and the tremendous labor involved for each experiment, from the expression of opsins in each of the target inputs (Uva, NIf, mMAN, and Av), the retrograde labelling of each type of projection neuron, and ultimately the optical stimulation of infected axons while recording from identified projection neurons. Taken together, this study makes an important contribution to increasing our identification, and ultimately understanding, of the basic synaptic elements that make up the circuit organization of HVC, and how external inputs, which we know to be critical for song production and learning, contribute to the intrinsic computations within this critic circuit.

      This study is impressive in its scope, rigorous in its implementation, and thoughtful regarding its limitations. The manuscript is well-written, and I appreciate the clarity with which the authors use our latest understanding of the evolutionary origins of this circuit to place these studies within a larger context and their relevance to the study of vocal control, including human speech. My comments are minor and primarily about legibility, clarification of certain manipulations, and organization of some of the summary figures.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Shao et al. investigate the contribution of different cortical areas to working memory maintenance and control processes, an important topic involving different ideas about how the human brain represents and uses information when no longer available to sensory systems. In two fMRI experiments, they demonstrate that human frontal cortex (area sPCS) represents stimulus (orientation) information both during typical maintenance, but even more so when a categorical response demand is present. That is, when participants have to apply an added level of decision control to the WM stimulus, sPCS areas encode stimulus information more than conditions without this added demand. These effects are then expanded upon using multi-area neural network models, recapitulating the empirical gradient of memory vs control effects from visual to parietal and frontal cortices. Multiple experiments and analysis frameworks provide support for the authors' conclusions, and control experiments and analysis are provided to help interpret and isolate the frontal cortex effect of interest. While some alternative explanations/theories may explain the roles of frontal cortex in this study and experiments, important additional analyses have been added that help ensure a strong level of support for these results and interpretations.

      Strengths:

      - The authors use an interesting and clever task design across two fMRI experiments that is able to parse out contributions of WM maintenance alone along with categorical, rule-based decisions. Importantly, the second experiments only uses one fixed rule, providing both an internal replication of Experiment 1's effects and extending them to a different situation when rule switching effects are not involved across mini-blocks.

      - The reported analyses using both inverted encoding models (IEM) and decoders (SVM) demonstrate the stimulus reconstruction effects across different methods, which may be sensitive to different aspects of the relationship between patterns of brain activity and the experimental stimuli.

      - Linking the multivariate activity patterns to memory behavior is critical in thinking about the potential differential roles of cortical areas in sub-serving successful working memory. Figure 3's nicely shows a similar interaction to that of Figure 2 in the role of sPCS in the categorization vs. maintenance tasks. This is an important contribution to the field when we consider how a distributed set of interacting cortical areas support successful working memory behavior.

      - The cross-decoding analysis in Figure 4 is a clever and interesting way to parse out how stimulus and rule/category information may be intertwined, which would have been one of the foremost potential questions or analyses requested by careful readers.

      - Additional ROI analyses in more anterior regions of the PFC help to contextualize the main effects of interest in the sPCS (and no effect in the inferior frontal areas, which are also retinotopic, adds specificity). And, more explanation for how motor areas or preparation are likely not involved strengthens the takeaways of the study (M1 control analysis).

      - Quantitative link via RDM-style analyses between the RNNs constructed and fMRI data.

      Weaknesses:

      - In the given tasks, multiple types of information codes may be present, and more detail on this possibility could always be added analytically or in discussion. However, the authors have added beneficial support to this comparison in this version of the manuscript.

      - The space of possible RNN architectures and their biological feasibility could always be explored more, but links between the fMRI and RNN data provide a good foundation for this work moving forward.

    2. Reviewer #2 (Public review):

      Summary:

      The author provide evidence that helps resolve long-standing questions about the differential involvement of frontal and posterior cortex in working memory. They show that whereas early visual cortex shows stronger decoding of memory content in a memorization task vs a more complex categorization task, frontal cortex shows stronger decoding during categorization tasks than memorization tasks. They find that task-optimized RNNs trained to reproduce the memorized orientations show some similarities in neural decoding to people. Together, this paper presents interesting evidence for differential responsibilities of brain areas in working memory.

      Strengths:

      This paper was overall strong. It had a well-designed task, best-practice decoding methods, and careful control analyses. The neural network modeling adds additional insight into the potential computational roles of different regions.

      Weaknesses:

      Few. The RNN-fMRI correspondence could be a little more comprehensive, but the paper contributes a compelling set of empirical findings and interpretations that can inform future research.

    1. Reviewer #1 (Public review):

      Here, the authors propose that changes in m6A levels may be predictable via a simple model that is based exclusively on mRNA metabolic events. Under this model, m6A mRNAs are "passive" victims of RNA metabolic events with no "active" regulatory events needed to modulate their levels by m6A writers, readers, or erasers; looking at changes in RNA transcription, RNA export, and RNA degradation dynamics is enough to explain how m6A levels change over time.

      The relevance of this study is extremely high at this stage of the epitranscriptome field. This compelling paper is in line with more and more recent studies showing how m6A is a constitutive mark reflecting overall RNA redistribution events. At the same time, it reminds every reader to carefully evaluate changes in m6A levels if observed in their experimental setup. It highlights the importance of performing extensive evaluations on how much RNA metabolic events could explain an observed m6A change.

    2. Reviewer #2 (Public review):

      Dierks et al. investigate the impact of m6A RNA modifications on the mRNA life cycle, exploring the links between transcription, cytoplasmic RNA degradation and subcellular RNA localization. Using transcriptome-wide data and mechanistic modelling of RNA metabolism, the authors demonstrate that a simplified model of m6A primarily affecting cytoplasmic RNA stability is sufficient to explain the nuclear-cytoplasmic distribution of methylated RNAs and the dynamic changes in m6A levels upon perturbation. Based on multiple lines of evidence, they propose that passive mechanisms based on the restricted decay of methylated transcripts in the cytoplasm play a primary role in shaping condition-specific m6A patterns and m6A dynamics. The authors support their hypothesis with multiple large-scale datasets and targeted perturbation experiments. Overall, the authors present compelling evidence for their model which has the potential to explain and consolidate previous observations on different m6A functions, including m6A-mediated RNA export.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript works with a hypothesis where the overall m6A methylation levels in cells is influenced by mRNA metabolism (sub-cellular localization and decay). The basic assumption is that m6A causes Mrna decay and this happens in the cytoplasm. They go on to experimentally test their model to confirm its predictions. This is confirmed by sub-cellular fractionation experiments which shows high m6A levels in the nuclear RNA. Nuclear localized RNAs have higher methylation. Using a heat shock model, they demonstrate that RNAs with increased nuclear localization or transcription, are methylated at higher levels. Their overall argument is that changes in m6A levels is rather determined by passive processes that are influenced by RNA processing/metabolism. However, it should be considered that erasers have their roles under specific environments (early embryos or germline) and are not modelled by the cell culture systems used here.

      Strengths:

      This is a thought-provoking series of experiments that challenge the idea that active mechanisms of recruitment or erasure are major determinants for m6A distribution and levels.

      Comments on revisions:

      The authors have done a good job with the revision.

    1. Reviewer #1 (Public review):

      Summary:

      Sattin, Nardin, and colleagues designed and evaluated corrective microlenses that increase the useable field of view of two long (>6mm) thin (500 um diameter) GRIN lenses used in deep-tissue two-photon imaging. This paper closely follows the thread of earlier work from the same group (esp. Antonini et al, 2020; eLife), filling out the quiver of available extended-field-of-view 2P endoscopes with these longer lenses. The lenses are made by a molding process that appears practical and easy to adopt with conventional two-photon microscopes.

      Simulations are used to motivate the benefits of extended field of view, demonstrating that more cells can be recorded, with less mixing of signals in extracted traces, when recorded with higher optical resolution. In vivo tests were performed in piriform cortex, which is difficult to access, especially in chronic preparations.

      The design, characterization, and simulations are clear and thorough, but they do not break new ground in optical design or biological application. However, the approach shows much promise, including for applications such as miniaturized GRIN-based microscopes. Readers will largely be interested in this work for practical reasons: to apply the authors' corrected endoscopes to their own research.

      Strengths:

      The text is clearly written, the ex vivo analysis is thorough and well supported, and the figures are clear. The authors achieved their aims, as evidenced by the images presented, and were able to make measurements from large numbers of cells simultaneously in vivo in a difficult preparation.

      The authors did a good job of addressing issues I raised in initial review, including analyses of chromaticity and the axial field of view, descriptions of manufacturing and assembly yield, explanations in the text of differences between ex vivo and in vivo imaging conditions, and basic analysis of the in vivo recordings relative to odor presentations. They have also shortened the text, reduced repetition, and better motivated their approach in the introduction.

      Weaknesses:

      As discussed in review and nicely simulated by the authors, the large figure error indicated by profilometry (~10 um in some cases on average) is inconsistent with the optical performance improvements observed, suggesting that those measurements are inaccurate. I see no reason to include these inaccurate measurements.

    2. Reviewer #2 (Public review):

      In this manuscript, the authors present an approach to correct GRIN lens aberrations, which primarily cause a decrease in signal-to-noise ratio (SNR), particularly in the lateral regions of the field-of-view (FOV), thereby limiting the usable FOV. The authors propose to mitigate these aberrations by designing and fabricating aspherical corrective lenses using ray trace simulations and two-photon lithography, respectively; the corrective lenses are then mounted on the back aperture of the GRIN lens.

      This approach was previously demonstrated by the same lab for GRIN lenses shorter than 4.1 mm (Antonini et al., eLife, 2020). In the current work, the authors extend their method to a new class of GRIN lenses with lengths exceeding 6 mm, enabling access to deeper brain regions as most ventral region of the mouse brain. Specifically, they designed and characterized corrective lenses for GRIN lenses measuring 6.4 mm and 8.8 mm in length. Finally, they applied these corrected long micro-endoscopes to perform high-precision calcium signal recordings in the olfactory cortex.

      Compared with alternative approaches using adaptive optics, the main strength of this method is that it does not require hardware or software modifications, nor does it limit the system's temporal resolution. The manuscript is well-written, the data are clearly presented, and the experiments convincingly demonstrate the advantages of the corrective lenses.

      The implementation of these long corrected micro-endoscopes, demonstrated here for deep imaging in the mouse olfactory bulb, will also enable deep imaging in larger mammals such as rats or marmosets.

      Comments on revisions:

      The authors have clearly addressed all my comments.

    3. Reviewer #3 (Public review):

      Summary:

      This work presents the development, characterization and use of new thin microendoscopes (500µm diameter) whose accessible field of view has been extended by the addition of a corrective optical element glued to the entrance face. Two microendoscopes of different lengths (6.4mm and 8.8mm) have been developed, allowing imaging of neuronal activity in brain regions >4mm deep. An alternative solution to increase the field of view could be to add an adaptive optics loop to the microscope to correct the aberrations of the GRIN lens. The solution presented in this paper does not require any modification of the optical microscope and can therefore be easily accessible to any neuroscience laboratory performing optical imaging of neuronal activity.

      Strengths:

      (1) The paper is generally clear and well written. The scientific approach is well structured and numerous experiments and simulations are presented to evaluate the performance of corrected microendoscopes. In particular, we can highlight several consistent and convincing pieces of evidence for the improved performance of corrected microendoscopes:

      - PSFs measured with corrected microendoscopes 75µm from the centre of the FOV show a significant reduction in optical aberrations compared to PSFs measured with uncorrected microendoscopes.

      - Morphological imaging of fixed brain slices shows that optical resolution is maintained over a larger field of view with corrected microendoscopes compared to uncorrected ones, allowing neuronal processes to be revealed even close to the edge of the FOV.

      - Using synthetic calcium data, the authors showed that the signals obtained with the corrected microendoscopes have a significantly stronger correlation with the ground truth signals than those obtained with uncorrected microendoscopes.

      (2) There is a strong need for high quality microendoscopes to image deep brain regions in vivo. The solution proposed by the authors is simple, efficient and potentially easy to disseminate within the neuroscience community.

      Weaknesses:

      Weaknesses that were present in the first version of the paper were carefully addressed by the authors.

    1. Reviewer #1 (Public review):

      The IBL here presents an important paper that aims to assess potential reproducibility issues in rodent electrophysiological recordings across labs and suggests solutions to these. The authors carried out a series of analyses on data collected across 10 laboratories while mice performed the same decision-making task, and provided convincing evidence that basic electrophysiology features, single-neuron functional properties, and population-level decoding were fairly reproducible across labs with proper preprocessing. This well-motivated large-scale collaboration allowed systematic assessment of lab-to-lab reproducibility of electrophysiological data, and the suggestions outlined in the paper for streamlining preprocessing pipelines and quality metrics will provide general guidance for the field, especially with continued effort to benchmark against standard practices (such as manual curation).

      The authors have carefully incorporated our suggestions. As a result, the paper now better reflects where reproducibility is affected when using common, simple, and more complex analyses and preprocessing methods, and it is more informative-and more reflective of the field overall. We thank the reviewers for this thorough revision. We have 2 remaining suggestions on text clarification:

      (1) Regarding benchmarking the automated metrics to manual curation of units: although we appreciate that a proper comparison may require a lot of effort potentially beyond the scope of the current paper; we do think that explicit discussion regarding this point is needed in the text, to remind the readers (and indeed future generations of electrophysiologists) the pros and cons of different approaches.

      In addition to what the authors have currently stated (line 469-470):<br /> "Another significant limitation of the analysis presented here is that we have not been able to assess the extent to which other choices of quality metrics and inclusion criteria might have led to greater or lesser reproducibility."

      Maybe also add:<br /> "In particular, a thorough comparison of automated metrics against a careful, large, manually-curated dataset, is an important benchmarking step for future studies.

      (2) The authors now include in Figure 3-Figure Supplement 1 that highlight how much probe depth is adjusted by using electrophysiological features such as LFP power to estimate probe and channel depth. This plot is immensely informative for the field, as it implies that there can be substantial variability-sometimes up to 1 mm discrepancy between insertions-in depth estimation based on anatomical DiI track tips alone. Using electrophysiological features in this way for probe depth estimation is currently not standard in the field and has only been made possible with Neuropixels, which span several millimeters. These figures highlight that this should be a critical step in preprocessing pipelines, and the paper provides solid evidence for this.

      Currently, this part of the figure is only subtly referenced to in the text. We think it would be helpful to explicitly reference this particular panel with discussions of its implication in the text.

    2. Reviewer #2 (Public review):

      Summary:

      The authors sought to evaluate whether analyses of large-scale electrophysiology data obtained from 10 different individual laboratories are reproducible when they use standardized procedures and quality control measures. They were able to reproduce most of their experimental findings across all labs. Despite attempting to target the same brain areas in each recording, variability in electrode targeting was a source of some differences between datasets.

      Strengths:

      This paper gathered a standardized dataset across 10 labs and performed a host of state-of-the-art analyses on it. Their ability to assess the reproducibility of each analysis across this kind of data is an important contribution to the field.

      Comments on revisions:

      The authors have addressed almost all of the concerns that I raised in this revised version. The new RIGOR notebook is helpful, as are the new analyses.

      This paper attributes much error in probe insertion trajectory planning to the fact that the Allen CCF and standard stereotaxic coordinate systems are not aligned. Consequently, it would be very helpful for the community if this paper could recommend software tools, procedures, or code to do trajectory planning that accounts for this.

      I think it would still be helpful for the paper to have some discussion comparing/contrasting the use of the RIGOR framework with existing spike sorting statistics. They mention in their response to reviewers that this is indeed a large space of existing approaches. Most labs performing Neuropixels recordings already do some type of quality control, but these approaches are not standardized. This work is well-positioned to discuss the advantages and disadvantages of these alternative approaches (even briefly) but does not currently do so-it does not need to run any of these competing approaches to helpfully mention ideas for what a reader of the paper should do for quality control with their own data.

    1. Reviewer #1 (Public review):

      The manuscript consists of two separate but interlinked investigations: genomic epidemiology and virulence assessment of Salmonella Dublin. ST10 dominates the epidemiological landscape of S. Dublin, while ST74 was uncommonly isolated. Detailed genomic epidemiology of ST10 unfolded the evolutionary history of this common genotype, highlighting clonal expansions linked to each distinct geography. Notably, North American ST10 was associated with more antimicrobial resistance compared to others. The authors also performed long read sequencing on a subset of isolates (ST10 and ST74), and uncovered a novel recombinant virulence plasmid in ST10 (IncX1/IncFII/IncN). Separately, the authors performed cell invasion and cytotoxicity assays on the two S. Dublin genotypes, showing differential responses between the two STs. ST74 replicates better intracellularly in macrophage compared to ST10, but both STs induced comparable cytotoxicity levels. Comparative genomic analyses between the two genotypes showed certain genetic content unique to each genotype, but no further analyses were conducted to investigate which genetic factors likely associated with the observed differences. The study provides a comprehensive and novel understanding on the evolution and adaptation of two S. Dublin genotypes, which can inform public health measures. The methodology included in both approaches were sound and written in sufficient detail, and data analysis were performed with rigour. Source data were fully presented and accessible to readers.

      Comments on revised version:

      The authors have addressed all the points raised by the reviewer. The manuscript is now much enhanced in clarity and accuracy. The re-written Discussion is more relevant and brings in comparison with other invasive Salmonella serotypes.

      Comments:

      In light of the metadata supplied in this revision, for Australian isolates, all human cases of ST74 (n=7) were from faeces (assuming from gastroenteritis) while 18/40 of ST10 were from invasive specimen (blood and abscess). This may contradict with the manuscript's finding and discussion on different experiment phenotypes of the two STs, with ST74 showing more replication in macrophages and potentially more invasive. Thus, the reviewer suggests the authors to mention this disparity in the Discussion, and discuss possible reasons underlying this disparity. This can strengthen the author's rationale for further in vivo studies.

    2. Reviewer #2 (Public review):

      This is a comprehensive analysis of Salmonella Dublin genomes that offers insights into the global spread of this pathogen and region-specific traits that are important to understand its evolution. The phenotyping of isolates of ST10 and ST74 also offer insights into the variability that can be seen in S. Dublin, which is also seen in other Salmonella serovars, and reminds the field that it is important to look beyond lab-adapted strains to truly understand these pathogens. This is a valuable contribution to the field. The only limitation, which the authors also acknowledge, is the bias towards S. Dublin genomes from high income settings. However, there is no selection bias; this is simply a consequence of publicly available sequences.

    1. Reviewer #1 (Public review):

      Summary:

      The main observation that the sperm from CRISP proteins 1 and 3 KO lines are post-fertilization less developmentally competent is convincing. The data showing progressive acquisition of the sperm defects during epididymal transport and the exchange fluid studies showing the altered epididymal environment are important. However, the molecular characterization of the mechanism(s) that leads to these defects requires additional studies.

      Strengths:

      The generation of these double mutant mice is valuable for the field. Moreover, the fact that the double mutant line of Crisp 1 and 3 is phenotypically different from the Crisp 1 and 4 line suggests different functions of these epididymis proteins. The methods used to demonstrate that developmental defects are largely due to post-fertilization defects are also a considerable strength. The initial characterization that these sperm have altered intracellular Ca2+ levels, and increased rates of DNA fragmentation are valuable. The increase fragmentation of control sperm DNA when exposed to mutant epididymal fluid is significant and an excellent platform for future studies.

      Weaknesses:

      The study is mechanistically incomplete because evidence of how these proteins alter the environment is not shown. What are the target(s) of these proteins that result in increased Ca2+?

    2. Reviewer #2 (Public review):

      Summary:

      The study highlights the role of CRISP1 and CRISP3, two epididymal proteins, in early embryo development through DNA integrity. The authors demonstrate that C1/C3 DKO sperm exhibit defects in the DNA integrity, probably due to Ca2+ dysregulation in the epididymis. However, direct evidence for this mechanism requires further experiments. The finding of the involvement of the epididymal environment in embryogenesis is significant, but some results on sperm fertilizing ability of C1/C3 DKO mice were similar to the previous report. Thus, this point raises concern about the perspective of novelty.

      Strengths:

      The authors demonstrate that CRISP1 and CRISP3 regulate Ca2+ in the epididymal fluid, and loss of CRISP1 and CRISP3 disrupts Ca2+ regulation in the epididymal fluid, leading to sperm DNA fragmentation and impaired embryonic development after fertilization. This proposed mechanism is both novel and intriguing, offering valuable insights into the epididymal control of sperm quality.

      Weaknesses:

      The evidence supporting the mechanism of CRISP1 and CRISP3 in calcium regulation within epididymis and its contribution to the sperm DNA damage remains limited.

      Major comments:

      The data provided in this manuscript (Figure 2A and B) appear to overlap with data in previously published paper (PMID:33037689), despite differences in the duration of in vivo fertilization after mating. The results in both studies show similar findings, raising concerns about potential data redundancy.

      As shown in Figure 6A, while wild-type sperm were exposed to the epididymal fluid of C1/C3 DKO mice, the wild-type sperm exhibited DNA fragmentation. Additionally, when wild-type sperm were exposed to the epididymal fluid of wild-type mice with 10 mM Ca2+, DNA fragmentation is still observed. Therefore, the authors conclude that the DNA fragmentation in C1/C3 DKO sperm is due to the increased level of the Ca2+. However, the connection between the DNA damage in wild-type sperm exposed to the epididymal fluid of C1/C3 DKO mice and the increased levels of Ca2+ remains unclear. To clarify this, it is suggested that intracellular calcium levels in the wild type sperm should be analyzed before and after exposure to the epididymal fluid of C1/C3 DKO mice (or before and after adding 10 mM Ca2+ into wild-type fluid). Furthermore, the author should explain detailed information on epididymal fluid collection, because Ca2+ levels vary between different sections of the epididymis.

      In lines 321-323, the authors mention the selection system of the female reproductive tract that only allows high-quality sperm to reach the eggs (Cummins and Yanagimachi 1982), but this paper is not listed in the bibliography. It is important to ensure proper referencing.

      The discussion section is too long and difficult to follow well because there is redundancy of the results in many parts. It is recommended to shorten it by focusing only on relevant and important information.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, the authors investigate the role of BEND2, a novel regulator of meiosis, in both male and female fertility. Huang et al have created a mouse model where the full-length BEND2 transcript is depleted but the truncated BEND2 version remains. This mouse model is fertile, and the authors used it to study the role of BEND2 on both male and female meiosis. Overall, the full-length BEND2 appears dispensable for male meiosis. The more interesting phenotype was observed in females. Females exhibit a lower ovarian reserve suggesting that full-length BEND2 is involved in the establishment of the primordial follicle pool.

      Strengths:

      The authors generated a mouse model that enabled them to study the role of BEND2 in meiosis. The role of BEND2 in female fertility is novel and enhances our knowledge of genes involved in the establishment of the primordial follicle pool.

      Weaknesses highlighted previously:

      The manuscript extensively explores the role of BEND2 in male meiosis; however, a more interesting result was obtained from the study of female mice.

    2. Reviewer #2 (Public review):

      In their manuscript entitled "BEND2 is a crucial player in oogenesis and reproductive aging", the authors present their findings that full-length BEND2 is important for repair of meiotic double strand break repair in spermatocytes, regulation of LINE-1 elements in spermatocytes, and proper oocyte meiosis and folliculogenesis in females. The manuscript utilizes an elegant system to specifically ablate the full-length form of BEND2 which has been historically difficult to study due to its location on the X chromosome and male sterility of global knockout animals.

      The authors have been extremely responsive to reviewer critiques and have presented strong data and appropriate conclusions, making it an excellent addition to the field.

    3. Reviewer #3 (Public review):

      Huang et al. investigated the phenotype of Bend2 mutant mice which expressed truncated isoform. Bend2 deletion in male showed fertility and this enabled them to analyze the BEND2 function in females. They showed that Bend2 deletion in females showed decreasing follicle number which may lead to loss of ovarian reserve.

      Strengths:

      They found the truncated isoform of Bend2 and the depletion of this isoform showed decreasing follicle number at birth.

      Weaknesses highlighted previously:

      The authors showed novel factors that impact ovarian reserve. Although the number of follicles and conception rate are reduced in mutant mice, the in vitro fertilization rate is normal and follicles remain at 40 weeks of age. It is difficult to know how critical this is when applied to the human case.

      [Editors' note: We thank the authors for considering the previous recommendations and suggested corrections.]

    1. Reviewer #1 (Public review):

      Turi, Teng and the team used state of the art techniques to provide convincing evidence on the infraslow oscillation of DG cells during NREM sleep, and how serotonergic innervation modulates hippocampal activity pattern during sleep and memory. First, they showed that the glutamatergic DG cells become activated following an infraslow rhythm during NREM sleep. In addition, the infraslow oscillation in the DG is correlated with rhythmic serotonin release during sleep. Finally, they found that specific knockdown of 5-HT receptors in the DG impairs the infraslow rhythm and memory, suggesting that serotonergic signaling is crucial for regulating DG activity during sleep. Given that the functional role of infraslow rhythm still remains to be studied, their findings deepen our understanding on the role of DG cells and serotonergic signaling in regulating infraslow rhythm, sleep microarchitecture and memory.

    2. Reviewer #2 (Public review):

      Summary:

      The authors investigated DG neuronal activity at the population and single cell level across sleep/wake periods. They found an infraslow oscillation (0.01-0.03 Hz) in both granule cells (GC) and mossy cells (MC) during NREM sleep. The important findings are:

      (1) The antiparallel temporal dynamics of DG neuron activities and serotonin neuron activities/extracellular serotonin levels during NREM sleep<br /> (2) The GC Htr1a-mediated GC infraslow oscillation.

      Strengths:

      (1) The combination of polysomnography, Ca-fiber photometry, two-photon microscopy and gene depletion is technically sound. The coincidence of microarousals and dips in DG population activity is convincing. The dip in activity in upregulated cells is responsible for the dip at the population level.

      (2) DG GCs express excitatory Htr4 and Htr7 in addition to inhibitory Htr1a, but deletion of Htr1a is sufficient to disrupt DG GC infraslow oscillation, supporting the importance of Htr1a in DG activity during NREM sleep.

      Weaknesses from the original round of review:

      (1) The current data set and analysis are insufficient to interpret the observation correctly [...].

      (2) It is acceptable that DG Htr1a KO induces the reduced freezing in the CFC test (Fig. 6E, F), but it is too much of a stretch that the disruption of DG ISO causes impaired fear memory. There should be a correlation.

      (3) It is necessary to describe the extent of AAV-Cre infection. The authors injected AAV into the dorsal DG (AP -1.9 mm), but the histology shows the ventral DG (Supplementary Fig. 4), which reduces the reliability of this study.

      Comments on revisions:

      Thank you for the clarification of the detection criteria and the quantification of the specific events. This reviewer can now follow the authors' interpretation.

    1. Reviewer #1 (Public review):

      Summary:

      Using sequences of short videos to elicit emotional changes in participants, Malamud & Huys demonstrate how a brief, controlled emotion regulation intervention (distancing) can effectively alter subsequent emotion ratings. The authors employ latent state-space models to capture the trajectories of emotion ratings, leveraging tools from control theory to quantify the intervention's impact on emotion dynamics.

      Strengths:

      The experiment is well-designed and tailored to the computational modeling approach advanced in the paper. It also relies on a selection of stimuli that were previously validated. Within the constraints of a controlled experiment, the intervention successfully implements a relatively common tool of psychotherapeutic treatment, ensuring its clinical relevance.

      The computational modeling is grounded in the well-established framework of dynamical systems and control theory. This foundation offers a conceptually clear formalization along with powerful quantification tools that go beyond previous more data-driven approaches.

      Overall, the study presents a coherent approach that bridges concepts from clinical psychology and computational theories, providing a timely stepping stone toward advancing quantified, evidence-based psychological interventions targetting emotion control.

      Weaknesses:

      A primary limitation of this study, acknowledged by the authors, is its reliance on self-reports of participants' emotional states. Although considerable effort was made to minimize expectation effects, further research is needed to confirm that the observed behavioral changes reflect genuine alterations in emotional states. Additionally, the generalizability of the findings to long-term remediation strategies remains an open question.

      Second, the statistical analysis, particularly the computational approach, sometimes lacks sufficient detail and refinement. While I will not elaborate on specific points here, one notable issue is the interpretation of the intrinsic matrix (A). The model-free analysis reveals correlations between emotions at a given time or within an emotional state across time points. However, it does not provide evidence to support lagged interactions across states that would justify non-diagonal elements in A. The other result concerning the dynamics matrix only highlights a trend in the dominant eigenvalue, which is difficult to interpret in isolation. The absence of a statistically significant group x intervention interaction furthermore makes this finding a little compelling. This weakens the study's conclusions about the importance of intrinsic dynamics, as claimed in the title.

      Finally, to avoid potential misunderstandings of their work, the authors should be more careful about their use of terms pertaining to the control theory and take the time to properly define them. For example, the "controllability" of emotional states can either denote that those states are more changeable (control theory definition), or, conversely, more tightly regulated (common interpretation, as used in the abstract). This is true for numerous terms (stability, sensitivity, Gramian, etc.) for which no clear definition nor references are provided. Readers unfamiliar with the framework of control theory will likely be at a loss without more guidance.

    2. Reviewer #2 (Public review):

      Summary:

      In this well-conceived and timely study, the authors assess the controllability of emotions in a quantitative way using the framework of control theory. They use a controlled distancing intervention halfway through an emotion rating task where emotion-inducing short videos from a validated database are shown and find that the intervention enables a better controllability of externally induced emotions in the experimental group.

      Strengths:

      It is a highly original idea to address the external controllability of emotions using the formal framework of control theory. It is also a very propitious approach to take what could be called a 'micro-therapeutic' perspective which looks at the immediate effect of an intervention instead of the 'macro-therapeutic' mid- or long-term effect of a whole course of therapy.

      Weaknesses:

      Acquiring data online inevitably gives rise to selection and self-selection effects. This needs to be acknowledged clearly. Exacerbating this, participant remuneration seems low at an amount below the minimum or living wage in Western countries (do the authors know where their participants came from?).

      Another concern is that the intervention does not simply take place before the second block begins but is ongoing during the whole of the second block in that it is integrated into the phrasing of the task on each trial. It is therefore somewhat misleading to speak of a period 'after the intervention', and it would have been interesting to assess the effect of this by including a third group where the phrasing does not change, but the floating leaves intervention takes place.

      As mentioned in the Limitations section, observation noise was assumed and not estimated. While this is understandable in this case, the effect of this assumption could have been assessed by simulation with varying levels of observation (and process) noise.

      Relatedly, the reliance on formal model comparison is unfortunate since the outcome of such comparisons is easily influenced by slight changes to assumptions such as noise levels. An alternative approach would have been to develop a favoured model based on its suitability to address the research question and its ability, established by simulation, to distill relevant changes of behaviour into reliable parameter estimates.

      The statistical analyses clearly show the limitations of classical statistical testing with highly complex models of the kind the authors (commendably) use. Hunting for statistically significant interactions in a multivariate repeated-measures design relying on inputs from time series-derived point estimates is a difficult proposition. While the authors make the best of the bad situation they create by using null-hypothesis significance testing, a more promising approach would have been to estimate parameters using a sampler like Stan or PyMC and then draw conclusions based on posterior predictive simulations.

    3. Reviewer #3 (Public review):

      Summary:

      The manuscript takes a dynamical systems perspective on emotion regulation, meaning that rather than a simplistic model conceptualising regulation as applying to a single emotion (e.g. regulation of sadness), emotion regulation could cause a shift in the dynamics of a whole system of emotions (which are linked mathematically to one another). This builds on the idea that there are 'attractor states' of emotions between which people transition, governed by both the system's intrinsic characteristics (e.g. temporal autocorrelation of a particular emotion/person) and external driving forces (having a stressful week). Conceptually this is a very useful advance because it is very unlikely that emotions are elicited (or reduced) singly, without affecting other emotions. This paper is a timely implementation of these ideas in the context of psychotherapeutic intervention, distancing, which participants were trained (randomised) to perform while watching emotion-inducing videos.

      The authors' main conclusion is that distancing both stabilises specific emotional patterns and reduces the impact of external video clips. I would consider these results strong and believable, and to have the potential to impact models of emotion regulation as well as the field's broader views on the mechanisms of psychological therapies.

      Strengths:

      This paper has very many strengths: I would especially note the authors' very-well-matched active control condition and the robustness of their model comparison approach. One feature of the authors' approach is that they explicitly add noise - not what you typically see in an emotion time-series analysis - which allows participants to make errors in their own subjective ratings (a reasonable thing to assume); this noise can then be smoothed during filtering. In their model comparison approach, they explicitly test whether a true dynamical system explains emotion change/emotion regulation effect on emotions - demonstrating that both intrinsic dynamics and external inputs were needed to explain subjective emotion. Powerfully, they also used this approach to test the differential effects of the treatment groups (see below).

      The main result seems quite robust statistically. Verifying the effects of the distancing intervention on emotion, the authors found an interaction between time (pre- to post-intervention) and intervention group (distancing vs. relaxation) suggesting that distancing (but not relaxation) reduced ratings of almost all emotions. Participants allocated to the distancing intervention also showed decreased variability of emotion ratings compared to those in the relaxation intervention (though note this interaction was not significant).

      Using a model comparison approach, the authors then demonstrated that whilst the control group was best explained by a model that did not change its dynamics of emotions, the active intervention (distancing) group was best explained by a model that captured both changing emotion dynamics and a changing input weights (influence of the videos) - results confirmed in follow-up analyses. This is convincing evidence that emotion regulation strategies may specifically affect the dynamics of emotions - both their relationships to one another and their susceptibility to changes evoked by external influences.

      The authors also perform analyses that suggest their result is not attributable to a demand effect (finding that participants were quicker during the control intervention, which one would expect if they had already decided how to respond in advance of the emotion question). I personally also think a demand effect is unlikely given the robustness of their control intervention (which participants would be just as likely to interpret as mental health-enhancing training as distancing), and I am convinced by the notion that demand effects would be unlikely to elicit their more specific effects on the dynamic quality of emotions.

      Weaknesses:

      An interesting but perhaps at present slightly confusing aspect of their described results relates to the 'controllability' of emotions, which they define as their susceptibility to external inputs. Readers should note this definition is (as I understand it) quite distinct from, and sometimes even orthogonal to, concepts of emotional control in the emotion literature, which refer to intentional control of emotions (by emotion regulation strategies such as distancing). The authors also use this second meaning in the discussion. Because of the centrality of control/controllability (in both meanings) to this paper, at present it is key for readers to bear these dual meanings in mind for juxtaposed results that distancing "reduces controllability" while causing "enhanced emotional control".

      As above the authors use an active control - a relaxation intervention - which is extremely closely matched with their active intervention (and a major strength). However, there was an additional difference between the groups (as I currently understand it): "in the group allocated to the distancing intervention, the phrasing of the question about their feelings in the second video block reminded participants about the intervention, stating: "You observed your emotions and let them pass like the leaves floating by on the stream." I do wonder if the effects of distancing also have been partially driven by some degree of reappraisal (considered a separate emotion regulation strategy) since this reminder might have evoked retrospective changes in ratings.

      Not necessarily a weakness, but an unanswered question is exactly how distancing is producing these effects. As the authors point out, there is a possibility that eye-movement avoidance of the more emotionally salient aspects of scenes could be changing participants' exposure to the emotions somewhat. Not discussed by the authors, but possibly relevant, is the literature on differences between emotion types on oculomotor avoidance, which could have contributed to differential effects on different emotions.

    1. Reviewer #1 (Public review):

      Summary:

      The nuclear protein SATB-1 was originally identified as a protein of the 'nuclear matrix', an aggregate of nuclear components that arose upon extracting nuclei with high salt. While the protein was assumed to have a global function in chromatin organization, it has subsequently been linked to a variety of pathological conditions, notably cancer. The mapping of the factor by conventional ChIP procedures showed strong enrichment in active, accessible chromatin, suggesting a direct role in gene regulation, perhaps in enhancer-promoter communication. These findings did not explain why SATB-1-chromatin interaction resisted the 2 M salt extraction during early biochemical fractionation of nuclei.

      The authors, who have studied SATB-1 for many years, now developed an unusual variation of the ChIP procedure, in which they purify crosslinked chromatin by centrifugation through 8 M urea. Remarkably, while they lose all previously mapped signals for SATB-1 in active chromatin, they now gain many binding events in silent regions of the genome, represented by lamin-associated domains (LADs).

      SATB-1 had previously been shown by the authors and others to bind to DNA with special properties, termed BUR (for 'base-unpairing regions'). BURs are AT-rich and apparently enriched in equally AT-rich LADs. The 'urea-ChIP' pattern is essentially complementary to the classical ChIP pattern. The authors now speculate that the previously known SATB-1 binding pattern, which does not overlap BURs particularly well, is due to indirect chromatin binding, whereas they consider the urea-ChIP profile that fits better to the BUR distribution on the chromosome to be due to direct binding.

      Building on the success with urea-ChIP the authors adapted the 4C-procedure of chromosome conformation mapping to work with urea-purified chromatin. The data suggest that BUR-bound SATB-1 in heterochromatin mediates long-distance interaction with loci in active chromatin. They close with a model, whereby SATB-1 tethers active chromatin to the nuclear lamina. Because cell type-specific differences are observed, they suggest that the SATB-1 interactions are functionally relevant.

      Strengths:

      Given the unusual finding of essentially mutually exclusive 'standard ChIP' and 'urea-ChIP' profiles for SATB-1, the authors conducted many appropriate controls. They showed that all SATB-1 peaks in urea-ChIP and 96% of peaks in standard-ChIP represent true signals, as they are not observed in a SATB-1 knockout cell line. They also show that urea-ChIP and standard ChIP yield similar profiles for CTCF. The data appear reproducible, judged by at least two replicates and triangulation. The SATB-1 KO cells provide a nice control for the specificity of signals, including those that arise from their elaborately modified 4C protocol.

      Weaknesses:

      The weaknesses mainly relate to missing qualifier statements and overinterpretations. I also found some aspects of the model not yet well supported by the data.

      (1) Under high urea conditions the BUR elements should be rendered single-stranded, and one wonders whether this has any effect on the procedure. The authors should alert the reader of these circumstances.

      (2) An important conclusion is that urea-ChIP reveals direct DNA binding events, whereas standard ChIP shows indirect binding (which is stripped off by urea). I do not yet see any evidence for direct binding. It cannot be excluded, for example, that the binding is RNA-mediated. The authors mention in passing that urea-ChIP material still contains (specific!) RNA. Given that this is a new procedure, the authors should document the RNA content of urea-ChIP and RNase-treat their samples prior to ChIP to monitor an RNA contribution.

      (3) An important aspect of the model is that SATB-1 tethers active genes to inactive LADs. However, in the 4C experiment the BUR elements used to anchor the looping are both in the accessible, active chromatin domain.

    2. Reviewer #2 (Public review):

      Summary:

      The report by Kohwi-Shigematsu et al. describes the key observation that SATB1 binds directly to so-called BUR elements. This is in contrast to several other reports describing SATB1 binding to promoters and enhancers. This discrepancy is explained by the authors to depend on the features of the ChIP technique being used. Urea-ChIP, innovated by the authors, strips off protein-protein interactions that are maintained in conventional ChIP. The authors convincingly make the case that SATB1 and the key genome organiser CTCF co-localize by conventional ChIP but not urea ChIP, as particularly evident in Figure 2A. SATB1 controls long-range interactions in thymocytes and the expression of gene clusters. This feature is independent of TADs, as the knockdown of SATB1 expression does not affect the TAD patterns.

      Strengths:

      A new and innovative adaptation of the urea ChIP-seq technique has enabled the authors to reveal a new aspect of SATB1 binding to the genome. The authors provide a wealth of data to reinforce their claims. This report thus sheds new light on SATB1 function, which is particularly important given its role in metastasising cancer cells.

      Weaknesses:

      No weaknesses were identified by this reviewer.

    1. Reviewer #1 (Public review):

      Summary:

      In the manuscript entitled 'A comparative analysis of planarian regeneration specificity reveals tissue polarity contributions of the axial cWnt signalling gradient.' Cleland et al. study the robustness of regenerating a head or a tail in the proper position in two different planarian species (S. mediterranea and G. sinensis). The authors find that the expression of notum, a Wnt inhibitor that is triggered after any cut, shows different dynamics of expression in both planarian species, being more symmetrical in the species that display a higher number of double-headed or Janus heads (G. sinenesis), which they refer to a less robust regeneration. The authors claim that the reduced robustness of G. sinensis regeneration is partially explained by this anterior-posterior symmetric expression of notum, since in S. mediterranea, which shows a 'robust regeneration' it appears asymmetric. So, the first claim of the manuscript is that the symmetry in notum expression could underlie the poor robustness of regenerating a head/tail in small bipolar regenerating planarian fragments.

      Then, they analyse the role of a proposed tail-to-head cWnt signalling gradient during the regeneration of heads and tails in the same planarian species. To do so they develop an antibody that allows the quantification of b-catenin activity along the AP axis, together with a pharmacological approach that reduces the pre-existent cWnt gradient without affecting the wound-induced. Through this strategy the authors can demonstrate the slope of the b-catenin activity, which is a very nice result, and that it changes according to the size of the animal. Furthermore, they are able to demonstrate that by reducing the cWnt signalling in the pre-existent tissue, there is an increase in the number of double-headed regenerates (Janus heads) and that it depends on the body size and on the decreasing steepness of the cWnt gradient. This result relies on G. sinensis species since the drug is not so effective in S. mediterranea. Thus, the authors' second claim is that the slope of the cWnt gradient may contribute to head-tail regeneration specificity in planarians.

      To conclude, it is proposed that regeneration of the correct identity in each wound depends on multiple cues acting in parallel and that their species-specificity provides variations in the regenerative capability of the different planarian species.

      The study has great potential to have a high impact on the regeneration community, since the opportunity to compare mechanisms between close species provides the framework for understanding the essential mechanism of regeneration.

      Strengths:

      The project has several strengths. The authors are able to reproduce the Janus heads phenotypes described by Morgan TH by analysing different planarian species. This is of great importance in the planarian field, because with the current model species, S. mediterranea, this could not be reproduced. So, these results demonstrate that small planarian fragments do make errors during regeneration, giving rise to double-headed animals, which supports the well-known hypothesis that it exists an anteroposterior gradient underlying anteroposterior identity during regeneration. However, and importantly, it does not occur in all planarian species. So, there are differences between planarian species in the robustness of regeneration and may be in the mechanisms that drive this regeneration. The finding of different behaviours and gene expressions in different planarian species is very interesting and promising in the field of regeneration.

      A second strength of the study is the demonstration of the b-catenin1 slope in planarians and how it changes with the animal size, and also the establishment of a method to decrease it in the pre-existent tissue but not in the wound. This strategy allows us to examine specifically the role of the pre-existent cWnt signal, demonstrating that it does have a role in the decision of making head or tail during regeneration, which was an essential question in the field of planarians and animal regeneration.

      Weaknesses:

      (1) The finding that notum, which is the main head determinant identified in planarians, has a different dynamic in both planarian species is very suggestive. However, the different dynamics of notum expression during regeneration, which is the basis of the subsequent rationale, is not properly demonstrated, nor is its correlation with the robustness in regenerating a proper head/tail identity. Main concerns regarding this point:

      a) The authors observe that 'In regenerating S. mediterranea 2 mm trunk pieces cut from 6 mm animals, notum expression was induced predominantly at anterior-facing wounds as early as 6 h post-amputation (Figure 2A), as previously reported (Petersen and Reddien 2011)'. However, in the graphics in Figures 2B and C, the expression of notum at 6h is shown as symmetric. It definitely does not agree with the in situ, with the text, or with the published data. How was it measured? It should be corrected and explained since it is the basis of the subsequent rationale.

      b) Then, when measuring notum in G. sinensis the authors conclude: 'Strikingly and in sharp contrast to S. mediterranea, the number of notum expressing cells was nearly identical between anterior and posterior wounds without any discernible A/P asymmetry at any of the examined time points (Figures 2E-F)'. However, in the in situ results of 12 h regenerating G. sinensis, there is a clear difference in notum expression between anterior and posterior wounds. Is it not representative of the image? Again, how exactly the measurements were performed? Are dots or pixels quantified? It is not explained in the text. This is a crucial result that has to be consistent.

      c) A more general weakness of this part of the manuscript is that even if the authors demonstrate that in G. sinensis the expression of notum is symmetrical in contrast to S. mediterranea, this is just an observation of 1 species that has symmetrical notum and regenerates less robustly than 1 species that has asymmetrical expression and regenerates more robustly. If they for instance look at the expression of wnt1, maybe they also see differences between both species that could be linked to their different regeneration properties (related to this, see below the comment on wnt1 expression). That is to say, comparing 1 to 1 species cannot give any cause-effect evidence.<br /> Furthermore, the authors rely on the fact that notum inhibition rescues the wild-type phenotype to conclude that is the symmetric expression of notum that underlies the appearance of Janus heads. This is what can be read in the results: 'Significantly, the rescue of wild-type regenerates by notum(RNAi) suggests that the symmetric G. sinensis notum expression contributes to the formation of double-heads and thus to reduced regeneration specificity'; and in the Summary: We found that the reduced regeneration robustness of G. sinensis was partially explained by wound site-symmetric expression of the head determinant notum, which is highly anterior-specific in S. mediterranea.' However, notum RNAi decreases notum in both wounds, so it does not produce an asymmetric expression (at least this is not shown). So, it does not link the symmetry or asymmetry of notum with the appearance of Janus heads.

      d) If the authors want to maintain the claim that the symmetry of notum is one of the reasons that explain the increase in Janus head phenotype in G. sinensis, there are several possibilities to test it. For instance:

      i) Analyse notum expression in different planarian species and relate its symmetry or asymmetry with the appearance of Janus heads. If the claim is true, the species that are more robust should show more asymmetric expression of notum. This would sustain strongly the first claim, and would really be a breakthrough in the field of regeneration.

      ii) Another possibility is a more in-depth analysis of notum expression in the species of the study. If the authors show that larger fragments show fewer Janus heads, and also that it depends on the anteroposterior level of the fragments, they could try to relate the rate of Janus heads with the degree of asymmetry in notum expression in both wounds. For instance, they could analyze notum expression in bipolar regenerating fragments along the anteroposterior axis in both species; it should be more symmetric in G sinenesis, in all fragments, according to Figure 2 L. Or they could analyze notum expression in bipolar regenerating fragments of different sizes, mainly in 1 or 2 mm fragments of big planarians, since they are the fragments analyzed that form or not the Janus heads. In G sinensis the expression of notum should be more symmetrical than in S. mediterranea in these fragments.

      iii) The authors could design an experiment to demonstrate that the symmetry in the expression of notum affects the rate of Janus heads. The experiment that the authors show is the rescue of the Janus heads in G. sinensis after notum RNAi. However, notum RNAi suppresses notum in both wounds, thus not making them asymmetric. Furthermore, the rescue could be explained by the posteriorizing effect that notum RNAi has in planarians, as reported by several authors. A possibility could be to inhibit APC, which increases notum expression in S. mediterranea (Petersen and Reddien 2011). If APC RNAi in G. sinenesis produces an increase in notum in both wounds and the rate of Janus heads is not rescued, then it would support the hypothesis that notum symmetry is the cause of the Janus heads. However, if it produces an increase of notum in an asymmetric manner, then the Janus phenotype should be rescued.

      (2) The second weakness of the study is related to the methodology used to support the second claim, that the slope of bcatenin1 activity has a role in the decision of regeneration - a head and a tail in the correct tip. The main concerns relate to the specificity of the anti-bcatenin1 antibody and to the broad effect of C59 in the secretion of all Wnts.

      a) Raising an antibody against beta-catenin1 that allows the quantification by western blot is a strength of the study, since beta-catenin1 is the key element of the cWnt pathway, and their levels are directly associated with the activation of the pathway. Since this is one of the tools that support the second claim of the study, a characterization of the antibody and additional tests to prove its specificity are required. The authors show a Western blot in which the band intensity decreases after beta-catenin1 inhibition in both species. Further analysis should be shown:<br /> i) Demonstration that the intensity of the band increases after APC or Axin inhibition.<br /> ii) Does the antibody work in immunohistochemistry? It would provide further evidence of the specificity of a nuclear signal could be demonstrated.<br /> iii) Explanation and discussion of the protocol used to analyse the levels of b-catenin1 activity along the anteroposterior axis is required. It has been reported that beta-catenin1 is highly expressed and required in the brain in planarians, and also in the pharynx, and in the sexual organs (Hill and Petersen 2015, Sureda-Gomez et al 2016). How is it then explained the anterior-to-posterior gradient of expression of beta-catenin1 seen in this study in both species? Has the pharynx been removed before the protein extraction? What about the beta-catenin1 activity demonstrated in the brain? Why is it not reflected in the western blot analysis using the antibody? This point should be clarified.

      b) The second tool used in the second part of the manuscript is the drug C59, which inhibits Porcupine, a protein required for palmitoylation and secretion of Wnts. Because Porcupine could be required for the secretion of all Wnts, the phenotype obtained with the drug could be the sum of the inhibition of cWNT signal (wnt1 for instances) and non-canonical WNT (as wnt5). This is in fact the phenotype resulting after the inhibition of Wntless in planarians (Adell et al. 2009), which is also required for the secretion of Wnts. Thus, in the phenotypes resulting from C59 treatment the analysis of the nervous system and posterior/anterior markers is required. Looking at the in vivo phenotype it appears that in fact the drug is affecting both canonical and no canonical pathways since the animal with protrusions in the lateral part (Figure 4B-double head, or Supplementary Figure 3A) is very similar to the one reported after Wntless inhibition. In case the phenotypes observed also show non-canonical Wnt inhibition, this should be clearly shown and discussed.

      The above-mentioned weaknesses are the most important concerns about the present manuscript. However, there are other concerns related to a further analysis of the phenotypes and the analysis of additional Wnt elements as wnt1, which are essential to complete the study and are directly discussed with the authors.

    2. Reviewer #2 (Public review):

      Summary:

      This study identifies a key role for bodywide canonical Wnt gradients in controlling the outcome of regeneration within planarians, likely acting in parallel to injury-induced cues that also use tissue asymmetry to control this process. In S. Mediterranea a central part of this decision process is the asymmetric expression of the Wnt inhibitor notum specifically at injury sites facing in the anterior direction to promote head formation and inhibit tail formation through regulation of canonical Wnt signaling pathways. Leveraging classic studies by T.H. Morgan over a century ago, which found that amputated thin transverse fragments occasionally incorrectly regenerate 2 heads rather than a head and a tail in a species of Girardia planarians, this study identifies a closely related species G. Sinensis which undergoes errors to regeneration specificity under similar challenges. Morgan had proposed that his results might arise from the use of a "gradient of materials" providing axis information across the body axis such that small tissue fragments are too narrow to interpret gradient differences, leading to head/tail polarity defects in regeneration. The authors show very convincingly that this species of planaria undergoes notum expression after injury, but unlike in S. Mediterranea, this occurs symmetrically at the onset of regeneration. Using RNAi, they show notum participates in the regeneration of mispolarized heads (though interestingly apparently not in normal head regeneration unlike in Smeds, at least under these conditions). G. Sinensis planarians, like many organisms, have abundant expression of Wnt genes posteriorly. To test whether this gradient of Wnts may participate in the regeneration distinct from any Wnt signals activated after injury, the authors use chemical inhibition to reduce Wnt signaling prior to injury and then alleviate inhibition following injury by removal of the drug and confirming successful washout of the drug using mass spec. They also raise a new antibody that can detect beta-catenin-1 in this species in order to monitor the body-wide cWnt gradient after these treatments, and correlate this with outcomes on the head/tail regeneration decision. Using this approach, they find that homeostatic inhibition of porcupine (required for Wnt secretion) could dampen the cWnt/beta-catenin gradient and increase the incidence of inappropriate head regeneration at posterior-facing wounds. In addition, they find that the cWnt gradient is less steep in larger animals that also concurrently have a higher incidence of mistakes in regeneration specificity. Together, the paper presents compelling experiments and analysis to support the conclusion that cWnt gradients are an important determinant of head/tail identity determination decisions in G. Sinensis, and thereby proposes a plausible model that the notum asymmetry present in S. Mediterranea could act in parallel to support the higher regeneration robustness observed in that species.

      Strengths:

      This is a great paper, an instant classic. It addresses an enduring problem that Morgan and others initiated more than a century ago and brings a new synthesis of ideas to clarify an important mechanism. I also like the term "regeneration specificity" which can provide a nice unification and generalization of ideas that other authors have variously described as regeneration patterning or regeneration polarity. The work is a tour de force that creatively builds new tools and observations to leverage a new model of planarian species for unraveling general mechanisms of regeneration decision-making. The experiments are rigorously conducted and I find the overall data to be quite compelling. I have some comments for the authors to consider below for drawing out the interpretation and also clarifying the underlying mechanism.

      Comments:

      (1) The G. Sinesis species showed accurate head/tail specificity in 2mm thick fragments but was strongly impaired at 1 mm thick. I am assuming that outcomes of pieces greater than 2mm would make similarly robust head/tail choices, implying a rather sharp transition occurring between 1 and 2 mm. In that case, in the gradient model, are there theoretical reasons to predict that polarity outcomes would decline sharply rather than gradually as size thickness decreases? I think the muscle fibers themselves are thought to have lengths on the order of 200 microns, so I wonder what could account for the characteristic length of less than 1mm here? From the lab's prior analysis of beta-cat gradient, is this perhaps the minimal length where a difference in bcat protein levels can be detected? This is not essential to resolve in this draft (in my view), just a very interesting question arising from the present study. Relatedly, it seems that the slope of cWnt at the wound site itself might not be enough information for polarity because at a highly granular level, this should be identical at posterior-facing wounds from trunk fragments versus thin transverse fragments obtained at the same AP position, yet trunk fragments succeed at regeneration specificity whereas thin transverse fragments fail.

      (2) The paper nicely shows strong evidence that notum expression is definitely symmetric at the first occurrence of its expression by 6 hours in D. Sinensis, and this is a really important result of the paper. At 12 hours, it does look to me in the FISH experiments that there is more persistence of expression at the anterior-facing wound versus the posterior-facing wounds (Fig 2D), although the methods for quantification in Fig2E/F do not show a difference in expression at the two wound sites at this time point. Could this difference arise from differences in the perdurance or timing of early wound-induced signaling at the two wound sites that was perhaps too subtle to detect in the quantification methods used? Or perhaps these images do not represent the population? On a related note, the quantification method seems to fail to show that in 6h Smeds, notum expression is indeed asymmetric. Probably the issue here is not the data in the FISH images themselves which strongly support the author's interpretations, but rather a deficiency or limitation of the quantification method used, which should be resolved so that the conclusions from the single FISH images can be interpreted robustly. For example, some authors have used a method of counting notum+ cells and I wonder if this could provide better quantitative information here.

      (3) Given that the double-headed phenotype is observed from thin transverse fragments, ideally, the symmetry of notum could be established to occur in those types of fragments as well. This experiment would clarify that notum is expressed at posterior-facing wounds in the very same types of fragments that undergo the highest levels of mistakes in regeneration specificity.

      (4) Is wnt1 expressed symmetrically at wound sites in this species? It seems there are cases like acoels where wound-induced Wnt activation can occur asymmetrically but through preferential expression of Wnts at posterior-facing wounds, rather than notum. It would be interesting to know although I also think the work the authors already have done in this study itself already constitutes a very comprehensive advance and could be the subject of future work.

      (5) I agree that notum is relatively much more strongly expressed at the far posterior region in D. Senesis than in Smeds, but it does seem from the RNAseq data it also has some locally enriched expression at the anterior pole. Because the RNAseq analysis involves scaling expression across the regions for each gene, it is difficult to know if the anterior expression is relatively lower or perhaps even about the same level of expression as the anterior pole expression of this gene in Smeds. Though not essential to make the desired arguments, in situs on notum in the intact animals would be helpful to clarify this. Relatedly it would be fascinating to know whether D. Senesis notum undergoes anterior-pole expression around the 72 hour or similar timepoint as in Smeds.

      (6) The assessment of beta-catenin gradients was done through protein extractions from whole tissue fragments. However, it has been shown in other planarian species that beta-catenin can have strong tissue-specific expression in, for example, the pharynx, brain, and reproductive systems. Some supporting evidence or argument should be presented to clarify the interpretation that the graded expression observed by western blotting cannot be fully explained by this kind of tissue-specific expression of beta-catenin rather than representing a true signaling gradient as interpreted by the authors. For example, if this antibody could be used in immunostaining, this could support the beta-catenin signaling gradient. Alternatively, information about the location of the pharynx or any other posterior reproductive tissues in D. Sinensis could be calibrated with respect to the fragment bins used for the gradient--perhaps a portion of the C59-dependent body-wide gradient measured here occurs fully within tail tissue that lacks other regionalized tissue that could be a potential additional source of beta-catenin. Further discussion and interpretation, or additional experiments, should be included to rule out alternative confounding sources of beta-catenin in order to clarify the interpretation of the western blot as representing a beta-catenin signaling gradient.

      (7) I find the analysis in Figure 5 to be quite compelling for showing the importance of cWnt/Bcat gradients in contributing to head/tail determination, and I also think that the author's discussion of the limitations of the approach are well articulated and considered. Based on prior literature, it also seems very likely that there is a third redundantly acting component to regeneration specificity, which is the amplification of small differences in cWnt in a directional-dependent manner early in the regeneration process (24-72 hours in Smeds). This would explain why post-amputation with porcupine inhibitor in D. Sinensis caused 100% penetrant defects in regeneration specificity while the pre-treatment paradigm caused a weaker effect (25-40% for larger animals). In Smeds, it is known already that delivery of dsRNAs against beta-catenin-1, wnt1, and notum only after injury caused polarity defects, and thus all three genes certainly have a function relevant for head/tail after injury (Petersen and Reddien 2008, 2009, 2011- please note these experiments were reported in the text of these studies and not in individual figures). This evidence, combined with extensive FISH and complementary RNAi studies in the field, strongly suggests that some combination of the 6-18h injury-induced phase but also very likely the subsequent "pole-specific phase" of wnt1 expression is likely to be important for driving or enacting the tail fate program and is therefore a component of the regeneration specificity mechanism described here.

      (8) Prior work has also demonstrated roles for Wnt genes expressed in gradients to participate in regeneration specificity. In particular, inhibition of the wntP-2/wnt11-5 gene, which is expressed in an animal-wide gradient, strongly enhanced the effects of inhibition of wnt1, which is the earliest wound-activated Wnt gene, to cause 100% penetrant posterior head regeneration phenotypes in S. mediterranea (Petersen and Reddien 2009). These observations are complementary to the present study by implicating Wnts expressed in bodywide gradients in the process of regeneration decision-making. Given that this study also showed that wnt1 is necessary for new wntP-2 expression during the wound-induced early phase and that wnt1 activation does not require beta-catenin for its expression, collectively suggest a more complex process involved in gradient detection and the involvement of wound signals likely beyond only autoregulation of the cWnt gradient or notum asymmetry mechanisms. Although this paper is cited already, framing the present study more fully in context with this and other relevant prior work would be helpful to contextualize the advance for the field.

    3. Reviewer #3 (Public review):

      Summary:

      In this study, the authors revisit the hypothesis of gradient-based polarity specification during planarian regeneration proposed over a century ago, but here they apply molecular techniques and a valuable comparative approach. By using a comparative analysis with classic and modern planarian model organisms, the authors have identified variable molecular mechanisms that different planarian species utilize to ensure that the proper tissues are regenerated following wounding.

      Strengths:

      The comparative approach of using 2 different planarian species allowed the study to elucidate different molecular mechanisms that planarians utilize in re-establishing anterior-posterior axis polarity during regeneration. Without this comparative approach, the mystery of T.H. Morgan's data classic studies that demonstrate mistakes in this axis re-polarization would remain unanswered. Furthermore, the use of both a modern molecular model species and another more classical planarian species, which the authors have fully developed with molecular tools and techniques, sheds light on the diversity of genetic processes that closely related species seem to utilize in regeneration. To dissect the role of a long-hypothesized canonical cWnt signaling gradient, the authors developed a novel strategy using chemical genetics to titer this gradient, which led to phenotypes with enhanced aberrant axis polarity re-establishment. Together these experimental approaches establish a well-supported initial model for explaining the molecular mechanisms that different planarian species utilize to allow for proper regeneration of lost tissues.

      Weaknesses:

      While pharmacological perturbation of signaling pathways could produce off-target effects, the authors provide well-documented evidence that canonical Wnt signaling is altered with drug treatment. The correlation between altered cWnt signaling gradients and the incidence of double-headed regeneration is strong, but it is not clear that the axial cWnt signaling gradient is the ultimate cause of the modified regeneration polarity. However, the model established here and supported by considerable data provides a useful alternative to the mechanism of notum upregulation that has been well-documented in the Schmidtea mediterranea, the workhouse model in planarian research. Throughout the manuscript, the authors suggest that Girardia sinensis lost the ability to upregulate notum at anterior-facing wounds, but until additional planarian species are evaluated, it remains plausible (and equally parsimonious) that S. mediterranea could have innovated a novel strategy to re-establish axis-polarity through asymmetric notum expression.

      The study is very well-designed with considerable confirmation of results, especially in the novel use of the pharmacological inhibitor C59. This study is invaluable in its comparative approach, finding that well-established molecular processes may not explain similar developmental outcomes for different species; this corroborates the need to study additional model organisms and how an evolutionary approach to the study of development is imperative.

    1. Reviewer #1 (Public review):

      Summary:

      The authors analyzed the bacterial colonization of human sperm using 16S rRNA profiling. Patterns of microbiota colonization were subsequently correlated with clinical data, such as spermiogram analysis, presence of reactive oxygen species (ROS), and DNA fragmentation. The authors identified three main clusters dominated by Streptococcus, Prevotella, and Lactobacillus & Gardnerella, respectively, which aligns with previous observations. Specific associations were observed for certain bacterial genera, such as Flavobacterium and semen quality. Overall, it is a well-conducted study that further supports the importance of the seminal microbiota.

      Strengths:

      - The authors performed the analysis on 223 samples, which is the largest dataset in semen microbiota analysis so far

      - Inclusion of negative controls to control contaminations.

      - Inclusion of a positive control group consisting of men with proven fertility.

      [Editors' note: the authors addressed the concerns raised in the previous round of review.]

    1. Reviewer #1 (Public review):

      Summary:

      This work is a continuation of a previous paper from the Arnold group, where they engineered GFE3, which allows to specifically ablate inhibitory synapses. Here, the authors generate 3 different actuators:

      (1) An excitatory synapse ablator.<br /> (2) A photoactivatable inhibitory synapse ablator.<br /> (3) A chemically inhibitory synapse ablator.

      Following initial engineering, the authors present characterization and optimization data to showcase that these new tools allow one to specifically ablate synapses, without toxicity and with specificity. Furthermore, they showcase that these manipulations are reversible.

      Altogether, these new tools would be important for the neuroscience community.

      Strengths:

      The authors convincingly demonstrate the engineering, optimization and characterization of these new probes. The main novelty here is the new excitatory synapse ablator, which has not been shown yet and thus could be a valuable tool for neuroscientists.

      Weaknesses:

      The authors have convincingly demonstrated the use of these tools in cultured neurons. The biggest weakness is the limited information given for the use of these tools for in vivo studies. The authors provide one example of the use of these new tool to study retinal circuits, and show evidence that the excitatory synapse ablator reduces synaptic transmission in retinal slices. Still, more work will be required to use this tool in intact neuronal circuits. It remains unclear if it would be trivial to characterize how well these tools express and operate in vivo. This could be substantially different and present some limitations as to the utility of these tools.

    2. Reviewer #2 (Public review):

      Summary:

      This study introduces a set of genetically encoded tools for the selective and reversible ablation of excitatory and inhibitory synapses. Previously, the authors developed GFE3, a tool that efficiently ablates inhibitory synapses by targeting an E3 ligase to the inhibitory scaffolding protein Gephyrin via GPHN.FingR, a recombinant, antibody-like protein (Gross et al., 2016). Building on this work, they now present three new ablation tools: PFE3, which targets excitatory synapses, and two new versions of GFE3-paGFE3 and chGFE3-that are photoactivatable and chemically inducible, respectively. These tools enable selective and efficient synapse ablation in specific cell types, providing valuable methods for disrupting neural circuits. This approach holds broad potential for investigating the roles of specific synaptic input onto genetically determined cells.

      Strengths:

      The primary strength of this study lies in the rational design and robust validation of each tool's effectiveness, building on previous work by the authors' group (Gross et al., 2016). Each tool serves distinct research needs: PFE3 enables efficient degradation of PSD-95 at excitatory synapses, while paGFE3 and chGFE3 allow for targeted degradation of Gephyrin, offering spatiotemporal control over inhibitory synapses via light or chemical activation. These tools are efficiently validated through robust experiments demonstrating reductions in synaptic markers (PSD-95 and Gephyrin) and confirming reversibility, which is crucial for transient ablation. By providing tools with both optogenetic and chemical control options, this study broadens the applicability of synapse manipulation across varied experimental conditions, enhancing the utility of E3 ligase-based approaches for synapse ablation.

      Weaknesses:

      While this study provides valuable tools and addresses many critical points for varidation, examining potential issues with specificity and background ubiquitination in further detail could strengthen the paper. For PFE3, the study demonstrates reductions in both PSD-95 and GluA1. In their previous work, GFE3 selectively reduced Gephyrin without affecting major Gephyrin interactors or other PSD proteins. Clarifying whether PFE3 affects additional PSD proteins beyond GluA1 would be important for accurately interpreting results in experiments using PFE3. Additionally, further insight into PFE3's impact on inhibitory synapses would be valuable to assess the excitatory specificity and potential for circuit-level applications. For paGFE3 and chGFE3, the E3 ligase (RING domain of Mdm2) is overexpressed and thus freely diffusible within the cell as a separate construct. Although the authors show that Gephyrin is not significantly reduced without light or chemical activation, it remains possible that other proteins, particularly non-synaptic proteins, could be ubiquitinated due to the presence of freely diffusing E3 ligase in cytosol. Addressing these points would clarify the strengths and limitations of tools, providing users with valuable information.

    1. Reviewer #1 (Public review):

      Summary:

      The paper develops a phase method to obtain the excitatory and inhibitory afferents to certain neuron populations in the brainstem. The inferred contributions are then compared to the results of voltage clamp and current clamp experiments measuring the synaptic contributions to post-I, aug-E and ramp-I neurons.

      Strengths:

      The electrophysiology part of the paper is sound and reports novel features with respect to earlier work by JC Smith et al 2012, Paton et al 2022 (and others) who have mapped circuits of the respiratory central pattern generator. Measurements on ramp-I neurons, late-I neurons and two types of post-I neurons in Fig.2 besides measurements of synaptic inputs to these neurons in Fig.5 are to my knowledge new.

      Weaknesses:

      The phase method for inferring synaptic conductances fails to convince. The method rests on many layers of assumptions and the inferred connections in Fig.4 remain speculative. To be convincing, such method ought to be tested first on a model CPG with known connectivity to assess how good it is at inferring known connections back from the analysis of spatio-temporal oscillations. For biological data, once the network connectivity has been inferred as claimed, the straightforward validation is to reconstruct the experimental oscillations (Fig.2) noting that Rybak et al (Rybak, Paton Schwaber J. Neurophysiol. 77, 1994 (1997)) have already derived models for the respiratory neurons.

      The transformation from time to phase space, unlike in the Kuramoto model, is not justified here (L.94) and is wrong. The underpinning idea that "the synaptic conductances depend on the cycle phase and not on time explicitly" is flawed because synapses have characteristic decay times and delays to response which remain fixed when the period of network oscillations increases. Synaptic properties depend on time and not on phase in the network. One major consequence relevant to the present identification of excitatory or inhibitory behaviour, is that it cannot account for change in behaviour of inhibitory synapses - from inhibitory to excitatory action - when the inhibitory decay time becomes commensurable to the period of network oscillations (Wang & Buzsaki Journal of Neuroscience 16, 6402 (1996), van Vreeswijk et al. J. Comp. Neuroscience 1,313 (1994), Borgers and Kopell Neural Comput. 15, 2003). In addition, even small delays in the inhibitory synapse response relative to the pre-synaptic action potential also produce in-phase synchronization (Chauhan et al., Sci. Rep. 8, 11431 (2018); Borgers and Kopell, Neural Comput. 15, 509 (2003)). The present assumption are way too simplistic because you cannot account for these commensurability effects with a single parameter like the network phase. There is therefore little confidence that this model can reliably distinguish excitatory from inhibitory synapses when their dynamics properties are not properly taken into account.

      L..82, Eq.1 makes extremely crude assumptions that the displacement current (CdV/dt) is negligible and that the ion channel currents are all negligible. Vm(t) is also not defined. The assumption that the activation/inactivation times of all ion channels are small compared to the 10-20ms decay time of synaptic currents is not true in general. Same for the displacement current. The leak conductance is typically g~0.05-0.09ms/cm^2 while C~1uF/cm^2. Therefore the ratio C/g leak is in the 10-20ms range - the same as the typical docking neurotransmitter time in synapses.

      Models of brainstem CPG circuits have been known to exist for decades: JC Smith et al 2012, Paton et al 2022, Bellingham Clin. Exp. Pharm. And Physiol. 25, 847 (1998); Rubin et al., J. Neurophysiol. 101, 2146 (2009) among others. The present paper does not discuss existing knowledge on respiratory networks and gives the impression of reinventing the wheel from scratch. How will this paper add to existing knowledge?

      Comments on revisions:

      The authors have done a good job at revising the manuscript to put this work into the context of earlier work on brainstem central pattern generators.

      I still believe the case for the method is not as convincing as it would have been if the method had been validated first on oscillations produced by a known CPG model. Why would the inference of synaptic types from the model CPG voltage oscillations be predetermined? Such inverse problems are quite complicated and their solution is often not unique or sufficiently constrained. Recovering synaptic weights (or CPG parameters) from limited observations of a highly nonlinear system is not warranted (Gutenkunst et al., Universally sloppy parameter sensitivities in systems biology models, PLoS Comp. Biol. 2007; www.doi.org/10.1371/journal.pcbi.0030189) especially when using surrogate biological models like Hodgkin-Huxley models.

      In p.2, the edited section refers to the interspike interval being much smaller than the period of the network. More important is to mention the relationship between the decay time of inhibitory synapses and the period of the network.

    2. Reviewer #2 (Public review):

      Summary:

      By measuring intracellular changes in membrane voltage from a single neuron of the medulla the authors describe a method for determining the balance of excitatory and inhibitory synaptic drive onto a single neuron within this important brain region.

      Strengths:

      This data-driven approach to exploring neural circuits is well described and could be valuable in identifying microcircuits that generate rhythms. Importantly, perhaps, this inference method could enable microcircuits to be studied without the need for time consuming anatomical tracing or other more involved electrophysiological techniques. Therefore, I definitely can see the value in developing an approach of this type.

      Weaknesses:

      There are many assumptions that need to be accepted in order to successfully apply this technique and I was pleased to see that several of these assumption have been explored by the authors in this study.

      For example, this approach involves assuming the reversal potential that is associated with the different permeant ions that underlie the excitation and inhibition as well as the application of Ohms law to estimate the contribution of excitation and inhibitory conductance. My first concern was that this approach relies on a linear I-V relationship between the measured voltage and the estimated reversal potential. However, open rectification is a feature of any I-V relationship generated by asymmetric distributions of ions (see the GHK current equation) and will therefore be a particular issue for the inhibition resulting from asymmetrical Cl- ion gradients across GABA-A receptors. The mixed cation conductance that underlies most synaptic excitation will also generate a non-linear I-V relationship due to the inward rectification associated with polyamine block of AMPA receptors. The authors present evidence that over most of the voltage range examined the I-V relationship is linear and this is a helpful addition.

      This approach has similarities to earlier studies undertaken in the visual cortex that estimated the excitatory and inhibitory synaptic conductance changes that contributed to membrane voltage changes during receptive field stimulation. However, these approaches also involved the recording of transmembrane current changes during visual stimulation that were undertaken in voltage-clamp at various command voltages to estimate the underlying conductance changes. Molkov et al have attempted to essentially deconvolve the underlying conductance changes without this information and I am concerned that this simply may not be possible.

      The current balance equation (1) cited in this study is based upon the parallel conductance model developed by Hodgkin & Huxley. One key element of the HH equations is the inclusion of an estimate of the capacitive current generated due to the change in voltage across the membrane capacitance. While the present study takes into account the impact of membrane capacitance, a deeper discussion on how variations in capacitance across different neuron types might affect inference accuracy would be useful. Differences in capacitance could introduce variability in inferred conductances, potentially influencing model predictions.

      Studies using acute slicing preparations to examine circuit effects have often been limited to the study of small microcircuits - especially feedforward and feedback interneuron circuits. It is widely accepted that any information gained from this approach will always be compromised by the absence of patterned afferent input from outside the brain region being studied. In this study, descending control from the Pons and the neocortex will not be contributing much to the synaptic drive and ascending information from respiratory muscles will also be absent completely. This may not have been such a major concern if this study was limited to demonstrating the feasibility of a methodological approach. However, this limitation does need to be considered when using an approach of this type to speculate on the prevalence of specific circuit motifs within the medulla (Figure 4). Therefore, I would argue that some discussion of this limitation should be included in this manuscript.

    1. Reviewer #1 (Public review):

      Summary

      In this human neuroimaging and electrophysiology study, the authors aimed to characterise effects of a period of visual deprivation in the sensitive period on excitatory and inhibitory balance in the visual cortex. They attempted to do so by comparing neurochemistry conditions ('eyes open', 'eyes closed') and resting state, and visually evoked EEG activity between ten congenital cataract patients with recovered sight (CC), and ten age-matched control participants (SC) with normal sight. First, they used magnetic resonance spectroscopy to measure in vivo neurochemistry from two locations, the primary location of interest in the visual cortex, and a control location in the frontal cortex. Such voxels are used to provide a control for the spatial specificity of any effects because the single-voxel MRS method provides a single sampling location. Using MR-visible proxies of excitatory and inhibitory neurotransmission, Glx and GABA+ respectively, the authors report no group effects in GABA+ or Glx, no difference in the functional conditions 'eyes closed' and 'eyes open'. They found an effect of group in the ratio of Glx/GABA+ and no similar effect in the control voxel location. They then perform multiple exploratory correlations between MRS measures and visual acuity and report a weak positive correlation between the 'eyes open' condition and visual acuity in CC participants. The same participants then took part in an EEG experiment. The authors selected two electrodes placed in the visual cortex for analysis and report a group difference in an EEG index of neural activity, the aperiodic intercept, as well as the aperiodic slope, considered a proxy for cortical inhibition. Control electrodes in the frontal region did not present with the same pattern. They report an exploratory correlation between the aperiodic intercept and Glx in one out of three EEG conditions.

      The authors report the difference in E/I ratio and interpret the lower E/I ratio as representing an adaptation to visual deprivation, which would have initially caused a higher E/I ratio. Although intriguing, the strength of evidence in support of this view is not strong. Amongst the limitations are the low sample size, a critical control cohort that could provide evidence for higher E/I ratio in CC patients without recovered sight for example, and lower data quality in the control voxel. Nevertheless, the study provides a rare and valuable insight into experience-dependent plasticity in the human brain.

      Strengths of study

      How sensitive period experience shapes the developing brain is an enduring and important question in neuroscience. This question has been particularly difficult to investigate in humans. The authors recruited a small number of sight-recovered participants with bilateral congenital cataracts to investigate the effect of sensitive period deprivation on the balance of excitation and inhibition in the visual brain using measures of brain chemistry and brain electrophysiology. The research is novel, and the paper was interesting and well-written.

      Limitations

      Low sample size. Ten for CC and ten for SC, and further two SC participants were rejected due to lack of frontal control voxel data. The sample size limits the statistical power of the dataset and increases the likelihood of effect inflation.

      In the updated manuscript, the authors have provided justification for their sample size by pointing to prior studies and the inherent difficulties in recruiting individuals with bilateral congenital cataracts. Importantly, this highlights the value the study brings to the field while also acknowledging the need to replicate the effects in a larger cohort.

      Lack of specific control cohort. The control cohort has normal vision. The control cohort is not specific enough to distinguish between people with sight loss due to different causes and patients with congenital cataracts with co-morbidities. Further data from a more specific populations, such as patients whose cataracts have not been removed, with developmental cataracts, or congenitally blind participants, would greatly improve the interpretability of the main finding. The lack of a more specific control cohort is a major caveat that limits a conclusive interpretation of the results.

      In the updated version, the authors have indicated that future studies can pursue comparisons between congenital cataract participants and cohorts with later sight loss.

      MRS data quality differences. Data quality in the control voxel appears worse than in the visual cortex voxel. The frontal cortex MRS spectrum shows far broader linewidth than the visual cortex (Supplementary Figures). Compared to the visual voxel, the frontal cortex voxel has less defined Glx and GABA+ peaks; lower GABA+ and Glx concentrations, lower NAA SNR values; lower NAA concentrations. If the data quality is a lot worse in the FC, then small effects may not be detectable.

      In the updated version, the authors have added more information that informs the reader of the MRS quality differences between voxel locations. This increases the transparency of their reporting and enhances the assessment of the results.

      Because of the direction of the difference in E/I, the authors interpret their findings as representing signatures of sight improvement after surgery without further evidence, either within the study or from the literature. However, the literature suggests that plasticity and visual deprivation drives the E/I index up rather than down. Decreasing GABA+ is thought to facilitate experience dependent remodelling. What evidence is there that cortical inhibition increases in response to a visual cortex that is over-sensitised to due congenital cataracts? Without further experimental or literature support this interpretation remains very speculative.

      The updated manuscript contains key reference from non-human work to justify their interpretation.

      Heterogeneity in patient group. Congenital cataract (CC) patients experienced a variety of duration of visual impairment and were of different ages. They presented with co-morbidities (absorbed lens, strabismus, nystagmus). Strabismus has been associated with abnormalities in GABAergic inhibition in the visual cortex. The possible interactions with residual vision and confounds of co-morbidities are not experimentally controlled for in the correlations, and not discussed.

      The updated document has addressed this caveat.

      Multiple exploratory correlations were performed to relate MRS measures to visual acuity (shown in Supplementary Materials), and only specific ones shown in the main document. The authors describe the analysis as exploratory in the 'Methods' section. Furthermore, the correlation between visual acuity and E/I metric is weak, not corrected for multiple comparisons. The results should be presented as preliminary, as no strong conclusions can be made from them. They can provide a hypothesis to test in a future study.

      This has now been done throughout the document and increases the transparency of the reporting.

      P.16 Given the correlation of the aperiodic intercept with age ("Age negatively correlated with the aperiodic intercept across CC and SC individuals, that is, a flattening of the intercept was observed with age"), age needs to be controlled for in the correlation between neurochemistry and the aperiodic intercept. Glx has also been shown to negatively correlates with age.

      This caveat has been addressed in the revised manuscript.

      Multiple exploratory correlations were performed to relate MRS to EEG measures (shown in Supplementary Materials), and only specific ones shown in the main document. Given the multiple measures from the MRS, the correlations with the EEG measures were exploratory, as stated in the text, p.16, and in Fig.4. yet the introduction said that there was a prior hypothesis "We further hypothesized that neurotransmitter changes would relate to changes in the slope and intercept of the EEG aperiodic activity in the same subjects." It would be great if the text could be revised for consistency and the analysis described as exploratory.

      This has been done throughout the document and increases the transparency of the reporting.

      The analysis for the EEG needs to take more advantage of the available data. As far as I understand, only two electrodes were used, yet far more were available as seen in their previous study (Ossandon et al., 2023). The spatial specificity is not established. The authors could use the frontal cortex electrode (FP1, FP2) signals as a control for spatial specificity in the group effects, or even better, all available electrodes and correct for multiple comparisons. Furthermore, they could use the aperiodic intercept vs Glx in SC to evaluate the specificity of the correlation to CC.

      This caveat has been addressed. The authors have added frontal electrodes to their analysis, providing an essential regional control for the visual cortex location.

      Comments on revisions:

      In the first revision, the authors made reasonable adjustments to their manuscript that addressed most of my comments by adding further justification for their methodology, essential literature support, pointing out exploratory analyses, limitations and adding key control analyses. Their revised manuscript was overall improved, providing valuable information, though the evidence that supports their claims is still incomplete.

      In their second revision, the authors pointed to justifications for their analyses, careful interpretation and tempered claims to clarify their response to the initial feedback. However, my assessment of the first revision has not been changed after the second revision, because there were no further modifications of their responses to my feedback.

    2. Reviewer #2 (Public review):

      Summary:

      The study examined 10 congenitally blind patients who recovered vision through the surgical removal of bilateral dense cataracts, measuring neural activity and neuro chemical profiles from the visual cortex. The declared aim is to test whether restoring visual function after years of complete blindness impacts excitation/inhibition balance in the visual cortex. The manuscript reports precious behavioural, electrophysiological and magnetic resonance data from a rare population. Although the findings are useful for stimulating further research in the field, they only provide incomplete support to the authors' claims.

      The main claim is that sight recovery impacts the excitation/inhibition balance in the visual cortex; however, the paradigm does not allow to distinguish the effects of sight recovery from those of visual deprivation (i.e. in patients who were born blind but recovered vision after several months/years vs. patients who were born blind and never recovered vision); moreover, the link between electrophysiological findings and cortical excitation/inhibition is tentative and its interpretation remains speculative.

      Strengths:

      The findings are undoubtedly useful for the community, as they contribute towards characterising the many ways in which this special population differs from normally sighted individuals. The combination of MRS and EEG measures is a promising strategy to estimate a fundamental physiological parameter - the balance between excitation and inhibition in the visual cortex, which animal studies show to be heavily dependent upon early visual experience. Thus, the reported results pave the way for further studies, which may use a similar approach to evaluate more patients and control groups.

      Weaknesses:

      The main methodological limitation is the lack of an appropriate comparison group or condition to delineate the effect of sight recovery (as opposed to the effect of congenital blindness). Few previous studies suggested that Excitation/Inhibition ratio in the visual cortex is increased in congenitally blind patients; the present study reports that E/I ratio decreases instead. The authors claim that this implies a change of E/I ratio following sight recovery. However, supporting this claim would require showing a shift of E/I after vs. before the sight-recovery surgery, or at least it would require comparing patients who did and did not undergo the sight-recovery surgery (as common in the field).

      There are also more technical limitations related to the correlation analyses, which are partly acknowledged in the manuscript. A bland correlation between GLX/GABA and the visual impairment is reported, but this is specific to the patients group (N=10) and would not hold across groups (the correlation is positive, predicting the lowest GLX/GABA ratio values for the sighted controls - opposite of what is found). There is also a strong correlation between GLX concentrations and the EEG power at the lowest temporal frequencies. Although this relation is intriguing, it only holds for a very specific combination of parameters (of the many tested): only with eyes open, only in the patients group.

      Conclusions:

      The main claim of the study is that sight recovery impacts the excitation/inhibition balance in the visual cortex, estimated with MRS or through indirect EEG indices. However, due to the weaknesses outlined above, the study cannot distinguish the effects of sight recovery from those of visual deprivation. Moreover, many aspects of the results are interesting but their validation and interpretation require additional experimental work.

      Comments on revisions:

      The authors' revisions did not substantially alter the manuscript. As such, my assessment above remains unaltered.

    3. Reviewer #3 (Public review):

      Summary:

      This manuscript examines the impact of congenital visual deprivation on the excitatory/inhibitory (E/I) ratio in the visual cortex using Magnetic Resonance Spectroscopy (MRS) and electroencephalography (EEG) in individuals whose sight was restored. Ten individuals with reversed congenital cataracts were compared to age-matched, normally sighted controls, assessing the cortical E/I balance and its interrelationship and to visual acuity. The study reveals that the Glx/GABA ratio in the visual cortex and the intercept and aperiodic signal are significantly altered in those with a history of early visual deprivation, suggesting persistent neurophysiological changes despite visual restoration. First of all, I would like to disclose that I am not an expert in congenital visual deprivation, nor in MRS. My expertise is in EEG (particularly in the decomposition of periodic and aperiodic activity) and statistical methods. Second, although the authors addressed some of my concerns on the previous version of this manuscript, major concerns and flaws remain in terms of methodological and statistical approaches along with the (over) interpretation of the results.

      Persistent specific concerns include:<br /> (1 3.1) Response to Variability in Visual Deprivation<br /> Rather than listing the advantages and disadvantages of visual deprivation, I recommend providing at least a descriptive analysis of how the duration of visual deprivation influenced the measures of interest. This would enhance the depth and relevance of the discussion.

      (2 3.2) Small Sample Size<br /> The issue of small sample size remains problematic. The justification that previous studies employed similar sample sizes does not adequately address the limitation in the current study. I strongly suggest that the correlation analyses should not feature prominently in the main manuscript or the abstract, especially if the discussion does not substantially rely on these correlations. Please also revisit the recommendations made in the section on statistical concerns.

      (3 3.3) Statistical Concerns<br /> While I appreciate the effort of conducting an independent statistical check, it merely validates whether the reported statistical parameters, degrees of freedom (df), and p-values are consistent. However, this does not address the appropriateness of the chosen statistical methods.

      Several points require clarification or improvement:

      (4) Correlation Methods: The manuscript does not specify whether the reported correlation analyses are based on Pearson or Spearman correlation.<br /> This has been addressed in the final revision

      (5) Confidence Intervals: Include confidence intervals for correlations to represent the uncertainty associated with these estimates.<br /> This has been addressed in the final revision

      (6) Permutation Statistics: Given the small sample size, I recommend using permutation statistics, as these are exact tests and more appropriate for small datasets.

      (7) Adjusted P-Values: Ensure that reported Bonferroni corrected p-values (e.g., p > 0.999) are clearly labeled as adjusted p-values where applicable.<br /> This has been addressed in the final revision

      (8) Figure 2C<br /> Figure 2C still lacks crucial information that the correlation between Glx/GABA ratio and visual acuity was computed solely in the control group (as described in the rebuttal letter). Why was this analysis restricted to the control group? Please provide a rationale.

      (9 3.4) Interpretation of Aperiodic Signal<br /> Relying on previous studies to interpret the aperiodic slope as a proxy for excitation/inhibition (E/I) does not make the interpretation more robust.

      (10) Additionally, the authors state:<br /> "We cannot think of how any of the exploratory correlations between neurophysiological measures and MRS measures could be accounted for by a difference e.g. in skull thickness."

      (11) This could be addressed directly by including skull thickness as a covariate or visualizing it in scatterplots, for instance, by representing skull thickness as the size of the dots.

      (12 3.5) Problems with EEG Preprocessing and Analysis<br /> Downsampling: The decision to downsample the data to 60 Hz "to match the stimulation rate" is problematic. This choice conflates subsequent spectral analyses due to aliasing issues, as explained by the Nyquist theorem. While the authors cite prior studies (Schwenk et al., 2020; VanRullen & MacDonald, 2012) to justify this decision, these studies focused on alpha (8-12 Hz), where aliasing is less of a concern compared of analyzing aperiodic signal. Furthermore, in contrast, the current study analyzes the frequency range from 1-20 Hz, which is too narrow for interpreting the aperiodic signal asE/I. Typically, this analysis should include higher frequencies, spanning at least 1-30 Hz oreven 1-45 Hz (not 20-40 Hz).

      (13) Baseline Removal: Subtracting the mean activity across an epoch as a baseline removal step is inappropriate for resting-state EEG data. This preprocessing step undermines the validity of the analysis. The EEG dataset has fundamental flaws, many of which were pointed out in the previous review round but remain unaddressed. In its current form, the manuscript falls short of standards for robust EEG analysis.

      (14) The authors mention: "The EEG data sets reported here were part of data published earlier (Ossandón et al.,2023; Pant et al., 2023)." Thus, the statement "The group differences for the EEG assessments corresponded to those of a larger sample of CC individuals (n=38) " is a circular argument and should be avoided."<br /> The authors addressed this comment and adjusted the statement. However, I do not understand, why the full sample published earlier (Ossandón et al., 2023) was not used in the current study?

      Comments on revisions:

      The current version of the manuscript is almost unchanged compared to the last version. Unfortunately, I observed that the authors have not adequately addressed most of my previous suggestions; rather, they provided justifications for not incorporating them.

      Given this, I do not see the need to modify my initial assessment.

    1. Reviewer #2 (Public review):

      van Vliet and colleagues present results of a study correlating internal states of a convolutional neural network trained on visual word stimuli with evoked MEG potentials during reading.

      In this study, a standard deep learning image recognition model (VGG-11) trained on a large natural image set (ImageNet) that begins illiterate but is then further trained on visual word stimuli, is used on a set of predefined stimulus images to extract strings of characters from "noisy" words, pseudowords and real words. This methodology is used in hopes of creating a model which learns to apply the same nonlinear transforms that could be happening in different regions of the brain - which would be validated by studying the correlations between the weights of this model and neural responses. Specifically, the aim is that the model learns some vector embedding space, as quantified by the spread of activations across a layer's weights (L2 Norm prior to ReLu Activation Function), for the different kinds of stimuli, that creates a parameterized decision boundary that is similar to amplitude changes at different times for a MEG signal. More importantly, the way that the stimuli are ordered or ranked in that space should be separable to the degree we see separation in neural activity. This study does show that the layer weights corresponding to five different broad classes of stimuli do statistically correlate with three specific components in the ERP. However, I believe there are fundamental theoretical issues that limit the implications of the results of this study.

      As has been shown over many decades, there are many potential computational algorithms, with varied model architectures, that can perform the task of text recognition from an image. However, there is no evidence presented here that this particular algorithm has comparable performance to human behavior (i.e. similar accuracy with a comparable pattern of mistakes). This is a fundamental prerequisite before attempting to meaningfully correlate these layer activations to human neural activations. Therefore, it is unlikely that correlating these derived layer weights to neural activity provides meaningful novel insights into neural computation beyond what is seen using traditional experimental methods.

      One example of a substantial discrepancy between this model and neural activations is that, while incorporating frequency weighting into the training data is shown to slightly increase neural correlation with the model, Figure 7 shows that no layer of the model appears directly sensitive to word frequency. This is in stark contrast to the strong neural sensitivity to word frequency seen in EEG (e.g. Dambacher et al 2006 Brain Research), fMRI (e.g. Kronbichler et al 2004 NeuroImage), MEG (e.g. Huizeling et al 2021 Neurobio. Lang.), and intracranial (e.g. Woolnough et al 2022 J. Neurosci.) recordings. Figure 7 also demonstrates that late stages of the model show a strong negative correlation with font size, whereas later stages of neural visual word processing are typically insensitive to differences in visual features, instead showing sensitivity to lexical factors.

      Another example of the mismatch between this model and visual cortex is the lack of feedback connections in the model. Within visual cortex there are extensive feedback connections, with later processing stages providing recursive feedback to earlier stages. This is especially evident in reading, where feedback from lexical level processes feeds back to letter level processes (e.g. Heilbron et al 2020 Nature Comms.). This feedback is especially relevant for reading of words in noisy conditions, as tested in the current manuscript, as lexical knowledge enhances letter representation in visual cortex (the word superiority effect). This results in neural activity in multiple cortical areas varying over time, changing selectivity within a region at different measured time points (e.g. Woolnough et al 2021 Nature Human Behav.), which in the current study is simplified down to three discrete time windows, each attributed to different spatial locations.

      The presented model needs substantial further development to be able to replicate, both behaviorally and neurally, many of the well-characterized phenomena seen in human behavior and neural recordings that are fundamental hallmarks of human visual word processing. Until that point it is unclear what novel contributions can be gleaned from correlating low dimensional model weights from these computational models with human neural data.

      The revised version of this manuscript has not addressed these concerns.

    2. Reviewer #3 (Public review):

      Summary:

      The authors investigate the extent to which the responses of different layers of a vision model (VGG-11) can be linked to the cascade of responses (namely, type-I, type-II and N400) in the human brain when reading words. To achieve maximal consistency between, they add noisy-activations to VGG and finetune it on a character recognition task. In this setup, they observe various similarities between the behavior of VGG and the brain when presented with various transformations of the words (added noise, font modification etc).

      Strengths:<br /> - The paper is well written and well presented<br /> - The topic studied is interesting.<br /> - The fact that the response of the CNN on unseen experimental contrasts such as adding noise correlated with previous results on the brain is compelling.

      Weaknesses:<br /> - The paper is rather qualitative in nature. In particular, the authors show that some resemblance exists between the behavior of some layers and some parts of the brain, but it is hard to quantitively understand how strong the resemblences are in each layer, and the exact impact of experimental settings such as the frequency balancing (which seems to only have a very moderate effect according to figure 5)<br /> - The experiments only consider a rather outdated vision model (VGG)

      Comments on revisions:

      After rebuttal, the authors significantly strengthened their results. I now find the paper much more convincing, and thank the author for their careful consideration of the reviewers' suggestions.

    1. Reviewer #1 (Public review):

      Summary:

      Insects and their relatives are commonly infected with microbes that are transmitted from mothers to their offspring. A number of these microbes have independently evolved the ability to kill the sons of infected females very early in their development; this male killing strategy has evolved because males are transmission dead-ends for the microbe. A major question in the field has been to identify the genes that cause male killing and to understand how they work. This has been especially challenging because most male-killing microbes cannot be genetically manipulated. This study focuses on a male-killing bacterium called Wolbachia. Different Wolbachia strains kill male embryos in beetles, flies, moths, and other arthropods. This is remarkable because how sex is determined differs widely in these hosts. Two Wolbachia genes have been previously implicated in male-killing by Wolbachia: oscar (in moth male-killing) and wmk (in fly male-killing). The genomes of some male-killing Wolbachia contain both of these genes, so it is a challenge to disentangle the two.

      This paper provides strong evidence that oscar is responsible for male-killing in moths. Here, the authors study a strain of Wolbachia that kills males in a pest of tea, Homona magnanima. Overexpressing oscar, but not wmk, kills male moth embryos. This is because oscar interferes with masculinizer, the master gene that controls sex determination in moths and butterflies. Interfering with the masculinizer gene in this way leads the (male) embryo down a path of female development, which causes problems in regulating the expression of genes that are found on the sex chromosomes.

      Strengths:

      The authors use a broad number of approaches to implicate oscar, and to dissect its mechanism of male lethality. These approaches include: a) overexpressing oscar (and wmk) by injecting RNA into moth eggs, b) determining the sex of embryos by staining female sex chromosomes, c) determining the consequences of oscar expression by assaying sex-specific splice variants of doublesex, a key sex determination gene, and by quantifying gene expression and dosage of sex chromosomes, using RNASeq, and d) expressing oscar along with masculinizer from various moth and butterfly species, in a silkmoth cell line. This extends recently published studies implicating oscar in male-killing by Wolbachia in Ostrinia corn borer moths, although the Homona and Ostrinia oscar proteins are quite divergent. Combined with other studies, there is now broad support for oscar as the male-killing gene in moths and butterflies (i.e. order Lepidoptera).

    2. Reviewer #2 (Public review):

      Wolbachia are maternally transmitted bacteria that can manipulate host reproduction in various ways. Some Wolbachia induce male killing (MK), where the sons of infected mothers are killed during development. Several MK-associated genes have been identified in Homona magnanima, including Hm-oscar and wmk-1-4, but the mechanistic links between these Wolbachia genes and MK in the native host are still unclear.

      In this manuscript, Arai et al. show that Hm-oscar is the gene responsible for Wolbachia-induced MK in Homona magnanima. They provide evidence that Hm-Oscar functions through interactions with the sex determination system. They also found that Hm-Oscar disrupts sex determination in male embryos by inducing female-type dsx splicing and impairing dosage compensation. Additionally, Hm-Oscar suppresses the function of Masc. The manuscript is well-written and presents intriguing findings. The results support their conclusions regarding the diversity and commonality of MK mechanisms, contributing to our understanding of the mechanisms and evolutionary aspects of Wolbachia-induced MK.

    1. Joint Public Review:

      Summary:

      Jia and colleagues developed a fluorescence resonance energy transfer (FRET)-based biosensor to study programmed cell death in the zebrafish spinal cord. They applied this tool to study death of zebrafish spinal motor neurons.

      Strengths:

      Their analysis shows that the tool is a useful biosensor of motor neuron apoptosis in living zebrafish and can reveal which part of the neuron undergoes caspase activation first.

      Weaknesses:

      As far as it is possible to tell, the authors focus on death of motor neurons innervating axial muscles. Previous work from over 30 years ago revealed that only a small number of these motor neurons die early in development. So this is not new, although following the cells and learning details of their apoptosis is new. Most of the work on motor neuron death in tetrapods was carried out on limb innervating motor neurons. Zebrafish have paired pectoral and pelvic fins, homologs of tetrapod paired limbs. These fins are innervated by distinct sets of motor neurons in zebrafish, as they are in tetrapods. However, the authors have not focused on these particular motor neurons, and thus have not made a fair comparison with tetrapods. In fact, they do not tell us which spinal levels they observed or whether they have been consistent from animal to animal. Pelvic fins emerge much later than pectoral fins in zebrafish, so it is possible that the time frame during which the authors imaged motor neuron death does not include motor neurons innervating pelvic fins.

    1. Reviewer #1 (Public review):

      Experiments in model organisms have revealed that the effects of genes on heritable traits are often mediated by environmental factors -- so-called gene-by-environment (or GxE) interactions. In human genetics, however, where indirect statistical approaches must be taken to detect GxE, limited evidence has been found for pervasive GxE interactions. The present manuscript argues that the failure of statistical methods to detect GxE may be due to how GxE is modelled (or not modelled) by these methods.

      The authors show, via re-analysis of an existing dataset in Drosophila, that a polygenic 'amplification' model can parsimoniously explain patterns of differential genetic effects across environments. (Work from the same lab had previously shown that the amplification model is consistent with differential genetic effects across the sexes for a number of traits in humans.) The parsimony of the amplification model allows for powerful detection of GxE in scenarios in which it pertains, as the authors show via simulation.

      Before the authors consider polygenic models of GxE, however, they present a very clear analysis of a related question around GxE: When one wants to estimate the effect of an individual allele in a particular environment, when is it better to stratify one's sample by environment (reducing sample size, and therefore increasing the variance of the estimator) versus using the entire sample (including individuals not in the environment of interest, and therefore biasing the estimator away from the true effect specific to the environment of interest)? Intuitively, the sample-size cost of stratification is worth paying if true allelic effects differ substantially between the environment of interest and other environments (i.e., GxE interactions are large), but not worth paying if effects are similar across environments. The authors quantify this trade-off in a way that is both mathematically precise and conveys the above intuition very clearly. They argue on its basis that, when allelic effects are small (as in highly polygenic traits), single-locus tests for GxE may be substantially underpowered.

      The paper is an important further demonstration of the plausibility of the amplification model of GxE, which, given its parsimony, holds substantial promise for the detection and characterization of GxE in genomic datasets. However, the empirical and simulation examples considered in the paper (and previous work from the same lab) are somewhat "best-case" scenarios for the amplification model, with only two environments and with these environments amplifying equally the effects of only a single set of genes. It would be an important step forward to demonstrate the possibility of detecting amplification in more complex scenarios, with multiple environments each differentially modulating the effects of multiple sets of genes. This could be achieved via simulations similar to those presented in the current manuscript.

      Comments on revisions:

      The authors have (with reasonable justification) said that my main recommendations for strengthening the conclusions of the paper are beyond its scope, and they have thoughtfully responded to my (and the other reviewer's) other comments. The paper is now more clearly written---in particular, the connection between the single-locus bias-variance tradeoff calculations and the polygenic results is much more transparent than before. Given that the authors have (again, with fair justification) chosen not to address my major comment, my broad assessment of the paper is unchanged---I think it is an important contribution to a critical topic---and I have no further comments for its improvement (though I note an issue with figure referencing in the captions of Supplementary Figs S2 and S3).

    1. Reviewer #1 (Public review):

      Summary:

      The authors report an inability to reproduce a transgenerational memory of avoidance of the pathogen PA14 in C. elegans. Instead, the authors demonstrate intergenerational inheritance for a single F1 generation, in embryos of mothers exposed to OP50 and PA14, where embryos isolated from these mothers by bleaching are capable of remembering to avoid PA14 in a manner that is dependent on systemic RNAi proteins sid-1 and sid-2. This could reflect systemic sRNAs generated by neuronal daf-7 signaling that are transmitted to F1 embryos. The authors note that transgenerational memory of PA14 was reported by the Murphy group at Princeton, but that environmental or strain variation (worms or bacteria) might explain the single generation of inheritance observed at Harvard. The Hunter group tried different bacterial growth conditions and different worm growth temperatures for independent PA14 strains, which they show to be strongly pathogenic. However, the authors could not reproduce a transgenerational effect at Harvard. This paper honestly alters expectations and indicates that the model that avoidance of PA14 is remembered for multiple generations is not robust enough to be replicated in all laboratories.

      Overall, this paper that demonstrates that one model for transgenerational inheritance in C. elegans is not robust. The author do demonstrate an avoidance memory for F1 embryos that could be a maternal effect, and the authors confirm that this is mediated by a systemic small RNA response. There are several points in the manuscript where a more positive tone might be helpful.

      Strengths:

      The authors note that the high copy number daf-7::GFP transgene used by the Murphy group displayed variable expression and evidence for somatic silencing or transgene breakdown in the Hunter lab, as confirmed by the Murphy group. The authors nicely use single copy daf-7::GFP to show that neuronal daf-7::GFP is elevated in F1 but not F2 progeny with regards to memory of PA14 avoidance, speaking to an intergenerational phenotype.

      The authors nicely confirm that sid-1 and sid-2 are generally required for intergenerational avoidance of F1 embryos of moms exposed to PA14. However, these small RNA proteins did not affect daf-7::GFP elevation in the F1 progeny. This result is unexpected given previous reports that daf-7::GFP is not elevated in F1 progeny of sid mutants.

      The authors studied antisense small RNAs that change in Murphy data sets, identifying 116 mRNAs that might be regulated by sRNAs in response to PA14. The authors show that the maco-1 gene, putatively targeted by piRNAs according to the Kaletsky 2020 paper, displays few siRNAs that change in response to PA14. The authors conclude that the P11 ncRNA of PA14, which was proposed to promote interkingdom RNA communication by the Murphy group, may not affect maco-1 expression in C. elegans, although they did not formally demonstrate this. The authors define 8 genes based on their analysis of sRNAs and mRNAs that might promote resistance to PA14, but they do not further characterize these genes' role in pathogen avoidance. Others might wish to consider following up on these genes and their possible relationship with P11.

      Weaknesses:

      This very thorough and interesting manuscript is at times pugnacious.

      Please explain more clearly what is High Growth media for E. coli in the text and methods, conveying why it was used by the Murphy lab, and if Normal Growth or High Growth is better for intergenerational heritability assays.

      Comments on revisions:

      The authors have done a reasonable job cordially revising this manuscript, and the authors have addressed most reviewer concerns. It is likely that the P11 gene was in some of the PA14 Pseudomonas strains tested, as one was kindly provided by the Murphy group.

    2. Reviewer #2 (Public review):

      This paper examines the reproducibility of results reported by the Murphy lab regarding transgenerational inheritance of a learned avoidance behavior in C. elegans. It has been well established by multiple labs that worms can learn to avoid the pathogen pseudomonas aeruginosa (PA14) after a single exposure. The Murphy lab has reported that learned avoidance is transmittable to 4 generations and dependent on a small RNA expressed by PA14 that elicits the transgenerational silencing of a gene in C. elegans. The Hunter lab now reports that although they can reproduce inheritance of the learned behavior by the first generation (F1), they cannot reproduce inheritance in subsequent generations.

      This is an important study that will be useful for the community. Although they fail to identify a "smoking gun", the study examine several possible sources for the discrepancy, and their findings will be useful to others interested in using these assays. The preference assay appears to work in their hands in as much as they are able to detect the learned behavior in the P0 and F1 generations, suggesting that the failure to reproduce the transgenerational effect is not due to trivial mistakes in the protocol. The authors provide a full protocol and highlight key deviations from the Murphy lab protocol. The authors provide good evidence that no single protocol modification was sufficient on its own to explain the divergent results. It remains possible that protocol differences affected the assay cumulatively or that other uncontrolled factors were responsible. Nevertheless, the authors provide good evidence that the trans-generational effect reported by the Murphy lab lacks experimental robustness, calling into question its ecological relevance in the wild.

    3. Reviewer #3 (Public review):

      Summary:

      It has been previously reported in many high-profile papers, that C. elegans can learn to avoid pathogens. Moreover, this learned pathogen avoidance can be passed on to future generations - up to the F5 generation in some reports. In this paper, Gainey et al. set out to replicate these findings. They successfully replicated pathogen avoidance in the exposed animals, as well as a strong increase in daf-7 expression in ASI neurons in F1 animals, as determined by a daf-7::GFP reporter construct. However, they failed to see strong evidence for pathogen avoidance or daf-7 overexpression in the F2 generation. The failure of replication is the major focus of this work.<br /> Given their failure to replicate these findings, the authors embark on a thorough test of various experimental confounders that may have impacted their results. They also re-analyze the small RNA sequencing and mRNA sequencing data from one of the previously published papers and draw some new conclusions, extending this analysis.

      Strengths:

      • The authors provide a thorough description of their methods, and a marked-up version of a published protocol that describes how they adapted the protocol to their lab conditions. It should be easy to replicate the experiments.

      • The authors test source of bacteria, growth temperature (of both C. elegans and bacteria), and light/dark husbandry conditions. They also supply all their raw data, so that sample size for each testing plate can be easily seen (in the supplementary data). None of these variations appears to have a measurable effect on pathogen avoidance in the F2 generation, with all but one of the experiments failing to exhibit learned pathogen avoidance.

      • The small RNA seq and mRNA seq analysis is well performed and extends the results shown in the original paper. The original paper did not give many details of the small RNA analysis, which was an oversight. Although not a major focus of this paper, it is a worthwhile extension on the previous work.

      • It is rare that negative results such as these are accessible. Although the authors were unable to determine the reason that their results differ from those previously published, it is important to document these attempts in detail, as has been done here. Behavioral assays are notoriously difficult to perform and public discourse around these attempts may give clarity to the difficulties faced by a controversial field.

      Weaknesses:

      • Although the "standard" conditions have been tested over multiple biological replicates, many of the potential confounders that may have altered the results have been tested only once or twice. For example, changing the incubation temperature to 25{degree sign}C was tested in only two biological replicates (Exp 5.1 and 5.2) - and one of these experiments actually resulted in apparent pathogen avoidance inheritance in the F2 generation (but not in the F1). An alternative pathogen source was tested in only one biological replicate (Exp 3). Given the variability observed in the F2 generation, increasing biological replicates would have added to the strengths of the report.

      • A key difference between the methods used here and those published previously, is an increase in the age of the animals used for training - from mostly L4 to mostly young adults. I was unable to find a clear example of an experiment when these two conditions were compared, although the authors state that it made no difference to their results.

      • The original paper reports a transgenerational avoidance effect up to the F5 generation. Although in this work the authors failed to see avoidance in the F2 generation, it would have been prudent to extend their tests for more generations in at least a couple of their experiments to ensure that the F2 generation was not an aberration (although this reviewer acknowledges that this seems unlikely to be the case).

    1. Reviewer #2 (Public review):

      Summary:

      The authors reported that mutations were identified in the ZC3H11A gene in four adolescents from 1015 high myopia subjects in their myopia cohort. They further generated Zc3h11a knockout mice utilizing the CRISPR/Cas9 technology.

      Comments on revisions:

      Chong Chen and colleagues revised the manuscript; however, none of my suggestions from the initial review have been sufficiently addressed.

      (1) I indicated that the pathogenicity and novelty of the mutation need to be determined according to established guidelines and databases. However, the conclusion was still drawn without sufficient justification.<br /> (2) The phenotype of heterozygous mutant mice is too weak to support the gene's contribution to high myopia. The revised manuscript does not adequately address these discrepancies. Furthermore, no explanation was provided for why conditional gene deletion was not used to avoid embryonic lethality, nor was there any discussion on tissue- or cell-specific mechanistic investigations.<br /> (3) The title, abstract, and main text continue to misrepresent the role of the inflammatory intracellular PI3K-AKT and NF-κB signaling cascade in inducing high myopia. No specific cell types have been identified as contributors to the phenotype. The mice did not develop high myopia, and no relationship between intracellular signaling and myopia progression has been demonstrated in this study.

    2. Reviewer #3 (Public review):

      Chen et al have identified a new candidate gene for high myopia, ZC3H11A, and using a knock-out mouse model, have attempted to validate it as a myopia gene and explain a potential mechanism. They identified 4 heterozygous missense variants in highly myopic teenagers. These variants are in conserved regions of the protein, and predicted to be damaging, but the only evidence the authors provide that these specific variants affect protein function is a supplement figure showing decreased levels of IκBα after transfection with overexpression plasmids (not specified what type of cells were transfected). This does not prove that these mutations cause loss of function, in fact it implies they have a gain-of-function mechanism. They then created a knock-out mouse. Heterozygotes show myopia at all ages examined but increased axial length only at very early ages. Unfortunately, the authors do not address this point or examine corneal structure in these animals. They show that the mice have decreased B-wave amplitude on electroretinogram (a sign of retinal dysfunction associated with bipolar cells), and decreased expression of a bipolar cell marker, PKCα. On electron microscopy, there are morphologic differences in the outer nuclear layer (where bipolar, amacrine, and horizontal cell bodies reside). Transcriptome analysis identified over 700 differentially expressed genes. The authors chose to focus on the PI3K-AKT and NF-κB signaling pathways and show changes in expression of genes and proteins in those pathways, including PI3K, AKT, IκBα, NF-κB, TGF-β1, MMP-2 and IL-6, although there is very high variability between animals. They propose that myopia may develop in these animals either as a result of visual abnormality (decreased bipolar cell function in the retina) or by alteration of NF-κB signaling. These data provide an interesting new candidate variant for development of high myopia, and provide additional data that MMP2 and IL6 have a role in myopia development. For this revision, none of my previous suggestions have been addressed.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Arimura et al describe MagIC-Cryo-EM, an innovative method for immune-selective concentrating of native molecules and macromolecular complexes for Cryo-EM imaging and single-particle analysis. Typically, Cryo-EM imaging requires much larger concentrations of biomolecules than those that are feasible to achieve by conventional biochemical fractionation. This manuscript is meticulously and clearly written and the new technique is likely to become a great asset to other electron microscopists and chromatin researchers.

      Strengths:

      Previously, Arimura et al. (Mol. Cell 2021) isolated from Xenopus extract and resolved by Cryo-EM a sub-class of native nucleosomes conjugated containing histone H1.8 at the on-dyad position, similar to that previously observed by other researchers with reconstituted nucleosomes. Here they sought to analyze immuno-selected nucleosomes aiming to observe specific modes of H1.8 positioning (e.g. on-dyad and off-dyad) and potentially reveal structural motifs responsible for the decreased affinity of H1.8 for the interphase chromatin compared to metaphase chromosomes. The main strength of this work is a clever and novel methodological design, in particular the engineered protein spacers to separate captured nucleosomes from streptavidin beads for clear imaging. The authors provide a detailed step-by-step description of MagIC-Cryo-EM procedure including nucleosome isolation, preparation of GFP nanobody attached magnetic beads, optimization of the spacer length, concentration of the nucleosomes on graphene grids, data collection and analysis, including their new DUSTER method to filter-out low signal particles. This tour de force methodology should facilitate the consideration of MagIC-Cryo-EM by other electron microscopists, especially for analysis of native nucleosome complexes.<br /> In pursuit of biologically important new structures, the immune-selected H1.8-containing nucleosomes were solved at about 4A resolution; their structure appears to be very similar to the previously determined structure of H1.8-reconstituted nucleosomes. There were no apparent differences between the metaphase and interphase complexes suggesting that the on-dyad and off-dyad positioning does not explain the differences in H1.8 - nucleosome binding. However, they were able to identify and solve complexes of H1.8-GFP with histone chaperone NPM2 in a closed and open conformation providing mechanistic insights for H1-NPM2 binding and the reduced affinity of H1.8 to interphase chromatin as compared to metaphase chromosomes.

      MagIC technique still has certain limitations resulting from formaldehyde fixation, use of bacterial-expressed recombinant H1.8-GFP, and potential effects of magnetic beads and/or spacer on protein structure, which are explicitly discussed in the text. Notwithstanding these limitations, MagIC-Cryo-EM is expected to become a great asset to other electron microscopists and biochemists studying native macromolecular complexes.

      Comments on revisions:

      In the revision, Arimura et al. have constructively addressed the reviewer's concerns, by discussing possible limitations and including additional information on proteomic analysis and H1.8-NPM2 structures.<br /> The revised manuscript and rebuttal letter strengthen my initial opinion that this paper describes an innovative method for immune-selective concentrating of native molecules and macromolecular complexes thus enabling Cryo-EM imaging and structural analysis of native nucleosome complexes at low concentration. This manuscript is meticulously and clearly written and may become a great asset to other electron microscopists and chromatin researchers

    2. Reviewer #2 (Public review):

      Summary:

      The authors present a straightforward and convincing demonstration of a reagent and workflow that they collectively term "MagIC-cryo-EM", in which magnetic nanobeads combined with affinity linkers are used to specifically immobilize and locally concentrate complexes that contain a protein-of-interest. As a proof of concept, they localize, image, and reconstruct H1.8-bound nucleosomes reconstructed from frog egg extracts. The authors additionally devised an image-processing workflow termed "DuSTER", which increases the true positive detections of the partially ordered NPM2 complex. The analysis of the NPM2 complex {plus minus} H1.8 was challenging because only ~60 kDa of protein mass was ordered. Overall, single-particle cryo-EM practitioners should find this study useful.

      Strengths:

      The rationale is very logical and the data are convincing.

      Weaknesses:

      I have seen an earlier version of this study at a conference. The conference presentation was much easier to follow than the current manuscript. It is as if this manuscript had undergone review at another journal and includes additional experiments to satisfy previous reviewers. Specifically, the NPM2 results don't seem to add much to the main story (MagIC-cryo-EM) and read more like an addendum. The authors could probably publish the NPM2 results separately, which would make the core MagIC results (sans DusTER) easier to read.

      Comments on revisions:

      The authors have addressed my concerns. Congratulations!

    1. Reviewer #1 (Public review):

      Summary:

      The major result in the manuscript is the observation of the higher order structures in a cryoET reconstruction that could be used for understanding the assembly of toroid structures. The cross-linking ability of ZapD dimers result in bending of FtsZ filaments to a constant curvature. Many such short filaments are stitched together to form a toroid like structure. The geometry of assembly of filaments - whether they form straight bundles or toroid like structures - depends on the relative concentrations of FtsZ and ZapD.

      Strengths:

      In addition to a clear picture of the FtsZ assembly into ring-like structures, the authors have carried out basic biochemistry and biophysical techniques to assay the GTPase activity, the kinetics of assembly, and the ZapD to FtsZ ratio.

      Weaknesses:

      The discussion does not provide an overall perspective that correlates the cryoET structural organisation of filaments with the biophysical data. The current version has improved in terms of addressing this weakness and clearly states the lacuna in the model proposed based on the technical limitations.

      Future scope of work includes the molecular basis of curvature generation and how molecular features of FtsZ and ZapD affect the membrane binding of the higher order assembly.

    2. Reviewer #3 (Public review):

      Summary:

      Previous studies have analyzed the binding of ZapD to FtsZ and provided images of negatively stained toroids and straight bundles, where FtsZ filaments are presumably crosslinked by ZapD dimers. Toroids without ZapD have also been previously formed by treating FtsZ with crowding agents. The present study is the first to apply cryoEM tomography, which can resolve the structure of the toroids in 3D. This shows a complex mixture of filaments and sheets irregularly stacked in the Z direction and spaced radially. The most important interpretation would be to distinguish FtsZ filaments from ZapD crosslinks, This is less convincing. The authors seem aware of the ambiguity: "However, we were unable to obtain detailed structural information about the ZapD connectors due to the heterogeneity and density of the toroidal structures, which showed significant variability in the conformations of the connections between the filaments in all directions." Therefore, the reader may assume that the crosslinks identified and colored red are only suggestions, and look for their own structural interpretations. But readers should also note some inconsistencies in stoichiometry and crosslinking arrangements that are detailed under "weaknesses."

      Strengths.

      This is the first cryoEM tomography to image toroids and straight bundles of FtsZ filaments bound to ZapD. A strength is the resolution, which. at least for the straight bundles. is sufficient to resolve the ~4.5 nm spacing of ZapD dimers attached to and projecting subunits of an FtsZ filament. Another strength is the pelleting assay to determine the stoichiometry of ZapD:FtsZ (although this also leads to weaknesses of interpretation).

      Weaknesses

      The stoichiometry presents some problems. Fig. S5 uses pelleting to convincingly establish the stoichiometry of ZapD:FtsZ. Although ZapD is a dimer, the concentration of ZapD is always expressed as that of its subunit monomers. Fig. S5 shows the stoichiometry of ZapD:FtsZ to be 1:1 or 2:1 at equimolar or high concentrations of ZapD. Thus at equimolar ZapD, each ZapD dimer should bridge two FtsZ's, likely forming crosslinks between filaments. At high ZapD, each FtsZ should have it's own ZapD dimer. However, this seems contradicted by later statements in Discussion and Results. (1) "At lower concentrations of ZapD, .. toroids are the most prominent structures, containing one ZapD dimer for every four to six FtsZ molecules." Shouldn't it be one ZapD dimer for every two FtsZ? (2) "at the high ZapD concentration...a ZapD dimer binds two FtsZ molecules connecting two filaments." Doesn't Fig. S5 show that each FtsZ subunit has its own ZapD dimer? And wouldn't this saturate the CTD sites with dimers and thus minimize crosslinking?

      A major weakness is the interpretation of the cryoEM tomograms, specifically distinguishing ZapD from FtsZ. The distinction of crosslinks seems based primarily on structure: long continuous filaments (which often appear as sheets) are FtsZ, and small masses between filaments are ZapD. The density of crosslinks seems to vary substantially over different parts of the figures. More important, the density of ZapD's identified and colored red seem much lower than the stoichiometry detailed above. Since the mass of the ZapD monomer is half that of FtsZ, the 1:1 stoichiometry in toroids means that 1/3 of the mass should be ZapD and 2/3 FtsZ. However, the connections identified as ZapD seem much fewer than the expected 1/3 of the mass. The authors conclude that connections run horizontally, diagonally and vertically, which implies no regularity. This seems likely, but as I would suggest that readers need to consider for themselves what they would identify as a crosslink.

      In contrast to the toroids formed at equimolar FtsZ and ZapD, thin bundles of straight filaments are assembled in excess ZapD. Here the stoichiometry is 2:1, which would mean that every FtsZ should have a bound ZapD DIMER. The segmentation of a single filament in Fig. 5e seems to agree with this, showing an FtsZ filament with spikes emanating like a picket fence, with a 4.5 nm periodicity. This is consistent with each spike being a ZapD dimer, and every FtsZ subunit along the filament having a bound ZapD dimer. But if each FtsZ has its own dimer, this would seem to eliminate crosslinking. The interpretative diagram in Fig. 6, far right, which shows almost all ZapD dimers bridging two FtsZs on opposite filaments, would be inconsistent with this 2:1 stoichiometry.

      In the original review I suggested a control that might help identify the structures of ZapD in the toroids. Popp et al (Biopolymers 2009) generated FtsZ toroids that were identical in size and shape to those here, but lacking ZapD. These toroids of pure FtsZ were generated by adding 8% polyvinyl chloride, a crowding agent. The filamentous substructure of these toroids in negative stain seemed very similar to that of the ZapD toroids here. CryoET of these toroids lacking ZapD might have been helpful in confirming the identification of ZapD crosslinks in the present toroids. However, the authors declined to explore this control.

      Finally, it should be noted that the CTD binding sites for ZapD should be on the outside of curved filaments, the side facing the membrane in the cell. All bound ZapD should project radially outward, and if it contacted the back side of the next filament, it should not bind (because the CTD is on the front side). The diagram second to right in Fig. 6 seems to incorporate this abortive contact.