7,251 Matching Annotations
  1. Apr 2023
    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This interesting, well written paper uses cutting edge technologies to address the evolutionary dynamics of changes in Leishmania donovani genomes in response to high drug pressure. Using single-cell genome sequencing and lineage tracing with a newly adapted cell barcoding system, the authors were able to follow aneuploid changes and lineage selection following exposures to high concentrations of either antimony or miltefosine. The main conclusions drawn from the careful bioinformatic analyses and methodic representation of 864 single cell genomes and 453 different traceable lineages were that for each drug exposure there was polyclonal selection of pre-adapted parasites complemented by de novo adaptions. Consistent changes in aneuploidy were associated with the populations selected by antimony, while miltefosine selected for populations that had a point mutation in a miltefosine transporter gene. These conclusions are well supported by the data.

      Significance

      One general comment is that the contribution of pre-adapted lineages to the emergence of drug resistant populations under conditions of natural exposure is apt to be overstated from the current analysis. As the authors discuss, the L. donovani line used is already pre-adapted to resist antimony due, at least in part, to the amplification of the MRPA gene on chromosome 23. So it is expected that lineages adapted to strong antimony pressure will pre-exist in this line. It seems possible that the de novo adaptions that were observed, involving further copy number amplification of chromosome 23 and other chromosomes (eg chr 31), might be facilitated by their pre-existing aneuploides. Thus the evolutionary dynamics observed might be very particular to these sorts of pre-conditioned cells. It should also be discussed that the culture condtions themselves may pre-condition the parasites for antimony resistance (and possibly other drugs). Continuous passage of L. donovani in axenic culture produced consistent patterns of aneuploid changes, including amplification of Chr 23 (Barja et al., Nat Ecol evol, 2017). Thus a potential caveat of the use of cultured promastigotes is that their culture adaptions might involve genes on the same chromosomes that confer drug resistance.<br /> For the miltefosine selection, of the 7 lineages surviving in at least one of the MePOP replicates, only lineage 302 is represented more than once. What is the evidence that the adaptive mutations in the other 6 lineages were pre-existing and did not arise de novo?

      Figs 3b and 3c are incorrectly referenced in the text.

      Discussion p. 8 - "Interestingly, the Gly160Asp mutation also correlated with the frequency of a specific lineage (lineage 27) and appeared in 3 of the 4 MePOPs, indicating that this was a pre-existing mutation found in that lineage." Lineage 302 would appear to be the correct lineage, not 27. Please clarify.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Negreira et al. present a study that aims to understand the early evolution of aneuploidy. They use Leishmania, a protozoon parasite known for its genome plasticity, as model, and two drugs as stress inducers. In this work, they use single-cell genomics and lineage tracing to detect changes in chromosome copy numbers. They conclude that, although parasites tend to have genomes with unusual plasticity, aneuploidy dynamics depend on the stressor more than the organism.

      Further experiments:

      Lines 121-124: I believe the authors should corroborate the statement that expansion of lineages that were fitter prior to drug exposure is stochastically by doing a statistical test comparing their obtained data and randomly generated simulated values. Given that there is still a considerable proportion of lineages with higher fitness and found in more than one passage, I believe this experiment/test would add strength to the conclusion.

      Minor issues:

      Fig. 1B: Add label to top horizontal axis, showing frequency of each karyotype. Lines 92-96: Could the authors postulate how and why pre-existing aneuploid cells seem to be selected upon SbIII exposure? Fig. 3: Are panels B and C swapped in the figure or the reference swapped in the text? Fig. 3C seems to refer to the mutation (lines 173-179), whereas Fig. 3B seems to relate to the surviving lineages (lines 183-186). Lines 94-97: Could the authors comment on the advantages and disadvantages of such an aggressive selection method? I am not surprised with such a drastic decrease in lineage diversity in this context.

      Could the authors elaborate on what is different in chromosome 31 that makes it so prone to change?

      Significance

      Aneuploidy can be well-tolerated, beneficial, or deleterious. Particularly, they can confer resistance against environment stresses, including drug pressures. This study aims to understand how aneuploidy arises. The authors approach this question using a model organism, Leishmania donovani, and two distinct drugs as environmental stressors. Using single-cell DNA sequencing and lineage tracing, the authors find that the appearance of aneuploidy is dependent on the drug used, which makes it dependent on the environmental stressor, rather than pre-determined. Importantly, they present a new barcoding method that may be useful to the field of experimental genome evolution.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Negreira et al. have studied aneuploidy in Leishmania selected using a "flash selection" with SbIII or miltefosine (MF). They provided evidence for the SbIII arm that a few parasites in the population with a specific genotype were enriched during drug selection, and these selected parasites with continuous drug pressure further present modifications in their ploidy. For MF selection they show a different scenario where first a minor population with a mutation in the MT gene is selected and with further passages with drugs, parasites with changes in ploidy are further enriched.

      Here are some comments that hopefully will be helpful for the authors.

      The plasticity of the Leishmania genome is fascinating. It is remarkable that these parasites can tolerate so many and frequent changes in ploidy. Either these changes are stochastic and serendipitous or as convey by the authors are part of the parasite arsenal to respond to a changing environment. They cleverly used single cell sequencing and bar-coded parasites in this well designed and well conducted study to assess the role of ploidy in parasite biology.

      1. Drugs are not inducing any of the changes observed, instead the drugs are selecting for parasites with different genotypes (e.g. polyploidy of chromosome 23 for SbIII or parasites with mutations in MT). This is an important conceptual difference and the authors need to change their text throughout starting at line 28.
      2. Line 170. Its is probably expected that no cells have increased copy of chromosome 23, 27 and 31 after single cell genomics. None of the first passages of the four SePOP are polyploid for chromosome 27. One possibility is that a subpopulation of cells with increased copy of chr. 23 (because of MRPA?) and 31 (because of ?) are first selected and in subsequent passages cells triploid for 27 are selected. Of note the ploidy of chr. 27 appears to decrease from passage 4 to 5 in SePOP1 which is unusual if the drug pressure is maintained.
      3. Lane 194. I agree with the concept of the selection of pre-existing aneuploid cells but the additional somy changes observed are, in my opinion, just selected because these changes occur continuously.
      4. Their barcoded strategy was interesting but it would appear that different lineages are enriched in the 4 SePOP. It would be of interest to test whether those lineages have similar ploidy at the onset. I am unclear of why they have to amplify the barcode prior sequencing. Could they just not get this info from the SePOP data; it is my understanding that the drug selection was done with the barcoded population. This would have facilitated the correlation barcode-specific ploidy.
      5. The MF screen was harsh and the parasites selected (derived from few clones within the population when considering the time needed to expand) contained SNPs in MT. Difficult to compare the two screens. Passages with higher MF concentration led to major changes in ploidy but with few common features between the MePOP lines.
      6. I am not asking for extra work but as a suggestion to help in linking ploidy with phenotype it would have been very interesting to look at 5 passages without drug (SbIII or miltefosine) to see whether a decrease in ploidy is correlated to a decrease in resistance.

      Minor points

      1. The environment studied (high drug pressure) is unlikely to occur in nature. The authors may wish to comment on how this may translate in the sand fly or in animals.
      2. In Fig. S2 MRPA in SePOP1 is a signature of extrachromosomal amplification. Was that studied?
      3. For Chromosome 31 in the Sb screen, it would appear that the proximal (left) part is of lower copy number than the distal (right) portion of the chromosome. How could this have happened? Deletion of a portion of chromosome 31 for one allele? This has been described before (Mukherjee et al., 2013) in SbIII resistant lines as one telomeric end of Chr. 31 encodes AQP1, the route of entry of SbIII.

      Significance

      The plasticity of the Leishmania genome is fascinating. It is remarkable that these parasites can tolerate so many and frequent changes in ploidy. Either these changes are stochastic and serendipitous or as convey by the authors are part of the parasite arsenal to respond to a changing environment. They cleverly used single cell sequencing and bar-coded parasites in this well designed and well conducted study to assess the role of ploidy in parasite biology.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank all reviewers for their comments and suggestions. The revised manuscript included new experiments they suggested and extensive text edits. Our point-by-point response is shown in bold.

      Point-by-point description of the revisions

      —----------------------------------------------------------------------------------------------------------------

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary

      In this manuscript, Blank et al. propose a link between cell-cycle dependent changes in metabolic flux and corresponding changes in TORC1 activity in yeast cells. Based on their findings, the authors propose that Bat1-dependent leucine synthesis from glucose increases as cells progress through G1 and that this activates TORC1 to drive cell cycle progression. Although the existence of cell-cycle dependent synthesis of leucine is a novel and exciting finding, several aspects of the proposed model are not sufficiently supported by experimental evidence, in particular the fact that the increase in Leu synthesis is causing the increase in TORC1 activity in late G1.

      Major comments:

      1. To show that the increase in Leu biosynthesis in S-phase is activating TOR, one would ideally want to blunt this increase in biosynthesis and assay TORC1 activity. Admittedly, this is difficult. So, instead, the authors study bat1- cells which have strongly impaired synthesis of BCAA including Leucine. The relevance of these bat1- cells to the proposed cell-cycle dependent model, however, is questionable for two reasons: 1) Although the authors state that "exogenous supplementation of BCAAs in all combinations suppressed the growth defect of bat1- cells, especially when valine was present", the spot assays in Figure 3 show visible rescues only when valine is present either alone or in combination, while supplementation of leucine or isoleucine does not seem to have any effect. Hence it appears that the bat1- phenotype is mainly due to limiting valine levels, not leucine levels. 2) The relevance of these results for understanding TORC1 regulation are questionable, since valine does not typically activate TORC1. Does addition of Leu to bat1- cells increase TORC1 activity ? RESPONSE: The reviewer’s comments were very valuable. We performed the suggested experiments (adding not only Leu but also Ile and Val) to bat1 cells and measuring phosphorylation of Rps6 (see new Figure 4D) and the DNA content of those cells (see new Figure 3C). We found that Leu weakly promotes cell cycle progression, compared to the addition of Val, which also leads to pronounced activation of TORC1 (>10-fold activation; see Figure 4D). We discuss these findings in the revised text.

      We also note, as published by others and now discussed in the text, that in WT cells, exogenous addition of Leu (or any other BCAA) does not lead to sustained activation of TORC1 (see new Figure 4D). This is not surprising. As reported by the Hall lab (see PMID: 25063813, which we now cite), the Gtr-dependent activation of TORC1 by BCAAs mentioned by the reviewer is very transient. Hence, our new data, showing sustained TORC1 activation and cell cycle effects upon Val addition in bat1 cells, is exciting. They argue that bat1 cells serve as a highly sensitized background of low TORC1 activity, enabling the display of effects that are difficult to measure in WT cells.

      TORC1 activity is known to depend on steady-state leucine concentrations in the cell rather than on leucine flux. Although the authors observe that the synthesis rate of leucine increases during G1 progression, this does not necessarily translate into increased leucine concentrations in the cell. To support the claim that the increase in TORC1 activity during G1 progression depends on leucine, the authors would need to show that, not only leucine synthesis, but also overall leucine levels in the cell increase during G1 progression.

      RESPONSE: We did this experiment and now report the data (see new Figure EV2), using the Edman degradation-based assay. We found that changes in the steady-state levels of BCAAs had a similar pattern, and those changes were most significant for valine (rising 30-40% from late G1 to G2/M). Nonetheless, we note also that the kinetics of amino acid synthesis measured by our isotope tracing experiment need not match the steady-state levels of amino acids. Steady-state levels are affected by a multitude of parameters, only one of which is the rate of synthesis, as we now discuss in detail in the manuscript.

      To test whether the increase in Leu biosynthesis in S-phase activates TORC1, a few different approaches could be tested: 1) Since leucine activates TORC1 through the Gtr proteins, the authors could test whether rendering TORC1 resistant to low leucine through expression of constitutively active Gtrs abolishes the cell-cycle dependence in TORC1 activity. 2) Leu could be added to the medium of wildtype cells in G1 to the amount necessary to cause an increase in intracellular Leu levels similar to those seen in S-phase to test whether this increases TORC1 activity.

      RESPONSE: We did the suggested experiments, which are now shown in the new Figure 5. Leucine and valine accelerated the rise in TORC1 activity in G1. However, there were no noticeable downstream consequences in the kinetics of cell cycle progression. As we discuss in the text:

      “A small acceleration of the rise in the levels of phosphorylated Rps6 was evident in both the leucine- and valine supplemented cells (Figure 5A,B). Nonetheless, there were no noticeable downstream consequences in the kinetics of cell cycle progression, in either the rate the cells increased in size or their critical size (Figure 5A; see values above the corresponding blots), consistent with the notion that TORC1 activity already is at a maximal level in these conditions…”

      In Fig 2B one sees that Leu biosynthesis peaks at 150min and then drops again. The p-RpS6 blot in Fig. 5D, however, only goes up to 140 min and shows that TORC1 activity increases up to 140 min, but it doesn't show timepoints beyond 150 min when Leu biosynthesis drops again, and hence one would expect TORC1 activity to drop. If TORC1 activity were to drop from 150min onwards, this would strengthen the correlation between Leu biosynthesis and TORC1 activity.

      RESPONSE: The reason for the drop in Figure 2 is trivial and does not affect the interpretation. As seen in Figure 1 (the experiment from which the data in Figure 2 are shown), by 180 min, the cells were entering a new cell cycle, evidenced by a reduction in cell size (Figure 1B) and in the fraction of budded cells (Figure 2B). At that point, there is a mix of mothers and daughters with very poor synchrony, making it impossible to conclude much about the drop in Leu synthesis (i.e., does it arise from the lack of new synthesis in mothers, daughters, or both?). In the experiment in Figure 5, the reviewer mentions (now those figures have moved to File S8 because we added more experiments in the figure) the experiment terminated when peak budding was reached, which was 140 min, within one cell cycle. Lastly, it is important to stress that every elutriation experiment is different. While the times are close, comparing various experiments on a time basis alone is inaccurate. Instead, the metric used in the field to compare different experiments is usually cell size, which we use in all other Figures except Figure 1 because, in that case, the experiment was a time-based, pulse-chase one.

      Minor concerns:

      1. In Figure EV4, the authors should highlight some of the metabolites that are significantly changed, in particular the BCAA. The figure is not very informative as currently presented. __RESPONSE: We have now labeled the BCAAs, and a few more metabolites as suggested (note the Figure is now EV5). __

      Fig 2 - are "expressed ratios" the best term for metabolite levels? Unlike genes, where such heat maps are often used, the metabolites are not 'expressed'. How about 'relative metabolite level' instead?

      RESPONSE: Good point. The axis now reads “relative abundance”.

      Page 8: "We also measured the MID values from the media of the same cultures used to prepare the cell extracts." Where are these data? We don't see them in File S2?

      RESPONSE: The data are in File S2 (there are many ‘sheets’ in the file). In sheets 3,4 are the MID values and the analysis from metabolites in the media.

      Fig 4B - the x-axis labeling is missing for the bat1- cells

      RESPONSE: Corrected. Note that new DNA content measurements are now shown in Figure 3C.

      Although the authors state repeatedly that they show "for the first time in any system" that TORC1 activity is dynamic in the cell cycle, similar observations have already been made before, for instance showing high mTORC1 activity in the G1/S transition in the Drosophila wing disc or low mTORC1 activity during mitosis in mammalian cells (see PMIDs 28829944, 28829945, and 31733992). The text should be amended accordingly.

      RESPONSE: Thank you. Corrected.

      There are two entries for valine in File S1/Sheet8. Why?

      RESPONSE: The reason is that they were detected in both analytical pipelines (primary metabolites and biogenic amines; primary metabolites were measured with GC-TOF MS, while biogenic amines with HILIC-QTOF MS/MS), which were combined in the Table. We did not describe it adequately in the previous version. We do now, in the Methods. We also note that the raw data from each method are shown in the corresponding supplemental files. We combined them in the Table used in the Figure for display purposes. We also note that the amino acids were also measured by another method (PTH-based HPLC). Hopefully, the new edits in the Methods clarify these points.

      Reviewer #1 (Significance (Required)):

      Significance

      Despite the well-known effects of pharmacological or genetic manipulations of TORC1/mTORC1 on cell cycle progression, whether and how mTORC1 activity itself is physiologically coupled to cell cycle progression is still an insufficiently studied aspect. Hence this study provides an interesting link between cell-cycle dependent regulation of amino acid biosynthesis and TORC1 regulation. Importantly, the results of this study rely on centrifugal elutriation to obtain cell cycle synchronization, thus ruling out potential metabolic artifacts due to pharmacological methods. The observed changes in metabolic flux are therefore likely genuine and represent the major strength of the study. The major limitation is the lack of strong evidence supporting the notion that the increase in Leu biosynthesis at late G1 or S-phase is causing the increase in TORC1 activity.

      The major advance is conceptual - that amino acid biosynthesis rates are cell-cycle dependent.

      These results will be of interest to a broad audience of people studying the cell cycle, cell growth, TORC1 activity, cell metabolism and cancer.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This paper provides evidence that branched chain amino acid (BCAA) in the G1 phase of the cell cycle, fueled by pyruvate generated by glucose catabolism activates cell growth and allows cells to reach the critical size required for entry into S phase by activation of TORC1 signaling. Previous work had indicated that Leucine supplementation of a bat1 bat2 mutant, lacking both enzymes that catalyze BCAA from the alpha-keto acid precursors and starved on minimal medium, led to TORC1 activation. This work is significant in suggesting that BCAA synthesis from glucose is responsible for a cyclic activation of TORC1 necessary for a normal rate of cell growth in the G1 phase of the cell cycle.

      The study employs metabolic flux analysis of metabolites derived from glucose following a pulse-chase with different isotopes of glucose in synchronized early G1 cells (obtained by elutriation) throughout one cell cycle. They claim that the only compelling changes in metabolites observed as the cell cycle proceeds was a decline in pyruvate containing only one heavy 13C carbon atom and a corresponding increase in Leu (M6) with 6 heavy carbon atoms, which is interpreted to indicate Leu synthesis from pyruvate that begins in early G1 and peaks at mitosis. They show that a bat1 mutant exhibits a slow-growth phenotype that can be mitigated only by valine (although they infer similar effects for Leu and Ile that I find unconvincing) and they observed reductions in all three BCAAs in different experiments that measure steady amino acid levels in different ways (although the results are compelling only for Val). They go on to show evidence that the bat1 mutation reduces birth and mean cell size and leads to an increased proportion of G1 cells in asynchronous cultures, and they claim that bat1 cells take much longer than WT to achieve the same size found when a synchronized WT culture reaches 50% budding (although they don't show the data for this last point.) Interestingly, they find that deleting BAT1 suppresses sensitivity to the TORC1 inhibitor rapamycin (Rap), consistent with the idea that the bat1 mutation impairs TORC1 activity in the same manner as Rap and that BCAA are required to activate TORC1 in WT cells to the level that can be impaired by Rap, as summarized in the model in Fig. 5F. Consistent with this, they present evidence that the bat1 mutation reduces TORC1 signaling as judged by diminished Rps6 phosphorylation (although it was not shown that this effect could be reversed by Val addition). They also show that TORC1 signaling/Rps6-P increases as the cell cycle progresses using elutriated early G1 cells, suggesting that TORC1 activity is periodic in the cell cycle (although they don't establish this periodicity through a second cell cycle).

      General critique:

      The conclusion that BCAA synthesis from glucose is responsible for a cyclic activation of TORC1 necessary for a normal rate of cell growth in the G1 phase of the cell cycle is potentially of considerable significance. There are however a number of puzzling aspects of the data that seem to weaken this conclusion. As described in greater detail below, it is difficult to explain why only Leu is synthesized from glucose during the cell cycle, and why only Val shows a marked reduction in the bat1 mutant that appears to be responsible for the slow-growth phenotype. In addition, there are important controls lacking of showing that a Val supplement can suppress the G1 delay and reduction in TORC1 signaling in the bat1 mutant. In addition, the evidence that TORC1 activity is periodic in the cell cycle is lacking and it needs to be shown that Rps6-P levels are periodic through at least a second cell cycle.

      Major comments:

      -Why don't they observe synthesis of Ile and particularly Val in the metabolic flux experiment of Fig. 1, especially considering that only Val appears to be critically required for normal cell growth in the bat1 mutant based on the results in Fig. 3B?

      RESPONSE: We now show the actual plots and the errors of all the measurements in Figure 2 (instead of a heatmap we had shown before). Valine (M5) levels show a very similar trend to leucine (M6). The variance in the measurements was higher, though, and statistically, the valine changes were less significant. Hence, it was more appropriate to highlight the leucine changes. Lastly, the new DNA content data (Figure 3C) show an effect upon the addition of leucine, albeit less significant than that of valine addition.

      -The data in Fig. 3B do not show a convincing increase in growth of the bat1 mutant with addition of Leu and Ile; and the stimulation by Val alone seems identical to that seen with Val in combination with Leu and Ile. Thus, it appears that the slow-growth of the bat1 mutant results only from reduced Val levels, not all 3 BCAAs, which is at odds with their interpretation of the data.

      __RESPONSE. As mentioned above, the effect of valine is more pronounced than leucine's, but leucine does have consequences, best shown in the DNA content analysis (new Figure 3C). We also note that valine alone is insufficient to suppress the growth and cell cycle defects of bat1 cells. The latest data we have added (see Figures 3 and 5) are consistent with the interpretation that at least some de novo synthesis of BCAAs in the cell may be needed, explaining why exogenous BCAAs, including valine, are unable to correct the defects of bat1 cells fully. __

      -they claim to see reductions in all three BCAAs in the bat1 mutant; however, no significant reduction was found for Leu in Fig. EV3, and only Val was altered by the 1.5-fold cut-off imposed on the MS metabolomics data in Fig. EV4 (which could be appreciated only by an in-depth examination of the supplementary data in File S1-the Val, Leu, and Ile dots should be labeled in Fig. EV4). In addition, the reductions in Ala and Gly showin in Fig. EV3 were not found in the MS analysis of Fig. EV4. It needs to be acknowledged that the metabolomics data show a marked reduction in the bat1 mutant only for Valine with little or no change in Leucine levels. This result is difficult to explain with the simple models shown in Fig. 3A and 5F, which requires additional comment. The authors should acknowledge the much greater effect of the bat1 mutation on Val levels versus Leu and Ile, revealed both by measuring the levels of BCAAs in the mutant and comparing the BCAAs for rescuing the slow-growth of the mutant, and explain how this can be reconciled with the results in Fig. 2 where only Leu and not Val or Ile synthesis was detected.

      __RESPONSE. The perceived discrepancy in the steady-state measurements could easily arise from the different analytical methods used in each case. The differences are less substantial than the reviewer implies. For steady-state measurements in BAT1 vs. bat1 cells, we used the PTH-based method (which only detects amino acids) and two different MS-based pipelines (which detect various metabolites). From the MS-based analyses, the drop for all BCAAs was statistically significant. Although the magnitude of the drop was greater for valine (about 60% for valine vs. ~30% for isoleucine and leucine). Why is this a problem? __

      As for the valine changes in the isotope tracing experiments, as we mentioned above, the trend for valine (M5) was similar to that of leucine (M6) (now, hopefully, that data is shown better in Figure 2). Furthermore, as we commented above (see response to Reviewer 1) and now stated in the text, our isotope tracing experiments measure only the rate of synthesis, which need not match the steady-state abundances. The latter are affected by a multitude of variables, including the turnover of proteins and amino acids, not to mention their partition into distinct intracellular pools.

      __Lastly, please note that we have now added PTH-based measurements of amino acid levels in the cell cycle of wild type cells (new Figure EV2). As mentioned in our response to Reviewer 1, we found that changes in the steady-state levels of BCAAs had a similar pattern, and those changes were most significant for valine (rising 30-40% from late G1 to G2/M). __

      -They need to add the data indicating that the bat1 mutant requires longer than WT cells to reach the ~35 fL volume at which 50% of WT cells are budded.

      __RESPONSE: We added all that data (new Figure EV6) and discussed it better in the text. Note that our elutriation analyses allow accurate estimates of the G1 duration, which is at least 2x longer in bat1 vs. BAT1 cells. __

      -It seems important to show that Val supplementation can suppress the overabundance of G1 cells in bat1 mutant cells shown in Fig. 4C; and can restore sensitivity to Rap and Rps6-P accumulation in bat1 mutant cells (in Fig.s 5A & B).

      __RESPONSE: Excellent suggestions. We now present the requested experiments. The DNA content data are in Figure 3C, and the phospho-Rps6 data in the new Figure 4D are discussed in the text. Briefly, exogenous valine, and to a lesser extent leucine, suppressed the G1 accumulation, but not to wild type levels. Exogenous valine also substantially increased TORC1 activity (>10-fold). __

      -It seems important to show that Rps6-P will decline in M phase and increase during a second cell cycle to establish that TORC1 activity actually fluctuates in the cell cycle instead of just by reduced by the manipulations involved in collecting young G1 cells by elutriation.

      RESPONSE: The second cycle comment is not pertinent to our elutriation setup. The two-cycle approach should be used in arrest-and-release synchronizations to minimize arrest-related artifacts when cells continue to grow in size. This is why we used elutriation in the first place, as described in the text, to avoid such artifacts. In elutriations it is the first cycle, exclusively of daughter cells, that can be meaningfully scored. After that, the cells lose synchrony very fast because you have mothers (which grow in size very little) and daughters (which need to double in size until mitosis). Hence, the second cycle will be meaningless and impossible to interpret.

      Reviewer #2 (Significance (Required)):

      General Assessment:

      Strengths: Evidence for BCAA biosynthesis from glucose in the G1 phase of the cell cycle, and evidence obtained from analyzing the bat1 mutant that BCAA synthesis underlies activation of TORC1 early in the cell cycle in a manner required to achieve the critical cell size necessary for G1 to S transition.

      Weaknesses: Lack of evidence for Val biosynthesis in G1 despite evidence that Val limitation is more crucial than Leu limitation in the bat1 mutant; lack of confirmation that Val limitation underlies the delayed G1-S transition and reduced TORC1 signaling in the bat1 mutant; and lack of compelling evidence that TORC1 activity is periodic in WT cells.

      Advance: This would be the first evidence that TORC1 activity varies through the cell cycle in a manner controlled by synthesis of BCAAs

      Audience: This advance would be of great interest to a wide range of workers studying how the cell cycle is regulated and the role of TORC1 in controlling cell growth and division in normal cells and in human disease.

      My expertise: Mechanisms of metabolic regulation of gene expression at the transcriptional and translational levels in budding yeast

      **Referees cross-commenting**

      Ref. #1's major comment 1 echoes my request for clarification about whether Leu, and not just Val, is limiting growth in the bat1 mutant, and also the need to determine which BCAA supplement to bat1 cells will restore TORC1 activity (which was also requested by Ref. #3).

      I agree with this reviewer's request to provide evidence that Leu levels actually increase during G1 progression (comment #2). I also think the suggested experiments in Comment #3 are reasonable for their potential to provide stronger evidence that Leu production in the G1 phase of wild-type cells activates TORC1, as currently the argument is based on the finding of low TORC1 activation in bat1 cells (that seem to be limiting for Val vs. Leu). Comment #4 echoes similar requests made by both me and Ref. #3. Ref. #3's major comments 1 and 3 mirror two of my major comments. I wasn't convinced of the need to monitor Sch9 versus Rps6 phosphorylation as a read-out of TORC1 activity-does being a direct substrate truly matter? Regarding comment 5, I wasn't convinced of the need to include Rap-sensitive or -resistant control strains for the analysis in Fig. 5A. And regarding comment 4, while it would be interesting to examine if TORC1 regulates BCAA synthesis during cell cycle progression, this seems to be outside the scope of a demonstration that BCAA synthesis stimulates TORC1.

      Thus, it seems we all agree on certain experiments that need to be carried out, and Ref. #1 has rightly proposed a few others with the potential to strengthen the evidence that Leu production during G1 phase mediates cyclic activation of TORC1

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, Blank and colleagues measure the synthesis of various metabolites from glucose during cell cycle progression and observe an increased synthesis of branched-chain amino acids (BCAA) from the early G1 to late G1 phase. Interestingly, they also found a gradual increase in TORC1 activity from the early G1 to the S phase which is proposed to be dependent on BCAA synthesis.

      Major comments:

      1. The authors show that TORC1 activity increases from the early G1 to the S phase. TORC1 activity is sensitive to short-term starvations caused during changing media or centrifugations. Hence, the concern arises regarding the increased pattern of TORC1 activity during the cell cycle. Is it really a biological phenomenon or a cellular adaptation to experimental conditions? Can authors provide more support for this observation? Can authors monitor the cell cycle for the two cell cycles to confirm that TORC1 activity shows a wavy pattern? RESPONSE: The same point was also made by Reviewer #2. As we noted in our response above, “____The second cycle comment is not pertinent to our elutriation setup. The two-cycle approach should be used in arrest-and-release synchronizations to minimize arrest-related artifacts when cells continue to grow in size. This is why we used elutriation in the first place, as described in the text, to avoid such artifacts. In elutriations it is the first cycle, exclusively of daughter cells, that can be meaningfully scored. After that, the cells lose synchrony very fast because you have mothers (which grow in size very little) and daughters (which need to double in size until mitosis). Hence, the second cycle will be meaningless and impossible to interpret.____”

      The authors use Rps6 phosphorylation as a read-out of TORC1 activity, which is not a direct substrate of TORC1. Analysis of the direct substrates of TORC1, such as phosphorylation of Sch9 will solidify the author's claim.

      RESPONSE: The reviewers discussed this point (see their comments above). We agree with the opinion that Rps6 phosphorylation accurately reports on TORC1 activity (also used in the fly experiments we now cite, as requested by Reviewer 1). For all our experiments' objectives and conclusions, it doesn't matter if the phosphorylation of Rps6 lies more downstream than Sch9 phosphorylation.

      Authors show that Bat1 lacking strain have reduced TORC1 activity. Can authors restimulate these cells with Leucin, Valine, and Isoleucine individually or in combination to identify the critical amino acid for the TORC1 activity?

      RESPONSE: Yes, that is an excellent suggestion. We show the experiment in Figure 4D (see previous response). Valine showed pronounced activation (>10-fold).

      The authors claim that increased BCAA synthesis is necessary for TORC1 activation. Since TORC1 is shown to be upstream of amino acid biosynthesis pathways, it will be interesting to check if TORC1 per se regulates BCAA synthesis during cell cycle progression. The authors could inhibit TORC1 by rapamycin treatment and monitor if the BCAA synthesis still shows cell cycle-dependent modulation.

      RESPONSE: The reviewers also discussed this point (see their comments above). We agree with the view that it is a very substantial undertaking, well beyond the scope of this work.

      In Figure 5A, the use of any rapamycin-sensitive and rapamycin-resistant strains as controls will strengthen their claim of TORC1 inhibition being epistatic to Bat1 deletion, since the rapamycin in minimal media might be less effective.

      RESPONSE: Again, the reviewers also discussed this point (see their comments above). We agree that it will not add much to the conclusions in the context of all the data we show and the existing literature.

      Minor comments:

      1. The data of metabolic labeling, especially various species M1, M2, M3, etc., of an individual metabolite is difficult to understand for the general readers. Hence, a schematic explaining various species might be helpful. RESPONSE: We added a new Figure (EV1) delineating the carbons from glucose to valine and leucine.

      Please describe the elutriation approach in more detail with media conditions and buffer conditions to understand the overall experimental setup.

      RESPONSE: We now added this information (see the second section of the Materials and Methods).

      Reviewer #3 (Significance (Required)):

      Significance:

      Overall, this study presents an interesting observation to the researchers working in TORC1 and cell cycle regulation.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript, Blank and colleagues measure the synthesis of various metabolites from glucose during cell cycle progression and observe an increased synthesis of branched-chain amino acids (BCAA) from the early G1 to late G1 phase. Interestingly, they also found a gradual increase in TORC1 activity from the early G1 to the S phase which is proposed to be dependent on BCAA synthesis.

      Major comments:

      1. The authors show that TORC1 activity increases from the early G1 to the S phase. TORC1 activity is sensitive to short-term starvations caused during changing media or centrifugations. Hence, the concern arises regarding the increased pattern of TORC1 activity during the cell cycle. Is it really a biological phenomenon or a cellular adaptation to experimental conditions? Can authors provide more support for this observation? Can authors monitor the cell cycle for the two cell cycles to confirm that TORC1 activity shows a wavy pattern?
      2. The authors use Rps6 phosphorylation as a read-out of TORC1 activity, which is not a direct substrate of TORC1. Analysis of the direct substrates of TORC1, such as phosphorylation of Sch9 will solidify the author's claim.
      3. Authors show that Bat1 lacking strain have reduced TORC1 activity. Can authors restimulate these cells with Leucin, Valine, and Isoleucine individually or in combination to identify the critical amino acid for the TORC1 activity?
      4. The authors claim that increased BCAA synthesis is necessary for TORC1 activation. Since TORC1 is shown to be upstream of amino acid biosynthesis pathways, it will be interesting to check if TORC1 per se regulates BCAA synthesis during cell cycle progression. The authors could inhibit TORC1 by rapamycin treatment and monitor if the BCAA synthesis still shows cell cycle-dependent modulation.
      5. In Figure 5A, the use of any rapamycin-sensitive and rapamycin-resistant strains as controls will strengthen their claim of TORC1 inhibition being epistatic to Bat1 deletion, since the rapamycin in minimal media might be less effective.

      Minor comments:

      1. The data of metabolic labeling, especially various species M1, M2, M3, etc., of an individual metabolite is difficult to understand for the general readers. Hence, a schematic explaining various species might be helpful.
      2. Please describe the elutriation approach in more detail with media conditions and buffer conditions to understand the overall experimental setup.

      Significance

      Overall, this study presents an interesting observation to the researchers working in TORC1 and cell cycle regulation.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This paper provides evidence that branched chain amino acid (BCAA) in the G1 phase of the cell cycle, fueled by pyruvate generated by glucose catabolism activates cell growth and allows cells to reach the critical size required for entry into S phase by activation of TORC1 signaling. Previous work had indicated that Leucine supplementation of a bat1 bat2 mutant, lacking both enzymes that catalyze BCAA from the alpha-keto acid precursors and starved on minimal medium, led to TORC1 activation. This work is significant in suggesting that BCAA synthesis from glucose is responsible for a cyclic activation of TORC1 necessary for a normal rate of cell growth in the G1 phase of the cell cycle.

      The study employs metabolic flux analysis of metabolites derived from glucose following a pulse-chase with different isotopes of glucose in synchronized early G1 cells (obtained by elutriation) throughout one cell cycle. They claim that the only compelling changes in metabolites observed as the cell cycle proceeds was a decline in pyruvate containing only one heavy 13C carbon atom and a corresponding increase in Leu (M6) with 6 heavy carbon atoms, which is interpreted to indicate Leu synthesis from pyruvate that begins in early G1 and peaks at mitosis. They show that a bat1 mutant exhibits a slow-growth phenotype that can be mitigated only by valine (although they infer similar effects for Leu and Ile that I find unconvincing) and they observed reductions in all three BCAAs in different experiments that measure steady amino acid levels in different ways (although the results are compelling only for Val). They go on to show evidence that the bat1 mutation reduces birth and mean cell size and leads to an increased proportion of G1 cells in asynchronous cultures, and they claim that bat1 cells take much longer than WT to achieve the same size found when a synchronized WT culture reaches 50% budding (although they don't show the data for this last point.) Interestingly, they find that deleting BAT1 suppresses sensitivity to the TORC1 inhibitor rapamycin (Rap), consistent with the idea that the bat1 mutation impairs TORC1 activity in the same manner as Rap and that BCAA are required to activate TORC1 in WT cells to the level that can be impaired by Rap, as summarized in the model in Fig. 5F. Consistent with this, they present evidence that the bat1 mutation reduces TORC1 signaling as judged by diminished Rps6 phosphorylation (although it was not shown that this effect could be reversed by Val addition). They also show that TORC1 signaling/Rps6-P increases as the cell cycle progresses using elutriated early G1 cells, suggesting that TORC1 activity is periodic in the cell cycle (although they don't establish this periodicity through a second cell cycle).

      General critique:

      The conclusion that BCAA synthesis from glucose is responsible for a cyclic activation of TORC1 necessary for a normal rate of cell growth in the G1 phase of the cell cycle is potentially of considerable significance. There are however a number of puzzling aspects of the data that seem to weaken this conclusion. As described in greater detail below, it is difficult to explain why only Leu is synthesized from glucose during the cell cycle, and why only Val shows a marked reduction in the bat1 mutant that appears to be responsible for the slow-growth phenotype. In addition, there are important controls lacking of showing that a Val supplement can suppress the G1 delay and reduction in TORC1 signaling in the bat1 mutant. In addition, the evidence that TORC1 activity is periodic in the cell cycle is lacking and it needs to be shown that Rps6-P levels are periodic through at least a second cell cycle.

      Major comments:

      • Why don't they observe synthesis of Ile and particularly Val in the metabolic flux experiment of Fig. 1, especially considering that only Val appears to be critically required for normal cell growth in the bat1 mutant based on the results in Fig. 3B?
      • The data in Fig. 3B do not show a convincing increase in growth of the bat1 mutant with addition of Leu and Ile; and the stimulation by Val alone seems identical to that seen with Val in combination with Leu and Ile. Thus, it appears that the slow-growth of the bat1 mutant results only from reduced Val levels, not all 3 BCAAs, which is at odds with their interpretation of the data.
      • they claim to see reductions in all three BCAAs in the bat1 mutant; however, no significant reduction was found for Leu in Fig. EV2, and only Val was altered by the 1.5-fold cut-off imposed on the MS metabolomics data in Fig. EV3 (which could be appreciated only by an in-depth examination of the supplementary data in File S1-the Val, Leu, and Ile dots should be labeled in Fig. EV3). In addition, the reductions in Ala and Gly showin in Fig. EV2 were not found in the MS analysis of Fig. EV3. It needs to be acknowledged that the metabolomics data show a marked reduction in the bat1 mutant only for Valine with little or no change in Leucine levels. This result is difficult to explain with the simple models shown in Fig. 3A and 5F, which requires additional comment. The authors should acknowledge the much greater effect of the bat1 mutation on Val levels versus Leu and Ile, revealed both by measuring the levels of BCAAs in the mutant and comparing the BCAAs for rescuing the slow-growth of the mutant, and explain how this can be reconciled with the results in Fig. 2 where only Leu and not Val or Ile synthesis was detected.
      • They need to add the data indicating that the bat1 mutant requires longer than WT cells to reach the ~35 fL volume at which 50% of WT cells are budded.
      • It seems important to show that Val supplementation can suppress the overabundance of G1 cells in bat1 mutant cells shown in Fig. 4C; and can restore sensitivity to Rap and Rps6-P accumulation in bat1 mutant cells (in Fig.s 5A & B).
      • It seems important to show that Rps6-P will decline in M phase and increase during a second cell cycle to establish that TORC1 activity actually fluctuates in the cell cycle instead of just by reduced by the manipulations involved in collecting young G1 cells by elutriation.

      Referees cross-commenting

      Ref. #1's major comment 1 echoes my request for clarification about whether Leu, and not just Val, is limiting growth in the bat1 mutant, and also the need to determine which BCAA supplement to bat1 cells will restore TORC1 activity (which was also requested by Ref. #3). I agree with this reviewer's request to provide evidence that Leu levels actually increase during G1 progression (comment #2). I also think the suggested experiments in Comment #3 are reasonable for their potential to provide stronger evidence that Leu production in the G1 phase of wild-type cells activates TORC1, as currently the argument is based on the finding of low TORC1 activation in bat1 cells (that seem to be limiting for Val vs. Leu). Comment #4 echoes similar requests made by both me and Ref. #3. Ref. #3's major comments 1 and 3 mirror two of my major comments. I wasn't convinced of the need to monitor Sch9 versus Rps6 phosphorylation as a read-out of TORC1 activity-does being a direct substrate truly matter? Regarding comment 5, I wasn't convinced of the need to include Rap-sensitive or -resistant control strains for the analysis in Fig. 5A. And regarding comment 4, while it would be interesting to examine if TORC1 regulates BCAA synthesis during cell cycle progression, this seems to be outside the scope of a demonstration that BCAA synthesis stimulates TORC1.

      Thus, it seems we all agree on certain experiments that need to be carried out, and Ref. #1 has rightly proposed a few others with the potential to strengthen the evidence that Leu production during G1 phase mediates cyclic activation of TORC1

      Significance

      General Assessment:

      Strengths: Evidence for BCAA biosynthesis from glucose in the G1 phase of the cell cycle, and evidence obtained from analyzing the bat1 mutant that BCAA synthesis underlies activation of TORC1 early in the cell cycle in a manner required to achieve the critical cell size necessary for G1 to S transition.

      Weaknesses: Lack of evidence for Val biosynthesis in G1 despite evidence that Val limitation is more crucial than Leu limitation in the bat1 mutant; lack of confirmation that Val limitation underlies the delayed G1-S transition and reduced TORC1 signaling in the bat1 mutant; and lack of compelling evidence that TORC1 activity is periodic in WT cells.

      Advance: This would be the first evidence that TORC1 activity varies through the cell cycle in a manner controlled by synthesis of BCAAs

      Audience: This advance would be of great interest to a wide range of workers studying how the cell cycle is regulated and the role of TORC1 in controlling cell growth and division in normal cells and in human disease.

      My expertise: Mechanisms of metabolic regulation of gene expression at the transcriptional and translational levels in budding yeast

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      In this manuscript, Blank et al. propose a link between cell-cycle dependent changes in metabolic flux and corresponding changes in TORC1 activity in yeast cells. Based on their findings, the authors propose that Bat1-dependent leucine synthesis from glucose increases as cells progress through G1 and that this activates TORC1 to drive cell cycle progression. Although the existence of cell-cycle dependent synthesis of leucine is a novel and exciting finding, several aspects of the proposed model are not sufficiently supported by experimental evidence, in particular the fact that the increase in Leu synthesis is causing the increase in TORC1 activity in late G1.

      Major comments:

      1. To show that the increase in Leu biosynthesis in S-phase is activating TOR, one would ideally want to blunt this increase in biosynthesis and assay TORC1 activity. Admittedly, this is difficult. So, instead, the authors study bat1- cells which have strongly impaired synthesis of BCAA including Leucine. The relevance of these bat1- cells to the proposed cell-cycle dependent model, however, is questionable for two reasons: 1) Although the authors state that "exogenous supplementation of BCAAs in all combinations suppressed the growth defect of bat1- cells, especially when valine was present", the spot assays in Figure 3 show visible rescues only when valine is present either alone or in combination, while supplementation of leucine or isoleucine does not seem to have any effect. Hence it appears that the bat1- phenotype is mainly due to limiting valine levels, not leucine levels. 2) The relevance of these results for understanding TORC1 regulation are questionable, since valine does not typically activate TORC1. Does additionn of Leu to bat1- cells increase TORC1 activity ?
      2. TORC1 activity is known to depend on steady-state leucine concentrations in the cell rather than on leucine flux. Although the authors observe that the synthesis rate of leucine increases during G1 progression, this does not necessarily translate innto increased leucine concentrations in the cell. To support the claim that the increase in TORC1 activity during G1 progression depends on leucine, the authors would need to show that, not only leucine synthesis, but also overall leucine levels in the cell increase during G1 progression.
      3. To test whether the increase in Leu biosynthesis in S-phase activates TORC1, a few different approaches could be tested: 1) Since leucine activates TORC1 through the Gtr proteins, the authors could test whether rendering TORC1 resistant to low leucine through expression of constitutively active Gtrs abolishes the cell-cycle dependence in TORC1 activity. 2) Leu could be added to the medium of wildtype cells in G1 to the amount necessary to cause an increase in intracellular Leu levels similar to those seen in S-phase to test whether this increases TORC1 activity.
      4. In Fig 2B one sees that Leu biosynthesis peaks at 150min and then drops again. The p-RpS6 blot in Fig. 5D, however, only goes up to 140 min and shows that TORC1 activity increases up to 140 min, but it doesn't show timepoints beyond 150 min when Leu biosynthesis drops again, and hence one would expect TORC1 activity to drop. If TORC1 activity were to drop from 150min onwards, this would strengthen the correlation between Leu biosynthesis and TORC1 activity.

      Minor concerns:

      1. In Figure EV3, the authors should highlight some of the metabolites that are significantly changed, in particular the BCAA. The figure is not very informative as currently presented.
      2. Fig 2 - are "expressed ratios" the best term for metabolite levels? Unlike genes, where such heat maps are often used, the metabolites are not 'expressed'. How about 'relative metabolite level' instead?
      3. Page 8: "We also measured the MID values from the media of the same cultures used to prepare the cell extracts." Where are these data? We don't see them in File S2?
      4. Fig 4B - the x-axis labeling is missing for the bat1- cells
      5. Although the authors state repeatedly that they show "for the first time in any system" that TORC1 activity is dynamic in the cell cycle, similar observations have already been made before, for instance showing high mTORC1 activity in the G1/S transition in the Drosophila wing disc or low mTORC1 activity during mitosis in mammalian cells (see PMIDs 28829944, 28829945, and 31733992). The text should be amended accordingly.
      6. There are two entries for valine in File S1/Sheet8. Why?

      Significance

      Despite the well-known effects of pharmacological or genetic manipulations of TORC1/mTORC1 on cell cycle progression, whether and how mTORC1 activity itself is physiologically coupled to cell cycle progression is still an insufficiently studied aspect. Hence this study provides an interesting link between cell-cycle dependent regulation of amino acid biosynthesis and TORC1 regulation. Importantly, the results of this study rely on centrifugal elutriation to obtain cell cycle synchronization, thus ruling out potential metabolic artifacts due to pharmacological methods. The observed changes in metabolic flux are therefore likely genuine and represent the major strength of the study. The major limitation is the lack of strong evidence supporting the notion that the increase in Leu biosynthesis at late G1 or S-phase is causing the increase in TORC1 activity.

      The major advance is conceptual - that amino acid biosynthesis rates are cell-cycle dependent.

      These results will be of interest to a broad audience of people studying the cell cycle, cell growth, TORC1 activity, cell metabolism and cancer.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      General Statement

      We thank the reviewers for a thorough review that will help us to improve the manuscript in the revision process. In our opinion, all three reviewers found the manuscript interesting, novel, and relevant for a broader readership. The reviewers suggested performing additional analyses of cell quantification from existing brain tissue or from newly generated tissue. All reviewers identified several shared concerns that we are happy to address by additional experiments and analyses to improve our manuscript. The reviewers suggested including the Control Diet + LiPR treatment group to further characterize the effects of LiPR on adult neurogenesis outside the context of the High Fat Diet. Also, the reviewers suggested including built upon the analysis of tanycytes and their proliferation. Some of these analyses will require generating new experimental animals, however, most analyses can be performed from already available brain tissue or previously collected confocal microscope images. Because we had anticipated some of the possible concerns, we have placed mice in the experiment already in February 2023. These mice are in the 4-month treatment group of Control Diet + LiPR. We will collect the brain tissue at the end of May 2023 and will analyze it in June and July 2023. In April and May 2023, we will work on analyses from existing tissue or images as described in detail below. We estimate that the suggested analyses are all feasible and should be manageable in 3 months. In fact, we are pleasantly surprised by the favorable nature of the reviews, especially from the reviewer 1 and 3, which allowed us to address around 50% of comments already as demonstrated in this revision plan (see section 3). Therefore, we are confident that we will be able to address the remaining concerns to full satisfaction of all relevant reviewers’ comments.

      Reviewer 1


      In this manuscript, Jorgensen and colleagues describe their findings on the action of a palmitoylated form of prolactin-release peptide (LiPR) on neural stem cells (NSC) in the adult mouse hypothalamus and adult mouse hippocampus. Their main conclusion is that LiPR can counteract the effects of high-fat diet (HFD) and rescue some of the adverse effects of HFD. Specifically, the authors provide evidence that: - Exposure to HFD reduces the number of presumptive adult neural stem cells (NSCs) in the adult hypothalamus, whereas exposure to LiPR reverses this trend. - The results suggest that LiPR reduces the proliferation of alpha-tanycytes and/or their progeny in the hypothalamus in the context of HFD, with Liraglutide acting similarly. In contrast, while LiPR also suppresses proliferation in the SGZ, Liraglutide works there in the opposite direction. - LiPR also helps the survival of adult-born hypothalamic neurons. - Reduction of proliferation by LiPR suggests a model where LiPR increases the number of NSCs presumably by reducing their rate of activation. - The results suggest that LiPR promotes expression of PrRP receptors in the hypothalamic neurons, suggesting that PrRP may act directly on such neurons (and tanycytes?) in vivo. - The authors also show that HFD and LiPR alter gene expression profiles of the MBH cells, with HFD, but not LiPR, inducing myelination-related genes. - Finally, they show that PrRP stimulates an increase in Ca2+ in in vitro-derived human hypothalamic neurons. - The authors conclude that LiPR may be reducing activation and proliferation of the hypothalamic stem cells and thereby preserve their pool from exhaustion, which was stimulated by HFD. The manuscript presents interesting data and is clearly written. There are several comments, mainly editorial.

      RESPONSE: We thank the reviewer for the favorable and positive assessment of our manuscript and for finding our study to be interesting to a broad audience and well written, with most comments described by the reviewer as “editiorial”. Below, we address the reviewer’s concerns in a detailed revision plan.

        • It is unclear why most of the experiments do not include the control+LiPR group. Even though the focus of the study was the action of LiPR in the context of HFD, questions remain regarding the action of LiPR per se. Is LiPR (or Liraglutide, for that matter) completely inactive on the normal diet background, with respect to neurogenesis in the hypothalamus and the hippocampus? Whether the Response is positive or negative, it would give a much better understanding of the action of LiPR - does it regulate neurogenesis in various physiological contexts, or does it only kick in with a particular type of diet? In fact, this was examined (see Supplementary figures), but only for the cells in culture and, when performed with animals, was limited to 7 and 21 days, rather than 4 months, which would have been much more informative.* RESPONSE: We thank the reviewer for this suggestion. We agree that including the Control Diet + LiPR group for the 4-month HFD group would complement the results from the 7 and 21 days. We will generate this treatment group for the 4-month HFD group and analyze the effect of LiPR on aNSC and adult-generated neurons. These mice in the 4-month treatment are in the experiment already from February 2023 and we plan to analyze their brain sections in June and July 2023.
      1. The question above is also relevant when considering the conclusions on the potential depletion of the stem cell pool (again, whether in the hypothalamus or the hippocampus), particularly at the 4-month time point. The mice are ~6 months old by that time, and neurogenesis in both regions is expected to decrease by that time. Are LiPR or Liraglutide able to suppress or exacerbate this decrease? Can they be used to mitigate this decrease when mice are on a regular diet?*

      RESPONSE: This concern will be addressed by analyzing the Control + LiPR mice for the 4-month HFD group (see our response to the point 1 above). We will analyze neural stem cells in the Hypothalamic Ventricular Zone and neural progenitors in the Median Eminence of these mice to address whether LiPR treatment changes the time-dependent decrease in both cell populations.

      • A somewhat related issue is that, in most cases, only the percentage or the density of cells are shown on the graphs, rather than the absolute numbers (at least for some cases). This sometimes complicates the comparisons; for instance, does the surface of the hypothalamus change between 2 and 6 months of age? The tanycytes' number stays, apparently, the same (e.g., Fig. 2) but the production of new neurons is supposed to fall dramatically.*

      RESPONSE: We thank the reviewer for this comment. We agree that the quantification of absolute number of cells is the preferable approach that we have used in our previous publications on subventricular (SVZ) or subgranular (SGZ) neurogenesis. However, hypothalamic adult neurogenesis is dispersed over much larger volume of tissue than neurogenesis in the SVZ or SGZ, which is confined to narrow tissue compartments. As we do not have access to a confocal microscope with stereological software, absolute quantification in entire MBH is not feasible. Nevertheless, we believe that our quantification of cell density provides an unbiased and informative approach that allowed us to compare the effects of LiPR and diet on the neurogenic process.

      • The authors write "LiPR may prevent stem cells from exhaustion, induced by HFD" - but it is not clear that HFD indeed leads to exhaustion - there is no statistically significant difference in the number of the stem cells (alpha-tanycytes) between the control and HFD or between HFD at 1, 3, or 12 weeks.*

      RESPONSE: We thank the reviewers for their insights. We adjusted the interpretation to better reflect our results. On line 442, we replaced the original statement “The lower cell activation may protect the stem cell pool from exhaustion elicited by the HFD“ with a new one, “The lower cell activation may protect the stem cell pool from exhaustion elicited by the HFD“.

      • Numerous papers show that the rate of production of new adult hypothalamic neurons (mainly those derived from beta-tanycytes) drops drastically within the first several weeks of mouse life. Does HFD accelerate, and LiPR mitigate, this decrease? Perhaps one can calculate the numbers from the graphs, but it would help if this is explained in the text of the manuscript. Also, it is not always clear whether specific experiments were performed with the zones of the hypothalamic wall that only contain alpha-tanycytes.*

      RESPONSE: Our results show that LiPR rescues the HFD-induced reduction in adult-generated hypothalamic neurons only in the context of 4-month HFD but not in the 7- and 21-day HFD. In the methods (line 877), we specify that “the Region of Interest (ROI) quantified included the MBH parenchyma with the Arcuate (Arc), DMN and Ventromedial (VMN) Nuclei and the Medial Eminence (ME)”. In the results of the revised manuscript (lines 301-303), we highlighted the areas of the ROI. Upon the request of Reviewer 3 (comment 14), we included new data on quantification of BrdU+ neurons in the Arcuate Nucleus (S.Fig.5O). This data show that 21d HFD increases the number of new neurons in ArcN, which is reversed by LiPR or Liraglutide (text added to results and discussion on lines 309-313 and 468-474, respectively). Finally, in the discussion (lines 464-488), it is stated that HFD and/or LiPR had no effect on number of new hypothalamic neurons or cells in the MBH parenchyma in the 7- and 21-day groups and this is discussed in the context of relevant literature.

      • A sharp increase in PCNA+ cells in the hippocampus at the 21-day time point, both in the control and in the HFD and HFD/LiPR groups (Fig. S2f) is a little puzzling because neither the Dcx+ nor the Ki67+ cells show this increase.*

      RESPONSE: We agree with the reviewer that this increase in the number of PCNA+ cells is puzzling. We quantified the number of PCNA+ cells twice by two different people, always getting the same result. Given that this is a minor result in a supplementary figure, we would prefer not analyzing this again, unless the reviewer would insist on it.

      • The study deals with several agents and several processes; a simple scheme that summarizes authors' conclusions might help to better understand the relationships between those agents and processes.*

      RESPONSE: We thank the reviewer for this useful suggestion. We included a summarizing schematic in the revised manuscript as the new Figure 6. We will update the schematic for the final revised manuscript, when we will incorporate the new analyses.

      ***Referee cross-commenting**

      I agree, the lack of the LiPR group complicates the interpretation of the results. I also agree that the experiments with vimentin staining, calcium increase, and even with neurospheres do not add much to the main questions that this study attempts to Response, and I'd rather see a more thorough analysis of the activation and differentiation data. I also want to reiterate that the concept of LiPR/PrRP preventing the exhaustion of the hypothalamic stem cell pool is not clear, because it is not shown that this pool does actually get exhausted under normal or HFD conditions. This latter issue again requires the LiPR-alone group. Also, as a clarification - I wrote about 1 month required to compete the revision assuming that the authors actually have the data on the Control+LipR group or at least the specimens available, mainly because the supplementary material shows results with this group, at least with the neurospheres. If this group is fully missing, then the effort will obviously take a longer time.

      Reviewer #1 (Significance (Required)):

      The provided evidence suggests, for the first time, that PrRP prevents the loss of the neural stem cells population in the adult hypothalamus that was diminished by obesity and HFD. This finding might be interesting to a broad audience.

      *

      Reviewer 2


      *The authors examine the effect of an anorexigenic drug, LiPR in the context of treatment with high fat diet (HFD) and with a special focus on hypothalamic neural stem/progenitor cells and neurogenesis. The work is mostly based on mice and a barrage of different techniques (confocal imaging, cell cultures with time lapse, gene expression...) are used. The results are interesting because they address the yet-poorly understood implication of hypothalamic neurogenesis in food intake and energy balance. The results point at complex effects at different levels (neural stem cells, neurons, division, survival...). The experimental approach is sometimes thorough in the treatment of details on the one hand, it also lacks of consistency on the other, and as a result the conclusions lack strength. There is a number of experiments that sometimes seem unrelated and this hurts the comprehension of the manuscript, specially in lieu of the complexity of the results obtained.

      *

      RESPONSE: We thank the reviewer for finding our results interesting and relevant. We will strive to improve the consistency of our results in the revised manuscript to satisfy the reviewer’s concerns.

      1. A major issue is the lack of a LiPR-only group, which would much facilitate the interpretation of the results. The effect of LiPR alone is however tested, but only in comparison with the Control in one of the in vitro experiments (S.Fig. 3) RESPONSE: We agree with the reviewer that expanding on the LiPR-only effect would facilitate the interpretation of the results (see concern 1 and 2 of reviewer 2). We want to emphasize, however, that we analyzed the HFD-independent LiPR effects not only in vitro but also in vivo by quantifying the number of BrdU+ cells and neurons in the MBH of mice exposed to 21-day HFD (S.Fig. 5 O-Q) and by including the Control Diet + LiPR in the RNAseq experiment (Fig.5C). Nevertheless, we will analyze the number of alpha tanycytes and proliferating cells for the 21-day Control Diet + LiPR treatment group. And we will generate mice treated with Control Diet + LiPR to complement the 4-month group. In this Control Diet + LiPR group, we will quantify the number of tanycytes and number of BrdU+ cells and neurons.

      2. As plotted, in Fig 1B is difficult to interpret the effect of HFD and LiPR, might be using percentage and noting the statistical differences as in the other would help. It looks like HFD has no effect compared to control on weight and only at the end LiPR could have an effect. On the other hand, after 4 months, HFD mice are clearly above the controls and it is then, albeit when weight gain has reached a plateau, that LiPR has an effect. The election of these arbitrary paradigms and their drawbacks has to be better explained.*

      RESPONSE: We thank the reviewer for the comment. We analyzed the effect of HFD and/or LiPR on the body weight for the 21-day group (Fig.1B) in the original manuscript (lines 111-115). The two-way, repeated measure ANOVA revealed no effect of the treatment on the body weight in the 7-day group, however, it revealed the effect of the duration of treatment on the body weight in the 21-day group. As suggested by the reviewer, we included the Control Diet + LiPR in the 21-day group (Fig.1B). We analyzed the data with ANOVA and found that the treatment has a statistically significant effect on the body weight, however, without any statistical difference between treatment groups (lines 112-116 in the revised manuscript). In addition, we will include the Control Diet + LiPR in the 4-month group.

      Why was the proportion of GPR10+BrdU+MAP2+ cells only assessed in control mice and no in the experimental groups if its expression in overall neurons changes? This suggests that the receptor is expressed in neurons. Interestingly, exposure to 21d HFD reduced density of GPR10, which was rescued by LiPR administration (Fig.1L). Why was this time point chosen and not the longer-term one? What is the consequence of the alterations in the potential number of GPR10, specially in relation to the administration of LiPR? This clarification is important because a 14-day treatment was chosen for the in vitro experiments in which LiPR, but not HFD, seems to have an effect on cell proliferation. Might be it would have been more useful to use a paradigm in which HFD has an effect to better compare with in vivo work and for the rationale of the work. "Besides GPR10, we co-localized neuronal cytoskeleton structures with NPFFR2 in the MBH (Fig.1O-P)..." Why were not GPR10 and NPFF2 analyzed in a similar and consistent manner ? It is confusing.

      RESPONSE: The proportion of GPR10+BrdU+Map2+ neurons was quantified to address whether new neurons express the PrRP receptor. We chose to analyze the proportion of GPR10+BrdU+Map2+ neurons at the 21d time-point because we had the most robust data for this or related time points in vitro and in vivo. We will emphasize this in the text. But we prefer not to analyze the effect of LiPR on the density or expression of GPR10 or NPFF2 for all time points. We consider this to be beyond the scope and focus of the manuscript.

      The number of GFAP+ α-tanycytes is not significantly changed by HFD therefore LiPR does not rescue, but rather increases the number of GFAP+ α-tanycytes in the 7-day setting. There are no differences among groups later, the effect is lost by 21 days, therefore there is a transient excess of GFAP+ α-tanycytes which later "disappear" in the LiPR group. The authors state that LiPR rescues the decrease in "htNSCs", but after 21 days the number of the GFAP+ α-tanycytes is the same in all groups without the need of LiPR. There is no experimental follow up (addressing proliferation and survival of these cells) and the conclusions stated in the text (results and discussion) are not really supported by the data. The in vitro experiments could be a complement, but are no substitute for the missing in vivo exploration.

      RESPONSE: We thank the reviewer for this comment. We agree that we did not correctly interpret the data. On line 158, we replaced the original statement “This suggests that short LiPR rescues HFD-induced reduction in the number of htNSCs” with a new one that reflects of date correctly, “This suggests that short LiPR increases the number of htNSCs. In our revision plan, we will quantify the number of proliferating tanycytes to complement our in vitro results.

      • The fact that cell division is "rarely found" (Rax GFAP) experiments also push for further investigation. It is difficult to see that relevance of the inclusion of the vimentin staining experiment if there is no further exploration. The effect of LiPR is only transient, in the 7-day paradigm and as the parameter evaluated is the proportion of vimentin+ tanycytes among GFAP+ tanycytes it could only be reflecting increased expression of the filament. "Nevertheless, we did not observe a statistically different change in the area occupied by Rax+ tanycytes (Fig.2H)." Why did the authors use Rax only for this experiment if "GFAP+ α-tanycytes which are considered the putative htNSCs?" What is the justification for not seeing changes in relation to the results reported in Fig 2D-F? "Because Vimentin is associated with nutrient transport in cells and with metabolic response to HFD 52-54, we quantified the proportion of GFAP+ tanycytes expressing Vimentin (Fig.2F)." It is difficult to see that relevance of the inclusion of the vimentin staining experiment if there is no further exploration. The effect of LiPR is only transient, in the 7-day paradigm and as the parameter evaluated is the proportion of vimentin+ tanycytes among GFAP+ tanicytes it could only be reflecting increased expression of the filament.*

      RESPONSE: Because Vimentin is a marker of neural stem cells and alpha tanycytes, we quantified the number of GFAP+Vimentin+ tanycytes to complement the quantification of GFAP+ alpha tanycytes. We are sorry that this was not clear, and we highlighted this connection in the revised manuscript (line 165). Because Rax is expressed in alpha tanycytes, we expected that LiPR will increase Rax in the Hypothalamic Ventricular Zone (HVZ). We agree with the reviewer that further investigation may be useful, and we will quantify the number of alpha tanycytes positive for Rax instead of determining only the volume of Rax+ tissue. We will quantify Rax+GFAP+ neural stem cells in the HVZ and Rax+GFAP+ neural progenitors (so-called beta tanycytes) in the Median Eminence to improve characterization of the cell dynamics in vivo.

      • Why there is no Ki67 experiment in the 7-day paradigm if that is the timepoint in which changes in the number or proportion of GFAP+ tanycytes are observed? PCNA was then used but only in the 21-day paradigm. What is the interpretation and relevance of these data? What are the non-htNSCs proliferating cells, whose dynamics are different from the changes in the number or proportion of htNSCs that could be potentially related to changes in mitosis? Again, I think it would be much useful for the work to explore in detail the changes in the putative htNSCs than investing in experiments that only add confusion.*

      __RESPONSE: __We apologize if the data presentation is confusing. We will include the quantification of the Ki67+ cells for the 7-day time point. In the MBH, many cell types undergo mitosis, including the oligodendrocyte precursor cells, microglia, astrocytes, and infiltrating macrophages. However, characterizing the identify of all these different cell types in response to the HFD and/or LiPR is beyond the scope of this study. To resolve whether HFD and/or LiPR influence proliferating aNSCs, we will quantify the proliferating cells in the HVZ, which will allow us to separate the proliferating aNSCs from all other proliferating cell types in the MBH.

      • The inclusion of Liraglutide + HFD, (not Liraglutide alone) only in some of the experiments is pointless if there is no direct comparison with LiPR and a timepoint is missing. In S.Fig 3, Fig. 5 and S.Fig 7 LFD (low fat diet?) is used in several occasions as in: "on reducing number of PCNA+ cells in 21d protocol (one-way ANOVA (OWA), F(2,12) = 16.66, p = 0.0003) when compared to both LFD and HFD groups". Is this the control diet?*

      RESPONSE: We apologize for the confusion caused by labelling the conditions of the Control Diet inconsistently. In some figures (e.g., Fig.2, S.Fig.3, Fig.4), we labelled the Control Diet as “Control”, whereas in some other figures (e.g., Fig.5, S.Fig.7) we labelled the Control Diet as “LFD” (Low Fat Diet). In all experiments and figures, the used Control Diet was identical. We unified the labelling of the Control Diet in all figures and in the text of the revised manuscript. Respectfully, we do not agree that including the Liraglutide data is pointless. We included the Liraglutide in the context of the HFD as a direct comparison with the HFD + LiPR group to demonstrate that the two anti-obesity compounds exert differential effects on adult neurogenesis. Such comparison has not been done before in analyzing adult neurogenesis and is valuable for better understanding of functions of these anti-obesity compounds.

      • The final experiment shows that application of hPrRP31, a variation of LiPR, causes an immediate calcium increase in human induced pluripotent stem cell-derived hypothalamic nucleus. This finding is interesting in itself because it brings light about the function of the receptor/s. It would have been very useful to test what other receptors mentioned to bind LiPR is mediating the effect. In any case, the focus of the work are the neural stem/progenitor cells responsible for neurogenesis and the changes in their properties because of HFD and LiPR, therefore I would trade these experiments for a more thorough and detailed dissection of these effects.*

      RESPONSE: We thank the reviewer for recognizing the relevance of the experiments with the hiPSC-derived neurons. As described in the comments above, we will conduct additional experiments to address the effect of LiPR on aNSCs and proliferation to more thoroughly as suggested by the reviewer.

      Minor points: __ A.__ Introduce "GLP-1RA"

      __RESPONSE: __We thank the reviewer for identifying this omission. We introduced the term in the revised manusript (line 50).

        • "HFD-induced inflammation and astrogliosis in the hypothalamus 45,46, whereas the long (4mo) protocol leads to DIO" Are these notions exclusive?* __RESPONSE: __This statement emphasized that HFD-induced inflammation and astrogliosis precede obesity. We prefer to leave the statement as it is.
        • LiPR displays no effects on astrocytes" "Displays" is not the correct term.* RESPONSE: We replaced the term “display” with the word “show” in the revised manuscript (line 342).

      ***Referee cross-commenting**

      I think we all referees agree for the most part. The main concern stated by all of us is the lack of a LiPR-alone group. The rest of the concerns are also related or complementary. In my opinion the mostly common view by the referees is reasuring.

      Reviewer #2 (Significance (Required)):

      The strengths of the work are its novelty in the field and the variety of techniques employed. The work has the potential of unveiling mechanistic insight into the regulation of neural stem/progenitor cells and neurogenesis. The main audience of this work would be the community working on this field. The lack of experiments testing that the changes observed actually participate in food intake prevent the work from being of relevance for a broader audience (food intake, energy balance, obesity...). The limitations are the descriptive nature of the work and the lack of a consistent and systematic experimental design that would allow to extract solid conclusions upon to which build upon future research.

      *

      Reviewer 3

      The work of Jörgensen et al describes the effect of a lipidized analogue of the prolactin releasing peptide (LiPR) on the mouse metabolism in response to high fat diet (HFD) and on hypothalamic and subgranular zone (SGZ) neurogenesis. They conclude that LiPR reduces body weight and improves metabolic parameters affected by HFD as well as it concomitantly stimulates neurogenesis in both niches the SGZ and the hypothalamus. The link between both effects is not demonstrated. The work is well conducted, the hypothesis is interesting and the experimental approach is adequate. The scope is wide and results are interesting, however a few aspects need to be further clarified. The manuscript is well written although the modification of some aspects would facilitate the reading such as the use of non described abbreviations for example.

      RESPONSE: We thank the reviewer for the positive assessment of our manuscript and for recognizing its novelty and importance for the research in neurogenesis, endocrinology, and metabolism. We will strive to clarify and facilitate our conclusions to improve the manuscript.

        • One concern in this study is the experimental groups. Authors analyze three groups control,HFD and HFD treated with LiPR. Authors conclude that the effects of LiPR are diet independent. However, given the results obtained by the authors on the effect of LiPR, the main question that arises in here is whether LiPR would have an effect on control mice. It seems tha a group is missing in the experimental design in which control ,mice are treated with LiPR during 7, 21 and the last two weeks of the 4 months. Author must include this information or at least argue the election of the experimental design.* RESPONSE: We thank the reviewer for this insight. We agree that including the Control Diet + LiPR in some of our analyses would improve the revised manuscript as also noted by Reviewer 2 (comment 1 and 2) and by Reviewer 2 (comment 1 and 2). In the original manuscript, we included the quantification of BrdU+ cells in the MBH for the Control Diet + LiPR in the 21-day group. To expand on these results, we will quantify the effects of LiPR on alpha tanycytes in the 21-day group. In addition, we will generate Control Diet + LiPR mice for the 4-month group to complement the HFD and HFD + LiPR data.
      1. Body weight is found reduced by LiPR as well as other metabolic parameters in mice treated with LiPR during the last two weeks of the 4 Mo HFD. However, no effects on hypothalamic or SGZ neurogenesis are not observed in this experimental group. How do authors explain this results?*

      __RESPONSE: __The 4-month group contains animals that are over 6-month-old, which display very low levels of cell proliferation and differentiation in comparison with the 7 and 21-day groups that contain mice that are 2 and 2.5 months old, respectively. It is possible that these low levels of neurogenesis did not allow us to detect any pro-neurogenic effects of LiPR. Alternatively, the low neurogenesis in older animals precludes us from detecting the adverse effects of the HFD, which are rescued by LiPR in younger animals.

      • In figure 1 I-K images are not clear and better resolution images would help.*

      RESPONSE: We provided images with higher resolution for Figure 1I-K of the revised manuscript.

      • Authors conclude that LiPR is increasing the number of NSC by reducing their activation. However, authors show an induced increase in htNSC only in mice fed HFD for 7 days and not in the 21 day fed mice or the 4 mo fed mice (fig 2 d-f). In addition, authors test for the number of cells expressing Ki67 (fig 2 L), however, the number of Ki67+ alpha tanicytes is not shown.*

      RESPONSE: We thank the reviewer for this insight. In the revised manuscript (line 158), we corrected the inaccurate statement that LiPR increased the number of aNSCs and did not rescue their number, which was also noted by Reviewer 1 (comment 5) and by Reviewer 2 (comment 4). In addition, we will quantify the number of Ki67+ cells in the Hypothalmic Ventricular Zone (HVZ), which will address whether LiPR affects proliferation of aNSCs. This concern parallels comment 6 of Reviewer 2.

      • On figure 2B it seems that is alpha 2 tanicytes that are missing in response to HFD.*

      RESPONSE: Indeed, the panel in Figure 2B shows that the HFD reduces the number of alpha tanycytes, including the alpha 2 tanycytes. This representative image supports our quantification results in Figure 2D-E.

      • Are Fig 2 A-C images representative of mice fed HFD for 7 days?*

      __RESPONSE: __Yes, the representative images in panels of Fig. 2A-C are from the 7-day group. However, the legend states that these images are from the 21-day group. This is an error that we corrected in the revised manuscript in the legend of Figure 2 (line 572). We apologize for this and thank the reviewer for double-checking.

      • By looking at figure 2B it seems like the proportion of alpha tanicytes is higher in HFD since no or very few tanicytes are observed and almost all of them are alpha tanicytes.*

      RESPONSE: Indeed, 7 days of HFD reduced the number of alpha 2 tanycytes, which occupy the ventral-lateral aspect of the 3rd ventricle. This reduction of alpha 2 tanycytes drives the lover proportion of GFAP+ alpha-tanycytes out of all GFAP+ tanycytes. We emphasized this in the text of the revised manuscript (line 435-437).

      • In fig 2 d-f, an increase in the number of GFAP+ alpha tanicytes and its proportion as well as labelled with vimentin is observed in control mice fed with normal diet for 7 days compared with mice fed normal diet for 21 days. How do authors explain this difference?*

      RESPONSE: There is no difference in the number of GFAP+ alpha tanycytes or proportion of GFAP+ alpha tanycytes between 7-day and 21-day Control Diet mice. We used the two-way, repeated measure ANOVA with the Bonferroni’s pots-hoc test and did not observe any statistical difference between these 2 quantifications for the Control Diet mice at 7 and 21 days. There is a statistical difference between 7-day and 21-day Control Diet mice in the proportion of GFAP+Vimentin+ tanycytes. This could be due to expansion of the Vimentin+ tanycytes in relatively young adult mice. Given that this is not a major point, we prefer not expanding its discussion in the manuscript.

      • In fig 2 Why are the differences in RAX, KI67 and PCNA only present in mice fed HFD for 21 days?*

      RESPONSE: We thank the reviewer for this question, which reflects a similar comment 6 of Reviewer 2. To improve consistency of the presented data, we will quantify the proliferating cells also for the 7-day time point. In addition, we will quantify the number of proliferating cells in the HVZ, which will allow us to address whether HFD and/or LiPR alter proliferation of tanycytes.

      • Authors test for adult hippocampal neurogenesis in the three groups. DO images in fig S2 correspond to the 21 day treatment group?*

      RESPONSE: Yes, the representative images in the Supplementary Figure 2 are from the 21-day group. This is stated in the figure legend.

      • On fig S2 C, it seems that in HFD fed mice treated with LiPR newly generated neuroblasts are more differentiated have authors looked at DCX+ cell morphology?*

      RESPONSE: We thank the reviewer for this observation. We have not analyzed the morphology of DCX+ cells or DCX+ neuroblasts in the SGZ. As the manuscript focuses on the hypothalamic and not hippocampal neurogenesis, we prefer not to analyze the morphology in the revised manuscript.

      • In this same figure, it seems like the number of DCX+ neuroblasts and the number of newly generated neurons is reduced in mice of the 21 d group compared to the 7 day group. Is this statistically significant?*

      RESPONSE: We used the two-way, repeated measure ANOVA with the Bonferroni’s pots-hoc test to analyze the DCX+ neuroblasts and neurons. We observed a statistically very significant effect of LiPR treatment on the number of DCX+ neuroblasts and neurons (page 10 of the original manuscript). However, the Bonferroni’s test did not reveal any difference between 7-day and 21-day treatment groups.

      • There is a large reduction in the number of DCX+ cells from control 21 d treated mice to control 4 month treated mice. Is this statistically significat? How do authors explain this dramatic reduction?*

      RESPONSE: Yes, there is statistically significant reduction in the number of DCX+ cells and DCX+ neurons in the SGZ between the 21-day and 4-month group S.Fig.2). This reduction is most likely a result of aging. The mice of the 21-day group were around 2.5 months of age when culled, whereas the 4-month group month mice were over 6.5-month-old. The decline in SGZ neurogenesis with age is well documented. Because this decrease in DCX+ cells in the SGZ is an obvious consequence of the animals’ age and because the hippocampal neurogenesis is not the primary focus of this manuscript, we prefer not to discuss this feature in the manuscript.

      • Authors do not show the effect of HFD on BrdU+ neurons in the Arcuate. However, all data need to be shown.

      *

      RESPONSE: We stated (on page 12 of the original manuscript) that in the Arcuate Nucleus of the 21-day group, there was “a statistically significant increase of BrdU+ neurons by HFD compared to Control (data not shown)”. To satisfy reviewer’s comment, we incorporated this data in the S.Fig.5 as the new panel S.Fig.5O and added the following text (lines 309-313) to the revised manuscript: “However, in the ArcN, the primary nutrient and hormone sensing neuronal nucleus of MBH 4, there was a statistically significant difference in number of BrdU+ neurons due to treatment (OWA, F(3,15) = 3.97, p = 0.0029). Exposure to 21d HFD significantly increased the number of BrdU+ neurons in the ArcN, which was reversed by co-administration of LiPR or Liraglutide (S.Fig.5O).” In addition, we adjusted the relevant discussion (lines 468-472): “Our results show that the short and intermediate exposure to HFD does not change the number of newly generated, BrdU+ cells, neurons, or astrocytes in the MBH parenchyma, however, it increases the number of BrdU+ neurons in the primary sensing ArcN, which is reversed by the con-current administration of LiPR or Liraglutide” and (lines 474-476): “In addition, our results show that while LiPR does not change the number of new cells in the MBH parenchyma, it can rescue the increased production of new neurons in the ArcN in the context of the intermediate HFD exposure.”

      *Reviewer #3 (Significance (Required)):

      In general the manuscript includes a great amount of work to demonstrate the effect of LiPR on neurogenesis (hippocampal and hypothalamic). The scope is wide, and the hypothesis is really interesting. Authors may need to solve some issues in order to completely demonstrate their claims and conclusions, but once the work is done, it will be very valuable to understand the effect of pharmacological agents used in the field of endocrinology to treat metabolic disorders such as type 2 diabetes di type 2 diabetes. So far, no studies have been done in which the effect of this molecules have been described on SGZ and hypothalamic neurogenesis. Both the field of endocrinology and metabolism as well as the field of adult neurogenesis may benefit of a study of this type.*

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The work of Jörgensen et al describes the effect of a lipidized analogue of the prolactin releasing peptide (LiPR) on the mouse metabolism in response to high fat diet (HFD) and on hypothalamic and subgranular zone (SGZ) neurogenesis. They conclude that LiPR reduces body weight and improves metabolic parameters affected by HFD as well as it concomitantly stimulates neurogenesis in both niches the SGZ and the hypothalamus. The link between both effects is not demonstrated. The work is well conducted, the hypothesis is interesting and the experimental approach is adequate. The scope is wide and results are interesting, however a few aspects need to be further clarified. The manuscript is well written although the modification of some aspects would facilitate the reading such as the use of non described abbreviations for example.

      Major comments:

      1. One concern in this study is the experimental groups. Authors analyze three groups control,HFD and HFD treated with LiPR. Authors conclude that the effects of LiPR are diet independent. However, given the results obtained by the authors on the effect of LiPR, the main question that arises in here is whether LiPR would have an effect on control mice. It seems tha a group is missing in the experimental design in which control ,mice are treated with LiPR during 7, 21 and the last two weeks of the 4 months. Author must include this information or at least argue the election of the experimental design.
      2. Body weight is found reduced by LiPR as well as other metabolic parameters in mice treated with LiPR during the last two weeks of the 4 Mo HFD. However, no effects on hypothalamic or SGZ neurogenesis are not observed in this experimental group. How do authors explain this results?
      3. In figure 1 I-K images are not clear and better resolution images would help.
      4. Authors conclude that LiPR is increasing the number of NSC by reducing their activation. However, authors show an induced increase in htNSC only in mice fed HFD for 7 days and not in the 21 day fed mice or the 4 mo fed mice (fig 2 d-f). In addition, authors test for the number of cells expressing Ki67 (fig 2 L), however, the number of Ki67+ alpha tanicytes is not shown.
      5. On figure 2B it seems that is alpha 2 tanicytes that are missing in response to HFD.
      6. Are Fig 2 A-C images representative of mice fed HFD for 7 days?
      7. By looking at figure 2B it seems like the proportion of alpha tanicytes is higher in HFD since no or very few tanicytes are observed and almost all of them are alpha tanicytes.
      8. In fig 2 d-f, an increase in the number of GFAP+ alpha tanicytes and its proportion as well as labelled with vimentin is observed in control mice fed with normal diet for 7 days compared with mice fed normal diet for 21 days. How do authors explain this difference?
      9. In fig 2 Why are the differences in RAX, KI67 and PCNA only present in mice fed HFD for 21 days?
      10. Authors test for adult hippocampal neurogenesis in the three groups. DO images in fig S2 correspond to the 21 day treatment group?
      11. On fig S2 C, it seems that in HFD fed mice treated with LiPR newly generated neuroblasts are more differentiated have authors looked at DCX+ cell morphology?
      12. In this same figure, it seems like the number of DCX+ neuroblasts and the number of newly generated neurons is reduced in mice of the 21 d group compared to the 7 day group. Is this statistically significant?
      13. There is a large reduction in the number of DCX+ cells from control 21 d treated mice to control 4 month treated mice. Is this statistically significat? How do authors explain this dramatic reduction?
      14. Authors do not show the effect of HFD on BrdU+ neurons in the Arcuate. However, all data need to be shown.

      Significance

      In general the manuscript includes a great amount of work to demonstrate the effect of LiPR on neurogenesis (hippocampal and hypothalamic). The scope is wide, and the hypothesis is really interesting. Authors may need to solve some issues in order to completely demonstrate their claims and conclusions, but once the work is done, it will be very valuable to understand the effect of pharmacological agents used in the field of endocrinology to treat metabolic disorders such as type 2 diabetes di type 2 diabetes.

      So far, no studies have been done in which the effect of this molecules have been described on SGZ and hypothalamic neurogenesis. Both the field of endocrinology and metabolism as well as the field of adult neurogenesis may benefit of a study of this type.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The authors examine the effect of an anorexigenic drug, LiPR in the context of treatment with high fat diet (HFD) and with a special focus on hypothalamic neural stem/progenitor cells and neurogenesis. The work is mostly based on mice and a barrage of different techniques (confocal imaging, cell cultures with time lapse, gene expression...) are used.

      The results are interesting because they address the yet-poorly understood implication of hypothalamic neurogenesis in food intake and energy balance. The results point at complex effects at different levels (neural stem cells, neurons, division, survival...). The experimental approach is sometimes thorough in the treatment of details on the one hand, it also lacks of consistency on the other, and as a result the conclusions lack strength. There is a number of experiments that sometimes seem unrelated and this hurts the comprehension of the manuscript, specially in lieu of the complexity of the results obtained.

      These are the detailed comments:

      A major issue is the lack of a LiPR-only group, which would much facilitate the interpretation of the results. The effect of LiPR alone is however tested, but only in comparison with the Control in one of the in vitro experiments (S.Fig. 3)

      As plotted, in Fig 1B is difficult to interpret the effect of HFD and LiPR, might be using percentage and noting the statistical differences as in the other would help. It looks like HFD has no effect compared to control on weight and only at the end LiPR could have an effect. On the other hand, after 4 months, HFD mice are clearly above the controls and it is then, albeit when weight gain has reached a plateau, that LiPR has an effect. The election of these arbitrary paradigms and their drawbacks has to be better explained.

      Why was the proportion of GPR10+BrdU+MAP2+ cells only assessed in control mice and no in the experimental groups if its expression in overall neurons changes?

      This suggests that the receptor is expressed in neurons. Interestingly, exposure to 21d HFD reduced density of GPR10, which was rescued by LiPR administration (Fig.1L). Why was this time point chosen and not the longer-term one? What is the consequence of the alterations in the potential number of GPR10, specially in relation to the administration of LiPR?

      This clarification is important because a 14-day treatment was chosen for the in vitro experiments in which LiPR, but not HFD, seems to have an effect on cell proliferation. Might be it would have been more useful to use a paradigm in which HFD has an effect to better compare with in vivo work and for the rationale of the work.

      "Besides GPR10, we co-localized neuronal cytoskeleton structures with NPFFR2 in the MBH (Fig.1O-P)..." Why were not GPR10 and NPFF2 analyzed in a similar and consistent manner ? It is confusing.

      The number of GFAP+ α-tanycytes is not significantly changed by HFD therefore LiPR does not rescue, but rather increases the number of GFAP+ α-tanycytes in the 7-day setting. There are no differences among groups later, the effect is lost by 21 days, therefore there is a transient excess of GFAP+ α-tanycytes which later "disappear" in the LiPR group. The authors state that LiPR rescues the decrease in "htNSCs", but after 21 days the number of the GFAP+ α-tanycytes is the same in all groups without the need of LiPR. There is no experimental follow up (addressing proliferation and survival of these cells) and the conclusions stated in the text (results and discussion) are not really supported by the data. The in vitro experiments could be a complement, but are no substitute for the missing in vivo exploration.

      The fact that cell division is "rarely found" (Rax GFAP) experiments also push for further investigation.

      It is difficult to see that relevance of the inclusion of the vimentin staining experiment if there is no further exploration. The effect of LiPR is only transient, in the 7-day paradigm and as the parameter evaluated is the proportion of vimentin+ tanycytes among GFAP+ tanycytes it could only be reflecting increased expression of the filament. "Nevertheless, we did not observe a statistically different change in the area occupied by Rax+ tanycytes (Fig.2H)."

      Why did the authors use Rax only for this experiment if "GFAP+ α-tanycytes which are considered the putative htNSCs?" What is the justification for not seeing changes in relation to the results reported in Fig 2D-F?

      "Because Vimentin is associated with nutrient transport in cells and with metabolic response to HFD 52-54, we quantified the proportion of GFAP+ tanycytes expressing Vimentin (Fig.2F)." It is difficult to see that relevance of the inclusion of the vimentin staining experiment if there is no further exploration. The effect of LiPR is only transient, in the 7-day paradigm and as the parameter evaluated is the proportion of vimentin+ tanycytes among GFAP+ tanicytes it could only be reflecting increased expression of the filament.

      Why there is no Ki67 experiment in the 7-day paradigm if that is the timepoint in which changes in the number or proportion of GFAP+ tanycytes are observed? PCNA was then used but only in the 21-day paradigm. What is the interpretation and relevance of these data? What are the non-htNSCs proliferating cells, whose dynamics are different from the changes in the number or proportion of htNSCs that could be potentially related to changes in mitosis? Again, I think it would be much useful for the work to explore in detail the changes in the putative htNSCs than investing in experiments that only add confusion.

      The inclusion of Liraglutide + HFD, (not Liraglutide alone) only in some of the experiments is pointless if there is no direct comparison with LiPR and a timepoint is missing. In S.Fig 3, Fig. 5 and S.Fig 7 LFD (low fat diet?) is used in several occasions as in: "on reducing number of PCNA+ cells in 21d protocol (one-way ANOVA (OWA), F(2,12) = 16.66, p = 0.0003) when compared to both LFD and HFD groups". Is this the control diet?

      The final experiment shows that application of hPrRP31, a variation of LiPR, causes an immediate calcium increase in human induced pluripotent stem cell-derived hypothalamic nucleus. This finding is interesting in itself because it brings light about the function of the receptor/s. It would have been very useful to test what other receptors mentioned to bind LiPR is mediating the effect. In any case, the focus of the work are the neural stem/progenitor cells responsible for neurogenesis and the changes in their properties because of HFD and LiPR, therefore I would trade these experiments for a more thorough and detailed dissection of these effects.

      Minor points:

      Introduce "GLP-1RA"

      "HFD-induced inflammation and astrogliosis in the hypothalamus 45,46, whereas the long (4mo) protocol leads to DIO" Are these notions exclusive?

      "LiPR displays no effects on astrocytes" "Displays" is not the correct term.

      Referee cross-commenting

      I think we all referees agree for the most part. The main concern stated by all of us is the lack of a LiPR-alone group. The rest of the concerns are also related or complementary. In my opinion the mostly common view by the referees is reasuring.

      Significance

      The strengths of the work are its novelty in the field and the variety of techniques employed. The work has the potential of unveiling mechanistic insight into the regulation of neural stem/progenitor cells and neurogenesis. The main audience of this work would be the community working on this field. The lack of experiments testing that the changes observed actually participate in food intake prevent the work from being of relevance for a broader audience (food intake, energy balance, obesity...).

      The limitations are the descriptive nature of the work and the lack of a consistent and systematic experimental design that would allow to extract solid conclusions upon to which build upon future research.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, Jorgensen and colleagues describe their findings on the action of a palmitoylated form of prolactin-release peptide (LiPR) on neural stem cells (NSC) in the adult mouse hypothalamus and adult mouse hippocampus. Their main conclusion is that LiPR can counteract the effects of high-fat diet (HFD) and rescue some of the adverse effects of HFD. Specifically, the authors provide evidence that:

      • Exposure to HFD reduces the number of presumptive adult neural stem cells (NSCs) in the adult hypothalamus, whereas exposure to LiPR reverses this trend.
      • The results suggest that LiPR reduces the proliferation of alpha-tanycytes and/or their progeny in the hypothalamus in the context of HFD, with Liraglutide acting similarly. In contrast, while LiPR also suppresses proliferation in the SGZ, Liraglutide works there in the opposite direction.
      • LiPR also helps the survival of adult-born hypothalamic neurons.
      • Reduction of proliferation by LiPR suggests a model where LiPR increases the number of NSCs presumably by reducing their rate of activation.
      • The results suggest that LiPR promotes expression of PrRP receptors in the hypothalamic neurons, suggesting that PrRP may act directly on such neurons (and tanycytes?) in vivo.
      • The authors also show that HFD and LiPR alter gene expression profiles of the MBH cells, with HFD, but not LiPR, inducing myelination-related genes.
      • Finally, they show that PrRP stimulates an increase in Ca2+ in in vitro-derived human hypothalamic neurons.
      • The authors conclude that LiPR may be reducing activation and proliferation of the hypothalamic stem cells and thereby preserve their pool from exhaustion, which was stimulated by HFD. The manuscript presents interesting data and is clearly written. There are several comments, mainly editorial.

      • It is unclear why most of the experiments do not include the control+LiPR group. Even though the focus of the study was the action of LiPR in the context of HFD, questions remain regarding the action of LiPR per se. Is LiPR (or Liraglutide, for that matter) completely inactive on the normal diet background, with respect to neurogenesis in the hypothalamus and the hippocampus? Whether the answer is positive or negative, it would give a much better understanding of the action of LiPR - does it regulate neurogenesis in various physiological contexts, or does it only kick in with a particular type of diet? In fact, this was examined (see Supplementary figures), but only for the cells in culture and, when performed with animals, was limited to 7 and 21 days, rather than 4 months, which would have been much more informative.

      • The question above is also relevant when considering the conclusions on the potential depletion of the stem cell pool (again, whether in the hypothalamus or the hippocampus), particularly at the 4-months time point. The mice are ~6 months old by that time, and neurogenesis in both regions is expected to decrease by that time. Are LiPR or Liraglutide able to suppress or exacerbate this decrease? Can they be used to mitigate this decrease when mice are on a regular diet?
      • A somewhat related issue is that, in most cases, only the percentage or the density of cells are shown on the graphs, rather than the absolute numbers (at least for some cases). This sometimes complicates the comparisons; for instance, does the surface of the hypothalamus change between 2 and 6 months of age? The tanycytes' number stays, apparently, the same (e.g., Fig. 2) but the production of new neurons is supposed to fall dramatically.
      • The authors write "LiPR may prevent stem cells from exhaustion, induced by HFD" - but it is not clear that HFD indeed leads to exhaustion - there is no statistically significant difference in the number of the stem cells (alpha-tanycytes) between the control and HFD or between HFD at 1, 3, or 12 weeks.
      • Numerous papers show that the rate of production of new adult hypothalamic neurons (mainly those derived from beta-tanycytes) drops drastically within the first several weeks of mouse life. Does HFD accelerate, and LiPR mitigate, this decrease? Perhaps one can calculate the numbers from the graphs, but it would help if this is explained in the text of the manuscript. Also, it is not always clear whether specific experiments were performed with the zones of the hypothalamic wall that only contain alpha-tanycytes.
      • A sharp increase in PCNA+ cells in the hippocampus at the 21-day time point, both in the control and in the HFD and HFD/LiPR groups (Fig. S2f) is a little puzzling because neither the Dcx+ nor the Ki67+ cells show this increase.
      • The study deals with several agents and several processes; a simple scheme that summarizes authors' conclusions might help to better understand the relationships between those agents and processes.

      Referee cross-commenting

      I agree, the lack of the LiPR group complicates the interpretation of the results. I also agree that the experiments with vimentin staining, calcium increase, and even with neurospheres do not add much to the main questions that this study attempts to answer, and I'd rather see a more thorough analysis of the activation and differentiation data. I also want to reiterate that the concept of LiPR/PrRP preventing the exhaustion of the hypothalamic stem cell pool is not clear, because it is not shown that this pool does actually get exhausted under normal or HFD conditions. This latter issue again requires the LiPR-alone group. Also, as a clarification - I wrote about 1 month required to compete the revision assuming that the authors actually have the data on the Control+LipR group or at least the specimens available, mainly because the supplementary material shows results with this group, at least with the neurospheres. If this group is fully missing, then the effort will obviously take a longer time.

      Significance

      The provided evidence suggests, for the first time, that PrRP prevents the loss of the neural stem cells population in the adult hypothalamus that was diminished by obesity and HFD. This finding might be interesting to a broad audience.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank both the reviewers for the positive comments, insightful suggestions, and constructive criticisms. We have added new calculations, analyzed new data, added new figures in the main text and the supplementary material, revised the main text and the supplementary text to address the reviewer’s comments. We believe the modifications have improved the quality of the manuscript. Below we append our point-by-point response to the reviewers’ comments.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): * Summary: The paper by Rajakaruna, Desai, and Das develops a multiscale computational model (PASCAR) to study design of features of CAR-T cells. Their ODE-based model captures cell-cell interactions using equilibrium receptor-ligand binding relations and a simplified representation of intracellular signaling. The cellular-scale model feeds into a population model including populations of CAR-T cells, healthy cells, and target cells. The model accounts for CAR-T cells with varying numbers of CARs; it accounts for target/healthy cells with varying numbers of ligands. The authors use published cytometry and cytotoxicity data to parameterize the model, which they show captures experimental trends well when they use a kinetic proofreading model to phenomenologically represent intracellular signaling. They then use an optimization approach to characterize features of the CAR-T cell design space that maximize killing of target cells while minimizing the destruction of healthy cells. Their conclusions are consistent with physical intuition and provide quantitative and generalizable predictions about biophysical parameters (including equilibrium binding constants, kinetic rates, etc.).

      Major comments:

      1. In general, the paper is logically laid out and easy to follow.*

      Thank you for the positive comment.

      However, some of the underlying mechanisms were not clear to me: * * (A) - In Figure 3A, it is not clear why the rate of lysis is greater for populations with an intermediate range of CAR abundances. I understand the authors' statement that "this is because the smaller number of CAR-T cells present in [higher or lower CAR expression groups]..." However, it is not clear why intermediate-level CAR-T cell populations are largest, noting that populations with higher receptor levels have larger proliferation rates. Is this simply reflecting the initial size of the populations, or is another mechanism at play? I think the paper would benefit from discussion/quantification of this.

      We thank the reviewer for the insightful comment.

      We have edited the main text (pages 8-9) and added a supplementary figure (Fig. S4) to address the above comment. The proliferation rate (ρRHUH) for a subpopulation of size TR increases almost linearly with R since ρRH ∝ R when CAR and HER2 interact with high affinity, i.e., KD≪ R and KD≪H. The distribution of CAR abundances at t=0 estimated by our method follows a lognormal distribution, i.e., the CAR T cell subpopulation size at an intermediate value of R is larger than that at larger values of R. However, given the estimated values for ρRHUH (RHUH decreases with time as the number of target cells are lysed by the CAR T cells. Therefore, the peak of the population remains at intermediate values of R values at later times, and both the initial distribution and the relatively smaller values of the estimated proliferation rate are responsible for the behavior.

      *(B) - In Figure 2, C_N plateaus at HER2 density between 10^3 and 10^4. However, % lysis does not plateau until a density closer to 10^5. What is the underlying mechanism? I think the paper would benefit from its exploration.

      *

      Thank you for the comment.

      We have modified the Figure 2 to show the percentage lysis at intermediate values of the HER2 density. The percentage lysis plateaus at similar HER2 concentrations as CN which is expected as the lysis and proliferation rates are proportional to CN. We have modified the text to explain the behavior.

      • It is likely that CAR-T cells would encounter various ratios of target and healthy cells depending on patient, microenvironment, in vitro experimental design, etc. My understanding is that the optimization was done with equal numbers of healthy and target cells. It would be useful to explore how sensitive the optimization is to the ratio of target and healthy cells. This could provide useful design guidance to experimentalists.

      *

      Thank you for the comment.

      We have carried out our Pareto front calculations at different healthy and tumor cell ratios namely, 1:4 and 4:1. The Pareto fronts show similar behavior as that shown for the 1:1 ratio in Figure 4 with small vertical and horizontal shifts in the curves compared to the 1:1. We have shown these additional results in the main text (page 11) and the Figure S8 in the supplementary material.

      • Two assumptions of the population model initially surprised me. However, given the strong performance of the model, they seem to be well justified. Could the authors address the following with brief discussion?

      (A) - The model essentially assumes a well-mixed population of cells, treating lysis and proliferation as second-order "reactions." However, individual cells likely encounter relatively few cells on the time scale of simulations. *

      This is an excellent point.

      We have added a supplementary text (Supplementary Text 3) and the text below in the Discussion section (page 14) to address the above comment.

      PASCAR also assumes that the target and the T cells are well mixed. In vitro cytotoxicity experiments are carried out in culture wells and for the experiments in Hernandez-Lopez et al.6 Our estimates show that 99.8% of the T cells were partnered with target cells (details in Supplementary Text 3). However, depending on the number of target and T cells, the number of target cells in the immediate vicinity of a T cell is likely to be varied (details in Supplementary Text 3), therefore, a weighted sum for the target and T cells in Eq. (3)-(4) would be more appropriate. We plan to include that in a future study.

      (B) - The model doesn't include "mixing" of CAR-T cell populations upon proliferation (i.e., a cell with R receptors can't divide and result in cell with a different number of receptors). Is this justified by the biology?

      We thank the reviewer for raising this excellent point.

      We have added the text below in the Discussion section (page 14) to address the above comment.

      PASCAR assumes that the CAR abundances in single CD8+ T cells do not mix as they divide, i.e., daughter cells have the same CAR abundances as the mother cell. However, proteins in human cells (e.g., H1299 non-small cell lung carcinoma cell line) have been observed to mix due to cell division (Sigal et al., 2006) in time scales longer than two cell generations. It is unclear if the CARs follow the similar pattern as the CD8+ T cells proliferate. The doubling time scale for the faster proliferating CD8+ T cells in our model is ~1.7 days and the mean doubling time of the CD8+ T cell population is ~3 days, therefore, there will a negligible amount of mixing in the system due to cell proliferation if a similar mixing time scale as in Sigal et al. (Sigal et al., 2006) occurs for the CAR CD8+ T cells.

      *Minor comments

      1. A couple of figures appear to be mis-referenced in the paper: Figure 2D (end of paragraph, page 7) should presumably be Figure 2E, and Figure S3 should be S2 (end of page 7).*

      Done.

      • I don't know what "conv." stands for in the figures (I couldn't find the abbreviation in the captions or main text). *

      We have changed all the “conv” abbreviations to “const.” indicating constitutive CAR T cells.

      • Last pargraph of page 9: "However, decreasing K_D further starts decreasing lysis..." Given the previous sentences, this should presumably say "...increasing K_D further..."*

      Done.

      • I was initially confused by the second sentence of the last paragraph of Results. Based on the previous paragraph, I expected the sentence to read "when K_D increased" (not decreased) because of the statement "similar to constitutive CAR-T cells..." However, I think the underlying argument/conclusion is the same.*

      Done.

      • It is not completely clear to me what is being plotted in Figures 2D, 4B, and S1. Where do each of the points come from? Why do there appear to be sets of 4 points when there are more experimental data points in 2C?*

      Thank you for the comment.

      We have edited the figures and the captions to address the comment.

      • What were the values of $\Delta_R$ and $\Delta_H$? (Or, alternatively, how many bins were chosen?) *

      We have shown the ΔH and ΔR values in Figures S10-11 in the supplementary material.

      7. It would be useful to define $\mu$ and $\sigma$ in the main text before they are introduced in Table 1.

      Done.

      *Reviewer #1 (Significance (Required)):

      The paper addresses an important and timely problem, given the strong interest in designing CAR-T cells for cancer therapy. This paper adds to existing computational approaches (clearly summarized in the intro) by introducing a multiscale framework that includes cellular-level properties - like CAR binding affinities, etc. - with a population model that is important for capturing collective behavior of many cells. It is parameterized by experimental data and provides a framework for optimizing cells to maximize target cell killing while minimizing off-target killing of healthy cells. This will be of interest to computational groups in the field, can be extended to incorporate additional biology and/or data, and has the potential to provide useful guidance to experimental design of CAR-T cells. It could be highly impactful if combined with experiments in the future.*

      We appreciate the positive comment.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): * Summary :

      In this study, Rajakaruna et al. propose a mathematical modeling framework called PASCAR to simulate the response of T cells engineered to express chimeric antigen receptors (CAR) against the oncogenic marker HER2 on target cells. The authors propose that the degree of T cell activation is given by a simple CAR occupancy model in the presence or absence of additional kinetic proofreading steps. A population-level ODE model is then used to describe proliferation and death of both target cells and T cells on longer time-scales as a function of the degree of T cell activation.

      The model results are compared with recent experiments by Fernandez-Lopez et al. 2021 (ref. 6). showing that T cells respond to HER2 abundance on target cells in an ultrasensitive manner when using a circuit where a low-affinity synthetic Notch receptor (synNotch) for HER2 controls the expression of a high-affinity CAR for HER2. With this synNotch-CAR circuit, T cells are able to kill tumor cells with high HER2 abundance while sparing healthy cells with 100 fold less HER2.

      The authors first fit model parameters in the situation where T cells constitutively express CARs of either low (Kd=210nM) or high (Kd=17.6nM) affinity and suggest that 7 kinetic proofreading steps are needed to account for the experimental data. For the situation where T cells are endowed with the synNotch-CAR circuit, the authors implicitly account for ultrasensitivity by assuming that CAR abundance is proportionnal to a Hill function of HER2 abundance on target cells. Using this asumption, they fit model parameters to experimental data. The authors use the model to predict the response (%lysis in target cells) for different initial numbers of T cells not used in the fitting procedure and conclude that the PASCAR model can generalize well to unseen situations.

      The authors finally perform pareto optimization to investigate how optimization of lysis of tumor cell with high HER2 abundance and sparing of healthy cells with low HER2 can be performed simultaneously. They conclude by suggesting parameters values of the synNotch-CAR circuit optimizing the discrimination between healthy and tumor cells. * Major comments :

      1(A) - In Figure 2A, the error bars are not properly drawn : the whiskers are not horizontal, not aligned and seem to have been placed manually. Some points and error bars are found outside plot limits. This is intriguing and suggests that this figure was edited manually. Error bars do not seem to agree with the original experimental data.

      Thank you for pointing this out. We have modified Figure 2A. The extracted experimental data from Hernandez-Lopez et al.6 and the corresponding error bars are also provided in in an excel data file ”Error_bars_%lysis_&Predictions” available at the GitHub link.

      *(B) The lines corresponding to the model results should be drawn using many more points(as compared to experimental results) to better illustrate the model behavior over the range of HER2 abundance values represented. Here, the representation of the model result is misleading (it suggests a linear increase of the %lysis between the 10^3 and 10^5 HER2 molecules/cell). *

      Done. Reviewer 1 also pointed to this in Major comment #1B. We have modified Figures 2A-D,G and Figures 4A,D,F to address this. Please refer to our response to Reviewer #1 for details.

      (C)The number of target and CAR T cells should be modified to correspond to those used in the original experiment (100000 target cells and 15000 CAR T cells for the model versus 20000 target cells and 10000 CAR T cells in the experiments).

      The numbers (20000 of target cells and 10000 CAR T cells) we used in our model are taken from Hernandez-Lopez (see figure caption of Fig. 2 (page 2) in Hernandez-Lopez et al.). In addition, we reached out to Dr. Hernandez-Lopez and Dr. Wendell Lim to confirm the numbers of target cells and CAR T cells used in the experiments.

      2 - An error is found in the expression of CN in the KP model. Indeed, Kd_tilde should be equal to Kd. Given that the authors do not provide the details of their calculation, it is not clear where the error comes from. A potential source of error could be the absence of the dissociation reaction of the CN complex in Fig.1 (see minor comments). The authors should correct the error and re-run the model with the correct expression for CN.

      Thank you for raising this point.

      The expressions shown in Eqs. 1 and 2 in our original manuscript is correct, however, it can be further simplified to get an expression where Kd_tilde is equal to K_d. We have included a detailed derivation of the equations in the supplementary material (Supplementary Text 1).

      3(A) - The conversion scheme used to convert the association rate k_on (and also of the dissociation Kd) from units 1/(nM . s) to units 1/(molecules per cell . s) is not appropriate. Indeed, association rates depend on the diffusion of molecules which greatly differs between soluble (SPR measurements) and membrane-bound molecules. These different diffusion properties should be taken into account for the conversion.

      We thank the reviewer for raising this point.

      We have modified the main text (page 7) and added additional calculations (Supplementary Text 2) and a figure (Figure S1) in the supplementary material to address the comment. Briefly, we evaluated the role of diffusion in modifying the binding (k_on) and unbinding (k_off) rates following the approach developed by Eigen, Bell, Keizer, and others and found that for the rates used in Hernandez-Lopez et al, the changes in the rates are less than 20%, which does not lead to appreciable changes in in CN (Fig. S1). Therefore, including the effect of diffusion will affect the percentage lysis negligibly in this case.

      *(B) Moreover, the conversion formula was found to give a Kd of 3.2 molecules/cell for the high affinity CARs and of 39 molecules/cell for the low affinity CARs. This information is important to interpret the results and should appear in the main text. As such, these Kd estimates are far below the typical number of CARs on T cells (10^3) and of HER2 ligands (from 10^3 to 10^6) on target cells. In this situation, the number of HER2:CAR complexes is entirely determined by the limiting component (HER2 or CAR) and does not depend on Kd (as shown in Fig.2B). Estimates of Kd in the 10^3 molecules/cell range would produce T cell responses that depend on Kd and potentially provide a good agreement between the NKP model and the experimental results shown in Fig.2A. The authors should therefore re-evaluate the performances of the NKP model. *

      We agree with the reviewer regarding the above comment.

      We have moved the conversion of K_D to the unit of molecules/cell. As we point out in our response to the previous comment, including the effect of diffusion in the reactions does not change the K_d appreciably and therefore, the NKP model would be unable to fit the results (% Lysis) shown in Fig 2A.

      4(A) - KP model : The authors make a confusion about the performance of the KP model when stating : "The estimated value of the phosphorylation rate, kp (≈ 0.007 s -1 ) is larger than the ligand unbinding rate koff (≈ 10^-4 s^-1 ) indicating that the kinetic proofreading scheme is active in separating CAR-T cell responses across high and low affinity CARs". KP ligand discrimination is efficient when kp is much smaller than koff which is not the case here. To compensate for this inefficient discrimination, a large number N of proofreading steps is needed.

      Thank you for the comment.

      We have edited the sentence to address the comment (bottom of page 9 in the main text).

      (B) The rate kp=7e-3 s^-1 sets a time-scale 1/kp = 2.5 min. The typical time scale for activation would then be N/kp = 17.5min which is much larger than the time-scale at which the KP mechanism operates during normal TCR signaling following pMHC-TCR engagement. Indeed, during TCR signaling, KP operates within a few tens of seconds as recently illustrated in a study by Mc Affee et al. (https://doi.org/10.1038/s41467-022-35093-9*) showing that LAT condensates appear typically 20 to 30 seconds following TCR engagement. *

      Thank you for the comment and the reference.

      We have edited the discussion to incorporate the above comment (last paragraph in page 12 in the main text).

      5 - The authors should modify Fig.2D to produce a separate graph for each variable ("%lysis", "mean" and "var"). Indeed, differences are potentially hidden by plotting variables with different scales on the same graph. For the comparison of the % lysis between data and model, it would be helpful to have colors and shapes as in Fig.2A and Fig.2C. The authors should also represent the experimental and theoretical distributions of CAR molecules / T cell for the different experimental conditions (different abundance of HER2/target cell).

      Done.

      We have included Figures 2E and 4C in the main text to show comparisons between the means and variances.

      6 - The "Cost" function in the methods section seems to be defined for only one experimental condition (corresponding to a given HER2 abundance). Please indicate that it is the sum over all experimental conditions that is minimized. Author show in Fig.2A the variable (%lysis) used in the cost function. Importantly, the other variables (mean and variance of CAR abundance at day 3) should also be plotted to help the reader appreciate the agreement between model and data.

      Done.

      We have edited the equation in page 15 in the main text to reflect the sum in the cost function.

      We have included figures (Figs. 2F, 2H, 4B) in the main text and the supplementary material (Fig. S2A ) in the supplementary material quantifying comparisons between the data and our model.

      7 - The author should quantify the goodness of the fit and analyze the sensitivity of the model results (the "Cost" function) with respect to parameter values. An investigation of the sensitivity of the model output as of function of all pairs of parameters would certainly highlight the fact that the estimates of parameters kp and N are correlated.

      Done.

      We have calculated correlations between the estimated parameters to address this. The results are shown in the main text (pages 10 and 17) and in Fig. S5 in the supplementary material.

      8 - To model the ultrasensitive synNotch-CAR circuit, the authors assume that CAR expression is a Hill function of HER2 abundance on target cells. The parameters of this Hill function are estimated by fitting both the % lysis and CAR expression at day 3. The authors should evaluate the agreement between model results and experimental values by plotting CAR expression at day 3 (using CAR expression data from Supplementary Figure 1C in ref.6).

      Done.

      We have included the comparisons in Figure S12 in the supplementary material and mentioned those in the figure legend for Fig. 4 in the main text.

      9 - In Figure 4C, for 12000 and 15000 T cells, experimental results show a non-ultrasensitive response (also Supp.Fig.S4E in ref 6) which does not agree well with the model results. Hence, the authors claim that the agreement is good does not seem to be supported. The model should also be tested using experimental data where synNotch and CAR receptors with different affinities are used (in particular Supp.Fig.S4D in ref.6 where a Hill coefficent of 0.6 is estimated for the med-low circuit). It will also be of interest to show that the model can reproduce results from Supp.Fig.S5A in ref.6 where cells with high and low CAR expression are used.

      Thank you for the comment.

      We have calculated the goodness of the fit R2 for our predictions of Fig. S4E in ref. 6 and our R2 = 0.97 suggest excellent agreement with the data. However, we agree that the data for E:T= 0.75 or E:T=0.6 in Fig. S4E in ref. 6 can be interpreted as a gradual increase, however, additional experiments at HER2 abundances 104 molecules/cell probably would be able to help distinguish a ultrasensitive response vs a gradual response at these E:T ratios.

      We have tested model predictions for synNotch CAR T cells for higher affinity CAR (Fig. S4D, top panel, in ref. 6) which shows excellent agreement (Fig. 4F in our revised manuscript). We were unable to generate any prediction for the med-low synNotch circuit (Fig. S4D, bottom panel, in ref. 6) as the CAR expressions for the med-low synNotch circuit are not available in the manuscript. However, we have tested new model predictions (Figs. 2G-H) for constitutive CAR T cells (Fig. S5A in ref. 6) for high and low CAR expressions at different E:T ratios. The agreement between the data and the predictions is reasonable (R2 = 0.90) . Therefore, we believe we have confronted our model with responses generated by several types of CAR T cells and the excellent to reasonable agreements of the PASCAR model with the data provide confidence in the utility of our framework to investigate CAR T cell responses in vitro.

      Minor comments :

      *Figure 1 : left : The schematic of the CAR receptor is inaccurate. CD3z domains should be shown within the intra-cytoplasmic part of the receptor, and not as separate proteins. In addition to the CD3z domain, the 41BB domain should also be represented (see ref 6 by Fernadez-Lopez at al.). The arrow correspond to the dissociation of the complex C_N is missing. Without this reaction in the KP model, the steady state solution leads to C_i = 0 for i in [0, N-1]. All receptor-ligand complexes eventually reach and stay in the C_N state. *

      We thank the reviewer for catching this.

      We have made changes in the schematic figure to include the changes suggested above.

      middle: In the schematic, add labels "lysis of target cell" and "proliferation" next to the corresponding parameters. The arrows should point from the label ("cancer cell" and "CAR-T cell") to the cell not to the other way around.

      Done.

      Right : this schematic is not useful and should either be removed or completed to provide useful information to the reader.

      Done.

      *Figure 2 : A - A reference to the article with the original data should be added in the legend. In line with the original article, "conv." should be replaced by "const." as an abbreviation for "constitutive". B and E - Please use a log scale for the y-axis. Have the authors represented an average of C0 and CN across the population at day 3? If so, that information should appear in the figure legend. *

      Done.

      Figure 3. To help the reader interpret these graphs, the authors should also show T_R(t) and U_H(t) on separate graphs. It would also be useful to show C_N as a function of R for H=10^6.2 both for high and low affinity CAR.

      Done.

      Figure 4. A - the number of target cells and CAR T cells do not correspond to those used in the original experiment (see major comment 1).

      Done. Please check our response to comment #1(B) for Reviewer #2.

      *B - Same comments as for Fig.2D. The legend appears to be incorrect ("% lysis" should be blue open circle and orange open squares). *

      Done.

      *C - Use more points to plot the model results. *

      These figures have all the points plotted. However, some points are overlapping with some other.

      Reviewer #2 (Significance (Required)):

      The modeling framework is minimal but appropriate to describe CAR T cell activation and subsequent proliferation and lysis of target cells. The advantage of the simplicity of the model formulation is to allow a direct interpretation of the impact of the different parameters on the model output.

      Thank you for the positive remark.

      *However, the authors seldom discuss how the behavior of the model is controlled by the parameters and their values. Accordingly, the analysis of the theoretical results needs to be further developed. The authors should also quantify the goodness of fit and analyze the sensitivity of model results to parameter values. This will allow to evaluate how the experimental data constrain model parameters and to compare the performances of the different models. *

      We have provided further explanation for some of the results obtain using our model (please refer to responses to comments # 1A, 3A, and 2B) for Reviewer 1), added a correlation analysis for the estimated parameters (Fig. S5 in the supplementary material), and included goodness of the fit (R2 values) for the fits and the model predictions. We believe these new results address the reviewers’ comments.

      The authors should also assess the biological significance of their results by confronting their parameter estimates to related parameter estimates used in other models of T cell activation. The model should further be tested in other situations with different receptor affinities and cell numbers.

      Thank you for the comment.

      We have now tested new predictions for a highest affinity synN-CAR (Figure 4F) and for increasing and decreasing CAR abundances at different E:T ratios (Figure 2G-H). There are few models of CAR T cells (e.g., Rohrs et al. iScience, 2020) which use more detailed signaling models. Therefore, it will be difficult to compare the estimated values of parameters in our model and with those models. The time scales of signaling can also depend on the specifics of the CAR construct. Therefore, though it will be useful to compare different models and their parameter values developed so far, we believe this is outside the scope of this manuscript. We have included some potential directions for extending our current framework in the Discussion section (pages 12-14). If the editor and the reviewer strongly feel the need for including this in the current manuscript, we can do that.

      This research should be of interest to readers specialized in the field of mathematical modeling of biological systems and in CAR-T cell immunotherapies.

      Thank you for the positive comment.

      *Fields of expertise of the reviewer : biophysics, mathematical modeling of biological systems, molecular mechanisms of T cell signaling and activation. *

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      In this study, Rajakaruna et al. propose a mathematical modeling framework called PASCAR to simulate the response of T cells engineered to express chimeric antigen receptors (CAR) against the oncogenic marker HER2 on target cells. The authors propose that the degree of T cell activation is given by a simple CAR occupancy model in the presence or absence of additional kinetic proofreading steps. A population-level ODE model is then used to describe proliferation and death of both target cells and T cells on longer time-scales as a function of the degree of T cell activation.

      The model results are compared with recent experiments by Fernandez-Lopez et al. 2021 (ref. 6). showing that T cells respond to HER2 abundance on target cells in an ultrasensitive manner when using a circuit where a low-affinity synthetic Notch receptor (synNotch) for HER2 controls the expression of a high-affinity CAR for HER2. With this synNotch-CAR circuit, T cells are able to kill tumor cells with high HER2 abundance while sparing healthy cells with 100 fold less HER2.

      The authors first fit model parameters in the situation where T cells constitutively express CARs of either low (Kd=210nM) or high (Kd=17.6nM) affinity and suggest that 7 kinetic proofreading steps are needed to account for the experimental data. For the situation where T cells are endowed with the synNotch-CAR circuit, the authors implicitly account for ultrasensitivity by assuming that CAR abundance is proportionnal to a Hill function of HER2 abundance on target cells. Using this asumption, they fit model parameters to experimental data. The authors use the model to predict the response (%lysis in target cells) for different initial numbers of T cells not used in the fitting procedure and conclude that the PASCAR model can generalize well to unseen situations.

      The authors finally perform pareto optimization to investigate how optimization of lysis of tumor cell with high HER2 abundance and sparing of healthy cells with low HER2 can be performed simultaneously. They conclude by suggesting parameters values of the synNotch-CAR circuit optimizing the discrimination between healthy and tumor cells.

      Major comments:

      1. In Figure 2A, the error bars are not properly drawn : the whiskers are not horizontal, not aligned and seem to have been placed manually. Some points and error bars are found outside plot limits. This is intriguing and suggests that this figure was edited manually. Error bars do not seem to agree with the original experimental data. The lines corresponding to the model results should be drawn using many more points(as compared to experimental results) to better illustrate the model behavior over the range of HER2 abundance values represented. Here, the representation of the model result is misleading (it suggests a linear increase of the %lysis between the 10^3 and 10^5 HER2 molecules/cell). The number of target and CAR T cells should be modified to correspond to those used in the original experiment (100000 target cells and 15000 CAR T cells for the model versus 20000 target cells and 10000 CAR T cells in the experiments).
      2. An error is found in the expression of CN in the KP model. Indeed, Kd_tilde should be equal to Kd. Given that the authors do not provide the details of their calculation, it is not clear where the error comes from. A potential source of error could be the absence of the dissociation reaction of the CN complex in Fig.1 (see minor comments). The authors should correct the error and re-run the model with the correct expression for CN.
      3. The conversion scheme used to convert the association rate k_on (and also of the dissociation Kd) from units 1/(nM . s) to units 1/(molecules per cell . s) is not appropriate. Indeed, association rates depend on the diffusion of molecules which greatly differs between soluble (SPR measurements) and membrane-bound molecules. These different diffusion properties should be taken into account for the conversion.

      Moreover, the conversion formula was found to give a Kd of 3.2 molecules/cell for the high affinity CARs and of 39 molecules/cell for the low affinity CARs. This information is important to interpret the results and should appear in the main text. As such, these Kd estimates are far below the typical number of CARs on T cells (10^3) and of HER2 ligands (from 10^3 to 10^6) on target cells. In this situation, the number of HER2:CAR complexes is entirely determined by the limiting component (HER2 or CAR) and does not depend on Kd (as shown in Fig.2B). Estimates of Kd in the 10^3 molecules/cell range would produce T cell responses that depend on Kd and potentially provide a good agreement between the NKP model and the experimental results shown in Fig.2A. The authors should therefore re-evaluate the performances of the NKP model. 4. KP model : The authors make a confusion about the performance of the KP model when stating : "The estimated value of the phosphorylation rate, kp (≈ 0.007 s -1 ) is larger than the ligand unbinding rate koff (≈ 10^-4 s^-1 ) indicating that the kinetic proofreading scheme is active in separating CAR-T cell responses across high and low affinity CARs". KP ligand discrimination is efficient when kp is much smaller than koff which is not the case here. To compensate for this inefficient discrimination, a large number N of proofreading steps is needed.

      The rate kp=7e-3 s^-1 sets a time-scale 1/kp = 2.5 min. The typical time scale for activation would then be N/kp = 17.5min which is much larger than the time-scale at which the KP mechanism operates during normal TCR signaling following pMHC-TCR engagement. Indeed, during TCR signaling, KP operates within a few tens of seconds as recently illustrated in a study by Mc Affee et al. (https://doi.org/10.1038/s41467-022-35093-9) showing that LAT condensates appear typically 20 to 30 seconds following TCR engagement. 5. The authors should modify Fig.2D to produce a separate graph for each variable ("%lysis", "mean" and "var"). Indeed, differences are potentially hidden by plotting variables with different scales on the same graph. For the comparison of the % lysis between data and model, it would be helpful to have colors and shapes as in Fig.2A and Fig.2C. The authors should also represent the experimental and theoretical distributions of CAR molecules / T cell for the different experimental conditions (different abundance of HER2/target cell). 6. The "Cost" function in the methods section seems to be defined for only one experimental condition (corresponding to a given HER2 abundance). Please indicate that it is the sum over all experimental conditions that is minimized. Author show in Fig.2A the variable (%lysis) used in the cost function. Importantly, the other variables (mean and variance of CAR abundance at day 3) should also be plotted to help the reader appreciate the agreement between model and data. 7. The author should quantify the goodness of the fit and analyze the sensitivity of the model results (the "Cost" function) with respect to parameter values. An investigation of the sensitivity of the model output as of function of all pairs of parameters would certainly highlight the fact that the estimates of parameters kp and N are correlated. 8. To model the ultrasensitive synNotch-CAR circuit, the authors assume that CAR expression is a Hill function of HER2 abundance on target cells. The parameters of this Hill function are estimated by fitting both the % lysis and CAR expression at day 3. The authors should evaluate the agreement between model results and experimental values by plotting CAR expression at day 3 (using CAR expression data from Supplementary Figure 1C in ref.6). 9. In Figure 4C, for 12000 and 15000 T cells, experimental results show a non-ultrasensitive response (also Supp.Fig.S4E in ref 6) which does not agree well with the model results. Hence, the authors claim that the agreement is good does not seem to be supported. The model should also be tested using experimental data where synNotch and CAR receptors with different affinities are used (in particular Supp.Fig.S4D in ref.6 where a Hill coefficent of 0.6 is estimated for the med-low circuit). It will also be of interest to show that the model can reproduce results from Supp.Fig.S5A in ref.6 where cells with high and low CAR expression are used.

      Minor comments:

      Figure 1 : left : The schematic of the CAR receptor is inaccurate. CD3z domains should be shown within the intra-cytoplasmic part of the receptor, and not as separate proteins. In addition to the CD3z domain, the 41BB domain should also be represented (see ref 6 by Fernadez-Lopez at al.). The arrow correspond to the dissociation of the complex C_N is missing. Without this reaction in the KP model, the steady state solution leads to C_i = 0 for i in [0, N-1]. All receptor-ligand complexes eventually reach and stay in the C_N state.

      middle: In the schematic, add labels "lysis of target cell" and "proliferation" next to the corresponding parameters. The arrows should point from the label ("cancer cell" and "CAR-T cell") to the cell not to the other way around.

      Right : this schematic is not useful and should either be removed or completed to provide useful information to the reader.

      Figure 2 : A - A reference to the article with the original data should be added in the legend. In line with the original article, "conv." should be replaced by "const." as an abbreviation for "constitutive". B and E - Please use a log scale for the y-axis. Have the authors represented an average of C0 and CN across the population at day 3? If so, that information should appear in the figure legend.

      Figure 3. To help the reader interpret these graphs, the authors should also show T_R(t) and U_H(t) on separate graphs. It would also be useful to show C_N as a function of R for H=10^6.2 both for high and low affinity CAR.

      Figure 4. A - the number of target cells and CAR T cells do not correspond to those used in the original experiment (see major comment 1). B - Same comments as for Fig.2D. The legend appears to be incorrect ("% lysis" should be blue open circle and orange open squares). C - Use more points to plot the model results.

      Significance

      The modeling framework is minimal but appropriate to describe CAR T cell activation and subsequent proliferation and lysis of target cells. The advantage of the simplicity of the model formulation is to allow a direct interpretation of the impact of the different parameters on the model output. However, the authors seldom discuss how the behavior of the model is controlled by the parameters and their values. Accordingly, the analysis of the theoretical results needs to be further developed. The authors should also quantify the goodness of fit and analyze the sensitivity of model results to parameter values. This will allow to evaluate how the experimental data constrain model parameters and to compare the performances of the different models. The authors should also assess the biological significance of their results by confronting their parameter estimates to related parameter estimates used in other models of T cell activation. The model should further be tested in other situations with different receptor affinities and cell numbers.

      This research should be of interest to readers specialized in the field of mathematical modeling of biological systems and in CAR-T cell immunotherapies.

      Fields of expertise of the reviewer: biophysics, mathematical modeling of biological systems, molecular mechanisms of T cell signaling and activation.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary: The paper by Rajakaruna, Desai, and Das develops a multiscale computational model (PASCAR) to study design of features of CAR-T cells. Their ODE-based model captures cell-cell interactions using equilibrium receptor-ligand binding relations and a simplified representation of intracellular signaling. The cellular-scale model feeds into a population model including populations of CAR-T cells, healthy cells, and target cells. The model accounts for CAR-T cells with varying numbers of CARs; it accounts for target/healthy cells with varying numbers of ligands. The authors use published cytometry and cytotoxicity data to parameterize the model, which they show captures experimental trends well when they use a kinetic proofreading model to phenomenologically represent intracellular signaling. They then use an optimization approach to characterize features of the CAR-T cell design space that maximize killing of target cells while minimizing the destruction of healthy cells. Their conclusions are consistent with physical intuition and provide quantitative and generalizable predictions about biophysical parameters (including equilibrium binding constants, kinetic rates, etc.).

      Major comments:

      1. In general, the paper is logically laid out and easy to follow. However, some of the underlying mechanisms were not clear to me:

      2. In Figure 3A, it is not clear why the rate of lysis is greater for populations with an intermediate range of CAR abundances. I understand the authors' statement that "this is because the smaller number of CAR-T cells present in [higher or lower CAR expression groups]..." However, it is not clear why intermediate-level CAR-T cell populations are largest, noting that populations with higher receptor levels have larger proliferation rates. Is this simply reflecting the initial size of the populations, or is another mechanism at play? I think the paper would benefit from discussion/quantification of this.

      3. In Figure 2, C_N plateaus at HER2 density between 10^3 and 10^4. However, % lysis does not plateau until a density closer to 10^5. What is the underlying mechanism? I think the paper would benefit from its exploration.
      4. It is likely that CAR-T cells would encounter various ratios of target and healthy cells depending on patient, microenvironment, in vitro experimental design, etc. My understanding is that the optimization was done with equal numbers of healthy and target cells. It would be useful to explore how sensitive the optimization is to the ratio of target and healthy cells. This could provide useful design guidance to experimentalists.
      5. Two assumptions of the population model initially surprised me. However, given the strong performance of the model, they seem to be well justified. Could the authors address the following with brief discussion?

      6. The model essentially assumes a well-mixed population of cells, treating lysis and proliferation as second-order "reactions." However, individual cells likely encounter relatively few cells on the time scale of simulations.

      7. The model doesn't include "mixing" of CAR-T cell populations upon proliferation (i.e., a cell with R receptors can't divide and result in cell with a different number of receptors). Is this justified by the biology?

      Minor comments

      1. A couple of figures appear to be mis-referenced in the paper: Figure 2D (end of paragraph, page 7) should presumably be Figure 2E, and Figure S3 should be S2 (end of page 7).
      2. I don't know what "conv." stands for in the figures (I couldn't find the abbreviation in the captions or main text).
      3. Last pargraph of page 9: "However, decreasing K_D further starts decreasing lysis..." Given the previous sentences, this should presumably say "...increasing K_D further..."
      4. I was initially confused by the second sentence of the last paragraph of Results. Based on the previous paragraph, I expected the sentence to read "when K_D increased" (not decreased) because of the statement "similar to constitutive CAR-T cells..." However, I think the underlying argument/conclusion is the same.
      5. It is not completely clear to me what is being plotted in Figures 2D, 4B, and S1. Where do each of the points come from? Why do there appear to be sets of 4 points when there are more experimental data points in 2C?
      6. What were the values of $\Delta_R$ and $\Delta_H$? (Or, alternatively, how many bins were chosen?)
      7. It would be useful to define $\mu$ and $\sigma$ in the main text before they are introduced in Table 1.

      Significance

      The paper addresses an important and timely problem, given the strong interest in designing CAR-T cells for cancer therapy. This paper adds to existing computational approaches (clearly summarized in the intro) by introducing a multiscale framework that includes cellular-level properties - like CAR binding affinities, etc. - with a population model that is important for capturing collective behavior of many cells. It is parameterized by experimental data and provides a framework for optimizing cells to maximize target cell killing while minimizing off-target killing of healthy cells. This will be of interest to computational groups in the field, can be extended to incorporate additional biology and/or data, and has the potential to provide useful guidance to experimental design of CAR-T cells. It could be highly impactful if combined with experiments in the future.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would like to thank all reviewers for their time and effort invested into reviewing our manuscript.

      Please find our responses to your comments, criticisms and suggestions below in blue.

      __Reviewer #1 (Evidence, reproducibility and clarity (Required)): __

      Summary:

      The manuscript by Vishwanatha et al. presents findings on the fission yeast transcription factor Cbf11, which is involved in regulating lipid synthesis. Changes in lipid metabolism often have detrimental effects on nuclear division (evidenced by the high percentage of cut phenotypes among strains with altered lipid content). Here the authors show that cbf11 deletion strains produce additional phenotypes such as changes to cohesion dynamics and altered chromatin modification within centromeric regions, in turn perhaps affecting microtubule attachment and proper chromosome distributions. This hypothesis is supported by the authors' finding of epistatic effects between cbf11 and cohesin loading and unloading.

      Major comments:

      While the evidence presented supports the hypothesis of altered cohesin loading as a major driver of observed mitotic defects, changes in the NE surface area are likely to also contribute to the phenotypes even in pre-anaphase stages.

      • This is an interesting notion. We are only aware of NE overproduction and nuclear “flares” observed upon the Lipin phosphatase dysregulation (PMID 23873576).

      • However, in our case we rather expect NE membrane shortage, not overproduction. Accordingly, we do see that the nuclear cross section area (thus likely also NE surface area) is smaller in cbf11KO compared to WT (see boxplots below). Is this what you are referring to? We are not sure how this would affect the pre-anaphase stages of mitosis.

      Did the authors test any double deletions with regulators involved in decreasing lipid content (e.g. spo7, nem1, ned1) to counteract the role of Cbf11? This could be useful in assessing the relative contribution of cohesion dynamics and histone modifications.

      • We previously published (PMID: 27687771) that cut6/ACC overexpression can indeed partially suppress the cut phenotype in the cbf11KO background. So lipid metabolism does play a role and does contribute to mitotic fidelity. In the current manuscript, we are showing that other factors contribute as well and that defects arise already prior to anaphase, which is not consistent with the simple notion of shortage of membrane building blocks during anaphase. We appreciate your suggestion on testing the relative contributions of these various factors to mitotic fidelity, but we have not tested any of the suggested double mutants.

      A possible role of physical constraints dictated by the NE was already mentioned by the authors in the context of spindle bending and decreased elongation rates and some preliminary experimental data on this would be appreciated. Generation of strains, acquisition of some timelapses, and quantification of spindle elongation rate/buckling frequency should be feasible in a reasonable time frame.

      • Assaying spindle parameters in Lipin-related mutants would indeed be interesting, but again, these are anaphase phenotypes. We are not sure how this is relevant for the pre-anaphase findings we report? Also, we unfortunately no longer have the personnel and capacity to carry out the suggested experiments.

      The authors report mRNA levels of the centromere flanking genes per1 and sdh1 to be increased by 1.5x and decreased by 2x in comparison to WT. Could the authors elaborate on whether this is an expected trend? Kaufmann et al., 2010 reported low transcription of per1 when the surrounding regions are predominantly acetylated. Fig. 4A suggests a slight increase of H3K9ac at per1 and a decrease of transcription would be conceivable.

      • We do not have any particular expectations regarding the expression levels of per1 and sdh1 in our system. We simply note that their expression changes in cbf11KO (in different directions) and this is accompanied by changes in H3K9 acetylation patterns.

      • The increased histone acetylation at the per1 locus that you mention (Kaufmann et al., 2010) was only shown for H4K12ac, while we measured H3K9ac (these marks are deposited by different enzymes). The authors actually report that “The levels of histone H3 at per1 did not change significantly between the two growth conditions and strains”, so we do not think that paper is relevant for our study.

      Fig. 3B indicates a catastrophic mitosis percentage of roughly 9.5% in cbf11∆ while in Fig. 1C 4% of all cells, or ˜31% of all mitotic events, is noted as abnormal. Could the authors clarify this discrepancy? Since Fig. 1 utilises time course data of 333 cells (please specify the number of analysed cells also in the legend), would the authors expect this data to be more trustworthy when compared to images of fixed cells? What were the criteria to assign divisions as catastrophic in fixed cells and which features were utilised to identify the 400 cells as mitotic?

      • We typically do see higher proportions of cut cells in fixed samples than in live-cell imaging. We believe this has to do with the different fluorescence readouts for live vs fixed cells. We have added the following explanations to the methods:

      “Please note that the observed frequencies of mitotic defects are not directly comparable between live and fixed cells. Following catastrophic mitosis, the dead cells rapidly lose histone-GFP fluorescence (imaging of live cells), but their DNA can still be visualized with DAPI for a much longer period (imaging of fixed cells), resulting in higher apparent defect frequencies in fixed cells.”

      • Importantly, we always compared cbf11KO to WT grown and processed under the same conditions, and that is how we determined the significance of any defects.

      • Mitotic defects were classified based on nuclear morphology both in live cells (histone signal) and in fixed cells (DAPI): Cells having the cut phenotype, or mis-segregated nucleus = 2 nuclei of different sizes, or septated cells with only one daughter cell having a nucleus, respectively.

      • We have analyzed images of at least 400 cells *in total* from asynchronous populations (interphase + mitotic >= 400). We have modified the figure legend to make this fact more clear. In our experience, this is the standard way of reporting the frequency of mitotic defects in asynchronous yeast cell populations.

      • We have specified the number of cells analyzed in Fig. 1C.

      Minor comments:

      Previous literature is, to the best of our knowledge, sufficiently referenced. The text is largely clear (some exceptions within the methods section will be elaborated on below). The figures, however, would benefit from graph titles and some minor formatting changes.

      • Figures:

      o Fig. 1: Specify the number of cells analysed in C within the legend as well. For B, please use colourblind-friendly schemes - especially since images are shown as merges only. The example of the "cut" phenotype appears small and crowded by surrounding cells. Especially the latter might affect mitotic fidelity. Under the assumption that this did not affect quantifications (WT seem fine) a less crowded cell would present a nicer example.

      • We have changed Fig. 1 as requested.

      o Fig. 3: Images shown in A add little benefit in their current form. What is the takeaway for the reader?

      • We hope that the reader gets concrete information on cellular and nuclear morphology of the investigated strains, which would be otherwise difficult to reproduce by textual description.

      Indicating that images represent DAPI staining and pointing out cells of interest with arrows/symbols would be helpful.

      • Done.

      The example shown for cbf11 appears to be dimmer in comparison and cell morphology is hard to interpret.

      • The cbf11KO cells stain fainter with DAPI than cells of other strains. We do not know why. To increase the clarity of the image, we have now adjusted the brightness and contrast of the cbf11KO panel (and indicated this adjustment in the figure legend).

      C feels misplaced in this figure and a title could improve readability.

      • We have added a title and moved the panel to Fig. 4 (4D).

      o Fig. 4: Graph titles needed, figure might work better in portrait

      • We have added the required graph titles.

      • We have recreated all ChIP-seq related figures to incorporate new data and to (hopefully) better highlight the differences between genotypes.

      • Text:

      o Mention median duration of mitosis in cbf11∆ (Fig. 2E) in text since WT is already noted;

      • Done.

      o Discussion, third paragraph: "TBZ [REF] and are prone to chromosome loss [...]". I assume this referred to minichromosome loss or have changes in ploidy/chromosome segregation been quantified?

      • Changes in ploidy were indeed not quantified. We have changed the wording to “__mini__chromosome loss”. But please note that the Ch16 minichromosome is derived from regular Chromosome III and is a real chromosome, albeit a small one.

      o Methods, Microscopy and image analysis:

      How were fixed cells imaged (glass bottom dishes, plated on lectin, mounted on slides)?

      Specify the CellR as widefield and provide details of the objective used (immersion and NA)

      • We have added the following information to the relevant Methods section:

      “Cells were applied on glass slides coated with soybean lectin, covered with a glass cover slip, and imaged using the 60X objective of the Olympus CellR widefield microscope with oil immersion (NA 1.4)”

      Elaborate on "manual evaluation of microscopic images"

      • We have extended the description of cell scoring:

      “The frequency of catastrophic mitosis occurrence was determined by manual evaluation of microscopic images using the counter function of ImageJ software, version 1.52p (Schneider et al., 2012). At least 400 cells from the asynchronous populations were analyzed per sample and mitotic defects were scored based on nuclear morphology and septum presence/position. ”

      For live cell microscopy, what was the estimated final density of cells within the 5 µl resuspension?

      • Our estimate is 4-8 x 10^6 cells in 5 ul. We have added this information into the Methods.

      What is meant by measuring the maximum section of plotted profiles? Is this the maximum distance of Hht1 signals within the entire time-lapse?

      • We have changed the description:

      “The nuclear distance was measured by using Hht2–GFP signals and converting the green channel images to binary, measuring the maximum distance between the Hht2-GFP signals using plot profile function in imageJ.”

      Was spindle length quantified the same way?

      • We have added the description:

      “Spindle length was quantified by drawing a line along the length of the spindle (using mCherry-Atb2 signals) at each timepoint and measuring the length of the line using imageJ.”

      Methods, ChIP-qPCR:

      It is not clear which strains were used, this can only be guessed by the use of a GFP antibody suggesting GFP tagged chromatin to be precipitated. For people with expertise outside of ChIP assays, this should be specified

      • We have listed the used strains in the ChIP-qPCR methods section.

      Reviewer #1 (Significance (Required)):

      Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      This manuscript presents a novel role for a transcription factor, one typically implicated in lipid metabolism, in chromatin modification and cohesin dynamics, with the possibility of this representing a more conserved process across ascomycetes. The mechanism of cbf11 regulation remains to be determined.

      Place the work in the context of the existing literature (provide references, where appropriate).

      This work helps link two bodies of work related to cell division that are usually considered in isolation, the regulation of lipid dynamics and the control of chromatin dynamics and cohesion. Some comparisons to phenotypes in closely related species would have helped provide a broader context (such as Yam et al., 2011, where the spindle morphologies in S. japonicus and response to cerulenin treatment might be of relevance to the work presented here).

      • We now briefly discuss the semi-open mitosis of Sch. japonicus and the Yam et al. 2011 paper at the beginning of the Discussion.

      State what audience might be interested in and influenced by the reported findings.

      Molecular and cellular biologists with interests in nuclear remodelling, lipid metabolism, kinetochore assembly.

      Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Fission yeast biology, nuclear remodelling, microscopy. We are not qualified to make in-depth comments on the soundness of ChIP-Seq and ChIP-qPCR experiments.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This manuscript describes detailed mechanisms by which the cbf11 deletion showed the phenotype. They found that the cbf11 deletion altered pericentromeric chromatin states such as the level of cohesin and hypermethylation.

      In general, their results are interesting and provide important insights into the relationship between lipid metabolism and chromosome segregation. The presented data are valuable for the community, but the authors should carefully re-assess their data.

      Major comments:

      1. Statistical analyses in some of the Fig.3B, 3C, 4B and S2 seem to be somewhat weird because p-values are too small for such a small number of experiments (three independent experiments) with large standard deviations. Please show all the data points in Fig. 2C-E, and provide raw values as a supplementary table for assessment of the data.

      2. We now show individual data points for all barplots and boxplots and provide all source numerical data as supplementary tables. The details of the used statistical tests are given in the respective figure legends.

      3. Pages 5-6: As for Fig. 4, the data is difficult to interpret because the trends of the ChIP-seq pattern of H3K9me2 between replicates look different: replicate 2 shows an increase of H3K9me2 signal, while replicate 1 shows almost no difference or weak if any. In such a case, the authors should repeat ChIP-seq one more time and confirm hypermethylation at these regions or confirm it by ChIP-qPCR.

      4. We do not agree with this statement. It is true that the exact histone modification patterns are not identical between the two replicates, but this is likely due to the differences in chromatin extract preparation in replicate 1 vs replicate 2 (see Methods). Importantly, both replicates show pronounced differences in H3K9me2 patterns between WT and cbf11KO. We have changed the visualization style to better highlight the differences between WT and mutant (Fig. 4A, Fig. S2B, S3)).

      5. Also, we have added one more biological replicate for the H3K9me2 ChIP-seq (Fig. S3) and performed the H3K9me2 ChIP-seq also in the Pcut6MUT strain with ~50% decreased expression of the cut6 gene (Cut6/ACC is the rate-limiting enzyme of fatty acid synthesis; cut6 is target of Cbf11) as 3 biological replicates (Fig. 4A and Fig. S3). Importantly, all replicates of both mutant strains show hypermethylated regions in the centromeres compared to WT.

      Assuming that the pericentromeric regions are hypermethylated by cbf11 deletion, it is still unclear why the transcription from only dh, but not dg, regions increased although their ChIP-seq data indicated both dh/dg regions were hypermethylated. A similar question arises to the expression of per1 and sdh1. Both K9Ac and K9me2 modifications seem to unchange at both per1 and sdh1 loci, whereas the expression levels of these loci changed in the opposite direction. These results suggest that the transcription levels of the centromeric region are independent of their histone modification states.

      • We do not know why dh expression differs from dg. But note that these are multi-copy repeats and it is very difficult to study individual copies separately. Our expression data, and partly also the ChIP-seq data represent “average” values across all the dh and dg copies present in the genome.

      • Importantly, Figure 4A (and Fig. S2B, S3) show a large piece of the fission yeast chromosome (~57 kbp) and this scale does not allow making informed judgements about the state of histone modifications at a particular promoter locus.

      • When we zoom in, we do see increased and decreased H3K9ac around the TSS of per1 and sdh1, respectively (2 replicates shown).

      • A key question of this study is to understand the relationship between lipid metabolism and chromosome structures. However, the results presented are not enough to address this question. I request to distinguish whether the defects on pericentromeric regions are mediated by lipid metabolism or direct effect by cbf11 deletion. Cbf11 is a transcription factor and can directly bind to DNA, thereby there is a possibility that Cbf11 directly modulates the pericentromeric chromatin state without regulating lipid metabolism. This question can probably be addressed. As the authors have shown in their previous study (Prevorovsky et al., 2016), overexpression of cut6, which encodes acetyl coenzyme A carboxylase and is a target of cbf11, can bypass nuclear defects. If the overexpression of cut6 restores alteration on pericentromeric regions such as cohesin enrichment and hypermethylation, it suggests the defects are a secondary effect of the decrease of phospholipid biosynthesis.

      • We agree that any rescue effects can be direct or indirect. And distinguishing between these two alternatives is unfortunately not straightforward.

      • Our Cbf11 ChIP-seq data do not show Cbf11 binding to centromeres (PMID 19101542), suggesting that any impact of Cbf11 on centromeric chromatin is most likely indirect and mediated by some other, downstream, players.

      • Instead of assaying cut6OE, we now show data that decreased cut6/ACC (a target of Cbf11) expression also leads to changes in histone methylation, similar to cbf11KO (Fig. 4A, Fig. S3). This suggests that lipid metabolism indeed can affect chromatin state (and the chromatin defects in cbf11KO are likely also lipid-related).

      • We have recently shown (Princová et al., 2023, PMID: 36626368) that decreased fatty acid synthesis leads to changes in acetylation and expression of specific stress-response genes in S. pombe, and the whole process involves the histone acetyltransferases Gcn5 and Mst1. Therefore, instead of implicating membrane phospholipids, we rather suggest that lipid metabolism can affect chromatin acetylation/methylation and structure via HATs, potentially through acetyl-CoA, the common substrate of both FA synthesis and HATs. We now mention the Princová et al., 2023 paper in the Discussion section.

      Minor comments:

      1. Figure 3C: The legend says, "Values represent means + SD from 3 independent experiments". It meant "means {plus minus} SD"?

      2. Corrected. Thank you for spotting this.

      3. The relationship between phospholipid synthesis and mitotic fidelity is now discussed in the bioRxiv paper (https://doi.org/10.1101/2022.06.01.494365). It would be nice to discuss this paper.

      4. Thank you for pointing out this reference. We now briefly mention this paper as a note that dysregulation of membrane phospholipid synthesis leads to mitotic phenotypes similar to cbf11KO.

      Reviewer #2 (Significance (Required)):

      Faithful chromosome segregation into daughter cells is crucial for cell proliferation. The authors previously reported that the deletion of cbf11, a transcription factor that regulates lipid metabolism genes, causes "cut (cell untimely torn)" phenotype (Prevorovsky et al., 2015; Prevorovsky et al., 2016). In this report, they examined detailed mechanisms by which the cbf11 deletion showed the phenotype, and found that the cbf11 deletion altered pericentromeric chromatin states such as the level of cohesin and hypermethylation. In general, their results are interesting and provide important insights into the relationship between lipid metabolism and chromosome segregation. The presented data are valuable for the community of basic science in the fields of chromosome biology and cell biology.

      We are cell biologists working on chromosomes and the cell nucleus.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The Vishwanatha et al. manuscript examined the nature of the mitotic defect in cbf11 deletion cells. cbf11+ encodes a CSL transcription factor that regulates lipid metabolism genes in S. pombe. Loss of cbf11+ was previously shown to have a "cut" phenotype presumably due in part to aberrant regulation of its target gene cut6+ which encodes-acetyl CoA/biotin carboxylase involved in fatty acid biosynthesis (Zach et al. 2018). The authors hypothesized that the mitotic defect exhibited as chromosome missegregation in cbf11 deletion cells may be caused by alterations in cohesin occupancy and H3K9 methylation in centromeres. Cohesin occupancy was slightly higher in centromeric dh and dg repeats in the cbf11 mutant and loss of the cohesin-loader gene wpl1+ appeared to suppress the mitotic defect. The authors also showed by ChIP-Seq that H3K9 methylation was higher in the centromeric regions, as well as increased minichromosomal loss in the cbf11 mutant.

      The discovery of increased cohesin occupancy and H3K9 hypermethylation in the centromeric regions of cbf11 deletion cells is novel and interesting. However, the main deficiency of the manuscript is that this discovery is underdeveloped. For example, the evidence linking the mitotic defect phenotype to these two processes was not well supported.

      • We believe that the links have already been well established in the literature. The integrity of centromeric heterochromatin (H3K9me2) is known to be required for mitotic fidelity (eg. Clr4/HMT and Clr6/HDAC mutants with H3K9me2 deficiency have high minichromosome loss and/or show lagging chromosomes during mitosis - PMID: 19556509, PMID: 8937982, PMID: 9755190). Moreover, we stress the known interconnections and provide relevant citations in the Discussion:

      “It is also important to note that heterochromatin, kinetochore function, cohesin occupancy, and gene expression are all interconnected and actually interdependent (Bernard et al., 2001; Folco et al., 2019, 5; Grewal and Jia, 2007; Gullerova and Proudfoot, 2008; Nonaka et al., 2002; Volpe et al., 2002)”

      • We show in the manuscript altered cohesin occupancy in cbf11KO and show that mutations in cohesin loading factors do affect mitotic fidelity of cbf11KO. While we do agree that this connection can be developed further, we believe this is beyond the scope of our current project.

      Moreover, there was no investigation in whether/how Cbf11 regulates cohesin occupancy or H3K9 methylation at the centromeres.

      • This is true. But again, we believe this is beyond the scope of our current project.

      Finally, the title and abstract provided an impression that lipid metabolism may influence cohesin occupancy and histone H3 hypermethylation at the centromeres, but this was not directly studied in the manuscript.

      • We now provide H3K9me2 ChIP-seq data on the Pcut6MUT mutant deficient in fatty acid synthesis to show that lipid metabolism indeed can affect histone methylation at the centromeres (Fig. 4A, Fig. S3).

      Centromeres are regions where sister chromatid cohesion is abolished last in mitosis. The observed higher levels of cohesin occupancy in the centromeric dh and dg repeats of cbf11 deletion cells could be the cause of chromosome missegregation, presumably because there is a delay or hinderance of cohesin removal from sister chromatids in mitosis. However, cohesin occupancy was carry out in asynchronous wild type and cbf11 deletion cultures, so it is unknown whether there is a delay of cohesion abolishment in mitosis. A cdc25-22 block and release experiment could better address this hypothesis.

      • We acknowledge these limitations of our findings regarding cohesin occupancy in the paper:

      “ Notably, centromeres are the regions where sister chromatin cohesion is abolished last during mitosis (Peters et al., 2008). Since cbf11Δ cells show altered cell-cycle and pre-anaphase mitotic duration compared to WT (Fig. 2), the observed difference in cohesin occupancy might merely reflect these changes in the timing of cell cycle progression. Alternatively, altered cohesin dynamics could play a role in the cbf11Δ mitotic defects.”

      • We agree the issue could be addressed better using synchronous cell populations. However, the cdc25 or cdc10 block-release does not work well in cbf11KO (PMID: 27687771), and we currently do not have the capacity to perform less disruptive forms of cell cycle synchronization.

      The observation that the spindle assembly checkpoint did not influence the mitotic catastrophe phenotype of cbf11 deletion cells suggests that the chromosome missegregation may not be mediated by defects in cohesin dynamics. How does Cbf11 influence cohesin dynamics in mitosis?

      • There are clearly multiple contributors to the mitotic defects observed in the cbf11KO strain and we state this explicitly throughout the manuscript.

      • We agree that it would be interesting in future to know more details about the link between Cbf11 and cohesin, but this is beyond the scope of our current project.

      Does Cbf11 regulate transcription of cohesin genes or indirectly through defects in the centromere or condensins?

      • Expression levels of cohesin and condensin genes are not affected by deletion of cbf11 (PMID: 26366556). We now mention these findings in the Results section.

      There was no direct evidence that H3K9 hypermethylation at the centromeres contributes to the mitotic catastrophe phenotype of cbf11 deletion cells.

      • This is true. However, the importance of H3K9me2 for mitotic fidelity has already been established in the literature (as we mention above).

      It is also not clear whether Cbf11 directly or indirectly influences histone methylation at the centromeres of affect centromere function.

      • When the Cbf11 protein is missing, centromeric histone methylation is different from normal (WT), and centromere function is not normal either - dh repeats are less expressed, minichromosome derived from ChrIII (so has a normal centromere) is 9x more frequently lost. So Cbf11 does affect these processes. The question remains, whether Cbf11 does this directly or indirectly. We favor the indirect route, as we have recently shown that H3K9 acetylation or methylation can be affected by shifting the balance between fatty acid synthesis (which is regulated by Cbf11) and histone acetyltransferase activity. We now mention these findings in the Discussion (Princová et al., 2023).

      Based on a substantial number of protein-protein interactions of Cbf11 and gene products that affect chromatin function/silencing at the centromeres from the Pancaldi et al. 2012 study (e.g. HIR complex, Hrp1-Hrp3, Cnp1, Ino80 complex), I am surprised that these candidates were not mentioned in this study or investigated.

      • Unfortunately, no DNase treatment was used during the affinity purification of Cbf11 in the study you mention. Therefore, the list of potential interactors is likely contaminated by irrelevant, DNA-mediated interactions with proteins sitting at nearby loci. This is why we have not pursued these candidates.

      Also, it would be more comprehensive to examine defects in transcriptional silencing in the centromeric regions using an ade6+ or ura4+/FOA marker system rather than measuring expression of per1+ and sdh1+.

      • We agree. We actually tried the ura4/FOA reporter system, but had problems constructing the reporter strains in the cbf11KO background. The resulting clones showed variable levels of FOA sensitivity (see figure of clones OC5-9 below), so we could not get a conclusive answer from this experiment and resorted to measuring the expression of pericentromeric genes.

      Figure 1A shows that the "cut" and nuclear displacement phenotypes are independent. However, cut mutants can also generate a nuclear displacement phenotype [Samejima et al. (1993) J. Cell Sci. 105: 135-143]. Therefore, I am not sure whether the latter phenotype can be treated as entirely independent from "cut" mutants.

      • We have made clarifications to Fig. 1A accordingly.

      Reviewer #3 (Significance (Required)):

      The discovery of increased cohesin occupancy and H3K9 hypermethylation in the

      centromeric regions of cbf11 deletion cells is novel and interesting. However, the main deficiency of the manuscript is that this discovery is underdeveloped.

      The results of this manuscript would be of considerable interest in the area of cell cycle research, transcription and chromatin structure and function.

      Reviewer #4 (Evidence, reproducibility and clarity (Required)):

      Summary

      In this paper Vishwanatha et al. analyze the mitotic phenotypes of cells lacking a regulator of lipid metabolism Cbf11. They propose that sister chromatid cohesion abnormalities and altered chromatin marks may contribute to the increased incidence of catastrophic mitosis. Additional experiments are required to improve the study and strengthen the authors' conclusions.

      Major Comments

      Both histone and alpha-tubulin tagging are known to aggravate mitotic errors in S. pombe. Before using these markers for live imaging, the authors should quantitate mitotic phenotypes in untagged cbf11∆ cells, as compared to the wild type. Using DAPI and Calcofluor staining (and ideally, also visualizing microtubules using anti- alpha-tubulin antibodies) the authors should measure the percentage of cells in mitosis and the percentage of cells that are going, or just went, through catastrophic mitosis, in asynchronous early-mid-exponential cell populations.

      • We agree that tagging can affect protein function in numerous ways.

      • The tagged versions of tubulin (mCherry-Atb2) and H3 (Hht2-GFP) used in our paper have been obtained from Phong Tran’s lab. These tagged alleles had been published (Nature Communications, PMID: 26031557) and used successfully to monitor mitotic defects including chromosome segregation errors and the cut phenotype.

      • The analyses of mitotic and septation defects of asynchronous untagged cbf11KO cells that you suggest (except for the spindle visualization) were already done by us (PMID: 19101542, PMID: 26366556) and are in agreement with our present study. In brief, we showed that cbf11KO populations contain ~10-30% of cells with mitotic defects (eg. cut), depending on the cultivation conditions. They also show septation defects and altered cell morphology and shorter cell length.

      In analyzing the dynamic of nuclear division, the authors claim that the interval between spindle formation and anaphase onset is "longer" and "more variable" in cbf11∆ cells compared to WT cells. The authors should provide proper statistical analysis of both differences to show that these differences are significant.

      • We now show the required data and statistical testing as Fig. 2H.

      The same goes for the authors' claim that mitotic duration is "more variable" in cbf11∆ cells compared to WT cells.

      • The spread of values for both WT and cbf11KO is given in Fig. 2G.

      As mentioned above, alternative estimates of possible perturbations of mitotic dynamics could be obtained by measuring the percentage of cells in different mitotic phases in asynchronous untagged cell populations, in order to avoid possible artifacts given by tagging histones and alpha-tubulin.

      • As you mention above, to estimate their cell cycle stage, untagged cells would need to be fixed and stained to visualize the nucleus and septum. However, using fixed cbf11KO cells is not optimal for this purpose. cbf11KO have septation and cell separation defects (PMID: 19101542, PMID: 26366556). This results in increased numbers of cells having a (persistent) septum in the asynchronous population, which obscures any estimates of cell cycle stages, and this is why we observed live cells during a timecourse.

      The fact that inactivation of SAC does not change the incidence of catastrophic mitoses shows that SAC is not involved and that there are likely no problems with kinetochore-microtubule attachments. Therefore, the authors' statement "These results suggest that SAC activity only plays a minor role (if any) in the mitotic defects observed in cbf11Δ cells" should be changed.

      • We have changed the sentence to:

      “These results suggest that SAC activity only plays a minor role (if any) in the mitotic defects observed in cbf11Δ cells, or that the defects are not caused by problems with kinetochore-microtubule attachment.”

      Also, the authors' statement in the conclusion that "This indicates that proper microtubule attachment to kinetochores might be compromised and takes longer to achieve in cbf11Δ cells, possibly triggering the SAC" should be changed accordingly or further proof should be provided.

      • This is probably a misunderstanding. We do not conclude that failed microtubule attachment to kinetochores is surely the cause of mitotic defects in cbf11KO. We merely describe our reasoning about structuring the project during its execution. We have rephrased the problematic sentence to improve clarity.

      • We already state in the Discussion that the mitotic defects of cbf11KO may be caused by something completely different from microtubule attachment.

      As pointed out by the authors, cohesion occupancy is affected by the cell cycle phases duration. Therefore, the authors should correct their data (Fig.3C) for the different duration of mitosis or measure cohesion occupancy in mitotically synchronized populations. If this is not possible, I suggest removing this piece of data altogether.

      • We agree (and acknowledge in the paper) that the measurement of cohesin occupancy can be affected by duration of mitotic phases. However we do not see a straightforward way of normalizing for mitotic duration, as cohesin occupancy changes differentially at particular chromosomal loci.

      • The suggested experiment of measuring cohesin occupancy in synchronized mitotic cells would likely help. However, as mentioned in our response to Reviewer 3 above, the cdc25 or cdc10 block-release does not work well in cbf11KO (PMID: 27687771), and the heat shock or drugs (eg. spindle poisons) would introduce confounding issues themselves. Unfortunately, we currently do not have the capacity to perform less disruptive forms of cell cycle synchronization.

      • Since we show that mutations in cohesin loading factors can rescue mitotic fidelity of cbf11KO cells (Fig. 3B), we consider the data shown in Fig. 3C relevant. Therefore, we opt to keep Fig. 3C in the paper, and we do point out the potential limitations of these results in the Results section.

      In Fig. 3A it is not clear what the authors mean by "morphological" differences between WT and cbf11∆ cells or between cbf11∆ cells and cbf11∆wpl1∆ cells. The authors should provide clearer images and indicate for each image which cells show morphological defects as an example.

      • We now use arrows to highlight cells with nuclear defects in Fig. 3A.

      • We now state examples of the cbf11KO-associated morphological defects in the text, together with a reference to the paper describing these defects in detail.

      In Fig. 3A many cells in single or double cbf11∆ mutants show increased size typical of diploid cells. The authors should perform flow cytometry to test for possible diploidization in their mutants, as that would clearly affect any conclusions on mitotic defects rescue or enhancement.

      • We previously published that cbf11KO cells show increased tendency for spontaneous diploidization (PMID: 19101542). When constructing cbf11KO strains, we always take care (including flow cytometry tests of DNA content) to exclude purely diploid clones, but the process of spurious diploidization is continuous and there are always diploid cells present in the cbf11KO culture.

      • We mention diploidization as a possible mitotic outcome in cbf11KO cells in the first section of the Results.

      As correctly pointed out by the authors, it is not clear if the increase in mitotic defects in cbf11∆ cells is entirely due to the perturbed lipid metabolism or to other factors being affected by Cbf11. A possible approach to prove this point, as suggested by the authors too, would be to test if the mitotic defects identified in cbf11∆ are common to other mutants of lipid metabolism that also show an increase in catastrophic mitotic events.

      • We now show ChIP-seq data showing that centromeric H3K9 shows aberrant methylation patterns also in a hypomorphic cut6/ACC mutant (Pcut6MUT) (Fig. 4A, Fig. S3).

      • We previously showed that the Pcut6MUT mutation predisposes fission yeast cells to catastrophic mitosis, and the defects manifest when Cut6 function is further weakened by limiting the supply of biotin (cofactor of Cut6) (PMID: 27687771).

      Also, the authors' statement in the conclusion: "we have demonstrated several novel factors, not directly related to lipid metabolism, that affect mitotic fidelity in cells with perturbed lipid homeostasis" should be modified as it was not proven that these effects are not due to altered lipid metabolism.

      • We agree that “it was not proven that these effects are not due to altered lipid metabolism”. However, the emphasis here is on the word “directly”. H3K9me2 and cohesin dynamics are not directly related to the metabolism of lipids. We have changed the phrasing to improve clarity.

      Minor comments

      The initial distinction (Fig. 1A) between "cut" and "nuclear displacement" phenotypes is somewhat confusing, especially since the authors are not investigating the different outcomes of a catastrophic mitosis. The two outcomes should be grouped together under the definition of "catastrophic mitosis" as it is done in the rest of the paper.

      • We have changed Fig. 1A accordingly.

      I do not think I understand the statement that "SAC abolition might actually suppress the mitotic defects of the cbf11∆ cells". The lack of SAC might aggravate defects in kinetochore-microtubule attachment or other aspects of spindle assembly. If the authors know of specific examples where the deletion of mad2 or the genes encoding other SAC components rescued the mitotic defects, they should cite those papers. Either way, this point needs clarification.

      • We already provide an example in the Discussion:

      “Intriguingly, SAC inactivation has been shown to suppress the temperature sensitivity of the cut9-665 APC/C mutant, which is also prone to catastrophic mitosis (Elmore et al., 2014)”

      • We have now included this reference and explanation also at the point in the text that you are referring to.

      Brightfield images in Fig. 1 would be clearer without the overlap of the fluorescence channels. The authors could also change the contrast of the images to highlight the septum.

      • We have changed Fig. 1B as requested.

      The length of spindle (shown in Fig. S1) is a more informative measurement for mitotic dynamics and should be used instead of the "nuclear distance" presented in Fig. 2.

      • This might be true for a successful mitosis. But in case of defects (such as spindle detachment from the chromosomes, regressive merger of the daughter nuclei), these parameters become partially uncoupled and both are informative. We have therefore included the data from Fig. S1 in new Fig. 2C-D.

      Generally, the authors could improve the data visualization by including in all the plots the single data points distribution along with the mean/median and error bars like it was done in Fig.2 C,D,E.

      • Done.

      Reviewer #4 (Significance (Required)):

      The paper expands the knowledge on Cbf11, a still poorly characterized regulator of lipid metabolism. The idea that in addition to nuclear membrane limitation, perturbations of lipid metabolism might cause mitotic chromosome dynamics defects (for instance, through changing the protein acetylation levels), is interesting, but the authors should strengthen their conclusions by performing controls and further experiments.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #4

      Evidence, reproducibility and clarity

      Summary

      In this paper Vishwanatha et al. analyze the mitotic phenotypes of cells lacking a regulator of lipid metabolism Cbf11. They propose that sister chromatid cohesion abnormalities and altered chromatin marks may contribute to the increased incidence of catastrophic mitosis. Additional experiments are required to improve the study and strengthen the authors' conclusions.

      Major Comments

      Both histone and alpha-tubulin tagging are known to aggravate mitotic errors in S. pombe. Before using these markers for live imaging, the authors should quantitate mitotic phenotypes in untagged cbf11∆ cells, as compared to the wild type. Using DAPI and Calcofluor staining (and ideally, also visualizing microtubules using anti- alpha-tubulin antibodies) the authors should measure the percentage of cells in mitosis and the percentage of cells that are going, or just went, through catastrophic mitosis, in asynchronous early-mid-exponential cell populations.

      In analyzing the dynamic of nuclear division, the authors claim that the interval between spindle formation and anaphase onset is "longer" and "more variable" in cbf11∆ cells compared to WT cells. The authors should provide proper statistical analysis of both differences to show that these differences are significant. The same goes for the authors' claim that mitotic duration is "more variable" in cbf11∆ cells compared to WT cells. As mentioned above, alternative estimates of possible perturbations of mitotic dynamics could be obtained by measuring the percentage of cells in different mitotic phases in asynchronous untagged cell populations, in order to avoid possible artifacts given by tagging histones and alpha-tubulin.

      The fact that inactivation of SAC does not change the incidence of catastrophic mitoses shows that SAC is not involved and that there are likely no problems with kinetochore-microtubule attachments. Therefore, the authors' statement "These results suggest that SAC activity only plays a minor role (if any) in the mitotic defects observed in cbf11Δ cells" should be changed. Also, the authors' statement in the conclusion that "This indicates that proper microtubule attachment to kinetochores might be compromised and takes longer to achieve in cbf11Δ cells, possibly triggering the SAC" should be changed accordingly or further proof should be provided.

      As pointed out by the authors, cohesion occupancy is affected by the cell cycle phases duration. Therefore, the authors should correct their data (Fig.3C) for the different duration of mitosis or measure cohesion occupancy in mitotically synchronized populations. If this is not possible, I suggest removing this piece of data altogether.

      In Fig. 3A it is not clear what the authors mean by "morphological" differences between WT and cbf11∆ cells or between cbf11∆ cells and cbf11∆wpl1∆ cells. The authors should provide clearer images and indicate for each image which cells show morphological defects as an example.

      In Fig. 3A many cells in single or double cbf11∆ mutants show increased size typical of diploid cells. The authors should perform flow cytometry to test for possible diploidization in their mutants, as that would clearly affect any conclusions on mitotic defects rescue or enhancement.

      As correctly pointed out by the authors, it is not clear if the increase in mitotic defects in cbf11∆ cells is entirely due to the perturbed lipid metabolism or to other factors being affected by Cbf11. A possible approach to prove this point, as suggested by the authors too, would be to test if the mitotic defects identified in cbf11∆ are common to other mutants of lipid metabolism that also show an increase in catastrophic mitotic events. Also, the authors' statement in the conclusion: "we have demonstrated several novel factors, not directly related to lipid metabolism, that affect mitotic fidelity in cells with perturbed lipid homeostasis" should be modified as it was not proven that these effects are not due to altered lipid metabolism.

      Minor comments

      The initial distinction (Fig. 1A) between "cut" and "nuclear displacement" phenotypes is somewhat confusing, especially since the authors are not investigating the different outcomes of a catastrophic mitosis. The two outcomes should be grouped together under the definition of "catastrophic mitosis" as it is done in the rest of the paper.

      I do not think I understand the statement that "SAC abolition might actually suppress the mitotic defects of the cbf11∆ cells". The lack of SAC might aggravate defects in kinetochore-microtubule attachment or other aspects of spindle assembly. If the authors know of specific examples where the deletion of mad2 or the genes encoding other SAC components rescued the mitotic defects, they should cite those papers. Either way, this point needs clarification.

      Brightfield images in Fig. 1 would be clearer without the overlap of the fluorescence channels. The authors could also change the contrast of the images to highlight the septum.

      The length of spindle (shown in Fig. S1) is a more informative measurement for mitotic dynamics and should be used instead of the "nuclear distance" presented in Fig. 2.

      Generally, the authors could improve the data visualization by including in all the plots the single data points distribution along with the mean/median and error bars like it was done in Fig.2 C,D,E.

      Significance

      The paper expands the knowledge on Cbf11, a still poorly characterized regulator of lipid metabolism. The idea that in addition to nuclear membrane limitation, perturbations of lipid metabolism might cause mitotic chromosome dynamics defects (for instance, through changing the protein acetylation levels), is interesting, but the authors should strengthen their conclusions by performing controls and further experiments.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The Vishwanatha et al. manuscript examined the nature of the mitotic defect in cbf11 deletion cells. cbf11+ encodes a CSL transcription factor that regulates lipid metabolism genes in S. pombe. Loss of cbf11+ was previously shown to have a "cut" phenotype presumably due in part to aberrant regulation of its target gene cut6+ which encodes-acetyl CoA/biotin carboxylase involved in fatty acid biosynthesis (Zach et al. 2018). The authors hypothesized that the mitotic defect exhibited as chromosome missegregation in cbf11 deletion cells may be caused by alterations in cohesin occupancy and H3K9 methylation in centromeres. Cohesin occupancy was slightly higher in centromeric dh and dg repeats in the cbf11 mutant and loss of the cohesin-loader gene wpl1+ appeared to suppress the mitotic defect. The authors also showed by ChIP-Seq that H3K9 methylation was higher in the centromeric regions, as well as increased minichromosomal loss in the cbf11 mutant.

      The discovery of increased cohesin occupancy and H3K9 hypermethylation in the centromeric regions of cbf11 deletion cells is novel and interesting. However, the main deficiency of the manuscript is that this discovery is underdeveloped. For example, the evidence linking the mitotic defect phenotype to these two processes was not well supported. Moreover, there was no investigation in whether/how Cbf11 regulates cohesin occupancy or H3K9 methylation at the centromeres. Finally, the title and abstract provided an impression that lipid metabolism may influence cohesin occupancy and histone H3 hypermethylation at the centromeres, but this was not directly studied in the manuscript.

      Centromeres are regions where sister chromatid cohesion is abolished last in mitosis. The observed higher levels of cohesin occupancy in the centromeric dh and dg repeats of cbf11 deletion cells could be the cause of chromosome missegregation, presumably because there is a delay or hinderance of cohesin removal from sister chromatids in mitosis. However, cohesin occupancy was carry out in asynchronous wild type and cbf11 deletion cultures, so it is unknown whether there is a delay of cohesion abolishment in mitosis. A cdc25-22 block and release experiment could better address this hypothesis. The observation that the spindle assembly checkpoint did not influence the mitotic catastrophe phenotype of cbf11 deletion cells suggests that the chromosome missegregation may not be mediated by defects in cohesin dynamics. How does Cbf11 influence cohesin dynamics in mitosis? Does Cbf11 regulate transcription of cohesin genes or indirectly through defects in the centromere or condensins?

      There was no direct evidence that H3K9 hypermethylation at the centromeres contributes to the mitotic catastrophe phenotype of cbf11 deletion cells. It is also not clear whether Cbf11 directly or indirectly influences histone methylation at the centromeres of affect centromere function. Based on a substantial number of protein-protein interactions of Cbf11 and gene products that affect chromatin function/silencing at the centromeres from the Pancaldi et al. 2012 study (e.g. HIR complex, Hrp1-Hrp3, Cnp1, Ino80 complex), I am surprised that these candidates were not mentioned in this study or investigated. Also, it would be more comprehensive to examine defects in transcriptional silencing in the centromeric regions using an ade6+ or ura4+/FOA marker system rather than measuring expression of per1+ and sdh1+.

      Figure 1A shows that the "cut" and nuclear displacement phenotypes are independent. However, cut mutants can also generate a nuclear displacement phenotype [Samejima et al. (1993) J. Cell Sci. 105: 135-143]. Therefore, I am not sure whether the latter phenotype can be treated as entirely independent from "cut" mutants.

      Significance

      The discovery of increased cohesin occupancy and H3K9 hypermethylation in the centromeric regions of cbf11 deletion cells is novel and interesting. However, the main deficiency of the manuscript is that this discovery is underdeveloped.

      The results of this manuscript would be of considerable interest in the area of cell cycle research, transcription and chromatin structure and function.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This manuscript describes detailed mechanisms by which the cbf11 deletion showed the phenotype. They found that the cbf11 deletion altered pericentromeric chromatin states such as the level of cohesin and hypermethylation.

      In general, their results are interesting and provide important insights into the relationship between lipid metabolism and chromosome segregation. The presented data are valuable for the community, but the authors should carefully re-assess their data.

      Major comments:

      1. Statistical analyses in some of the Fig.3B, 3C, 4B and S2 seem to be somewhat weird because p-values are too small for such a small number of experiments (three independent experiments) with large standard deviations. Please show all the data points in Fig. 2C-E, and provide raw values as a supplementary table for assessment of the data.
      2. Pages 5-6: As for Fig. 4, the data is difficult to interpret because the trends of the ChIP-seq pattern of H3K9me2 between replicates look different: replicate 2 shows an increase of H3K9me2 signal, while replicate 1 shows almost no difference or weak if any. In such a case, the authors should repeat ChIP-seq one more time and confirm hypermethylation at these regions or confirm it by ChIP-qPCR. Assuming that the pericentromeric regions are hypermethylated by cbf11 deletion, it is still unclear why the transcription from only dh, but not dg, regions increased although their ChIP-seq data indicated both dh/dg regions were hypermethylated. A similar question arises to the expression of per1 and sdh1. Both K9Ac and K9me2 modifications seem to unchange at both per1 and sdh1 loci, whereas the expression levels of these loci changed in the opposite direction. These results suggest that the transcription levels of the centromeric region are independent of their histone modification states.
      3. A key question of this study is to understand the relationship between lipid metabolism and chromosome structures. However, the results presented are not enough to address this question. I request to distinguish whether the defects on pericentromeric regions are mediated by lipid metabolism or direct effect by cbf11 deletion. Cbf11 is a transcription factor and can directly bind to DNA, thereby there is a possibility that Cbf11 directly modulates the pericentromeric chromatin state without regulating lipid metabolism. This question can probably be addressed. As the authors have shown in their previous study (Prevorovsky et al., 2016), overexpression of cut6, which encodes acetyl coenzyme A carboxylase and is a target of cbf11, can bypass nuclear defects. If the overexpression of cut6 restores alteration on pericentromeric regions such as cohesin enrichment and hypermethylation, it suggests the defects are a secondary effect of the decrease of phospholipid biosynthesis.

      Minor comments:

      1. Figure 3C: The legend says, "Values represent means + SD from 3 independent experiments". It meant "means {plus minus} SD"?
      2. The relationship between phospholipid synthesis and mitotic fidelity is now discussed in the bioRxiv paper (https://doi.org/10.1101/2022.06.01.494365). It would be nice to discuss this paper.

      Significance

      Faithful chromosome segregation into daughter cells is crucial for cell proliferation. The authors previously reported that the deletion of cbf11, a transcription factor that regulates lipid metabolism genes, causes "cut (cell untimely torn)" phenotype (Prevorovsky et al., 2015; Prevorovsky et al., 2016). In this report, they examined detailed mechanisms by which the cbf11 deletion showed the phenotype, and found that the cbf11 deletion altered pericentromeric chromatin states such as the level of cohesin and hypermethylation. In general, their results are interesting and provide important insights into the relationship between lipid metabolism and chromosome segregation. The presented data are valuable for the community of basic science in the fields of chromosome biology and cell biology.

      We are cell biologists working on chromosomes and the cell nucleus.

    5. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The manuscript by Vishwanatha et al. presents findings on the fission yeast transcription factor Cbf11, which is involved in regulating lipid synthesis. Changes in lipid metabolism often have detrimental effects on nuclear division (evidenced by the high percentage of cut phenotypes among strains with altered lipid content). Here the authors show that cbf11 deletion strains produce additional phenotypes such as changes to cohesion dynamics and altered chromatin modification within centromeric regions, in turn perhaps affecting microtubule attachment and proper chromosome distributions. This hypothesis is supported by the authors' finding of epistatic effects between cbf11 and cohesin loading and unloading.

      Major comments:

      While the evidence presented supports the hypothesis of altered cohesin loading as a major driver of observed mitotic defects, changes in the NE surface area are likely to also contribute to the phenotypes even in pre-anaphase stages. Did the authors test any double deletions with regulators involved in decreasing lipid content (e.g. spo7, nem1, ned1) to counteract the role of Cbf11? This could be useful in assessing the relative contribution of cohesion dynamics and histone modifications.

      A possible role of physical constraints dictated by the NE was already mentioned by the authors in the context of spindle bending and decreased elongation rates and some preliminary experimental data on this would be appreciated. Generation of strains, acquisition of some timelapses, and quantification of spindle elongation rate/buckling frequency should be feasible in a reasonable time frame.

      The authors report mRNA levels of the centromere flanking genes per1 and sdh1 to be increased by 1.5x and decreased by 2x in comparison to WT. Could the authors elaborate on whether this is an expected trend? Kaufmann et al., 2010 reported low transcription of per1 when the surrounding regions are predominantly acetylated. Fig. 4A suggests a slight increase of H3K9ac at per1 and a decrease of transcription would be conceivable.

      Fig. 3B indicates a catastrophic mitosis percentage of roughly 9.5% in cbf11∆ while in Fig. 1C 4% of all cells, or ˜31% of all mitotic events, is noted as abnormal. Could the authors clarify this discrepancy? Since Fig. 1 utilises time course data of 333 cells (please specify the number of analysed cells also in the legend), would the authors expect this data to be more trustworthy when compared to images of fixed cells? What were the criteria to assign divisions as catastrophic in fixed cells and which features were utilised to identify the 400 cells as mitotic?

      Minor comments: Previous literature is, to the best of our knowledge, sufficiently referenced. The text is largely clear (some exceptions within the methods section will be elaborated on below). The figures, however, would benefit from graph titles and some minor formatting changes.

      • Figures:
        • Fig. 1: Specify the number of cells analysed in C within the legend as well. For B, please use colourblind-friendly schemes - especially since images are shown as merges only. The example of the "cut" phenotype appears small and crowded by surrounding cells. Especially the latter might affect mitotic fidelity. Under the assumption that this did not affect quantifications (WT seem fine) a less crowded cell would present a nicer example.
        • Fig. 3: Images shown in A add little benefit in their current form. What is the takeaway for the reader? Indicating that images represent DAPI staining and pointing out cells of interest with arrows/symbols would be helpful. The example shown for cbf11 appears to be dimmer in comparison and cell morphology is hard to interpret. C feels misplaced in this figure and a title could improve readability.
        • Fig. 4: Graph titles needed, figure might work better in portrait
      • Text:
        • Mention median duration of mitosis in cbf11∆ (Fig. 2E) in text since WT is already noted;
        • Discussion, third paragraph: "TBZ [REF] and are prone to chromosome loss [...]". I assume this referred to minichromosome loss or have changes in ploidy/chromosome segregation been quantified?
        • Methods, Microscopy and image analysis: How were fixed cells imaged (glass bottom dishes, plated on lectin, mounted on slides)? Specify the CellR as widefield and provide details of the objective used (immersion and NA) Elaborate on "manual evaluation of microscopic images" For live cell microscopy, what was the estimated final density of cells within the 5 µl resuspension? What is meant by measuring the maximum section of plotted profiles? Is this the maximum distance of Hht1 signals within the entire time-lapse? Was spindle length quantified the same way?

      Methods, ChIP-qPCR:

      It is not clear which strains were used, this can only be guessed by the use of a GFP antibody suggesting GFP tagged chromatin to be precipitated. For people with expertise outside of ChIP assays, this should be specified

      Significance

      Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      This manuscript presents a novel role for a transcription factor, one typically implicated in lipid metabolism, in chromatin modification and cohesin dynamics, with the possibility of this representing a more conserved process across ascomycetes. The mechanism of cbf11 regulation remains to be determined.

      Place the work in the context of the existing literature (provide references, where appropriate).

      This work helps link two bodies of work related to cell division that are usually considered in isolation, the regulation of lipid dynamics and the control of chromatin dynamics and cohesion. Some comparisons to phenotypes in closely related species would have helped provide a broader context (such as Yam et al., 2011, where the spindle morphologies in S. japonicus and response to cerulenin treatment might be of relevance to the work presented here).

      State what audience might be interested in and influenced by the reported findings. Molecular and cellular biologists with interests in nuclear remodelling, lipid metabolism, kinetochore assembly.

      Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Fission yeast biology, nuclear remodelling, microscopy. We are not qualified to make in-depth comments on the soundness of ChIP-Seq and ChIP-qPCR experiments.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      In this paper, the authors present convincing experimental proof on why the BH3-only protein PUMA resists displacement by BH3-mimetics, while others such as tBID do not. Using a SMAC-mCherry based MOMP assay on isolated mitochondria, FRET in the presence of liposomes with a phospholipid composition similar to that of mitochondria as well as quantitative fast fluorescence lifetime imaging microscopy (F__�__rster resonance energy transfer - qF3) they show that the C-terminal region of PUMA (CTS), together with its BH3-domain, effectively "double-bolt" locks its interaction with BCL-XL and BCL-2 to resist displacement by the BCL-XL-specific BH3-mimetic A-1155463 or the BCL-2/BCL-XL inhibitor ABT-263 and AZD-4320. Although a similar mechanism has previously been published for BIM, the novel C-terminal binding sequence in PUMA is unrelated to that in the CTS of BIM and functions independent of PUMA binding to membranes. First, in contrast to BIM, PUMA contains multiple prolines and charged residues, and an unusually short span of hydrophobic amino acids, secondly, full length PUMA was more resistant to BH3-mimetic displacement than a PUMA mutant lacking the CTS (PUMA-d26) even in solution suggesting that the CTS of PUMA contributes to BH3-mimetic resistance even in the absence of membranes.<br /> The second, quite unexpected finding of this paper is that, in contrast to previous publications, the CTS of PUMA does not target the protein to mitochondria but to the ER. The authors show this by FLIM-FRET imaging and confocal microscopy, and they created mutants to identify the CTS residues (I175 and P180) that mediate binding to ER membranes.

      The authors did an excellent job to show the mechanism of displacement resistance of PUMA from BCL-2 survival factors from different angles (in vitro, on isolated mitochondria, liposomes and inside living cells), generating respective BH3 and CTS mutants and also domain swaps with other BH3-only proteins such as tBID. Also, the unexpected finding that PUMA primarily localizes to the ER has been extensively scrutinized and the data presented are convincing.

      Response:

      We appreciate the favourable comments and that the reviewer found the data presented convincing.

      Major comments:

      I have only three questions which I like the authors to address before this MS can be published.

      1) How can PUMA perform its pro-apoptotic action on MOMP from its site on the ER? Does PUMA eventually localize to MAMs (mitochondrial/ER contact sites)? Is it possible to co-IP PUMA with BCL-XL or BCL-2 from ER membranes or show such an interaction inside cells with PLA?

      Response:

      The reviewer raises an important point. One of the main conclusions from this paper is that the primary localization of exogenously expressed PUMA is at the ER. Our intent was to highlight the inherent specificity of the PUMA CTS sequence. However, we agree that identifying the localization of PUMA-BCL-XL complexes would add significantly to the manuscript. We carefully considered using co-IP or a proximity ligation assay (PLA) in order to investigate the localization of PUMA-BCL-XL complexes. In our experience the use of co-IP is very difficult to interpret due to the well characterized detergent-induced artifacts previously shown for BCL-2 family protein interactions (PMID: 9553144, PMID: 33794146). Moreover, PLAs are a proximity assay with a detection range of ~>20nm, and are difficult to quantify beyond enumerating frequency (ie counting spots). In contrast, the detection of FRET by fluorescence lifetime imaging microscopy (FLIM) is very sensitive to distance with a maximum that is <10nm, and the results can be interpreted quantitatively as apparent dissociation constants (manuscript Figures 2-3). Therefore we elected to use FLIM-FRET to address this question. We examined PUMA-specific interactions with BCL-XL at the ER and mitochondria by differentially segmenting the FLIM-FRET image data based on the signal from a mCherry-fused landmark expressed at the ER (mCherry-Cb5) or mitochondria (mCherry-ActA). This approach has similar spatial resolution to PLA yet retains more rigorous requirement for proximity and the quantitative interpretability of FLIM-FRET.

      For these experiments we used a recently described the method of mitochondrial image segmentation using hyperspectral image data collected during FLIM-FRET imaging (Osterlund et al., 2023). In this approach, a watershed segmentation algorithm was used to identify mitochondria areas from mCherry-ActA images collected simultaneously with the FLIM data. The ER was identified in separate samples using the same approach with mCherry-Cb5 image data. Simultaneous collection of the images ensures that the data are not affected by movement within the cells. Example images showing the segmentation results for each organelle have been added to the manuscript as Figure 4 - Figure Supplement 2A.

      The results of this FLIM-FRET experiment described in the text lines 581-598, revealed that VPUMA interacts with CBCL-XL within both ER and mitochondria-segmented ROIs (new Figure 4 - Figure Supplement 2B). These results can be explained by the fact that VPUMA is targeted to the ER, and BCL-XL is known to localize to the ER and mitochondria when bound to BH3 proteins in cells (Kale et al., 2018, PMID: 29149100). This result is similar to what we reported for BIK, another ER-localized BH3 protein that exerts its pro-apoptotic function from ER membranes (PMID: 11884414 and PMID: 15809295). Our recent data for ER localized BIK binding to mitochondria-targeted BCL-XL (Osterlund et al., 2023), suggests that, as the referee suggested, binding to occurs via a membrane-spanning interaction at MAMs (ER-mitochondia contact sites) and/or via relocalization of BIK and/or BCL-XL in response to their co-expression (Osterlund et al., 2023). Consistent with these interpretations, when expression of endogenous PUMA was upregulated in response to stress (Figure 4- figure supplement 3A-B), the amount of PUMA increased at both ER and mitochondria (Figure 4- figure supplement 3C). We have presented this data and interpretation on lines 599-621 and discussed the localization results and the similarity to BIK in the manuscript discussion, lines 1029-1035.

      2) Since PUMA seems to be "double-bolt" locked to BCL-2 or BCL-XL via its BH3-domain and CTS, how can it act as a pro-apoptotic inducer? Is its main function to act as an inhibitor of BCL-2 and BCL-XL rather than a direct BAX/BAK activator? And if it acts as a BAX/BAK activator, how can it be released from BCL-2/ BCL-XL, for example by another BH3-only protein which is induced by apoptosis stimulation? Or would in this case PUMA remain bound to BCL-2/ BCL-XL in order to activate BAX/BAK (which would be a kind of new activation mechanism)?

      Response:

      We appreciate the reviewers queries and have clarified the text to indicate that our interpretation is that by binding to BCL-XL, PUMA releases active BAX that is sequestered by BCL-XL (as shown in Figure 1A for purified proteins). Double bolt locking increases both affinity and avidity of PUMA for BCL-XL enabling competition to favor PUMA binding and displacement of sequestered BAX. To further address the reviewers point we added two additional experiments now shown in figure supplements to Figure 1. The data shown in new Figure 1 – figure supplement 1A (described on lines 182-191 of the revised manuscript) demontrates that PUMA kills HCT116 and BMK cells but not HEK293 cells. New Figure 1 – figure supplement 1B shows that inhibition of BCL-XL and MCL-1 using BH3 mimetics is sufficient to kill HCT116 and BMK cells while HEK293 cells are not killed by even high concentrations of these BH3 mimetics. To kill HEK293 cells requires activation of BAX (described on lines 191-201). Together this data indicates that the primary pro-apoptotic function of PUMA is inhbiting BCL-XL and MCL-1 rather than by activating BAX. This data fits very well with PUMA double-bolt locking resulting in very tight binding of PUMA to BCL-XL and likely MCL-1 as the primary mode of PUMA mediated induction of cell death, at least in the three cell lines investigated here. The importance and role of PUMA mediated BAX activation is an interesting area of active investigation that is beyond the purview of the current paper.

      3) Is PUMA still bound to the ER when it is transcriptionally induced by genotoxic stress. In this case, the extra amount of PUMA produced is supposed to directly activate BAX/BAK. Does it do this on the ER or on mitochondria?

      Response:

      The referee raises a very interesting point.

      Interestingly, Zheng et al., 2022 highlighted a P53-dependent death response to genotoxic stress, which results in the extension of peripheral, tubular ER and promotes the formation of ER-mitochondria contact sites (PMID: 30030520). Furthermore, PUMA is transcriptionally activated by P53 (PMID: 17360476). Therefore, we hypothesized the induction of PUMA would increase the fraction of PUMA at ER membranes and MAMs. As the latter resemble mitochondria in micrographs of cells we anticipated an increase in apparent mitochondrial localization. To address this question experimentally, we treated MCF-7 cells with genotoxic stress and ER stressors and tracked the expression of endogenous PUMA by immunofluorescence. The results are described in the manuscript (line 603-613, page 28) and shown in Figure 4 figure supplement 3.

      The immunofluorescence data confirmed that PUMA protein levels increase after genotoxic stress, as expected (Reference 39, 40 in the manuscript) and to a lessor but still significant extent after ER stress (Figure 4 figure supplements 3A and B). In response to stress the amount of PUMA increased at both ER and mitochondria, however, in unstressed cells the endogenous Puma co-localized more to the mitochondria than to the ER (Figure 4- figure supplement 3C). This suggests that similar to BIK localization of PUMA is dynamic. In particular, the abundance and localization of PUMA binding partners such as BCL-XL also affects PUMA localization (the new data are described on pages 27-28, Lines 591-621). As described above, the extra PUMA induced by genotoxic stress can indirectly activate BAX by binding BCL-XL and displacing sequestered activated BAX. Our FLIM-FRET data suggest PUMA can bind BCL-XL at both the mitochondria and the ER. Moreover, given the expansion of ER-mitochondrial contact sites that occurs during stress we cannot rule out the possibility that ER-localized PUMA can inhibit mitochondria-localized anti-apoptotic proteins (both BCL-XL and MCL-1) at the ER (for BCL-XL)and MAMs for both proteins.

      Reviewer #1 (Significance):

      Very significant contribution to the field. Quite novel

      Reviewer #2 (Evidence, reproducibility and clarity):

      This study by Pemberton and colleagues investigates interactions of pro-apoptotic PUMA with anti-apoptotic BCL-2 proteins, employing a variety of BH3-mimetics. The authors demonstrate that the PUMA/aa BCL-2 interactions are mediated not only via BH3-domain/groove interactions, but also dependent on a C-terminal sequence of PUMA. This mirrors (with distinct differences) what the authors have previously reported for BIM. They then, reveal that unexpectedly PUMA is often localising to the ER (as opposed to mitochondria), though this localisation is not important for the resistance of PUMA/BCL-2 complexes to BH3-mimetic treatment, authors speculate that ER localised PUMA may have a day job.

      In my opinion, the study is important for several reasons, not least it strongly argues that BH3-mimetics are not optimal (in themselves) to promote apoptosis dependent on PUMA, and that approaches to disrupt the "double-lock" mechanisms should be sought - this has clear clinical importance, but equally important is it adds a new layer of complexity to how BCL-2 family members "work", how the double-lock mechanism is overcome in physiological apoptosis remains an open question, for instance. The data support the authors' conclusions, I have a few points that could be addressed.

      Response:

      The positive comments from the reviewer are greatly appreciated.

      1 - The authors data in cells is consistent with a membrane recruitment effect of the PUMA CTS making a contribution to the resistance of PUMA/aa BCL-2 complexes to BH3-mimetics. What I found really intriguing, is that the CTS also influences affinity in the absence of membranes (Figure 1) - could the authors speculate why they think CTS may be affecting PUMA/aaBCL-2 binding in the absence of membranes ?

      Response:

      We agree with the reviewer that membrane binding contributes to BH3 mimetic resistant binding of PUMA to BCL-XL consistent with elegant data presented previously (Pécot et al., 2016; PMID: 28009301). However, we show in Figure 5D that mutants of VPUMA-d26 with restored membrane binding (VPUMA-d26-ER1 and VPUMA-d26-ER2) remain sensitive to BH3-mimetic displacement, indicating that membrane binding alone is not sufficient to confer resistance to BH3-mimetics. Furthermore, as the reviewer pointed out BH3 mimetic resistant binding is observed in the absence of membranes (Figure 1).

      The data using purified proteins strongly suggests that the CTS of PUMA binds to BCL-XL and is directly involved in the protein-protein interaction. The fact that PUMA with the C-terminal fusion to the fluorescent protein Venus (PUMAV) still localizes to membranes in live cells (Figure 4 D,E) suggests that the C-terminus of PUMA does not span the membrane bilayer. Instead, we hypothesize that the C-terminus of PUMA binds peripherally to the membrane making it available to physically contribute to a protein interaction with anti-apoptotic proteins. This interpretation is consistent with the low hydrophobicity and high proline content (6 of 28 residues) of the amino acid sequence of the PUMA CTS as shown in Figure 6 and compared to the transmembrane tail anchor sequences of other proteins, including the BH3-protein BIK, in Figure 5 supplement 1. Binding of Bcl-XL by both the BH3 region and CTS of PUMA would increase both the affinity and avidity of the interaction. The presentation of this data has been revised to add clarity on pages Page 8, lines 215-223 and in the discussion (Lines 988-997 and 1044-1050).

      2 - A minor point for clarification, are the mitochondria used in Fig 1A from BAX/BAK DKO cells ? - I had presumed so given exogenous BAX was added, but didn't note this in the text.

      We indeed use mitochondria from BAX/BAK DKO cells and exogenous recombinant BAX in Figure 1A. This has now been added to the text on lines 166-180.

      Reviewer #2 (Significance):

      detailed in report above

      Reviewer #3 (Evidence, reproducibility and clarity):

      In this paper, Pemberton et al show that PUMA resists BH3-mimetic mediated displacement from BCL-XL via a novel binding site within its C-terminus of PUMA termed CTS (the last 26aa). Interestingly, the CTS of PUMA directs the protein to the ER membrane and residues I175 and P180 within the CTS are required for both ER localization and BH3-mimetic resistance.

      Specific comments:<br /> 1 - BH3-mimetics kill cells by displacing sequestered pro-apoptotic proteins to initiate apoptosis. However, PUMA resists BH3-mimetic mediated displacement, and PUMA-d26 and PUMA I175A/P180A (CTS) do not. Thus, are these mutants sensitive to BH3-mimetics cell killing? In other words, do BH3-mimetics kill PUMA-/- cells that express either PUMA-d26 or PUMA I175A/P180A but not PUMA-/- cells that express wild type PUMA?

      Response:

      The reviewer raises a very interesting question that unfortunately we have been unable to address unambiguously. To answer this question requires separating the effects of PUMA on anti-apoptosis proteins and on activation of BAX and BAK as exogenous expression of express either PUMA-d26 or PUMA I175A/P180A is sufficient to kill PUMA-/- cells without the addition of a BH3 mimetic. To date we have been unable to identify mutants that inhibit anti-apoptotic proteins but that do not activate BAX and BAK as both PUMA-d26 and PUMA I175A/P180A have impaired BAX-activation function. This is additionally complicated by PUMA mediated inhibition of MCL-1, BCL-2 and BCL-W. Further, it isn’t possible to separate the function(s) using BAX/BAK knock-out cells because then PUMA induced cell death is completely abrogated. Understanding the direct activation of BAX by PUMA is an area of current investigation that is out of the scope of this paper as here we are focused on the interaction(s) of PUMA with anti-apoptotic proteins.

      2 - The authors elegantly demonstrate using microscopic analysis that over expressed PUMA mostly localizes to the ER membrane. Since this is a major conclusion in the paper which is different than previously reported, the authors should confirm these findings using sub-cellular fractions followed by Western blot analysis. They should demonstrate that endogenous and over-expressed PUMA are mainly localized to the ER membrane and that the PUMA-d26 and PUMA I175A/P180A are mainly localized to the cytoplasm.

      Response:

      We appreciate that the reviewer found the microscopic analysis convincing. We also tested the idea of sub-cellular fractionation proposed by the reviewer.However, we have found it to be very difficult to separate mitochondria and MAMs. To address the question raised we instead performed new co-localization experiments,in addition to those reported for PUMA-d26 and the point mutants in Figure 6 (images in Figure 6 - figure supplement 3). The new experiments areforendogenous PUMA at steady state and with increased expressed in response to stress. These immunofluorescence experiments are reported in Figure 4 -figure supplements 3. We also added FLIM-FRET experiments in which ROIs were derived from areas of the cell enriched in either ER or mitochondria(Figure 4 - figure supplement 2). The results of these experiments indicate that PUMA localization is dynamic and are described in detail above in response to reviewer 1 question 3 and in the manuscript from line 579 to 621 and discussed on lines 1029-1036.

      Reviewer #3 (Significance):

      The advance in this paper is significant and the paper should be published once the specific comments are adequately addressed

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this paper, Pemberton et al show that PUMA resists BH3-mimetic mediated displacement from BCL-XL via a novel binding site within its C-terminus of PUMA termed CTS (the last 26aa). Interestingly, the CTS of PUMA directs the protein to the ER membrane and residues I175 and P180 within the CTS are required for both ER localization and BH3-mimetic resistance.

      Specific comments:

      1. BH3-mimetics kill cells by displacing sequestered pro-apoptotic proteins to initiate apoptosis. However, PUMA resists BH3-mimetic mediated displacement, and PUMA-d26 and PUMA I175A/P180A (CTS) do not. Thus, are these mutants sensitive to BH3-mimetics cell killing? In other words, do BH3-mimetics kill PUMA-/- cells that express either PUMA-d26 or PUMA I175A/P180A but not PUMA-/- cells that express wild type PUMA?
      2. The authors elegantly demonstrate using microscopic analysis that over expressed PUMA mostly localizes to the ER membrane. Since this is a major conclusion in the paper which is different than previously reported, the authors should confirm these findings using sub-cellular fractions followed by Western blot analysis. They should demonstrate that endogenous and over-expressed PUMA are mainly localized to the ER membrane and that the PUMA-d26 and PUMA I175A/P180A are mainly localized to the cytoplasm.

      Significance

      The advance in this paper is significant and the paper should be published once the specific comments are adequately addressed

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This study by Pemberton and colleagues investigates interactions of pro-apoptotic PUMA with anti-apoptotic BCL-2 proteins, employing a variety of BH3-mimetics. The authors demonstrate that the PUMA/aa BCL-2 interactions are mediated not only via BH3-domain/groove interactions, but also dependent on a C-terminal sequence of PUMA. This mirrors (with distinct differences) what the authors have previously reported for BIM. They then, reveal that unexpectedly PUMA is often localising to the ER (as opposed to mitochondria), though this localisation is not important for the resistance of PUMA/BCL-2 complexes to BH3-mimetic treatment, authors speculate that ER localised PUMA may have a day job.

      In my opinion, the study is important for several reasons, not least it strongly argues that BH3-mimetics are not optimal (in themselves) to promote apoptosis dependent on PUMA, and that approaches to disrupt the "double-lock" mechanisms should be sought - this has clear clinical importance, but equally important is it adds a new layer of complexity to how BCL-2 family members "work", how the double-lock mechanism is overcome in physiological apoptosis remains an open question, for instance. The data support the authors' conclusions, I have a few points that could be addressed.

      • The authors data in cells is consistent with a membrane recruitment effect of the PUMA CTS making a contribution to the resistance of PUMA/aa BCL-2 complexes to BH3-mimetics. What I found really intriguing, is that the CTS also influences affinity in the absence of membranes (Figure 1) - could the authors speculate why they think CTS may be affecting PUMA/aaBCL-2 binding in the absence of membranes ?
      • A minor point for clarification, are the mitochondria used in Fig 1A from BAX/BAK DKO cells ? - I had presumed so given exogenous BAX was added, but didn't note this in the text.

      Significance

      detailed in report above

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this paper, the authors present convincing experimental proof on why the BH3-only protein PUMA resists displacement by BH3-mimetics, while others such as tBID do not. Using a SMAC-mCherry based MOMP assay on isolated mitochondria, FRET in the presence of liposomes with a phospholipid composition similar to that of mitochondria as well as quantitative fast fluorescence lifetime imaging microscopy (Förster resonance energy transfer - qF3) they show that the C-terminal region of PUMA (CTS), together with its BH3-domain, effectively "double-bolt" locks its interaction with BCL-XL and BCL-2 to resist displacement by the BCL-XL-specific BH3-mimetic A-1155463 or the BCL-2/BCL-XL inhibitor ABT-263 and AZD-4320. Although a similar mechanism has previously been published for BIM, the novel C-terminal binding sequence in PUMA is unrelated to that in the CTS of BIM and functions independent of PUMA binding to membranes. First, in contrast to BIM, PUMA contains multiple prolines and charged residues, and an unusually short span of hydrophobic amino acids, secondly, full length PUMA was more resistant to BH3-mimetic displacement than a PUMA mutant lacking the CTS (PUMA-d26) even in solution suggesting that the CTS of PUMA contributes to BH3-mimetic resistance even in the absence of membranes.

      The second, quite unexpected finding of this paper is that, in contrast to previous publications, the CTS of PUMA does not target the protein to mitochondria but to the ER. The authors show this by FLIM-FRET imaging and confocal microscopy, and they created mutants to identify the CTS residues (I175 and P180) that mediate binding to ER membranes.

      The authors did an excellent job to show the mechanism of displacement resistance of PUMA from BCL-2 survival factors from different angles (in vitro, on isolated mitochondria, liposomes and inside living cells), generating respective BH3 and CTS mutants and also domain swaps with other BH3-only proteins such as tBID. Also, the unexpected finding that PUMA primarily localizes to the ER has been extensively scrutinized and the data presented are convincing.

      Major comments:

      I have only three questions which I like the authors to address before this MS can be published.

      1. How can PUMA perform its pro-apoptotic action on MOMP from its site on the ER? Does PUMA eventually localize to MAMs (mitochondrial/ER contact sites)? Is it possible to co-IP PUMA with BCL-XL or BCL-2 from ER membranes or show such an interaction inside cells with PLA?
      2. Since PUMA seems to be "double-bolt" locked to BCL-2 or BCL-XL via its BH3-domain and CTS, how can it act as a pro-apoptotic inducer? Is its main function to act as an inhibitor of BCL-2 and BCL-XL rather than a direct BAX/BAK activator. And if it acts as a BAX/BAK activator, how can it be released from BCL-2/ BCL-XL, for example by another BH3-only protein which is induced by apoptosis stimulation? Or would in this case PUMA remain bound to BCL-2/ BCL-XL in order to activate BAX/BAK (which would be a kind of new activation mechanism)?
      3. Is PUMA still bound to the ER when it is transcriptionally induced by genotoxic stress. In this case, the extra amount of PUMA produced is supposed to directly activate BAX/BAK. Does it do this on the ER or on mitochondria?

      Significance

      Very significant contribution to the field. Quite novel

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We are very pleased that our manuscript was well-received by each of the three reviewers. Reviewer #1 found our study to be “interesting”, “clear” and “convincing”. Reviewer #2 found our study to be “unprecedented” and of “considerable interest to cell biologists in the vision community and likely to the broader cell biology community”. Reviewer #3 believed that we reported “novel and significant findings into an important cell biological problem” and that our study “should be of broad interest to cell biologists and vision scientists”. This reviewer also stated that “it is strongly recommended for publication”.

      Reviewer #1:

      The paper of Lewis et al. presents an interesting study describing new information about the morphology of nascent discs and the role of peripherin in determining disc and incisure structure. I have only a few comments mostly about presentation.

      We are happy that the reviewer liked our study.

      1. Because this study employs both frog and mouse, the authors should be careful to give the species when describing their results. The naming of the species would be particularly important in the first paragraph of the Results section and the legend to the first data figure, Fig. 2.

      We have clarified the text and figure legends to allow the reader to better follow which species each result came from.

      1. It is unclear what Movie 1 adds to Fig. 3. This movie could perhaps be omitted.

      We prefer to include the source data that the image in Figure 3 is derived from, particularly to stress that the pattern shown in a single z-section in this figure can be seen throughout the entire tomogram. We hope that the reviewer would agree.

      1. Movies 3 and 5 either don't work or consist of single frames, which would be better illustrated as figures in the text rather than as supplementary movies.

      We appreciate the reviewer catching that there were some technical issues with video playback. We have recompressed these videos and ensured that they will now play appropriately across a wide variety of computer specifications and video player applications.

      1. The incisures in Fig. 4 will be difficult for many readers to visualize. My experience was that once I saw one of them, I began to see the others. The incisures in Fig. 5 are, on the other hand, very easy to see. If Fig. 5 had come before Fig. 4, I would have had no problem. The authors may wish to exchange these two figures or to supply a cartoon for one of the rods in Fig. 4, so that the reader can more easily understand what he or she should be trying to see.

      We thank the reviewer for pointing out that some readers may have difficulties in fully appreciating the structure of incisures in this figure. We made two changes to improve the presentation of these images. First, we pseudo-colored several examples of enclosed discs in Figure 3, which highlights the structure of incisures. We also indicated one example of an incisure in these images with an arrowhead. Second, we pseudo-colored the example shown in Figure 4A to illustrate the same point, while still allowing the reader to view the three remaining examples in Figure 4 without any overlaid modifications.

      1. It is unclear to me why the authors are so fond of their untested theory that incisures "likely serve to protect the flat lamellar disc membranes from undesirable deformations" but seem skeptical of the notion that incisures are present and especially numerous in rods of large diameter to aid longitudinal diffusion. The later notion is supported not only by theoretical calculations but also by common sense.

      We appreciate this comment and, in fact, feel agnostic about both of these not mutually exclusive ideas. We removed the statement that the deposition of peripherin-2 in incisures likely serves to protect the flat lamellar disc membranes from undesirable deformations from the Introduction and rephrased the text in Discussion to stress that both functions are plausible and not mutually exclusive.

      This manuscript presents a clear and convincing description of disc formation and the role of the protein peripherin in the formation of disc incisures.

      Thank you for your kind comment.

      Reviewer #2:

      Summary: The manuscript by Lewis et al. focuses on the potential mechanisms underlying formation of incisures in rod photoreceptors. Incisures refer to the indentations that occur on the rim of the photoreceptor disc membranes. The presence of incisures has been noted for decades and have been identified across a number of species. The role of incisures is not entirely clear and the mechanisms governing their formation have largely been inferred from early transmission electron microscopy studies 40-60 years ago. More recent ultrastructural studies of rod outer segment discs from mice carrying mutant alleles of rhodopsin or periperhin-2 described changes in the length or presence of incisures, suggesting that these proteins likely play a fundamental role in incisure formation in mouse. The authors take advantage of advances in electron tomography to provide unprecedented analyses of incisure formation, size, and structural complexity in stacked discs within mouse photoreceptors. They also use genetic models to explore how rhodopsin and peripherin-2 contribute to incisure formation and length. The authors find that new discs are highly irregular in shape and do not contain incisures during disc formation. Incisures are only formed are discs are enclosed. They find that the incisures in adjacent discs always align adjacent to the ciliary axoneme. Intriguingly, they find evidence of physical connections on opposing sides of the incisure. Critically, they find that elevated levels of peripherin-2 increase incisure size and complexity while low levels of peripherin-2 prevent incisure formation. In contrast, reduced molar ratios of rhodopsin lead to smaller disc surface area but increased incisure complexity. These results lead the authors to conclude that incisure formation is mechanistically linked to the relative molar ratio of peripherin-2 to rhodopsin and that rods make a slight excess of peripherin-2 in order to drive proper disc closure. The excess peripherin-2 within the disc rim forces formation of an incisure.

      We are happy that the reviewer liked our study.

      Major comments<br /> 1. Line 145-146: the location of the incisure adjacent to the ciliary axoneme is an interesting observation indeed. As frogs have a number of incisures, is this a similar observation in species with multiple incisures or more exclusive to those species with a single incisure?

      Indeed, we did observe that one of the many incisures in a frog disc is aligned with the ciliary axoneme. We have now included Supplementary Figure S2 to highlight this observation using an example of two adjacent cells.

      1. While the presence of non-axonemal microtubules aligned with incisures in frog rods may provide an explanation for the number of incisures, the correlation with peripherin and rhodopsin content was lacking. In other words, do frog rods have considerably more peripherin-2 per disc than mouse rods?

      This is a great question and one that we are interested in pursuing in the future. However, adapting the mass spectrometry-based protein quantification approach that we used to determine the absolute numbers of peripherin-2, ROM1 and rhodopsin molecules per disc was a significant undertaking that took several years (Skiba et al., PMID: 36711880). This approach is currently applicable to only a particular set of outer segment proteins in the mouse and cannot be automatically re-purposed to quantification of proteins in other species that have different amino acid sequences. Thus, designing, validating and employing this quantification protocol to all peripherin-2 and ROM1 isoforms along with rhodopsin in the frog would be a major undertaking that cannot be completed in the context of this revision. Nonetheless, we are very appreciative for the reviewer’s enthusiasm for this topic and plan to address this question in the future.

      Minor comments<br /> 1. The location of the incisures are difficult to see in Figure 4. The arrowhead is pointing to a very low contrast area of the disc and the thin incisure can be seen, but it's difficult. If it is possible to pseudocolor the image in some way to highlight the disc vs the extramembrane space, it would be helpful.

      We thank the reviewer for noticing this issue, which was also commented by another reviewer. As described above, we pseudo-colored several examples in Figures 3 and 4.

      1. Line 138-142: As with any descriptive narrative of cell structures, it is important to ensure the reader can fully understand and appreciate the interpretation of the authors. The shape of the newly forming discs can be difficult to appreciate in Figure 4. The authors are strongly encouraged to perhaps take 1-2 examples and provide a drawing or schematic of the image that can be more clearly annotated to assist readers in finding the outline of the discs and incisures.

      We appreciate this point and pseudo-colored the surfaces of new forming discs in the examples shown in Figure 4A. We feel that pseudo-coloring helps the reader better visualize not only the structure of incisures, but also the irregular shape of the newly forming discs as in this specific example.

      Overall, the paper is well-written and organized logically. The figures are generally easy to interpret although some additional annotations would help readers identify incisures in some low-contrast images (see comments). The authors utilized state-of-the-art electron tomographic data and mouse genetics to address a fundamental question. This will be of considerable interest to cell biologists in the vision community and likely to the broader cell biology community on how peripheral/rim proteins can shape membrane.

      It is needless to say that we are very pleased by these comments and that the reviewer found our study to be of considerable interest to the broader cell biology community.

      The authors provide a well-reasoned model for how incisures form in mouse rod photoreceptors: a relative excess of peripherin-2 drives incisure formation. This agrees with their mass-spectrometry data and molar ratios of peripherin-2 and rhodopsin._ _The main concern and outstanding question is whether these results are specific to mouse photoreceptors? The experiments in Xenopus were limited and only found that a CRISPR knockout of one peripherin-2 ortholog prevented incisure formation. While this result agreed with the general model and how molar ratios of peripherin-2 contribute, the knockout phenotypes are different than that of mouse. Some hypotheses are mentioned to explain this, but none were tested. The authors provide a model that agrees with mouse data, but is this generalizable? The model should permit several predictions for incisure formation beyond that of mouse rods. It would be most helpful to look in a species with multiple incisures and calculate the molar ratios of rhodopsin and peripherin-2. Do Xenopus require significantly more peripherin-2 to form multiple incisures? Alternatively, is it possible for the authors to mine publically available proteomics studies to assess rhodopsin and peripherin-2 content from other species (e.g. human, non-human primates, rats, etc...) and correlate to incisure number and/or length? The study overall is interesting and thought-provoking, but the overall impact would be greatly enhanced if additional evidence was provided that their model is broadly generalizable given the variety in incisure number and photoreceptor disc morphology (e.g. surface area, diameter) across species.

      Related to a comment above, we are interested in pursuing each of these directions in frogs and other species in future studies, although it is not feasible to accomplish the required body of work in the context of manuscript revision. There are three other photoreceptor tetraspanins homologous to peripherin-2 that remain to be quantified and knocked out in frogs, alone and in combinations (the xrds36 and xrds35 isoforms and the peripherin-2-like protein). Testing the function of each of these in incisure formation would be an endeavor spanning several years of work. Additionally, there are no publicly available proteomic datasets that would contain information allowing an accurate quantification of rhodopsin and these homologous tetraspanins in other species. This question would require us to adapt our protein quantification approach, which would indeed be valuable, but would take significant time to complete.

      Reviewer #3:

      Summary. This work explores the formation of incisures in rod outer-segment (OS) disks. The visual pigment rhodopsin is the major lamellar protein in rod OS disks, while peripherin is the major structural protein of the disk rim. The authors used wild-type, Rho+/- and Rds+/- mice to vary the ratio of rhodopsin to peripherin in vivo, and compared these ratios to incisure length and complexity in rod OS.

      Comments. This study presents several new findings. The authors convincingly show by EM tomography that incisures only form after each OS disk has reached maturity (fully separated from the plasma membrane). This new finding corrects an earlier published observation. Next, they examined disk morphology in Rds+/- heterozygous null-mutant mice and showed that an ~50% reduction in peripherin levels resulted in rod OS disks with no incisures. They performed a similar study on Rho+/- heterozygotes mutants. This time they observed that an ~50% reduction in rhodopsin levels resulted in OS disks with excessively long incisures. MS analysis of rod OS proteins and quantitative analysis of the EM images showed that incisure length varies with the ratio of peripherin to rhodopsin. They further showed that wild-type rods contain a small excess of peripherin over the amount required to form mature disks with normal incisures. Finally, the authors examined the effects of peripherin levels in rods from Xenopus tropicalis, an animal containing large OS disks with multiple incisures and three homologs of peripherin. They used gene editing to generate Xenopus tropicalis with a null mutation in the xrds35 gene, which is most like mammalian peripherin. OS disks from xrds35-/- frogs contained no incisures by EM tomography, further supporting their hypothesis.

      Thank you for this nice summary of our study.

      Another protein in the rims of rod OS disks is ABCA4, an ATP-driven flippase that translocates PE conjugated to retinaldehyde from the lumenal to cytoplasmic leaflets of the disk membrane. Retinaldehyde is a toxic photoproduct of rhodopsin bleaching. It has been suggested that the large number of incisures in frog disks is due to the larger diameter of frog versus mouse rod OS, and hence the greater number of rhodopsins per disk. This relationship is thought to ensure sufficient ABCA4 flippase activity to process the larger flux of retinaldehyde released by rhodopsin in these wide disks during light exposure, and possibly to minimize the diffusion distance of retinaldehyde from the disk lamella to the rim. The authors' findings seem in conflict with this explanation. They may wish to comment on this facet of their results.

      We agree that it is possible for incisures to promote the encounter rate between retinaldehyde and ABCA4 in the disc. We do not find this idea to conflict with any of our interpretations; rather, this may be a complementary function of incisures. However, we failed to find any place in the literature where this hypothesis has been explicitly proposed and feel uneasy to present it as a new idea of our own in discussion. Fortunately, these reviews are public and truly interested readers could appreciate this idea. It is also worth noting that the correlation between incisure number and disc diameter is not perfect. For example, owl monkey discs appear to have a large number of incisures despite having a similar diameter to the mouse (Kroll and Machemer, PMID: 4970987).

      Significance. The manuscript presents novel and significant findings into an important cell biological problem, development of the rod OS. It is clearly written and the data are of high quality. The manuscript should be of broad interest to cell biologists and vision scientists. It is strongly recommended for publication.

      We are glad that the reviewer found our study to be of broad interest.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary. This work explores the formation of incisures in rod outer-segment (OS) disks. The visual pigment rhodopsin is the major lamellar protein in rod OS disks, while peripherin is the major structural protein of the disk rim. The authors used wild-type, Rho+/- and Rds+/- mice to vary the ratio of rhodopsin to peripherin in vivo, and compared these ratios to incisure length and complexity in rod OS.

      Comments. This study presents several new findings. The authors convincingly show by EM tomography that incisures only form after each OS disk has reached maturity (fully separated from the plasma membrane). This new finding corrects an earlier published observation. Next, they examined disk morphology in Rds+/- heterozygous null-mutant mice and showed that an ~50% reduction in peripherin levels resulted in rod OS disks with no incisures. They performed a similar study on Rho+/- heterozygotes mutants. This time they observed that an ~50% reduction in rhodopsin levels resulted in OS disks with excessively long incisures. MS analysis of rod OS proteins and quantitative analysis of the EM images showed that incisure length varies with the ratio of peripherin to rhodopsin. They further showed that wild-type rods contain a small excess of peripherin over the amount required to form mature disks with normal incisures. Finally, the authors examined the effects of peripherin levels in rods from Xenopus tropicalis, an animal containing large OS disks with multiple incisures and three homologs of peripherin. They used gene editing to generate Xenopus tropicalis with a null mutation in the xrds35 gene, which is most like mammalian peripherin. OS disks from xrds35-/- frogs contained no incisures by EM tomography, further supporting their hypothesis.

      Another protein in the rims of rod OS disks is ABCA4, an ATP-driven flippase that translocates PE conjugated to retinaldehyde from the lumenal to cytoplasmic leaflets of the disk membrane. Retinaldehyde is a toxic photoproduct of rhodopsin bleaching. It has been suggested that the large number of incisures in frog disks is due to the larger diameter of frog versus mouse rod OS, and hence the greater number of rhodopsins per disk. This relationship is thought to ensure sufficient ABCA4 flippase activity to process the larger flux of retinaldehyde released by rhodopsin in these wide disks during light exposure, and possibly to minimize the diffusion distance of retinaldehyde from the disk lamella to the rim. The authors' findings seem in conflict with this explanation. They may wish to comment on this facet of their results.

      Significance

      The manuscript presents novel and significant findings into an important cell biological problem, development of the rod OS. It is clearly written and the data are of high quality. The manuscript should be of broad interest to cell biologists and vision scientists. It is strongly recommended for publication.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary: The manuscript by Lewis et al. focuses on the potential mechanisms underlying formation of incisures in rod photoreceptors. Incisures refer to the indentations that occur on the rim of the photoreceptor disc membranes. The presence of incisures has been noted for decades and have been identified across a number of species. The role of incisures is not entirely clear and the mechanisms governing their formation have largely been inferred from early transmission electron microscopy studies 40-60 years ago. More recent ultrastructural studies of rod outer segment discs from mice carrying mutant alleles of rhodopsin or periperhin-2 described changes in the length or presence of incisures, suggesting that these proteins likely play a fundamental role in incisure formation in mouse. The authors take advantage of advances in electron tomography to provide unprecedented analyses of incisure formation, size, and structural complexity in stacked discs within mouse photoreceptors. They also use genetic models to explore how rhodopsin and peripherin-2 contribute to incisure formation and length. The authors find that new discs are highly irregular in shape and do not contain incisures during disc formation. Incisures are only formed are discs are enclosed. They find that the incisures in adjacent discs always align adjacent to the ciliary axoneme. Intriguingly, they find evidence of physical connections on opposing sides of the incisure. Critically, they find that elevated levels of peripherin-2 increase incisure size and complexity while low levels of peripherin-2 prevent incisure formation. In contrast, reduced molar ratios of rhodopsin lead to smaller disc surface area but increased incisure complexity. These results lead the authors to conclude that incisure formation is mechanistically linked to the relative molar ratio of peripherin-2 to rhodopsin and that rods make a slight excess of peripherin-2 in order to drive proper disc closure. The excess peripherin-2 within the disc rim forces formation of an incisure.

      Major comments

      1. Line 145-146: the location of the incisure adjacent to the ciliary axoneme is an interesting observation indeed. As frogs have a number of incisures, is this a similar observation in species with multiple incisures or more exclusive to those species with a single incisure?
      2. While the presence of non-axonemal microtubules aligned with incisures in frog rods may provide an explanation for the number of incisures, the correlation with peripherin and rhodopsin content was lacking. In other words, do frog rods have considerably more peripherin-2 per disc than mouse rods?

      Minor comments

      1. The location of the incisures are difficult to see in Figure 4. The arrowhead is pointing to a very low contrast area of the disc and the thin incisure can be seen, but it's difficult. If it is possible to pseudocolor the image in some way to highlight the disc vs the extramembrane space, it would be helpful.
      2. Line 138-142: As with any descriptive narrative of cell structures, it is important to ensure the reader can fully understand and appreciate the interpretation of the authors. The shape of the newly forming discs can be difficult to appreciate in Figure 4. The authors are strongly encouraged to perhaps take 1-2 examples and provide a drawing or schematic of the image that can be more clearly annotated to assist readers in finding the outline of the discs and incisures.

      Significance

      Overall, the paper is well-written and organized logically. The figures are generally easy to interpret although some additional annotations would help readers identify incisures in some low-contrast images (see comments). The authors utilized state-of-the-art electron tomographic data and mouse genetics to address a fundamental question. This will be of considerable interest to cell biologists in the vision community and likely to the broader cell biology community on how peripheral/rim proteins can shape membrane.

      The authors provide a well-reasoned model for how incisures form in mouse rod photoreceptors: a relative excess of peripherin-2 drives incisure formation. This agrees with their mass-spectrometry data and molar ratios of peripherin-2 and rhodopsin. The main concern and outstanding question is whether these results are specific to mouse photoreceptors? The experiments in Xenopus were limited and only found that a CRISPR knockout of one peripherin-2 ortholog prevented incisure formation. While this result agreed with the general model and how molar ratios of peripherin-2 contribute, the knockout phenotypes are different than that of mouse. Some hypotheses are mentioned to explain this, but none were tested. The authors provide a model that agrees with mouse data, but is this generalizable? The model should permit several predictions for incisure formation beyond that of mouse rods. It would be most helpful to look in a species with multiple incisures and calculate the molar ratios of rhodopsin and peripherin-2. Do Xenopus require significantly more peripherin-2 to form multiple incisures? Alternatively, is it possible for the authors to mine publically available proteomics studies to assess rhodopsin and peripherin-2 content from other species (e.g. human, non-human primates, rats, etc...) and correlate to incisure number and/or length? The study overall is interesting and thought-provoking, but the overall impact would be greatly enhanced if additional evidence was provided that their model is broadly generalizable given the variety in incisure number and photoreceptor disc morphology (e.g. surface area, diameter) across species.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Review of Lewis et al. 2023

      The paper of Lewis et al. presents an interesting study describing new information about the morphology of nascent discs and the role of peripherin in determining disc and incisure structure. I have only a few comments mostly about presentation.

      1. Because this study employs both frog and mouse, the authors should be careful to give the species when describing their results. The naming of the species would be particularly important in the first paragraph of the Results section and the legend to the first data figure, Fig. 2.
      2. It is unclear what Movie 1 adds to Fig. 3. This movie could perhaps be omitted.
      3. Movies 3 and 5 either don't work or consist of single frames, which would be better illustrated as figures in the text rather than as supplementary movies.
      4. The incisures in Fig. 4 will be difficult for many readers to visualize. My experience was that once I saw one of them, I began to see the others. The incisures in Fig. 5 are, on the other hand, very easy to see. If Fig. 5 had come before Fig. 4, I would have had no problem. The authors may wish to exchange these two figures or to supply a cartoon for one of the rods in Fig. 4, so that the reader can more easily understand what he or she should bel trying to see.
      5. It is unclear to me why the authors are so fond of their untested theory that incisures "likely serve to protect the flat lamellar disc membranes from undesirable deformations" but seem skeptical of the notion that incisures are present and especially numerous in rods of large diameter to aid longitudinal diffusion. The later notion is supported not only by theoretical calculations but also by common sense.

      Significance

      This manuscript presents a clear and convincing description of disc formation and the role of the protein peripherin in the formation of disc incisures.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      RC-2022-01805

      We thank all reviewers for their careful analysis of our manuscript, constructive suggestions and support of our work.

      Reviewer 1

      The authors show that proximity of early mouse embryo blastomere chromosomes to the cell cortex activates the Polar Body Extrusion pathway to generate cell fragments. The authors use live cell imaging in control and Myo1C and dynein knockdown embryos to document accumulation of actin and myosin near chromosomes that come in close proximity to the cell cortex, which correlates with the increased fragmentation of the mutant blastomeres. The live imaging data are nicely presented and the results are well quantified. I have two major comments, and some minor comments on clarity, for the authors consideration in revising the manuscript.

      Major comment:

      1. The authors imply that Myo1 and dynein knockdowns result in an increase in the number of cells where chromosomes come in close proximity to the cell cortex. Apparently the spindle anchoring defects are meant to indicate that such defects are responsible for the increased frequency of abnormal chromosome proximity to the cortex. But the authors never actually document whether chromosomes in fact do come into proximity to the cortex more often in the mutant than in control embryos. The authors should clarify if they think the spindle anchoring defect does result in abnormal chromosome distributions. Can the authors somehow quantify a defect in overall chromosome positioning in mutant vs control blastomeres? Presumably the movies the authors already have could be used to provide such quantification?

      We thank the reviewer for this opportunity to correct our previous assumptions. Following the reviewer’s suggestion, we tracked the distance between the cell surface and the center of the chromosomes cluster throughout mitosis. We found little difference in this distance between control and Myo1cKO embryos (Fig S3a), unlike what we had initially implied. This distance seemed more variable in Myo1cKo embryos than in control ones, suggesting that chromosome movements may be more erratic but analysis of this variation for individual cells did not show consistent differences between control and Myo1cKO embryos either (Fig S3b). Therefore, we cannot explain the increased signaling with differences in proximity of the chromosomes to the cortex during mitosis.

      Instead, as already hinted in our initial manuscript as an additional factor, we find that signaling from chromosomes to the cortex can occur for an extended time in embryos with impaired spindle anchoring.

      We had already measured that mitotic spindles persisted for a longer time in Myo1cKO embryos than in control ones (Fig 2b), as well as in ciliobrevin treated embryos as compared to DMSO treated ones (Fig S2b). To strengthen this data, we performed additional experiments in which we injected mRNA encoding fluorescent lamin-associated protein 2b (Lap2b-GFP) to track the breakdown and reassembly of the nuclear envelope. Consistent with the mitotic spindle persisting for a longer time in Myo1cKO embryos than in control ones, it generally takes more time for Myo1cKO embryos to reassemble their nuclear envelope than for control embryos (50 min vs 70 min, n = 8 control and 15 Myo1cKO embryos, p = 0.0161, Fig S3c-d, Movie 5). Taken together, the nuclear envelope and spindle data indicate that, although chromosomes are not closer to the cortex in Myo1cKO embryos than in control ones, they spend more time outside of the nucleus. This should give chromosomes extended opportunities to signal to the cortex and explains how difficulties with chromosome separation can lead to the hyper-activation of the polar body extrusion pathway.

      We have revised our manuscript accordingly.

      Near the end of the paper, the authors discuss how cell with bent/un-anchored spindles are more prone to fragmentation, referring to Figure 2. But Figure 2 does not document a correlation between blastomeres with bent spindles and increased fragmentation. Rather it shows an increase in bent spindles and in fragmentation in mutant vs control, but does show that they occur together. The authors should more accurately describe their results or provide such a correlation with additional data.

      We thank the referee for pointing out this missing information.

      To support our conclusions, we now provide additional analyses of mitosis duration in non-fragmenting and fragmenting cells from Myo1cKO embryos. When cells fragment, their mitosis is consistently longer, as measured from the persistence of the mitotic spindle, than when not fragmenting (Fig 2c). This provides a direct correlation between spindle defects and fragmentation.

      We now present these analyses in the revised manuscript.

      Finally, in describing the data in Figure 3, the authors refer to persistence of the spindle and bending of the spindle as indicating problems with anchoring. It is not clear to me how either spindle persistence or bending relate to anchoring. The authors should explain how they are related if they are, and it would be better if the authors could document spindle displacement relative to the cell center or cortex to make their point more directly that anchoring is defective.

      We apologize for not making this clearer in our initial manuscript. As others noted before (Kotak et al, 2012; Mangon et al, 2021), poorly anchored spindles show larger displacements or rotations during mitosis. Spindle persistence and bending may not be directly related to spindle anchoring defects but could reflect broader issues with spindle assembly and function caused by spindle anchoring defects. Since a previous in vitro study had identified that Myo1cKO is important for spindle anchoring (Mangon et al 2021) and that ciliobrevin, known for compromising spindle anchoring, phenocopied these aspects, we had initially focused on anchoring defects in our conclusions. We still stand by our conclusion that our data suggest spindle anchoring defects. Nevertheless, we agree that our observations report more general spindle defects and that anchoring may be only one of the defective aspects. Instead of “spindle anchoring defects”, we now simply mention “spindle defects” unless specifically discussing spindle straightness and rotation.

      Minor comment.

      The authors document in Figure 3 that Myo1C KO blastomeres have an enhanced response, with more myosin accumulating at the cortex in response to chromosomes. Why does knocking out one non-muscle myosin lead to enhanced accumulation of another? The authors note this effect but provide no discussion as to how it occurs. Some clarification might be helpful.

      In our manuscript, we report that chromosome proximity to the cortex is associated with Cdc42 activation, which leads to cortical actin recruitment (Fig 4a-d). We also observe that non-muscle myosin II (Myh9) is recruited to the cortex when chromosomes come near (Fig 3d-f). Importantly, these phenomena occur in control embryos as well and not only in Myo1cKO embryos.

      We propose that this recruitment is further increased in Myo1cKO embryos (Fig 3f) because chromosomes spend more time outside of the nuclear envelope (Fig 2). This leads to fragmentation and is not specific to Myo1cKO since the same occurs after ciliobrevin treatment (Fig S2).

      The authors provide a significant advance in our understanding of why early mammalian embryos, especially early human embryos, are so prone to fragmentation. Their data strongly support their conclusion that increased proximity of chromosomes to the cortex does lead to activation of the PBE response, which is an interesting and well documented finding. However, unless the authors can address my major comments and provide more direct evidence for increased displacement of chromosomes being responsible for increased fragmentation, they should revise their manuscript to acknowledge that they have not directly quantified chromosome positioning and thus do not conclusively document that it is responsible for increased fragmentation in the mutant oocytes.

      We thank the reviewer for their thorough analysis of our data and for giving us the opportunity to correct some of the aspects of our study.

      Reviewer 2

      The manuscript "Ectopic activation of the polar body extrusion pathway triggers cell fragmentation in preimplantation embryos" by Pelzer and colleagues is focused on mechanism of cell fragmentation in early preimplantation embryos. This is an important issue, since fragmentation, with subsequent cell loss, has significant impact on early development of human embryos in vitro.

      To study the cell fragmentation within the embryo, authors used mouse model system. However, since during the mouse preimplantation development blastomere fragmentation is less frequent than in human embryos, they used knockout of unconventional myosin-Ic to induce fragmentation of embryonic blastomeres with higher frequency and a similar morphology, known from human embryos.

      Using their Myo1c KO, authors confirmed previous observation that reduction of myosin-Ic impairs spindle anchoring and they further show that the defects in spindle anchoring are linked to cell fragmentation. And that similar defects could be induced by chemical inhibition of dynein. Importantly, the defects in anchoring, causing aberrant spindle movements, bring spindle and chromosomal DNA to the proximity of the cell cortex. This induces local changes in concentration and organization of actin and myosin IIA and leads into fragmentation. Authors show that this pathway shares similarity with mechanism of polar body extrusion (PBE) during meiosis, namely that it requires active Cdc42-mediated actin polymerization or Ect2 signaling. And also, that important role in cell fragmentation is played by cell surface tension. Based on their results, authors propose that cell fragmentation within the embryo is triggered either by hyperactivation of PBE pathway in cells with normal surface tension, or by PBE pathway activation in cells with higher contractility.

      This manuscript brings important information about mechanism, which might contribute to the high incidence of blastomere fragmentation in human embryos. I have not identified any important issues with experimental work or conclusions and therefore I recommend this paper for publication. The results from the mouse model system however need to be verified by further studies in human or similar embryos, which naturally exhibit higher fragmentation.

      We thank the reviewer for their careful examination of our manuscript and data.

      We agree that it would be important to verify the validity of our findings in other species. We have considered performing experiments with human embryos.

      Ideally, we would need embryos in their early cleavage stages (zygote to 4-cell stages) to be able study fragmentation without perturbing morphogenetic movements, which begin at the 8-cell stage. Such early embryos are particularly rare, which further requires careful experimental design.

      Ideally, such carefully designed experiment would not cause additional fragmentation (as we have mostly done in the present study) but rather reduce this deleterious process. In light of our experiments shown in Fig 4c-d, inhibiting Cdc42 would be a good way to reduce polar body extrusion signaling. Injection of DNCdc42 mRNA would be embryo-consuming to setup. We tried a Cdc42 chemical inhibitor on mouse embryos with unreliable results. Therefore, we do not yet feel confident in using precious human embryos with our currently available options.

      Another complication is administrative since this project was funded by the ERC, which does not allow experimentation with human embryos.

      As for studying the phenomenon in species other than mouse or human, we currently have limited access to other mammalian species. Generally, other mammalian embryos are less well characterized and, in particular, the species-specific fragmentation behavior would need to be characterized before initiating any attempt to reduce it.

      We hope that the reviewers will agree that the current manuscript, describing and dissecting a previously unknown mechanism, makes sufficient advances to be published without the need to assess its evolutionary conservation.

      This study revealed important mechanism, which might be responsible for inducing fragmentation of blastomeres in early preimplantation embryos. Authors use mouse knockout model system and therefore the results should be verified in other species, in which the embryos show higher fragmentation naturally. The manuscript provides evidence that pathway, leading into PBE in oocytes, remains operational also in embryos and might contribute to blastomere fragmentation in case when spindle loses anchoring to the membrane. The results of this manuscript should be of interest not only to the researchers in reproduction, but also to the general audience.

      Reviewer 3

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The manuscript discussed interesting and relevant topics in which the Authors addressed the effects of mouse Myo1C knock out on cell fragmentation and spindle anchoring defects. The authors found that fragmentation occurs in mitosis after ectopic activation of actomyosin contractility by signals emanating from DNA.

      Reviewer #3 (Significance (Required)):

      This is an excellent report dealing with significant technical methodologies. I find no fault in the methods, data analysis, or conclusions. I only have two comments. First, the authors should expand on the previous findings about the of the role of Myo1c during early preimplantation development. Second, the discussion should be expanded to compare the results of this study with those of previous/related studies (e.g., other factors involve in fragmentation and spindle anchoring). Finally, I was not able to open movie#2 and movie#8 so they may need to be re-uploaded.

      We thank the reviewer for their careful assessment of our study.

      We apologize for not discussing enough the previous research on Myo1c. To our knowledge, there is only one previous study reporting the effect of a point mutation on Myo1c on mouse ear physiology (Stauffer et al 2005). This is the first study on the role of Myo1c during mouse development. At this point, we would like to stress that our study, while partially based on the KO of Myo1c, is about cell fragmentation, which we induce experimentally in three independent ways: Myo1c KO, ciliobrevin treatment or Ect2 overexpression.

      Regarding fragmentation, to our knowledge there is simply no convincing mechanism to explain this phenomenon. One study proposed that membrane threads connecting the cell surface to the zona pellucida could pull on cells and promote fragmentation (Derick et al 2017). However, fragmentation also occurs without zona pellucida, and hence without threads pulling on cells’ surfaces (Yumoto et al 2020). Other than that, fragmentation was associated with mitosis and general cytoskeleton defects, without no clear mechanism (Alikani 1999, Fujimoto et al 2011, Daughtry et al 2019).

      We have now expanded these discussions.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The manuscript discussed interesting and relevant topics in which the Authors addressed the effects of mouse Myo1C knock out on cell fragmentation and spindle anchoring defects. The authors found that fragmentation occurs in mitosis after ectopic activation of actomyosin contractility by signals emanating from DNA.

      Significance

      This is an excellent report dealing with significant technical methodologies. I find no fault in the methods, data analysis, or conclusions. I only have two comments. First, the authors should expand on the previous findings about the of the role of Myo1c during early preimplantation development. Second, the discussion should be expanded to compare the results of this study with those of previous/related studies (e.g., other factors involve in fragmentation and spindle anchoring). Finally, I was not able to open movie#2 and movie#8 so they may need to be re-uploaded.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript "Ectopic activation of the polar body extrusion pathway triggers cell fragmentation in preimplantation embryos" by Pelzer and colleagues is focused on mechanism of cell fragmentation in early preimplantation embryos. This is an important issue, since fragmentation, with subsequent cell loss, has significant impact on early development of human embryos in vitro.

      To study the cell fragmentation within the embryo, authors used mouse model system. However, since during the mouse preimplantation development blastomere fragmentation is less frequent than in human embryos, they used knockout of unconventional myosin-Ic to induce fragmentation of embryonic blastomeres with higher frequency and a similar morphology, known from human embryos.

      Using their Myo1c KO, authors confirmed previous observation that reduction of myosin-Ic impairs spindle anchoring and they further show that the defects in spindle anchoring are linked to cell fragmentation. And that similar defects could be induced by chemical inhibition of dynein. Importantly, the defects in anchoring, causing aberrant spindle movements, bring spindle and chromosomal DNA to the proximity of the cell cortex. This induces local changes in concentration and organization of actin and myosin IIA and leads into fragmentation. Authors show that this pathway shares similarity with mechanism of polar body extrusion (PBE) during meiosis, namely that it requires active Cdc42-mediated actin polymerization or Ect2 signaling. And also, that important role in cell fragmentation is played by cell surface tension. Based on their results, authors propose that cell fragmentation within the embryo is triggered either by hyperactivation of PBE pathway in cells with normal surface tension, or by PBE pathway activation in cells with higher contractility.

      This manuscript brings important information about mechanism, which might contribute to the high incidence of blastomere fragmentation in human embryos. I have not identified any important issues with experimental work or conclusions and therefore I recommend this paper for publication. The results from the mouse model system however need to be verified by further studies in human or similar embryos, which naturally exhibit higher fragmentation.

      Significance

      This study revealed important mechanism, which might be responsible for inducing fragmentation of blastomeres in early preimplantation embryos. Authors use mouse knockout model system and therefore the results should be verified in other species, in which the embryos show higher fragmentation naturally. The manuscript provides evidence that pathway, leading into PBE in oocytes, remains operational also in embryos and might contribute to blastomere fragmentation in case when spindle loses anchoring to the membrane. The results of this manuscript should be of interest not only to the researchers in reproduction, but also to the general audience.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The authors show that proximity of early mouse embryo blastomere chromosomes to the cell cortex activates the Polar Body Extrusion pathway to generate cell fragments. The authors use live cell imaging in control and Myo1C and dynein knockdown embryos to document accumulation of actin and myosin near chromosomes that come in close proximity to the cell cortex, which correlates with the increased fragmentation of the mutant blastomeres. The live imaging data are nicely presented and the results are well quantified. I have two major comments, and some minor comments on clarity, for the authors consideration in revising the manuscript.

      Major comment:

      1. The authors imply that Myo1 and dynein knockdowns result in an increase in the number of cells where chromosomes come in close proximity to the cell cortex. Apparently the spindle anchoring defects are meant to indicate that such defects are responsible for the increased frequency of abnormal chromosome proximity to the cortex. But the authors never actually document whether chromosomes in fact do come into proximity to the cortex more often in the mutant than in control embryos. The authors should clarify if they think the spindle anchoring defect does result in abnormal chromosome distributions. Can the authors somehow quantify a defect in overall chromosome positioning in mutant vs control blastomeres? Presumably the movies the authors already have could be used to provide such quantification?
      2. Near the end of the paper, the authors discuss how cell with bent/un-anchored spindles are more prone to fragmentation, referring to Figure 2. But Figure 2 does not document a correlation between blastomeres with bent spindles and increased fragmentation. Rather it shows an increase in bent spindles and in fragmentation in mutant vs control, but does show that they occur together. The authors should more accurately describe their results or provide such a correlation with additional data.
      3. Finally, in describing the data in Figure 3, the authors refer to persistence of the spindle and bending of the spindle as indicating problems with anchoring. It is not clear to me how either spindle persistence or bending relate to anchoring. The authors should explain how they are related if they are, and it would be better if the authors could document spindle displacement relative to the cell center or cortex to make their point more directly that anchoring is defective.

      Minor comment.

      The authors document in Figure 3 that Myo1C KO blastomeres have an enhanced response, with more myosin accumulating at the cortex in response to chromosomes. Why does knocking out one non-muscle myosin lead to enhanced accumulation of another? The authors note this effect but provide no discussion as to how it occurs. Some clarification might be helpful.

      Significance

      The authors provide a significant advance in our understanding of why early mammalian embryos, especially early human embryos, are so prone to fragmentation. Their data strongly support their conclusion that increased proximity of chromosomes to the cortex does lead to activation of the PBE response, which is an interesting and well documented finding. However, unless the authors can address my major comments and provide more direct evidence for increased displacement of chromosomes being responsible for increased fragmentation, they should revise their manuscript to acknowledge that they have not directly quantified chromosome positioning and thus do not conclusively document that it is responsible for increased fragmentation in the mutant oocytes.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their constructive feedback on our manuscript. They did a very comprehensive and helpful job of laying out some key areas that could be improved. We were heartened by the fact that there was a fair amount of overlap between the two reviewers, and that comments were largely addressable without further experimentation.

      Below, we provide a summary of how we have attempted to address the comments and concerns from both reviewers. We also provide the rationale and action items for our responses. Overlapping comments from both reviewers have been consolidated and responded to together.

      Comment 1 (Reviewer #1, Minor Comment 1 & Reviewer #2, Significance)

      Both reviewers raised concerns about our choice to focus on essential genes in our CRISPRi screen, which could potentially underestimate the role of non-essential factors contributing to Tae1 sensitivity or resistance.

      Rationale: We agree with the reviewers that including non-essential genes could provide additional insights into the roles of non-essential factors in Tae1 sensitivity and resistance. We believe our focus on essential genes contributes a unique perspective to the field, as there already exists a body of work that interrogates non-essential genes in this space. Here are some citations that represent this body. We will highlight these better in the manuscript.

      Lin, H.-H.; Yu, M.; Sriramoju, M. K.; Hsu, S.-T. D.; Liu, C.-T.; Lai, E.-M. A High-Throughput Interbacterial Competition Screen Identifies ClpAP in Enhancing Recipient Susceptibility to Type VI Secretion System-Mediated Attack by Agrobacterium Tumefaciens. Front Microbiol 2020, 10, 3077. https://doi.org/10.3389/fmicb.2019.03077.

      Hersch, S. J.; Sejuty, R. T.; Manera, K.; Dong, T. G. High Throughput Identification of Genes Conferring Resistance or Sensitivity to Toxic Effectors Delivered by the Type VI Secretion System; preprint; Microbiology, 2021. https://doi.org/10.1101/2021.10.06.463450.

      Additionally, our screen was experimentally optimized for essential genes using our approach. The knockdown strategy is useful specifically for essential genes because E.coli is phenotypically very sensitive to essential gene perturbations (see more here: https://doi.org/10.1128/mBio.02561-21). While it would have been ideal to include non-essential genes too, doing so would require a different additional optimization that we believe would have diluted our bandwidth for this study. We do thank the reviewers for recognizing how much effort went into this!

      We do acknowledge this is a limitation and want to make sure the readership is aware of that. Ideally, one could do more rigorous side-by-side comparisons between studies if the approaches, set-up, and assays are the same. Unfortunately, due to differences in experimental set-up, we could not directly compare with the non-essential screens. We hope others will pick up where we left off. Here are some action items we can take to increase the odds of that:

      In the Introduction, we will mention other studies and highlight the need to investigate essential genes side-by-side with non-essential. (Lines 64-7) In the Discussion, we will add a sentence that acknowledges the importance of exploring non-essential genes for a more comprehensive understanding of Tae1 sensitivity and resistance. (Lines 484-5)

      Comment 2 (Reviewer #1, Minor Comment 5 & Reviewer #2, Major Comment)

      Both reviewers mentioned that the dormancy state in msbA-KD cells is not well characterized and its relationship with Tae1 resistance is not convincingly shown.

      Rationale: We agree that our manuscript does not clearly pin down whether Tae1 resistance is linked to a true dormancy state. There are some intriguing similarities between what we observe and what is classically known as “dormancy” or “persistence”, which have specific definitions. Although we don’t yet have a concrete reason to think it’s NOT those states, we also don’t have sufficient data to point to it clearly being the same at a mechanistic or cellular level. This is merely a hypothesis that our work suggests. We would love to see others follow up on this, as we suspect there are overlaps and potentially additional cellular states that have yet to be clearly defined in this field of bacterial physiology.

      Here is how we propose to address this concern:

      We simplified our language to be more descriptive and less loaded in terms of nomenclature around dormancy or persistence. Namely, we are referring to the cells in a more descriptive way with “slowed growth.” This allows us to clearly describe what we observe without attempting to ascribe mechanism or anything beyond that. It doesn’t fundamentally change the overarching interpretation of our study. (Lines 444, 490,497-9) In the Discussion, we will add text emphasizing the need for follow-up studies to fully address whether there is indeed a connection between Tae1 resistance and slowed growth. (Lines 491-3)

      Comment 3 (Reviewer #2, Major Comment)

      The reviewer asks if the degradation of the sugar backbone is also required for lysis or if it is just the crosslinking step that is important.

      Rationale: This is an astute point. We acknowledge that the degradation of the sugar backbone may play a role in lysis, and it’s predicted that this may be why the Pae H1-T6SS delivers a second PG-degrading toxin (Tge1), a muramidase that targets the sugar backbone. The most parsimonious conclusion from past studies by us and others is that Tae1 is critical for lysis, but not sufficient in the absence of any backbone-targeting enzyme. Indeed, many T6SS-encoding bacterial species also encode >1 type of PG-degrading enzyme, which may speak precisely to the reviewer’s point. However, it should also be noted that there may be endogenous enzymes with activities that can be leveraged alongside these toxins for the same effect.

      Action items:

      In the Discussion, we will add a sentence addressing the potential role of sugar backbone degradation in the lysis process and the need for future research on this topic. (Lines 524-6)

      Comment 4 (Reviewer #1, Minor Comment 2)

      The reviewer asks why lptC-KD leads to sensitivity to Tae1, while msbA-KD leads to resistance, considering both genes are implicated in LPS export.

      Rationale: We appreciate the reviewer's careful attention to the underlying biology. They are absolutely correct in pointing this difference out. Our interpretation is that the different phenotypes may indicate that although the LPS biosynthesis superpathway intersects with PG synthesis, lptC and msbA may intersect with PG synthesis in distinct ways. We can address this concern through the following:

      We will add a sentence in the Discussion section providing our interpretation of the different phenotypes observed for lptC-KD and msbA-KD. (Lines 508-13)

      Comment 5 (Reviewer #1, Minor Comment 4)

      The reviewer notes that the contribution of msbA to Tae1 resistance appears minor based on the results in Figure 3d.

      Rationale: There are actually two aspects to this concern, which we note below. We found it difficult to fully capture it in the manuscript, but our thoughts are as follows.

      (1) Technical viewpoint:

      Bacterial competition experiments are inherently noisy. The quantitative read-out is easily impacted by a number of parameters, including cellular density, input ratio between competitor cell types, growth stage, and possibly other environmental factors that are difficult to predict. In general, our view is that we should avoid over-indexing on the degree of the phenotype, focusing more on the direction of the phenotype (loss of statistically-significant Tae1 sensitivity) and the fact that it is reproducible in our hands. Furthermore, our argument is bolstered by clear validation of the loss of Tae1 sensitivity through orthogonal lysis assays (Fig. 4a-c).

      (2) Biological viewpoint

      It is challenging to isolate the specific interaction between Tae1 and individual genetic determinants, as we think it’s a complex system with multiple factors simultaneously at play. It is crucial to acknowledge that the unique contribution of Tae1 is only a part of the T6SS. There may be other compensatory actions that influence the outcomes observed, such as upregulation of non-Tae1 toxins, regulation of system activation/firing, timing and location of T6S injections, etc. We think these are exciting possibilities and that more groups should delve into the context-dependent dynamics of the system. Although outside the scope of our manuscript, we would be open to suggestions for how we can further emphasize this point.

      Comment 6 (Reviewer #2, Minor Comment)

      The reviewer recommends that we discuss whether our findings are specific to Tae1 or if they can be extrapolated to other toxins.

      Rationale: We understand the reviewer's interest in understanding the broader implications of our findings. Although our study focuses specifically on Tae1, we believe that our findings may provide insights into the mechanisms of sensitivity and resistance to other toxins that target the cell wall. However, experimentally investigating this would fall outside the scope of our current manuscript.

      Additional Minor Revisions

      Table 1: I would label MsbA and LptC as "LPS transport" and not "LPS synthesis" (Reviewer 1) Rationale: We agree that using “LPS transport” to describe the gene functions for lptC and msbA is more specific to their functions.

      Table 1 was updated to change the “pathway/process” categorizations for lptC and msbA from “LPS synthesis” to “LPS transport”. In line with this comment, we also changed the pathway/process categorization for murJ (Lipid II flippase) to “PG transport”. Figure 3 legend: "...deformed membranes .........are demarcated in (g) and (h)" (Reviewer 1) We thank the reviewer for pointing out the missing text in this figure legend.

      We corrected the error by adding the missing text back in Figure 3. Line 339-341: Supp. Fig. 9 should be Supp. Fig. 8 (Reviewer 1) Referenced Supp. Fig. was corrected. * Second, (L422-425) the authors conclude that their data demonstrate a "reactive crosstalk between LPS and PG synthesis". I disagree. There is no information in the paper that this is the case. The authors can only suggest that cross talk may occur. (Reviewer 2) We agree. Line 421-2: replaced “demonstrate” with “suggest” to soften the argument. *

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      This study reports the finding that lipopolysaccharide integrity modulates bacterial sensitivity to a Type-6-secreted bacterial toxin. The authors used the Tae1 amidase produced by the P. aeruginosa T6SS and Escherichia coli bacteria as prey cells as a model system to test the effect of knockdowns in essential gene expression of the prey. This was accomplished by constructing a library of knockdown (KD) genes based on Crispr/Cas9 and selecting for those targets where E. coli prey is not killed. The screen revealed, as expected, that KD genes encoding cell wall synthesis assembly (and bamA, involved in OM protein assembly) enhanced the sensitivity to Tae1. In contrast, KD targets in genes involved in lipid metabolism and lipopolysaccharide synthesis conferred resistant to the amidase toxin. The authors hypothesized that non-PG components of the cell envelope may shape Tae1 toxicity and undertook a more detailed analysis of the effects of knocking down one of these genes, msbA, using a various biochemical and imaging approaches. The MsbA protein is an ATPase permease that plays an essential role in flipping newly synthesized lipid A across the bacterial inner membrane. The authors show that resistance to Tae1 in msbA-KD is independent of cell wall hydrolysis (meaning that the Tae1 remains active), PG synthesis is suppressed (despite PG is still Tae1 sensitive), and that protein synthesis and growth is suppressed. This latter observation suggests that the E. coli prey enters a persistent (dormant) state that protects it from Tae1 toxicity. The authors conclude that Tae1 susceptibility in vivo is determined by cross talk between essential cell envelope pathways and the general growth state of the cell.

      Major comments:

      This is a nice study unravelling cellular off target factors that affect the killing in vivo by a T6SS toxin. In that sense the study is novel since the interplay of T6SS effectors in the context of the physiological state of the prey cell has not been directly investigated. so this study adds new information to the literature in the field.

      I have several comments concerning the interpretation of the results.

      First, it is interesting that Tae1, being an amidase, can be the sole responsible for PG degradation. The enzyme cleaved the peptide bridges but has no effect on the PG backbone. The study was not designed to pick up autolysins (since only essential genes were targeted) but one would assume that degradation of the sugar backbone must also be required for lysis.

      Second, (L422-425) the authors conclude that their data demonstrate a "reactive crosstalk between LPS and PG synthesis". I disagree. There is no information in the paper that this is the case. The authors can only suggest that cross talk may occur.

      Third, Tae1 maximal effect is present when new PG is made, which also begs the question about the location of this protein in the PG mesh. Like B-lactam and other PG-active antibiotics, the effect of Tae1 requires active cell growth. This is also consistent with the authors' finding that the msbA-KD bacterial cells enter a state of dormancy or persistence, which will make them capable of overcoming Tae1 toxicity.

      Fourth, an important outcome of protein synthesis inhibition and PG synthesis is increased oxidation and lipid peroxidation. This could also influence the results obtained in this study. It would be consistent with the other targets observed, which compromise lipid metabolism and membrane trafficking and secretion.

      Referees Cross-commenting

      Based on my own review and that of Reviewer 1, I think we both agree that there are 2 major limitations in this work: (i) the KD library only targets essential genes and this would potentially miss non-essential genes that when targeted for mutated could lead to synthetic lethal phenotypes that could be more revaling than a general defect protein synthesis, etc. and (ii) the dormancy state is not well characterized.

      Despite these points the study is very nicely done with a huge amount of work.

      Significance

      This is an important study addressing experimentally the complexities of bacteria-bacteria interactions in the context of predator-prey interplay. The T6SS effectors affecting PG appear to have the same characteristics as known antibiotics and bacteria use similar strategies to protect themselves from PG attack. This is not only to increase growth as an escape approach but also to reduce it to a point in which the target cell cannot be effectively killed despite the presence of the toxin.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      The manuscript by Trotta and co-workers investigates functions that shape E. coli envelope when cells are targeted by the cell-wall degrading toxin Tae1. The experimental setting employed by the authors is well thought and is based on the competition engaged by P. aeruginosa (Pae) expressing the type 6 secretion system (T6SS) against E. coli cells. In this context, the authors used an arrayed library of chromosomally encoded CRISPRi strains targeting essential genes of E. coli (knockdowns, KDs) to identify functions that increase or decrease E coli fitness following interbacterial competition with Pae cells expressing Tae1. The majority of genes whose depletion makes E. coli cells more sensitive to the toxin are implicated in PG synthesis while depletion of genes implicated in other cell envelope processes can result in toxin sensitivity or resistance. Among genes whose depletion makes E. coli cells more resistant to the toxin the authors selected those implicated in LPS biogenesis (msbA-KD and lpxK-KD), to investigate the hypothesis that non-PG components of the cell envelope may also shape Tae1 toxicity. While resistance to lpxK-KD to Tae1 could not be validated in the reconstructed strain likely due to a polar effect, the reconstituted msbA-KD gained Tae1 specific resistance. Further characterization of the msbA-KD revealed that Tae1 resistance is independent of cell wall hydrolysis and PG dynamics. By showing that both slow growth and decreased protein synthesis is specifically linked to Tae1 resistance in msbA-KD cells the authors suggest that a persistent state, induced by block of LPS biogenesis, helps depleted msbA cells to resist the toxic activity of Tae1. Overall, the experimental approach is solid, the developed in vivo screen to identify genetic interaction between secreted Tae1 and E coli is smart and well thought. I also acknowledge the huge work performed by the authors to characterize selected KD strains.

      My few comments to the manuscript are reported below.

      Major Comments

      There are no major comments

      Minor Comments

      1. Why the authors limit the search of functions that help P. aeruginosa to antagonize E. coli cells only to essential genes? I understand that the available CRISPRi strains collection (developed by Carol Goss and co-workers) is only targeting essential genes, but the rationale for this choice should be discussed. This approach is inevitably underestimating the role of perhaps important non-essential factors contributing to Tae1 sensitivity/resistance.
      2. It is intriguing that in Table 1 lptC is listed among the genes whose depletion leads to sensitivity to Tae1 whereas msbA transcriptional down regulation leads to resistance. Both LptC and MsbA are implicated in LPS export to the cell surface, and one would expect that their down-regulation leads to similar output in competition experiments with P. aeruginosa. Can the authors comment on that?
      3. Based on results reported in Figure 3 d (fold change msbA-KD CFU) the contribution of MsbA to Tae1 resistance seems minor. Can the authors comment?
      4. Based on the observation that msbA-KD cells arrest growth, do not divide, and decrease protein synthesis, the authors suggest that these cells enter a persistent state which could protect against Tae1 activity by passive tolerance. In support of this hypothesis the authors refer to published work (Roghanian et al. PloSOne 2019) showing that CRISPRi KD in lpxA (the first gene of the LPS biosynthetic pathway) triggers a dormancy state to respond to imbalances in outer membrane biogenesis. In this manuscript Roghanian and co-workers show that CRISPRi KD in lptA (encoding the periplasmic component of the LPS export machinery) share the same phenotypes as lpxA. These observations bring me again to the comment n. 2 above. I think that the authors should comment on this. In my opinion this is the weakest part of the manuscript as it is not convincingly showed i) that msbA-Kd cells enter a dormancy state, ii) how this dormancy state is related to Tae1 resistance.

      Table 1: I would label MsbA and LptC as "LPS transport" and not "LPS synthesis"

      Minor points

      Figure 3 legend: "...deformed membranes .........are demarcated in (g) and (h)"

      Line 339 341: Supp. Fig. 9 should be Supp. Fig. 8

      Significance

      This study aims at understanding how Tae1, a PG-degrading toxin secreted by T6SS specifically aids P. aeruginosa in antagonizing E. coli cells in vivo. By exploiting a smart in vivo genetic screen, the authors want to understand at the molecular level the interplay between Tae1 and essential functions in E. coli. The study of interspecies competition offers the possibility to investigate and dissect complex physiological processes and the interactions between them. The work is solid and the experimental plan well-conceived. However, the in vivo genetic screen is limited to the search of essential functions implicated to sensitivity or resistance to the secreted toxin. Such an approach is inevitably underestimating the role of perhaps important non-essential factors contributing to Tae1 sensitivity/resistance. Also, as indicated above, I think that the authors did not convincingly show i) that msbA-Kd cells enter a dormancy state, ii) how this dormancy state is related to Tae1 resistance.

      Audience Broad audience / basic research

      Expertise in outer membrane biogenesis

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      The authors would like to thank the reviewers for their valuable comments and suggestions. We have carefully considered all of the points raised and revised our manuscript accordingly. In the rebuttal letter below, we have extensively discussed all the different concerns and adjustments we made to our work. In what follows the reviewers’ comments are in blue and the authors’ responses are in black. The additions and changes to the main and supplementary text of the manuscript are highlighted in yellow.

      *Reviewer #1 (Evidence, reproducibility and clarity (Required)): *

      *In their paper entitled "CD38 promotes hematopoietic stem cell dormancy via c-Fos", Ibneeva et al., present a set of data predominantly from mouse HSCs where they explore the cell cycle kinetics and self-renewal capacity of LT-HSCs expressing (or not) CD38. They perform a series of sophisticated in vitro and in vivo experiments, including transplantations and single cell cultures and arrive at the conclusion that CD38 can fractionate LT-HSCs that are more deeply quiescent. Overall, it is an interesting question and would be of interest to experimental hematologists. That said, I had a number of issues that concerned me throughout the manuscript with regard to the robustness of the conclusions around CD38 and I have tried to detail these below.

      Major concerns: *

      *1) Novelty - It was unclear what the relationship of this CD38+ fraction had with other "segregators" of LT-HSCs - e.g., how does it compare with the Sca1 fractionation of Wilson et al, Cell Stem Cell 2015 or Gprc5c of Cabezas-Wallschied Cell 2017? Even if CD38 fractionated LT-HSCs, it was unclear what it would give beyond these two molecules (especially re: Sca-1 which is also a cell surface marker). *

      Response:

      We agree with the reviewer that further elaboration of this point with additional data would be helpful. We compared the expression of Sca-1 in the population of LT-HSCs (Lin- Kit+ Sca-1+ CD48- CD150+ CD34- CD201+) based on the gating strategy from the paper Wilson et al, Cell Stem Cell 2015. We found that all LT-HSCs (independent of CD38 expression) express Sca-1 at a high level and can be quantified as Sca-1hi (we have added these data in Fig. S2A). Thus, CD38 subfractionates LT-HSCs, and considering that we have shown that CD38+ are more quiescent (Fig. 3) and have higher repopulation capacity compared with CD38- LT-HSCs (Fig. 2E-G), we conclude that CD38 should be used in addition to Sca-1 to define dormant LT-HSCs.

      We found that CD38+ dormant HSCs expressed Gprc5c mRNA at higher levels than CD38- LT-HSCs (Fig. 5D). Therefore, we cannot exclude that CD38+ and Gprc5c+ identify the same population of dormant HSCs. However, Cabezas-Wallscheid Cell 2017 used the reporter Gprc5c-EGFP mouse strain, which is not widely available. In contrast, we propose to use readily available antibodies against CD38 for efficient isolation of dormant HSCs. Moreover, to define CD38+ dormant HSCs, researchers do not need to use the CD38KO mice as a negative control, it would be sufficient to use total bone marrow cells to identify the CD38+ population for gating dHSCs (we have added this information to Fig. S2C and in the text: line 119-121: “We demonstrated that total bone marrow cells can be used to define the CD38+ fraction in the absence of CD38 knock-out mice (CD38KO) (Fig. S2C), providing the possibility of an internal positive control for easy identification of CD38+ cells”.

      *Claims of CD38+ superiority in transplantation - I was surprised with the claim of CD38 negative cells being a less functional HSC when they are clearly still very strong in secondary transplantation assays. Both 38+ and 38- cells strongly repopulate secondary animals and only 5 mice were shown in the Figure. The legend suggests another experiment was undertaken, but these data are not presented. Did they substantially differ in their chimerism in primary and secondary animals? Was the magnitude of difference between the two fractions similar in both experiments? Is there a reason that the data could not be plotted on the same graph?

      *

      We have added the data from the second experiment to the graphs and changed the figure legend accordingly (Fig. 2D-H), now for primary transplantation n=8, for secondary transplantation n=6 vs 7. These data show the same trend of higher repopulation capacity of CD38+ LT-HSCs compared to CD38- LT-HSCs, although with the larger magnitude of difference in primary transplantation. We agree with the reviewer that CD38- LT-HSCs strongly repopulate secondary animals. However, the higher percentage of chimerism in peripheral blood and bone marrow for CD38+ LT-HSC progeny indicates their superior repopulation and self-renewal capacity compared to CD38- counterparts.

      Also, the typical experiment to establish a quantitative difference in HSC production would be a limiting dilution analysis with a much larger number of recipient animals - without such data it is difficult to ascertain how different the two fractions really are.

      While we appreciate the reviewer's suggestion to include additional data on the amount of repopulating HSCs, we respectfully disagree as we believe that this information is beyond the scope of the current study, which only aims to assess the functional superiority of CD38+ LT-HSCs over CD38- LT-HSCs in side-by-side comparisons. Assessment of donor-derived cells’ frequency in peripheral blood and bone marrow relative to the frequency of competitors after transplantation of the same amount of HSCs (so-called chimerism level) is a widely accepted assay in the field to demonstrate the difference in the functionality between two HSC fractions (Sanjuan-Pla et al., Nature 2013; Gekas C and Graf T, Blood 2015; Bernitz J.M et al. Cell 2016; and others, including papers cited by the reviewer: Wilson et al., Cell Stem Cell 2015 and Cabezas-Wallscheid et al., Cell 2017). A limiting dilution experiment will provide more detailed characteristics of two HSC fractions, namely the quantitative difference (how many cells from the sorted population can repopulate). However, this experiment will not significantly change our conclusion that the CD38+ LT-HSC fraction is superior in repopulation and self-renewal capacity compared to the CD38- LT-HSC fraction, as sufficiently demonstrated in Fig. 2E-G.

      Furthermore the claim that CD38- HSCs do not ever produce CD38+ cells is a bit premature with so few mice and confusingly presented data (e.g., Fig 2I is 5 pooled mice in a single histogram plot - were these concatenated flow files? If so, how were they normalised? Did the other experiment look the same? And were all CD38+ HSCs capable of giving rise to both CD38+ and CD38- cells or was it a subfraction of mice/samples?).

      The plot provided in Fig. 2I is a FACS analysis of pooled cells from mice transplanted with CD38+ or CD38- LT-HSCs (we added a detailed explanation in figure legend 2, lines 701-703). We provided data from the second experiment in Fig. S2G. All CD38+ LT-HSCs could give rise to both CD38+ and CD38- HSC; we added data in Fig. S2H.

      Cell Cycle status differences and grades of quiescence - Ki67 and DAPI are really quite tricky for discerning G0 versus G1 and no flow cytometry plots are provided for the reader to assess how this has been done. Could another technique (e.g., Hoechst/Pyronin) be used to confirm the results? Perhaps more concerning is the variability of the assay in the authors own hands. If I am interpreting things correctly, the plots in 3G, 3H and 3I in the platelet depletion, pIpC and 5FU experiments are >10% higher in the CD38- control arm than the data in 3A which make me worried about the robustness of the cell cycle assay to distinguish G0 from G1.

      Ki67 and DAPI staining is a widely accepted technique for distinguishing G0 from G1. We provide flow cytometry plots in Fig. S2F (original figures, S3B - updated figures), which the referee may have overlooked. We added a reference to the Fig. S3B to figure legend 3 to make it more transparent for the readers. We would like to clarify the reviewer’s concern regarding the slightly different frequency of CD38- cells in the G0 phase of the cell cycle at steady state in Fig. 3A (original figures). Fig. 3A compares the cell cycle stages between CD38- and CD38+ HSCs, while Fig. 3B compares the same parameters for CD38- vs CD38+ LT-HSCs, which are enriched for quiescent HSCs by using additional surface markers. Therefore, it is correct to compare the data for LT-HSCs under stress (Fig. 3G-I, original figures) with the data for LT-HSCs at steady state in figure 3B (original figures). To make it less confusing for the reader, since the entire Figure 3 is devoted to LT-HSCs, we have moved Figure 3A to the supplementary Figures (Fig. S3A).

      All experiments for Fig. S3A&3A, 3F, 3G, and 3H (updated figures), were performed separately, and we did not compare mice from different experiments to avoid differences due to technical details. However, the groups of mice for each specific treatment (ctrl vs. treatment at different time points) were analyzed on the same day, using the same amount of cells, the same master mix of antibodies, and the same FACS machine and settings to compare ctrl vs. treated mice (we added this information in the Materials and Methods section, lines 388-391). In addition, we performed a BrdU incorporation assay and label retention assay using H2B-GFP mice, which support our finding that CD38+ LT-HSCs are more quiescent than CD38- cells in the steady state.

      Minor points: Figure 3I was really confusing - it says it is the gating strategy for GFP retaining LT-HSCs, but only shows GFP versus cKit

      We reformulated the figure legend for 3D: “Representative plot defining GFP+ cells in LT-HSCs.”

      Figure 4B suggests that only 40% of CD38+ cells divide in the first 3 days - are there survival differences or are the cells sat there as single cells? It would be important to carry these further to see if cells eventually divide.

      This is a relevant and crucial point addressed by the reviewer. We did not find any significant difference in the survival of cells. We have added this data to the supplementary data - Fig. S4Q-R.

      Reviewer #1 (Significance (Required)):

      I believe the study will be of interest to specialist readers in the HSC field, especially those working on quiescence and G0 exit. At present, I think the conclusion of a true subfractionation is a bit premature, but there are pieces of data that do look exciting and warrant further investigation. It was a little unclear how this would advance beyond Sca-1 or Gprc5c fractionation for finding more primitive HSCs, but having cleaner markers is always a useful advance for the field.

      We thank the reviewer for his/her positive evaluation of our study. In our work, we compared several functional aspects of CD38+ and CD38- LT-HSCs:

      1. We used four techniques (Ki67 and DAPI staining, BrdU incorporation assay, label retention assay, single-cell division tracing assay) and showed that CD38+ LT-HSCs are more quiescent than CD38- cells.
      2. We performed a serial transplantation assay and found that although CD38- LT-HSCs have the long-term repopulation capacity, they repopulate significantly less effectively than CD38+ LT-HSCs.
      3. We used a combination of surface markers (Lin- Kit+ Sca-1+ CD48- CD150+ CD34- CD201+) to define LT-HSCs; all of which belong to the Sca-1hi population according to Wilson et al, 2015. We further separated Sca-1hi LT-HSCs into CD38+ and CD38- cells and found that they differ in the repopulation capacity and quiescence in steady state and upon hematological stress. We conclude that CD38 surface staining should be used on top of Sca-1 to sort dormant LT-HSCs.
      4. We found that CD38+ dormant LT-HSCs differ from CD38- cells in gene expression and response to CD38 and c-Fos inhibitors. CD38+ LT-HSCs are characterized by higher cytoplasmic Ca2+ and cell cycle inhibitor p57 levels than CD38- LT-HSCs. Thus, we demonstrated that CD38 is not only a marker but also has a functional role in mediating HSC dormancy. We discovered that CD38/cADPR/Ca2+/c-Fos/p57 axis regulates CD38+ HSC dormancy. Taken together, our findings demonstrate that CD38+ LT-HSCs have superior properties compared to CD38- LT-HSCs and can be classified as dHSCs, providing a simple approach for their isolation and further study. Moreover, we uncovered the CD38-mediated molecular mechanism regulating HSCs dormancy.

      Regarding my own expertise - I have spent ~20 years in the field undertaking single cell assays of normal and malignant mouse and human HSCs, including many of the core functional assays described in this paper and consider myself very familiar with the topic area.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Although the experiments were well done and supported their testing hypothesis, but the overall novelty of the whole work is not that strong and this is because:

      -the use of CD38 to identify/select and to test mouse LT-HSCs' function in vivo (although not commonly used nowadays) was demonstrated a few times more than 20 years ago (Randall, et al., 1996: PMID: 8639761 and Tajima et al., 2001; PMID: 11313250); in fact, the authors didn't even reference/acknowledge these papers which they should have done so; hence, most of the results in Fig.2 were already known (despite this current work gave a more detailed/better analysis);

      We agree with the reviewer that the previous findings using CD38 to separate HSPCs should be appreciated; however, we would like to point out that while the studies by Randall, et al., 1996: PMID: 8639761 and Tajima et al., 2001; PMID: 11313250 employ only 3 markers to discriminate HSPC (Lin- Sca-1+ Kit+), in our study, we performed for the first time a very detailed characterization of CD38+ cells using surface markers that were not available 20 years ago. We analyzed not only the HSC compartment but also different populations of multipotent progenitors. Modern surface marker combinations for the LT-HSC isolation allow us to show that both populations: CD38- and CD38+, can be classified as LT-HSCs in contrast to the data of Randall et al, where the authors did not find any long-term repopulating activity in the CD38- KLS compartment. Moreover, we showed the hierarchical relationships between these two populations. We appreciate the previous findings and recommendations of the reviewer, and have added citations (Randall, et al., 1996: PMID: 8639761 and Tajima et al., 2001; PMID: 11313250) and comment in the discussion section, lines 267-271:

      In contrast to previous studies reporting that only CD38+ HSPC compartment from adult mice contains LT-HSCs (42, 43), in our study we demonstrated using modern surface marker combinations for the isolation of LT-HSCs that while both populations: CD38- and CD38+, can be classified as LT-HSCs, only CD38+ LT-HSCs display characteristics of dormant HSCs (4).’’

      -it is known the generic roles of CD38 in producing cADPR, ADPR, etc and these can induce Ca2+ oscillation in cells; despite that, it was nicely demonstrated here that in mouse HSCs cADPR was the main signalling mediator;

      We thank the reviewer for pointing this out; indeed, it has not been shown before how Ca2+ is regulated in HSCs.

      the roles of cADPR in human CD34+ were demonstrated (Podesta et al., 2023; PMID: 12475890: when CD34+ HSPCs were primed in vitro with cADPR it resulted in enhanced short-term while maintaining long-term (secondary transplant) engraftment in NOD/SCID mice, probably (mechanisms were not determined at that time) inducing cycling/expansion of human CD34+CD38+ progenitors while inhibiting cycling (hence, better long-term maintenance) of CD34+CD38- HSPCs); on this note; the data presented in Fig.4 K and S5 should be eliminated as it adds little to their story and it can be quite confusing when comparing to mouse data unless the authors wish to explore in a more detailed way the human part.

      We appreciate the reviewer’s valuable suggestion. However, we respectfully disagree with their interpretation because we do not believe that the technical aspects of the cited paper (Podesta et al., 2003; PMID: 12475890) are robust enough to support their conclusions. Podesta et al. concluded that in vivo and in vitro treatment with a high dose of cADPR (25-fold higher than the physiological dose, according to the authors' estimation) stimulates the expansion of HSC and progenitor cells. At the same time, they did not use any surface markers to define populations and studied total mononuclear cord blood cells, so no conclusions can be drawn regarding CD34+ CD38+ and CD34+ CD38- dynamics. Unfortunately, we cannot confirm the reliability of the HSC engraftment data presented by Podesta et al. This is because they did not analyze the chimerism of human cells in peripheral blood and bone marrow for sixteen weeks post-transplantation, which is considered a standard time period for assessing long-term engraftment of human HSCs in the field (Brehm M.A. et al., Blood 2012, Cosgun K.N. et al., Cell Stem Cell 2014, Takagi S. et al. Blood 2012). Instead, they counted only some CD34+ cells at three and eleven weeks after transplantation. Therefore, the role of cADPR in the regulation of human HSC quiescence remained unknown.

      In our original study, we showed that blocking the CD38 ecto-enzymatic activity stimulated both human HSC and mouse HSCs to exit from the G0 phase of the cell cycle. The role of CD38 enzymatic activity can be conservative for mice and humans and needs to be further investigated in future studies on human HSCs. For this reason, we decided to keep Fig. 4K and S6 in the paper.

      -Ca2+ induction in cells can induce c-fos expression (as in an early response gene); in many cell types hence, it was not a surprising finding;

      We agree with the reviewer that it has been shown previously that Ca2+ induction in cells could induce c-fos expression (as an early response gene to stress). However, we have shown for the first time that Ca2+ regulates c-Fos expression in LT-HSCs under steady-state conditions.

      -c-fos was demonstrated to suppress cell cycle entry of dormant hematopoietic stem cells (Okada et al., 1999: PMID: 9920830).

      In the cited publication (Okada et al., 1999: PMID: 9920830) the authors have only analyzed the in vitro proliferation and colony formation of Lin- Sca-1+ cells in the IFNα/β inducible c-Fos overexpression model. This population mainly contains progenitor cells and only 0.004% of dormant LT-HSCs (please find below an estimation of LT-HSC frequency). Therefore, the role of c-Fos in the regulation of dormant HSC cell cycle entry remained unexplored.

      It would be useful to do ChIP-seq to determine to confirm that c-fos regulates p57 expression.

      We have shown that inhibition of c-Fos transcriptional activity inhibits p57 expression (Fig. 6G). ChIP–seq with antibody against c-Fos will answer whether c-Fos directly activates the expression of p57. However, we can only isolate 200-300 CD38+ LT-HSCs from all bones of one mouse. Unfortunately, the ChIP-seq with such an amount of cells is technically very difficult, which explains the absence of publications using ChIP-seq for studying transcription factors in LT-HSCs. We added in the Discussion section that we couldn’t exclude indirect regulation of p57 expression by c-Fos, lines 307-308:” In contrast, although we couldn’t exclude indirect regulation of p57kip2 expression by c-Fos, our data clearly reveal that inhibiting the interaction between c-Fos and DNA in dHSCs reduced protein levels of the cell cycle inhibitor p57kip2 and stimulated cell cycle entry.”

      So overall, many of the findings were already out there and the authors gathered many of the pieces of the puzzle and put them together (and demonstrated) in a nice and well-thought manner. This work does add useful information to the scientific community but unfortunately is not ground-breaking. It may contribute to other fields beyond hematopoiesis where CD38 function may play a role.

      Thank you very much for the positive review of our work. As mentioned by the reviewer, CD38 is expressed by other normal (lymphocytes, Kupffer cells (Tarrago M.G. et al., Cell Metabolism 2018)) and cancer cells, e.g. hematological malignancies, lung cancer, prostate cancer (Hogan K.A. et al. Frontiers in Immunology, 2019),) but has not been studied in the context of quiescence regulation. Currently, anti-CD38 monoclonal antibodies are used to treat malignancies (Daratumumab) by mediating cytotoxicity (Lokhorst H.M et al., N. Engl. J. Med, 2015). However, the inhibition of CD38 enzymatic activity has not been used broadly. Therefore, our study can be groundbreaking and open new directions in anti-cancer therapy.

      Reviewer #2 (Significance (Required)):

      In this manuscript, the authors investigated the potential roles of CD38 (mainly) in mouse HSCs quiescent; the authors dissected the potential molecular mechanism by which this occurred, and it was via CD38/cADPR/Ca2+/cFos/p57Kip2. The authors used a combination of transplantation assays to test the importance of CD38 in vivo, followed by a series of simple in vitro experiments (mainly using pharmacological means) to dissect the molecular mechanisms. The manuscript is well-written/explained and the data presented is solid. There are no major issues in terms of reproducibility and clarity in this work.

      We would like to thank the reviewer again for the detailed positive feedback.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Although the experiments were well done and supported their testing hypothesis, but the overall novelty of the whole work is not that strong and this is because:

      • the use of CD38 to identify/select and to test mouse LT-HSCs' function in vivo (although not commonly used nowadays) was demonstrated a few times more than 20 years ago (Randall, et al., 1996: PMID: 8639761 and Tajima et al., 2001; PMID: 11313250); in fact, the authors didn't even reference/acknowledge these papers which they should have done so; hence, most of the results in Fig.2 were already known (despite this current work gave a more detailed/better analysis);
      • it is known the generic roles of CD38 in producing cADPR, ADPR, etc and these can induce Ca2+ oscillation in cells; despite that, it was nicely demonstrated here that in mouse HSCs cADPR was the main signalling mediator;
      • the roles of cADPR in human CD34+ were demonstrated (Podesta et al., 2023; PMID: 12475890: when CD34+ HSPCs were primed in vitro with cADPR it resulted in enhanced short-term while maintaining long-term (secondary transplant) engraftment in NOD/SCID mice, probably (mechanisms were not determined at that time) inducing cycling/expansion of human CD34+CD38+ progenitors while inhibiting cycling (hence, better long-term maintenance) of CD34+CD38- HSPCs); on this note; the data presented in Fig.4 K and S5 should be eliminated as it adds little to their story and it can be quite confusing when comparing to mouse data unless the authors wish to explore in a more detailed way the human part.
      • Ca2+ induction in cells can induce c-fos expression (as in an early response gene); in many cell types hence, it was not a surprising finding;
      • c-fos was demonstrated to suppress cell cycle entry of dormant hematopoietic stem cells (Okada et al., 1999: PMID: 9920830).

      It would be useful to do ChIP-seq to determine to confirm that c-fos regulates p57 expression.

      So overall, many of the findings were already out there and the authors gathered many of the pieces of the puzzle and put them together (and demonstrated) in a nice and well-thought manner. This work does add useful information to the scientific community but unfortunately is not ground-breaking. It may contribute to other fields beyond hematopoiesis where CD38 function may play a role.

      Significance

      In this manuscript, the authors investigated the potential roles of CD38 (mainly) in mouse HSCs quiescent; the authors dissected the potential molecular mechanism by which this occurred, and it was via CD38/cADPR/Ca2+/cFos/p57Kip2. The authors used a combination of transplantation assays to test the importance of CD38 in vivo, followed by a series of simple in vitro experiments (mainly using pharmacological means) to dissect the molecular mechanisms. The manuscript is well-written/explained and the data presented is solid. There are no major issues in terms of reproducibility and clarity in this work.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In their paper entitled "CD38 promotes hematopoietic stem cell dormancy via c-Fos", Ibneeva et al., present a set of data predominantly from mouse HSCs where they explore the cell cycle kinetics and self-renewal capacity of LT-HSCs expressing (or not) CD38. They perform a series of sophisticated in vitro and in vivo experiments, including transplantations and single cell cultures and arrive at the conclusion that CD38 can fractionate LT-HSCs that are more deeply quiescent. Overall, it is an interesting question and would be of interest to experimental hematologists. That said, I had a number of issues that concerned me throughout the manuscript with regard to the robustness of the conclusions around CD38 and I have tried to detail these below.

      Major concerns:

      1. Novelty - It was unclear what the relationship of this CD38+ fraction had with other "segregators" of LT-HSCs - e.g., how does it compare with the Sca1 fractionation of Wilson et al, Cell Stem Cell 2015 or Gprc5c of Cabezas-Wallschied Cell 2017? Even if CD38 fractionated LT-HSCs, it was unclear what it would give beyond these two molecules (especially re: Sca-1 which is also a cell surface marker)
      2. Claims of CD38+ superiority in transplantation - I was surprised with the claim of CD38 negative cells being a less functional HSC when they are clearly still very strong in secondary transplantation assays. Both 38+ and 38- cells strongly repopulate secondary animals and only 5 mice were shown in the Figure. The legend suggests another experiment was undertaken, but these data are not presented. Did they substantially differ in their chimerism in primary and secondary animals? Was the magnitude of difference between the two fractions similar in both experiments? Is there a reason that the data could not be plotted on the same graph? Also, the typical experiment to establish a quantitative difference in HSC production would be a limiting dilution analysis with a much larger number of recipient animals - without such data it is difficult to ascertain how different the two fractions really are.

      Furthermore the claim that CD38- HSCs do not ever produce CD38+ cells is a bit premature with so few mice and confusingly presented data (e.g., Fig 2I is 5 pooled mice in a single histogram plot - were these concatenated flow files? If so, how were they normalised? Did the other experiment look the same? And were all CD38+ HSCs capable of giving rise to both CD38+ and CD38- cells or was it a subfraction of mice/samples?). 3. Cell Cycle status differences and grades of quiescence - Ki67 and DAPI are really quite tricky for discerning G0 versus G1 and no flow cytometry plots are provided for the reader to assess how this has been done. Could another technique (e.g., Hoechst/Pyronin) be used to confirm the results? Perhaps more concerning is the variability of the assay in the authors own hands. If I am interpreting things correctly, the plots in 3G, 3H and 3I in the platelet depletion, pIpC and 5FU experiments are >10% higher in the CD38- control arm than the data in 3A which make me worried about the robustness of the cell cycle assay to distinguish G0 from G1.

      Minor points:

      Figure 3I was really confusing - it says it is the gating strategy for GFP retaining LT-HSCs, but only shows GFP versus cKit

      Figure 4B suggests that only 40% of CD38+ cells divide in the first 3 days - are there survival differences or are the cells sat there as single cells? It would be important to carry these further to see if cells eventually divide.

      Significance

      I believe the study will be of interest to specialist readers in the HSC field, especially those working on quiescence and G0 exit. At present, I think the conclusion of a true subfractionation is a bit premature, but there are pieces of data that do look exciting and warrant further investigation. It was a little unclear how this would advance beyond Sca-1 or Gprc5c fractionation for finding more primitive HSCs, but having cleaner markers is always a useful advance for the field.

      Regarding my own expertise - I have spent ~20 years in the field undertaking single cell assays of normal and malignant mouse and human HSCs, including many of the core functional assays described in this paper and consider myself very familiar with the topic area.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2023-01862

      Corresponding author(s): Lasse, Sinkkonen

      1. General Statements [optional]

      This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

      In our manuscript we have aimed to take an unbiased and data-driven high-throughput approach for identification of transcription factors important for dopaminergic neuron differentiation via repeated, combined transcriptomics and epigenomics measurements. We also provide the research community with an extensive dataset enabling further studies on dopaminergic neurons beyond the scope of a single manuscript. We validate identified transcription factors not previously recognized being involved in mDAN differentiation. While we believe our approach is powerful in unbiased identification of central regulators, it does not focus only on factors that are unique for dopaminergic neurons. Importantly, the ranking of transcription factors is based on the epigenomic data of the target genes, rather than expression of transcription factors themselves. We have aimed for the genome-wide identification of pathways controlled by the identified transcription factors, for example through transcriptome analysis.

      For practical reasons, to gain the sufficient depth of data to accomplish our aim, only one iPSC line was used for the initial data generation. However, we fully agree on the need for validation of the key findings and overall gene expression profiles in additional independent cell lines. Please find below our detailed point-by-point plan on addressing the reviewers’ comments.

      2. Description of the planned revisions

      Insert here a point-by-point reply that explains what revisions, additional experimentations and analyses are planned to address the points raised by the referees.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this study, Ramos and colleagues defined gene regulatory networks and transcriptional landscape during differentiation of a human iPSC reporter line into dopaminergic neurons. Several omic techniques (RNA-seq, ATAC-seq, chromatin-IP) and modelling (EPIC-DREAM) allowed them to identify putative effectors of dopaminergic differentiation LBX1, NHLH1 and NR2F1/2. Using overexpression and shRNA-mediated knock down experiments, the authors attempted to validate the hits.

      This manuscript is very difficult to read and is confusing. The data are interesting, but they need to be presented in a more concise and readable way, in addition to be validated using additional iPSC lines. Below are few comments.

      We thank Reviewer1 for taking the time to evaluate our manuscript and for providing valuable feedback towards improving it further. We were happy to read that the Reviewer1 found the study interesting with only a few caveats. Here we will outline a detailed plan to address those limitations.

      In the revised manuscript we will do our best to improve the readability of the manuscript. However, since Reviewer2 has found that the manuscript is “well written, the research laid out in a clear way, and the experiments well thought”, it is somewhat difficult for us to identify the exact changes to introduce. Perhaps these are related to field-specific vocabulary or methodology, which we will aim to make more readable for broader audience.

      We agree on the concern of Reviewer1 that different human iPSC lines can show significant variability due to their individual genetic backgrounds. We have observed differences in the rate of neuronal differentiation, depending on the iPSC line, and transcriptomic analysis reveals hundreds of differentially expressed genes between independent iPSC lines. Still, in a case of a single healthy donor, we don’t expect an intra-individual variability to alter conclusions regarding key regulators of fundamental processes such as differentiation. To carry out our multi-omic analysis in the sufficient depth that we have applied and using only purified dopaminergic neurons with a TH-mCherry-reporter inserted using genome editing, it was (also budget-wise) not considered to include multiple independent iPSC lines for the entire panel of experiments (as our ambition was not to characterize a specific mutation). However, to address this point, we have generated a second iPSC line from a healthy donor with TH-mCherry-reporter inserted through genome editing. To address the concerns regarding variability between different human iPSC lines we plan to:

      1) Perform transcriptomic profiling of the second TH-mCherry-reporter line at selected time points of dopaminergic neuron differentiation to confirm the similarity of changes in cell identity at transcriptome level.

      2) Perform TH staining upon LBX1 or NHLH1 knock-down in additional iPSC lines following dopaminergic neuron differentiation, to confirm their effect on differentiation across iPSC lines. To do this we will apply the Yokogawa high content image analysis that has been recently established in our laboratories. This will also be related to the next point regarding microscopy images of the dopaminergic neuron differentiation and the effect of transcription factors on this.

      Only relative numbers and mRNA level normalized to control are presented in main figures. This is very confusing because there is no real quantification. Images of cultures to show increased/decreased number of dopaminergic neurons in non-FACS purified cultures following overexpression/knock down should be presented in main figures. It is recommended to add absolute quantification (percent of DAPI) and statistical analysis based on N=3 independent experiments.

      Thank you for raising this point. We are happy to clarify the quantification of dopaminergic neuron numbers and mRNA levels. All quantifications of dopaminergic neuron numbers were based on the mCherry reporter inserted in the TH locus through genome editing and expressed together with endogenous TH. While mCherry can be detected using microscopy (as shown in Figure 1), the signal is significantly weaker than what can be achieved through antibody staining and quantitative analysis is therefore much more accurate when systematically performed using FACS analysis and controlled by using a cell line without the mCherry reporter. Moreover, the approach is direct and not dependent on antibody specificity. Therefore, all quantifications of dopaminergic neuron numbers in the manuscript were performed using FACS.

      Most in vitro cell differentiation protocols show variability in their efficiency between independent experiments, which is typically reflected as variable expression levels of the different marker genes (Grancharova et al. 2021). This is also true for dopaminergic neuron differentiation and in our experiments the number of obtained dopaminergic neurons can vary between 5-20% while differentiations performed in parallel as part of the same experiment are typically very similar. Summarizing absolute numbers between independent experiments can lead to large variation while the relative effect of perturbation is reproducible. Therefore, our results are presented as relative changes in dopaminergic neuron numbers and mRNA levels.

      Nevertheless, to increase confidence in the impact of NHLH1 and LBX1 on dopaminergic neuron differentiation, we propose, as already described above, to perform TH staining upon LBX1 or NHLH1 knock-down in additional iPSC lines following dopaminergic neuron differentiation. To visualize the observed impact on differentiation.

      Based on images shown in figure S4, the effect of rapamycin is very low (no quantification is presented).

      We apologize for the unclear Figure Legend for Figure S4 that did not specify what is visualized in the image. The images represent the transduction efficiency of the neurons based on the GFP reporter co-expressed with the short hairpin constructs. The mCherry levels, that are quantified in Figure 6G, are not visualized in these images. We will correct the Figure Legend accordingly. As mentioned in the last sentence on page 20 of the manuscript (referring to Supplementary Figure S4), rapamycin did not induce similar level of reduction in cell numbers as LBX1 knock-down alone did.

      Are the three hits altered in dopaminergic neurons in Parkinson's disease and other synucleinopathies that could explain dysfunction of dopamine neurons in disease? Nurr1, EN1 and many other genes required for differentiation of dopaminergic neurons from pluripotent stem cells have their expression decreased in Parkinson's. It is expected that the expression of LBX1, NHLH1 and NR2F1/2 would change under disease condition.

      We have investigated the expression of LBX1, NHLH1 and NR2F1/2 using recent meta-analysis of post-mortem brain tissue transcriptomes of Parkinson’s disease patients (Tranchevent, Halder, & Glaab, 2023). None of these TFs was found to be dysregulated in Parkinson’s disease patients. This is consistent with the fact that the expression of these factors is not restricted only to A9 midbrain dopaminergic neurons that are primarily degenerating in Parkinson’s disease but can be detected also in several other types of neurons (please see also our response in section 4).

      However, NHLH1 expression is reduced in dopaminergic neurons derived from iPSCs of Parkinson’s disease patients carrying a LRRK2-G2019S mutation based on our published single cell RNA-seq data (Walter et al., 2021).

      Beyond this, our results implicate NHLH1 in the regulation of miR-124, which in turn has been found to be downregulated in Parkinson’s disease patients and neuroprotective in different animal models of Parkinson’s disease (Angelopoulou, Paudel, & Piperi, 2019; Saraiva, Paiva, Santos, Ferreira, & Bernardino, 2016; Yang, Li, Yang, Guo, & Li, 2021; Zhang et al., 2022). Similarly, a recent analysis of single nuclei RNA-seq of midbrains from Parkinson’s disease patients, showed that targets of NR2F2 were enriched in the vulnerable dopaminergic neuron population, promoting neurodegeneration (Kamath et al., 2022). Indicating the involvement of the pathway in disease progression without a change in transcription factor expression.

      Finally, a polymorphism in NHLH1 locus (rs2147472) is associated with schizophrenia while a polymorphism in LBX1 locus (rs12242050) is associated with Parkinson's disease, suggesting further involvement of these genes in disease risk.

      We propose to include these findings in the revised manuscript and discuss them in the context of the current literature.

      __Reviewer #1 (Significance (Required)): __

      Interesting study that needs to be replicated using additional cell lines.

      We would like to thank the reviewer for this positive conclusion and plan to address the key concerns using additional iPSC lines for transcriptome profiling and knock-down experiments.

      __ Reviewer #2 (Evidence, reproducibility and clarity (Required)):__

      In this manuscript Ramos et al. present a novel and comprehensive transcriptomic and epigenomic profile that identifies a series of key regulators of mDANs differentiation, providing functional validation and characterization of two newly associated TFs: LBX1 or NHLH1. In order to discover key regulators of mDAN differentiation the authors use their previous EPIC-DREM pipeline together with ATAC-seq data for the first time. Then, they focus their attention on those TFs with a more probable regulatory role by performing low input ChIP-seq for H3K27ac leading to the identification of 6 TFs as novel candidate regulators of mDAN differentiation under the control of super-enhancers at day 30 and day 50 of differentiation. In vitro knock down and overexpression of candidate TFs revealed LBX1, NHLH1 as important regulators of DAn differentiation. The authors then interrogate the role of these two TFs through RNA-seq and an Ingenuity Pathway Analysis (IPA)/g:Profiler and proposed regulation of the mature form miR-124 and cholesterol biosynthesis-related genes as the main processes controlled by NHLH1 and LBX1, respectively.

      Overall, the manuscript is well written, the research laid out in a clear way, and the experiments well thought. The novelty of this study lays in the combination of epigenomic and transcriptomic data at different time points in specific cells during DAn differentiation. I believe the conclusions are supported by the results presented and therefore recommend this paper for publication after addressing some minor points listed below:

      We would like to thank the reviewer for the detailed and overall positive evaluation of our work. We are grateful for the suggestions for improvements and below we detail our plan for addressing them.

      Minor comments:

      1. In page 15 the authors state "the list of 17 TFs was further explored to select the most promising candidates for functional analysis". However, they only named TCF4 and MEIS1 as examples of discarded TFs through literature search. It is not clear which of the remaining 15 TFs were discarded because of a literature search and which were by SE signal cutoff. Clarification is needed.

      We will add clarification statements here, providing more evidence for the selection of our candidates. For that, we will add a supplementary figure showing the locus and expression of the 11 TFs that were not selected.

      In page 15 the authors state "TFs, HOXB2, LBX1, NHLH1, NR2F1 (also known as COUP-TFI), NR2F2 (also known as COUP-TFII) and SOX4 were found to present the strongest SE signals and most dynamic gene expression profiles" however I could not find the data that corroborate this statement within tables or figures. Authors should provide hard data to support this statement.

      With the clarification from point 1, point 2 will also be answered for a clear description and criteria of our selection.

      In supplementary 3, in the IPA analysis some data appear with the warning "#¡NUM!" at the z-score. Some explanation should be given and if pertinent, added to the table legend.

      Sorry for not clarifying that in the dataset. That term is produced when IPA cannot predict the Z-score and it is represented in our bar graphs in grey (see Figure 6B). We will add that information to the table header.

      In methodology, some reagents and techniques appear with a code reference to catalog number and others don´t. Please keep it uniform throughout the text.

      In this study, we performed most of the techniques using kits which contained all necessary reagents for it. We will better clarify which reagents were provided by the manufacturer and which ones were additional to the kits.

      Supplementary table 1 has some TFs highlighted in yellow but there is no legend that explain what the yellow highlight symbolizes. Clarification is needed

      This is an error and there should not be any TF highlighted in yellow. We apologize for the inconvenience. The highlights will be removed from the revised tables.

      Format suggestions:

      1. For an easier to follow flow between figure 3A and the main text, it would be helpful if NR2F1 and NR2F2 graphs in Figure 3A appeared next to each other or one above the other.

      We will follow the recommendation from the reviewer, and we will change the order of the TFs in the figure to have both NR2F TFs next to each other.

      Supplementary table 2.

      Data is presented in a confused way. For example, the Top20_TFs_EPIC-DREM is presented as a list of names without divisions of type node or scoring annotations. It would be more informative and easy to follow if proper labeling and scoring is given within this spreadsheet without the necessity of navigating sup.table1 in parallel.

      it would be preferable to have an extra sheet showing the comparison between both data sets (SE and EPICDREAM) before providing a final list of relevant TFs.

      To the existing table containing the TFs controlled by SE, we are going to add the information regarding EPIC-DREM, namely, the rank those TFs got in each node together with their median ranking, and their best rank across nodes. That will give a good overview on how they look in both analyses. With this approach, some of the TFs controlled by SE will have no information regarding EPIC-DREM because their motif is not known according to the Jaspar database.

      Reviewer #2 (Significance (Required)):

      -General assessment:

      Overall, the manuscript is well written, the research laid out in a clear way, and the experiments well thought. The novelty of this study lays in the combination of epigenomic and transcriptomic data at different time points in specific cells during DAn differentiation and description of new roles in DAn differentiation for two TF: LBX1 or NHLH1.

      We thank the Reviewer2 for this assessment.

      -Limitations: One limitation, than the authors themselves mentioned, is the possibility that promising candidate TFs involved in mDAn differentiation are discarded or not taken in account by the EPIC-DREAM algorithm.

      We agree with this limitation and will make all the data available for the larger research community to use for follow-up work. Importantly, the data can be easily used for re-analysis using the same pipeline when improved databases become available.

      -Audience: This manuscript focuses on factors involved in mDAN differentiation which targets a highly specific audience however their multiomic and functional methodology might attract broader audiences looking to apply similar pipelines and/or experimentation in different areas of research.

      -My field of expertise:

      I am a geneticist and neuroscientist with expertise in molecular biology and epigenomics focused on age related neurodegenerative disorders.

      -Recommendation:

      I believe the conclusions are supported by the results presented and therefore recommend this paper for publication after addressing some minor points.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. If no revisions have been carried out yet, please leave this section empty.

      No changes were introduced so far.

      4. Description of analyses that authors prefer not to carry out

      Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

      Below we will provide a point-by-point response to concerns raised by the reviewers that we believe are outside of the scope of our study.

      There is not data showing that the targets are specifically required for dopaminergic differentiation. One may argue that same targets may be identified and required for differentiation of other neuronal cell types. Hence, hits need to be validated for other neuronal cell types using knock in and shRNA mediated KO.

      The novelty of this study resides in the use of epigenomic signatures to predict TF activity across differentiation and couple those predictions with the transcriptional changes occurring during this process to identify the TFs responsible for most of the transcriptional changes observed. Therefore, although our focus were TFs important for establishing cell identity, we did not select TFs with a selective/exclusive expression in these cells, namely, cell identity TFs. This gives another perspective regarding TF activity and their relevance for cellular processes like differentiation.

      We believe the TFs identified in our study are likely to be involved in regulation in several other neuronal subtypes. There is a wide range of neuronal subtypes and selection and establishment of some of the those for testing of our factors seems biased but also outside of the scope of this study.

      Are the neurons generated following overexpression/shRNA-mediated knock down of the three hits functional? Electrophysiological recordings could help.

      What other functions are affected in dopaminergic neurons when targets are knocked-down? Is lysosomal activity changed? Is the level of synaptic proteins altered compared to control?

      In order not to bias our approach towards particular phenotypes by selected analysis such as electrophysiological measurements or lysosomal activity assays, we performed a transcriptional profiling upon TF depletion for our selected candidates. Our transcriptional profiling highlighted the main pathways affected by the TFs and they are presented and discussed in our study. We exploit these data to find the processes controlled by our TFs that help to define dopaminergic neuron cell identity. We discussed them and tested the role of mTOR signaling and miR-124 as targets of our TFs. The results from the RNA-seq analysis did not indicate direct regulation of synaptic or lysosomal activity, and therefore we find such analysis to be outside of the scope of our study.

      Moreover, since the knock-down of our candidate TFs is in general inhibiting dopaminergic differentiation, studying the dopaminergic neurons remaining after a knock-down risks focusing on cells that have either partially or completely escaped the knock-down. Thereby influencing the value of detailed analysis of their functionality.

      References:

      Grancharova, T., Gerbin, K.A., Rosenberg, A.B. et al. A comprehensive analysis of gene expression changes in a high replicate and open-source dataset of differentiating hiPSC-derived cardiomyocytes. Sci Rep 11, 15845 (2021). https://doi.org/10.1038/s41598-021-94732-1

      Angelopoulou, E., Paudel, Y. N., & Piperi, C. (2019). miR-124 and Parkinson’s disease: A biomarker with therapeutic potential. Pharmacological Research, 150. https://doi.org/10.1016/J.PHRS.2019.104515

      Kamath, T., Abdulraouf, A., Burris, S. J., Langlieb, J., Gazestani, V., Nadaf, N. M., … Macosko, E. Z. (2022). Single-cell genomic profiling of human dopamine neurons identifies a population that selectively degenerates in Parkinson’s disease. Nature Neuroscience, 25(5), 588–595. https://doi.org/10.1038/S41593-022-01061-1

      Saraiva, C., Paiva, J., Santos, T., Ferreira, L., & Bernardino, L. (2016). MicroRNA-124 loaded nanoparticles enhance brain repair in Parkinson’s disease. Journal of Controlled Release : Official Journal of the Controlled Release Society, 235, 291–305. https://doi.org/10.1016/J.JCONREL.2016.06.005

      Tranchevent, L. C., Halder, R., & Glaab, E. (2023). Systems level analysis of sex-dependent gene expression changes in Parkinson’s disease. Npj Parkinson’s Disease 2023 9:1, 9(1), 1–16. https://doi.org/10.1038/s41531-023-00446-8

      Walter, J., Bolognin, S., Poovathingal, S. K., Magni, S., Gérard, D., Antony, P. M. A., … Schwamborn, J. C. (2021). The Parkinson’s-disease-associated mutation LRRK2-G2019S alters dopaminergic differentiation dynamics via NR2F1. Cell Reports, 37(3). https://doi.org/10.1016/J.CELREP.2021.109864

      Yang, Y., Li, Y., Yang, H., Guo, J., & Li, N. (2021). Circulating MicroRNAs and Long Non-coding RNAs as Potential Diagnostic Biomarkers for Parkinson’s Disease. Frontiers in Molecular Neuroscience, 14, 28. https://doi.org/10.3389/FNMOL.2021.631553/BIBTEX

      Zhang, F., Yao, Y., Miao, N., Wang, N., Xu, X., & Yang, C. (2022). Neuroprotective effects of microRNA 124 in Parkinson’s disease mice. Archives of Gerontology and Geriatrics, 99. https://doi.org/10.1016/J.ARCHGER.2021.104588

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript Ramos et al. present a novel and comprehensive transcriptomic and epigenomic profile that identifies a series of key regulators of mDANs differentiation, providing functional validation and characterization of two newly associated TFs: LBX1 or NHLH1. In order to discover key regulators of mDAN differentiation the authors use their previous EPIC-DREM pipeline together with ATAC-seq data for the first time. Then, they focus their attention on those TFs with a more probable regulatory role by performing low input ChIP-seq for H3K27ac leading to the identification of 6 TFs as novel candidate regulators of mDAN differentiation under the control of super-enhancers at day 30 and day 50 of differentiation. In vitro knock down and overexpression of candidate TFs revealed LBX1, NHLH1 as important regulators of DAn differentiation. The authors then interrogate the role of these two TFs through RNA-seq and an Ingenuity Pathway Analysis (IPA)/g:Profiler and proposed regulation of the mature form miR-124 and cholesterol biosynthesis-related genes as the main processes controlled by NHLH1 and LBX1, respectively. Overall, the manuscript is well written, the research laid out in a clear way, and the experiments well thought. The novelty of this study lays in the combination of epigenomic and transcriptomic data at different time points in specific cells during DAn differentiation. I believe the conclusions are supported by the results presented and therefore recommend this paper for publication after addressing some minor points listed below:

      Minor comments:

      1. In page 15 the authors state "the list of 17 TFs was further explored to select the most promising candidates for functional analysis". However, they only named TCF4 and MEIS1 as examples of discarded TFs through literature search. It is not clear which of the remaining 15 TFs were discarded because of a literature search and which were by SE signal cutoff. Clarification is needed.
      2. In page 15 the authors state "TFs, HOXB2, LBX1, NHLH1, NR2F1 (also known as COUP-TFI), NR2F2 (also known as COUP-TFII) and SOX4 were found to present the strongest SE signals and most dynamic gene expression profiles" however I could not find the data that corroborate this statement within tables or figures. Authors should provide hard data to support this statement.
      3. In supplementary 3, in the IPA analysis some data appear with the warning "#¡NUM!" at the z-score. Some explanation should be given and if pertinent, added to the table legend.
      4. In methodology, some reagents and techniques appear with a code reference to catalog number and others don´t. Please keep it uniform throughout the text.
      5. Supplementary table 1 has some TFs highlighted in yellow but there is no legend that explain what the yellow highlight symbolizes. Clarification is needed

      Format suggestions:

      1. For an easier to follow flow between figure 3A and the main text, it would be helpful if NR2F1 and NR2F2 graphs in Figure 3A appeared next to each other or one above the other.
      2. Supplementary table 2.
        • a. Data is presented in a confused way. For example, the Top20_TFs_EPIC-DREM is presented as a list of names without divisions of type node or scoring annotations. It would be more informative and easy to follow if proper labeling and scoring is given within this spreadsheet without the necessity of navigating sup.table1 in parallel.
        • b. it would be preferable to have an extra sheet showing the comparison between both data sets (SE and EPICDREAM) before providing a final list of relevant TFs.

      Significance

      General assessment:

      Overall, the manuscript is well written, the research laid out in a clear way, and the experiments well thought. The novelty of this study lays in the combination of epigenomic and transcriptomic data at different time points in specific cells during DAn differentiation and description of new roles in DAn differentiation for two TF: LBX1 or NHLH1.

      Limitations:

      One limitation, than the authors themselves mentioned, is the possibility that promising candidate TFs involved in mDAn differentiation are discarded or not taken in account by the EPIC-DREAM algorithm.

      Audience:

      This manuscript focuses on factors involved in mDAN differentiation which targets a highly specific audience however their multiomic and functional methodology might attract broader audiences looking to apply similar pipelines and/or experimentation in different areas of research.

      My field of expertise:

      I am a geneticist and neuroscientist with expertise in molecular biology and epigenomics focused on age related neurodegenerative disorders.

      Recommendation:

      I believe the conclusions are supported by the results presented and therefore recommend this paper for publication after addressing some minor points.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this study, Ramos and colleagues defined gene regulatory networks and transcriptional landscape during differentiation of a human iPSC reporter line into dopaminergic neurons. Several omic techniques (RNA-seq, ATAC-seq, chromatin-IP) and modelling (EPIC-DREAM) allowed them to identify putative effectors of dopaminergic differentiation LBX1, NHLH1 and NR2F1/2. Using overexpression and shRNA-mediated knock down experiments, the authors attempted to validate the hits.

      This manuscript is very difficult to read and is confusing. The data are interesting, but they need to be presented in a more concise and readable way, in addition to be validated using additional iPSC lines. Below are few comments.

      Only relative numbers and mRNA level normalized to control are presented in main figures. This is very confusing because there is no real quantification. Images of cultures to show increased/decreased number of dopaminergic neurons in non-FACS purified cultures following overexpression/knock down should be presented in main figures. It is recommended to add absolute quantification (percent of DAPI) and statistical analysis based on N=3 independent experiments.

      There is not data showing that the targets are specifically required for dopaminergic differentiation. One may argue that same targets may be identified and required for differentiation of other neuronal cell types. Hence, hits need to be validated for other neuronal cell types using knock in and shRNA mediated KO.

      Based on images shown in figure S4, the effect of rapamycin is very low (no quantification is presented).

      Are the neurons generated following overexpression/shRNA-mediated knock down of the three hits functional? Electrophysiological recordings could help.

      What other functions are affected in dopaminergic neurons when targets are knocked-down? Is lysosomal activity changed? Is the level of synaptic proteins altered compared to control?

      Are the three hits altered in dopaminergic neurons in Parkinson's disease and other synucleinopathies that could explain dysfunction of dopamine neurons in disease? Nurr1, EN1 and many other genes required for differentiation of dopaminergic neurons from pluripotent stem cells have their expression decreased in Parkinson's. It is expected that the expression of LBX1, NHLH1 and NR2F1/2 would change under disease condition.

      Significance

      Interesting study that needs to be replicated using additional cell lines.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to reviewer comments

      Reviewer #1: Major Points

      • I was hoping to see the gel run for various days of desiccation to support the conclusion that proteome remodeling occurs **during** the desiccation. Right now, the data in Fig. 2 come from a single day – 21 days post desiccation – so it still shows that proteomic remodeling happened during those 21 days but not exactly on which days. Response: Thank you for this suggestion. We have ourselves become quite interested in the exact nature and extent of proteome changes over time in this paradigm. Indeed, our findings in this study now open up so many future exciting directions including various possible molecular mechanisms that control this phenomenon. We are planning to carry out an extensive future study to compare the proteome of fresh and desiccated eggs quantitatively, and over time in order to explore these directions. At this stage though, a complete proteomic study is infeasible. However, our existing data still shows that Aedes eggs have acquired unique proteome – level changes which reiterates a distinct metabolic remodeling happening during the process of desiccation. We have added your point as an important consideration in the manuscript (L207-209).

      • In Fig 2B: Unclear what you’re using as a reference to say that “45 proteins increased and 125 proteins decreased in amounts” (L147-148). Relative to fresh eggs that were laid 48 hours ago? Why is this a good reference instead of say, fresh eggs that are 21 days old (same age as the desiccated eggs)? Response: Thank you for this comment, and this helps us to now clarify this point. Throughout the study, “fresh eggs” refer to eggs that were 48 hours old, maintained in moist conditions and not subjected to desiccation. Placing the eggs under moist conditions for 48 hours after egg laying was critical to allow embryonic development (Clements, 1992, ISBN: 9780412401800; Mundim-Pombo et al., 2021, PMID: 34645492). By “desiccated eggs”, we mean fresh eggs (48 hours old) which are subsequently dried for a total period of 21 days by placing the eggs on Whatman filter paper. Therefore, the comparisons made in Figures 2 and 3 are between fresh eggs and desiccated eggs (21 days). Fresh eggs cannot be left for 21 days in moisture as they would hatch into larvae approximately between 48-72 hours after being laid (Clements, 1992; Mundim-Pombo et al., 2021, Rezende et al., 2008, PMID: 18789161). Therefore, the only possible comparison is of fresh eggs at a stage where it would have acquired desiccation tolerance, with the fully desiccated 21-day old egg. We have added new content in the methods section (L426-431) on how eggs were collected for various experiments including the ones described in Figure 2 and also included a figure (Figure S1D, L966-970) to demonstrate the same.

      • L90-L91: "...dried for up to 21 days" But the methods section states that the eggs were dried for 10 days on Whatman filter paper. The 21 days refers to the fact that the authors looked at eggs that were stored for 21 days after the 10 days of desiccation, no? Isn't that why the x-axis goes up to 21 days in Fig. 1C? Please clarify. Response: As mentioned in the previous comment response, “21 days” refers to 48 hours of embryonic development (which was achieved by leaving the eggs in moist conditions for 48 hours), followed by 21 days of desiccation on Whatman paper. These dried eggs were then rehydrated to check the percentage hatching (Figure 1C). “21 days” does not mean 10 days of desiccation and 21 days of storage. We have accordingly modified the results section (L98-102), the figure (Figure 1A), its caption (L802-809) and the methods section (L401-415) to clarify and emphasize this point.

        • 1C: related to above. What does "0-day post desiccation" mean in the x-axis? Is these 10 days of desiccation on Whatman paper + 0 days of storage? Similarly, what is 12 days or 21 days post desiccation on the x-axis? These are 10 + 12 days and 10 +21 days respectively? Response: “0 days post desiccation” refers to fresh eggs that are 48 hours old post egg laying and not subject to desiccation. This has been the control throughout our study. As mentioned above, it does not mean 10 days of desiccation and 0 days of storage. We have rephrased the the results section (L98-102), the methods section (L401-415) and modified the illustration (Figure 1A) and its caption (L802-809)* appropriately to describe how the desiccation assay was performed.
      • Methods section on desiccation is very unclear (related to above). I cannot determine what the days in Fig. 1C means based on this methods section and the main text (and caption for fig. 1C). Response: We acknowledge the original methods had very brief statements, and so we have substantially revised the text (L98-102), the methods section (L401-415) and improved the schematic (Figure 1A) and its caption (L802-809) to provide clarity on the experimental methods and on how the desiccation assays were designed. We have also included a separate section (L426-431) and an illustration (Figure S1D, L966-970) to demonstrate how samples were collected for various experiments.

        • 2A: What are "D1" and "D2"? These are two trials of desiccation? For each lane (e.g., D1), did you combine 150 eggs and lysed them together for the single lane in the gel? Specify these points in the caption. Response: Yes, D1 and D2 refer to two independently conducted trials from desiccated eggs. 150 eggs were used in each trial, where these eggs were combined and lysed together for protein extraction in order to ensure sufficient material for both the qualitative visualization on SDS-PAGE gel and proteomic analysis. We have incorporated your suggestions in the revised methods section (L443-447) figure legends (L841-845, 857-860)*.
      • Related to above: Does the "21 day" correspond to 21 days **post** desiccation (i.e., "21" in the x-axis of Fig. 1C)? Or something else? Please specify in the figure caption. Response: Yes, 21 days in figure 1C corresponds to 21 days post-desiccation. We have clarified the definitions of fresh and desiccated eggs in response to comments 2, 3 and 4 above. To facilitate the understanding of how the desiccation assays were performed as well as the interpretations of Figure 1C, we have added text to the methods section (L401-415) and added explanations in the respective legends (Figure 1A, L802-809).

      • L145-146: What is the emPAI score? Give a one-sentence explanation. * Response: The emPAI (exponentially modified protein abundance index) is an absolute quantitation method now widely used in proteomics, which allows comparisons of protein data acquired by LC-MS/MS (Ishihama et al., 2005, PMID: 15958392). The PAI is the protein abundance index, and this is proportional to the logarithm of absolute protein concentration, and since detection relies on mass spectrometry, PAI will indicate the ratio of observed to observable (due to inherent peptide/ionization and detection properties) peptides. The emPAI values of proteins from one sample can now be compared with those in another sample, especially those obtained in contiguous MS runs using the exact same method, to determine increasing or decreasing proteins (as we have done in this study). Thank you for pointing this out and we have added the necessary information to the text (L159-163)*.

      Reviewer #2

      • However, the method used to define the tolerance as anhydrobiosis, which forms the basis of this claim, is flawed. Physiological strategies for tolerating desiccation can be broadly divided into "desiccation avoidance," which involves maintaining the physiological state by preventing water loss, and "desiccation tolerance," which involves responding to water loss by changing the metabolic system. Desiccation tolerance can be further categorized into two types: hypometabolism, which reduces the metabolic rate, and ametabolism, which completely stops metabolism. The former is general desiccation tolerance, while the latter is defined as anhydrobiosis (Keilin, 1959. doi: 10.1098/rspb.1959.0013). To be classified as anhydrobiosis, the authors must demonstrate that metabolism, including respiration, has ceased completely, not merely that water content has been significantly reduced. The authors claim that the weight of Ae. aegypti eggs dropped by about 65% and that they were still able to hatch even after 21 days of desiccation, as evidence of anhydrobiosis. However, this only confirms the tolerance to desiccation exhibited by many insects living in arid regions. Response: We primarily see this study as a short discovery report that will open multiple directions of future inquiry in this space and we greatly appreciate these points. The responses below, therefore, are elaborate and considered, and we hope will clarify these points extensively.

      We agree with the definition of anhydrobiosis as a phenomenon of the ability of some cells and animals to enter into a reversible state of suspended metabolism (ametabolism), and indeed we are admirers of the wonderful explanation of anhydrobiosis as explained by Keilin et al. in 1959. However, we would like to point out that even during such a state, the basal level of metabolism needed for cellular maintenance and repair has to exist (Bosch et al., 2021, PMID: 34347349; da Silva et al., 2019, PMID: 30266630; Garcia, 2011, PMID: 22116292; Pazos-Rojas et al., 2019, PMID: 31323038). The definitions of ‘hypometabolism’ and ‘ametabolism’ were made mostly in the 1950s, when it was primarily possible to only obtain bulk estimates of respiration or glycolysis. Indeed, in every known example of desiccation tolerance or dormancy, there is a decrease in the energetic arms of glycolysis and the TCA cycle (da Silva et al., 2019; Dinakar & Bartels, 2013, PMID: 24348488; Erkut et al., 2013, 2016, PMID: 24324795, PMID: 27090086; Hibshman et al., 2020, PMID: 33192606; Ryabova et al., 2020, PMID: 32723826; Thorat & Nath, 2018, PMID: 30622480; Zhang et al., 2019, PMID: 31019237). Entirely consistent with that, but with much more quantitative approaches that can make more complete inferences, our proteomics and metabolomics data (Figures 2 and 3), show a substantial decrease in glycolysis as well as the ATP and NADH producing arms of the TCA cycle (post α–ketoglutarate) clearly indicating a reduction in the key metabolic pathways involved in energy production (L245-255, Figure 3A).

      However, what we are now able to observe, is that there is a rewiring of the central carbon metabolism to support the production of protective molecules such as polyamines (in this case). This would be from a rerouting of flux, away from energy metabolism, but when that happens, it is essential that this ‘carbon and nitrogen’ is put somewhere. Energy-producing pathways during desiccation now are only active at very low efficiencies. The desiccated Aedes aegypti eggs are therefore indeed hypometabolic, and this conclusion is not made merely based on the fact that the total water content and weight of desiccated eggs has been reduced. Note that it is practically almost impossible to measure active respiration in desiccated Aedes eggs, since these measurements require a water-environment (and the entire purpose is lost if we add back water to the desiccated eggs). We will also point out that more recent studies by Erkut et al., 2013 in nematodes, which primarily relied on some proteomic measurements, as well as limited metabolite measurements, already hint that such phenomena occur in bona fide anhydrobiotes such as the pre-conditioned dauer larvae of C. elegans. By using approaches similar to those in our studies, we anticipate that there is a tremendous amount of new learning to be obtained in this area, and we will be able to better revise the definitions of desiccation tolerance or anhydrobiosis.

      A ~65% loss in mass, while also considering the mass of the egg shell (and therefore the actual loss of mass in the embryo will be an even higher percentage) is substantial. While we have revised the text thoroughly to avoid the description of these embryos as ‘true anhydrobiotes’, we have rephrased this as desiccation tolerant, and hope readers will appropriately consider these aspects.

      Finally, regarding the point of “However, this only confirms the tolerance to desiccation exhibited by many insects living in arid regions.”, we agree, and point out that little or nothing is known about the pathways or means by which many of such insects (including insects that are major causes of diseases in human, livestock or agriculture) survive under extremely dry environments and till date remain phenomenological. Our entire molecular understanding of desiccation tolerance comes from a handful of model organisms such as yeasts, nematodes, and some tardigrades. This study demonstrates the systematic analysis of desiccation tolerance and survival under rapidly changing environmental conditions in a non-model insect - the mosquito, which is already known to have globally diversified due to its ability to adapt behaviorally and physiologically to environmental fluctuations (Diniz et al., 2017, PMID: 28651558; Halsch et al., 2021, PMID: 33431560 ; Miller & Loaiza, 2015, PMID: 25569303). Our study is a substantial advance in this regard, providing interesting insights into mechanisms of desiccation tolerance in mosquito eggs, a property which could in turn contribute to global expansion of this insect. We anticipate that this work will lay foundation to several studies to control the spread of Aedes mosquitoes.

      Given the length of this report, we have chosen to avoid an extensive discussion section, and only briefly summarized this point (L65-78, L222-235, L245-255, L281-284).

      • The lack of significant accumulation of trehalose and the absence of accumulation of IDPs suggest that the tolerance in the dried eggs is not anhydrobiosis, which means that the manuscript is actually a study of the desiccation tolerance of Aedes aegypti eggs (not anhydrobiosis, nor is it extreme desiccation tolerance). The manuscript should, therefore, be renamed as "Aedes aegypti eggs use rewired polyamine and lipid metabolism to survive desiccation". Response: We agree with your suggestion of changing the title of the manuscript and hence have renamed it to “Aedes aegypti eggs use rewired polyamine and lipid metabolism to survive desiccation”.

      However, we believe that referring to organisms as anhydrobiotes just because of its ability to exclusively accumulate trehalose or IDPs during the desiccated state would be inappropriate, and hinders advances in this space. Please allow us a systematic explanation of the same, below, in three parts: on anhydrobiosis, on trehalose synthesis, and on IDPs.

      Anhydrobiosis or desiccation tolerance involves drastic physiological changes during the induction of anhydrobiosis, survival during the desiccated state and exiting this state upon rehydration (Bosch et al., 2021; Crowe, 2014, PMID: 24548118; Dinakar & Bartels, 2013; Pazos-Rojas et al., 2019; Rajeev et al., 2013, PMID: 23739051; Ryabova et al., 2020). Multiple processes enable the cell to deal with physical challenges – to protect proteins and membranes, and to maintain cellular integrity (L49-59, L225-232) . Different molecular processes can be used to attain this. The role of trehalose has been best characterized, at a molecular level primarily in yeasts and in nematodes (Erkut et al., 2016). Trehalose functions to protect the integrity of the membrane by forming glass-like structures as well as functions as a protein chaperone (Crowe et al., 1998, PMID: 9558455; Erkut et al., 2011, PMID: 21782434; Tapia & Koshland, 2014, PMID: 25456447). In order for organisms to utilize trehalose, they must first accumulate it substantially, and this can only be done by shifting to very high rates of gluconeogenesis (Calahan et al., 2011, PMID: 21840858; Erkut et al., 2011, 2016; Tapia & Koshland, 2014). Two principles emerge from our own (Gupta et al., 2019, PMID: 31259691; Varahan et al., 2019, 2020, PMID: 31241462, PMID: 32876564; Varahan & Laxman, 2021, PMID: 34849891; Vengayil et al., 2019, PMID: 31604822), and other studies that have tried to a build systems-level understanding of various ways by which flux towards trehalose can be increased. First, cells need to have carbon reserves that can reroute towards trehalose biosynthesis, either if glycolytic flux is reduced and/or if gluconeogenic flux is increased. Second, the presumption of ‘ametabolic states’ is incorrect, since there is a primary reduction of glycolysis and respiration, with a concurrent rerouting of flux towards trehalose accumulation. While this flux re-routing is possible (through various means), as has been observed in several desiccation tolerant organisms like yeasts and nematodes, all of these organisms were present in media/growth conditions where various carbon sources are abundant. Note that a key point of this study is to highlight that mosquito eggs are different in their natural environment – eggs are essentially a ‘closed system’, with limited inputs of nutrients, and when in fresh water (where eggs are typically laid), these are very poor carbon sources (L79-85). Hence, rerouting of flux towards trehalose in such cases will be practically impossible.

      Note that in this context, as a strategy to overcome desiccation stress, other organisms like tardigrades rarely accumulate trehalose but instead rely on intrinsically disordered proteins to survive desiccation (Boothby et al., 2017, PMID: 28306513; Hesgrove & Boothby, 2020, PMID: 33148259). Tardigrades, unlike nematodes or yeast are present typically in carbon-poor, water environments. Therefore, when viewed in the context we have explained above, unless they have suitable carbon stores, tardigrades will also be unable to ramp up trehalose production easily during the desiccation process. Therefore, it makes entirely more sense that tardigrades do not rely on trehalose, but instead utilize IDPs in desiccation tolerance. Before this study, there was no clear or established role for IDPs. Note that the function of the IDPs is also to protect proteins from denaturation, much like what was later found for trehalose (Crowe et al., 1998; Tapia & Koshland, 2014).

      An alternate way to achieve similar physical ends would be to utilize polyamines. Studies suggest a critical role for polyamines in desiccation tolerance in nematodes, separate from trehalose (Erkut et al., 2013). The ability of polyamines at higher concentrations to protect DNA/RNA, or phase transition into glass-like forms (much like trehalose and IDPs) is extremely well established (Miller-Fleming et al., 2015, PMID: 26156863; Saminathan et al., 2002, PMID: 12202757). Therefore, our findings establishing a protective role for polyamines would be entirely consistent with interpretations made under these contexts (Figure 3A, 3B, L281-293).

      Finally, we clarify the idea of desiccation tolerance in Aedes eggs. We establish the following – after desiccation, the eggs have substantially low glucose/glycolytic metabolism, and TCA cycle metabolites. This is seen both at the proteome and metabolite levels (Figure 2 and 3). In addition, we demonstrate substantially lower amounts of lipids, both in the desiccated state and after rehydration (Figure 2D and 2E). Our study points towards a novel aspect of how metabolic rewiring not only supports protection during the desiccated state, but also ensures reactivation of metabolism upon return of favourable conditions. In the Aedes eggs, desiccation tolerance which involves survival and sustenance of the pharate larvae inside the dried egg as well as the exit from this dried state upon exposure to water, can logically be achieved only by repurposing internal acetyl-CoA reserves, which come from increased fatty acid breakdown to synthesize polyamines (Figure 4E). The polyamines also confer protection from the consequences of desiccation together with other enzymatic antioxidants and molecular chaperones (Figure 2C). Fatty acids are utilized by the pharate larvae for its energetic needs during the dormant state as well as to fuel recovery upon rehydration.

      Conclusively, we find that desiccation tolerance can be achieved not just by accumulating trehalose or IDPs, but also because of additional relevant mechanisms that are biochemically possible. Thereby, this study adds up to our current knowledge and understanding of possible ways by which cells can achieve the same end of desiccation tolerance, and survival upon rehydration.

      • This manuscript provides interesting insights from the perspective of a metabolomic analysis for clarifying the mechanism of the "general" desiccation tolerance, not anhydrobiosis, in dried Ae. aegypti eggs. For instance, the accumulation of polyamines might contribute to desiccation tolerance. The authors suggest a relationship between the accumulation of polyamines and hatchability based on the fact that the inhibition of metabolic pathways resulted in a decrease in hatchability and polyamines. However, conclusive evidence of a causal relationship is not available. It is possible that the inhibitors disrupted metabolic pathways other than the polyamine synthesis, leading to a significant decrease in hatchability. Response: We understand the reviewer’s point made here; however, we would like to elaborate a clarification on this point. In order to test the role of polyamines in desiccation tolerance in Aedes eggs, we inhibited the polyamine biosynthetic pathway using difluoromethylornithine (DFMO). While there may be some non-target effects of a drug, as is true for every inhibitor, our choices of inhibitors were very deliberate and carefully considered. DFMO is extensively used as an anticancer drug to specifically target ornithine decarboxylase, the first (and rate-controlling) step of polyamine biosynthesis (LoGiudice et al., 2018, PMID: 29419804). Importantly, we made our inferences based on two sets of experiments with DFMO. First, we confirmed that DFMO reduces polyamine accumulation in desiccated eggs (Figure S4B). Next, we observed significant reductions in the hatching of desiccated eggs that were obtained from mosquitoes fed with the inhibitor (Figure 4A). This is consistent with a conclusion that the accumulation of polyamines is essential for desiccation tolerance. As critical controls, we included the hatching of fresh eggs obtained from mosquitoes fed with the inhibitor (in a concurrently conducted experiment, with the same sets of mosquitoes). These eggs showed a high percentage of hatching, which was very similar to the untreated controls (Figure 4A, L309-313). This minimizes the possibility that DFMO could inhibit other metabolic pathways that led to reduced hatching. While acknowledging the limitations of pharmacology, our data collectively (Figure 4A, S4B) are consistent with the likelihood that eggs where polyamine biosynthesis is inhibited, are sensitive to desiccation. Since it is not easily feasible to knock-out ODC in mosquitoes, which are still non-model organisms, it is practically implausible to do experiments that are more conclusive. In fact, such experiments as shown in this study have never been performed in mosquitoes (or other similar insects) before, and we therefore believe both the findings, and the approach (of feeding adult female mosquitoes with inhibitors before egg laying) to be substantial advances. We entirely anticipate that these approaches will stimulate future studies in the many new directions this study opens up.

      • The quantitative values of polyamines were shown only as relative values based on the values in fresh eggs of the control group. Absolute quantification of polyamines, particularly ornithine, putrescine, and spermidine, should be essential for this manuscript. * Response: We thank the reviewer for raising an important point here. However, it is almost impossible to do such an experiment, since the concentrations of metabolites are usually calculated on the basis of total cellular volume of the extracted cells, normalized to the number of cells (Bennett et al., 2008, PMID: 18714298). Calculating the volume of a single egg, particularly that of a desiccated egg because of its distorted shape is almost impossible. Hence, the steady state levels of all measured metabolites including polyamines, are represented as relative values calculated using the peak areas which corresponds to the amount of the particular metabolite present in the sample, where we normalize to egg numbers (L878-879)*. We have provided the peak areas of all the measured metabolites in Table S4. Note that relative metabolite comparisons are a near-universally accepted approach to show fold-level increases or decreases and as a reference, we include this extensive methods paper where we and others discuss the different, appropriate ways of metabolite comparisons (Walvekar et al., 2018, PMID: 30345389).

      • The statistical analysis throughout the study raises concerns, as the sole significant difference test employed is the student’s t-test. While this test is suitable for comparing two groups, it cannot be used for making comparisons between three or more groups. For instance, in the experiment depicted in Figure 4, a comparison of fresh and dried eggs in the control and inhibitor treatment combination would entail comparing four groups. To address this, a two-way analysis of variance ought to be conducted, followed by a post-test such as Bonferroni's or Tukey's multiple comparison test. Response: Thank you for allowing us to clarify this. In the case of our studies, it would be inappropriate to use a two-way ANOVA, and correct to use the unpaired t-tests, because we do not make any comparisons between three or more groups, although visually it might have appeared that way in Figure 4. The data in Figures 4A, 4B S4B and S4C consists of 4 samples – control fresh eggs, control desiccated eggs, treated fresh eggs and treated desiccated eggs. However, comparisons are only made between two groups at a time. These would be control fresh eggs versus control desiccated eggs; OR treated fresh eggs versus treated desiccated eggs OR control desiccated eggs versus treated desiccated eggs i.e., the comparisons are only made for the appropriate two sets. For illustrating these comparisons in an easily readable way, the graphs are presented together. A two-way ANOVA can only be used when comparisons are made between more than two groups or to determine the effect of 2 variables on an outcome which is not applicable in our case. Therefore, only an unpaired test (eg. a student t-test) is appropriate, and we make absolutely no point about multiple comparisons. We’ve included a table below, purely as a reference point, where the same comparisons were made using Wilcoxon’s ranked tests, which is a non-parametric test that only infers information in the magnitudes and signs of the differences between paired observations. Note that there is no change in the conclusions, nor is there any issue with significance for the specific samples compared (in the main manuscript figures). In addition to this, we have added additional text in the figure legends (L904-907, L918-921, L1015-1017, L1022-1025) and also modified the graphs in all the figures for a clearer illustration of the comparison sets.

      Figure No.

      Comparisons

      __ Measurement__

      __p value (Wilcoxon's rank-sum test) __

      Significance

      4A

      Control fresh eggs vs Control desiccated eggs

      % hatching

      0.08143

      ns

      Treated fresh eggs vs Treated desiccated eggs

      0.02857

      *

      Control desiccated eggs vs Treated desiccated eggs

      0.02857

      *

      4B

      Control fresh eggs vs Control desiccated eggs

      % hatching

      0.05714

      ns

      Treated fresh eggs vs Treated desiccated eggs

      0.02857

      *

      Control desiccated eggs vs Treated desiccated eggs

      0.02857

      *

      S4B (i)

      Control fresh eggs vs Control desiccated eggs

      Relative ornithine levels

      0.02107

      *

      Treated fresh eggs vs Treated desiccated eggs

      0.05907

      ns

      Control desiccated eggs vs Treated desiccated eggs

      0.0294

      *

      S4B (ii)

      Control fresh eggs vs Control desiccated eggs

      Relative putriscene levels

      0.02107

      *

      Treated fresh eggs vs Treated desiccated eggs

      0.8857

      ns

      Control desiccated eggs vs Treated desiccated eggs

      0.02857

      *

      S4B (iii)

      Control fresh eggs vs Control desiccated eggs

      Relative spermidine levels

      0.02107

      *

      Treated fresh eggs vs Treated desiccated eggs

      0.05907

      ns

      Control desiccated eggs vs Treated desiccated eggs

      0.0294

      *

      S4C

      Control fresh eggs vs Control desiccated eggs

      Relative lipid levels

      0.02107

      *

      Treated fresh eggs vs Treated desiccated eggs

      1

      ns

      Control desiccated eggs vs Treated desiccated eggs

      0.02857

      *

      *p<0.05, **p<0.01, ***p<0.001, ns - no significant difference.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This manuscript explores the mechanisms underlying extreme desiccation tolerance, known as anhydrobiosis, in Aedes aegypti eggs. The authors suggested that specific metabolites are involved in achieving this tolerance and provide a comparative metabolomic analysis between dried and fresh eggs to support their claim. In contrast to other anhydrobiotic animals, such as Polypedilum vanderplanki larvae and Artemia cysts, the dried eggs of Aedes aegypti do not accumulate large amounts of compatible solutes like trehalose or intrinsically disordered proteins (IDPs) such as LEA protein. Therefore, the authors want to contend that anhydrobiosis in Ae. aegypti eggs is achieved through a different mechanism.

      Significance

      However, the method used to define the tolerance as anhydrobiosis, which forms the basis of this claim, is flawed. Physiological strategies for tolerating desiccation can be broadly divided into "desiccation avoidance," which involves maintaining the physiological state by preventing water loss, and "desiccation tolerance," which involves responding to water loss by changing the metabolic system. Desiccation tolerance can be further categorized into two types: hypometabolism, which reduces the metabolic rate, and ametabolism, which completely stops metabolism. The former is general desiccation tolerance, while the latter is defined as anhydrobiosis (Keilin, 1959. doi: 10.1098/rspb.1959.0013). To be classified as anhydrobiosis, the authors must demonstrate that metabolism, including respiration, has ceased completely, not merely that water content has been significantly reduced. The authors claim that the weight of Ae. aegypti eggs dropped by about 65% and that they were still able to hatch even after 21 days of desiccation, as evidence of anhydrobiosis. However, this only confirms the tolerance to desiccation exhibited by many insects living in arid regions. The lack of significant accumulation of trehalose and the absence of accumulation of IDPs suggest that the tolerance in the dried eggs is not anhydrobiosis, which means that the manuscript is actually a study of the desiccation tolerance of Aedes aegypti eggs (not anhydrobiosis, nor is it extreme desiccation tolerance). The manuscript should, therefore, be renamed as "Aedes aegypti eggs use rewired polyamine and lipid metabolism to survive desiccation". This manuscript provides interesting insights from the perspective of a metabolomic analysis for clarifying the mechanism of the "general" desiccation tolerance, not anhydrobiosis, in dried Ae. aegypti eggs. For instance, the accumulation of polyamines might contribute to desiccation tolerance. The authors suggest a relationship between the accumulation of polyamines and hatchability based on the fact that the inhibition of metabolic pathways resulted in a decrease in hatchability and polyamines. However, conclusive evidence of a causal relationship is not available. It is possible that the inhibitors disrupted metabolic pathways other than the polyamine synthesis, leading to a significant decrease in hatchability. The quantitative values of polyamines were shown only as relative values based on the values in fresh eggs of the control group. Absolute quantification of polyamines, particularly ornithine, putrescine, and spermidine, should be essential for this manuscript. The statistical analysis throughout the study raises concerns, as the sole significant difference test employed is the Student's t-test. While this test is suitable for comparing two groups, it cannot be used for making comparisons between three or more groups. For instance, in the experiment depicted in Figure 4, a comparison of fresh and dried eggs in the control and inhibitor treatment combination would entail comparing four groups. To address this, a two-way analysis of variance ought to be conducted, followed by a post-test such as Bonferroni's or Tukey's multiple comparison test.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This manuscript valuably contributes to understanding how mosquito eggs survive desiccation: the authors establish that, during desiccation, the Ae. aegypti egg's TCA cycle and other metabolic pathways change in order to accumulate polyamines - these provide physical protection during desiccation - and breakdown of lipids which is required for both accumulating polyamines and fuel the recovery process once rehydration occurs (thereby helping the egg hatch after rehydration). The authors also establish that desiccation kills the eggs of another mosquito specie, An. stephensi, in which the above processes don't occur to provide protection during desiccation.

      Much of the study uses mass spectrometry of desiccated eggs of Ae. aegypti to determine proteomic changes that occur during desiccation. Interestingly, these included increased superoxide dismutase, glutathione transferase, and theioredoxin peroxidase - all of these regulate the homeostasis of redox processes in cells. These are particularly interesting because, as the authors noted, other studies in different organisms had shown that Reactive Oxygen Species (ROS) are created during desiccation. These results thus suggest that the results of this study would be of interest to those studying desiccation of dauer C. elegans and yeast. Interestingly, recent studies have shown that ROS and glutathione (and other ROS-reducing enzymes) are the key determinants of whether yeast survives or not at extremely high and low temperatures. Some differences were observed though. For example, unlike in desiccated yeast and C. elegans, Intrinsically Disordered Proteins (IDPs) weren't upregulated during desiccation of the mosquito eggs.

      For the most part, the experiments and analyses are rigorous and technically sound. The presentation and writing are clear, for the most part. But there are some aspects of the analyses and presentation that might benefit from clarifications. I specify these below.

      I support the publication of this work with very minor revisions. The only additional experiment that I can recommend is in point #1 below (doing gel and mass spec on at least one intermediate day during desiccation instead of just at the final day (day 21) which is what has been done). But since mass spectrometry is expensive and time-consuming, this experiment is only suggested but not absolutely necessary. The authors' major conclusions are still valid without this additional experiment. It's just that we don't know how fast the proteomic changes are occurring during desiccation without some timcourse as the one that I suggest here. Perhaps this point can be mentioned as a deficiency of the current work in the discussion, in lieu of doing the additional experiment.

      Major points:

      1. I was hoping to see the gel run for various days of desiccation to support the conclusion that the proteome remodeling occurs during the desiccation. Right now, the data in FIg. 2 come from a single day - 21 days post desiccation - so it still shows that proteomic remodeling happened during those 21 days but not exactly on which days.
      2. In Fig. 2B: unclear what you're using as a reference to say that "45 proteins increased and 125 porteins decreased in amounts" (L147-148). Relative to fresh eggs that were laid 48 hours ago? Why is this a good reference instead of, say, fresh eggs that are 21 days old (same age as the desiccated eggs)?
      3. L90-L91: "...dried for up to 21 days" But the methods section states that the eggs were dried for 10 days on Whatman filter paper. The 21 days refers to the fact that the authors looked at eggs that were stored for 21 days after the 10 days of desiccation, no? Isn't that why the x-axis goes up to 21 days in Fig. 1C? Please clarify.
      4. Fig. 1C: related to above. What does "0 day post desiccation" mean in the x-axis? Is this 10 days of desiccation on Whatman paper + 0 day of storage? Similarly, what is 12 days or 21 days post desiccation on the x-axis? These are 10 + 12 days and 10 +21 days respectively?
      5. Methods section on desiccation is very unclear (related to above). I cannot determine what the days in Fig. 1C mean based on this methods section and the main text (and caption for fig. 1c).
      6. Fig. 2A: what are "D1" and "D2"? These are two trials of desiccation? For each lane (e.g. D1), did you combine 150 eggs and lysed them together for the single lane in the gel? Specify these points in the caption.
      7. Related to above: Does the "21 day" correspond to 21 days post desiccation (i.e., "21" in the x-axis of Fig. 1C)? Or something else? Please specify in the figure caption.
      8. L145-146: What is emPAI score? Give a one-sentence explanation.

      Significance

      I support the publication of this work with very minor revisions. The only additional experiment that I can recommend is in point #1(doing gel and mass spec on at least one intermediate day during desiccation instead of just at the final day (day 21) which is what has been done). But since mass spectrometry is expensive and time-consuming, this experiment is only suggested but not absolutely necessary. The authors' major conclusions are still valid without this additional experiment. It's just that we don't know how fast the proteomic changes are occurring during desiccation without some timcourse as the one that I suggest here. Perhaps this point can be mentioned as a deficiency of the current work in the discussion, in lieu of doing the additional experiment.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01771

      Corresponding author(s): Franck Pichaud and Rhian Walther

      1. General Statements [optional]

      We are grateful for the reviewers’ comments and suggestions. Both reviewers agree that our work addresses a poorly understood questions in biology and medicine, and that it will be of interest to the community of cell and developmental biologists.

      We note that most of the comments/suggestions, especially from Rev#2, are concerned with the text. These include suggested references to be added, a need to expand on the Method description and suggested points of discussion. We have addressed all these issues in the revised manuscript.

      Our work aims to understand which pathways control the basal geometry of epithelial cells, and how cells coordinate remodeling of their basal geometry to organize a tissue in 3D, from apical (top) to basal (bottom). This is a relatively understudied area, especially when compared to the breadth of work related to the pathways that control the apical geometry of epithelial cells.

      The apical geometry of an epithelial cell is a direct function of the number of adherens junctions the cell shares with their neighbors. Suppression or extension of adherens junctions underpins apical geometry remodeling. Basally, this same cell will be attached to the basement membrane though integrin receptors. We use the fly retina, where cells adopt stereotyped basal geometry, to investigate whether and how integrin adhesion might induce cell basal geometry remodeling in morphogenesis.

      The novel finding we report that a temporal sequence of event seems to underpin cell basal geometry remodeling in the retina, whereby i) laminin accumulates at specific location within the basement membrane, which is ii) accompanied by a concomitant accumulation of Dystroglycan (DG), and subsequently iii) integrin receptors are recruited to these sites of high Laminin-DG. This, along with our genetic experiments, suggests that a Laminin-DG-Integrin axis controls the basal geometry of retinal cells. In this axis, we envisage patterning of the basement membrane through Laminin-DG directs integrin recruitment, which in turn induces cell basal geometry remodeling. To our knowledge, this pathway in epithelial morphogenesis, spanning from ECM regulation to integrin polarization, has not been reported before. As the function of these components in basal adhesion is conserved across phyla, we anticipate our findings will be broadly relevant for our understanding of epithelial morphogenesis.

      2. Description of the planned revisions

      The main suggestion, common to both our reviewers, is that we should provide further re-assurance that the RNAi strains we use to target basement membrane components and the DG and integrin pathways are specific, and that these strains do not come with off-target effects.

      We will follow this recommendation by i) including referencing when a line that we have used has been validated elsewhere, ii) by using at least two independent RNAi strains to target a gene of interest, iii) by making use of the deGrad-FP system (Caussinus et al., 2013) to target proteins instead of genes, iv) by making use of available mutant strains. This is all relatively straightforward, and I will detail the proposed experiments as part of the following point-by-point rebuttal and revision plan.

      REVIEWER #1

      Commenting on the need to provide further controls related to some of our RNAi experiments

      1)* All the genetics experiments are based on RNAi induced knock-down approach. Although such an approach is easy to justify for genes associated with lethality when mutated, it becomes less relevant for non-lethal ones as Dystroglycan complex components (Dg, Dys, Sgc) for which null and viable mutants are published and available. The phenotype of such mutants should be provided. *

      AND

      *There is no data explaining how these RNAi lines were validated. The fact that it gives the phenotype expected by the authors is obviously not sufficient. This point is essential to exclude off-target effects and to be able to compare the different genotypes (see #2). For instance, the strong effect of sarcoglycan could be questioned. Is it really specific? If yes, is the difference with other Dystroglycan complex members only due to RNAi efficiency or does it have a specific function? *

      AND

      Line 255, "These perturbations led to a failure of bPS/Mys to accumulate at the grommet". Dg mutants are viable (PMID: 18093579); do they show consistent phenotypes?

      __RE: __Our main methodology has been to use available RNAi strains to perturb composition of the basement membrane and to inhibit the expression of components of the DG and Integrin pathways. As pointed out by the reviewer, this approach allows us to assess the function of genes that might be embryonic lethal and allows us to specifically target the basal geometry remodeling step without perturbing earlier steps of retinal morphogenesis. This is important for the basement membrane and integrins, which are required although retinal tissue development. See for example: (Fernandes et al., 2014, Thuveson, 2019 #3787).

      We are aware that mutant alleles are available for dg, dys and sgc allow for recovering adult homozygous (or trans-heterozygous) animals. However, based on our previous experience using mutants for which only very few flies make it to adulthood, we feel it is best not to examine those animals. Compensatory pathways might be at play that could mask a phenotype (Please see our recent work on the viable roughest null allele in cell intercalation (Blackie et al., 2021).

      Therefore, we propose to induce mutant clones for dg, dys and sgc using the Flp/FRT system, using the strongest alleles that are available to us. Of note, in our experience stable proteins might not show a phenotype in small clones, but will develop a phenotype in larger ones, as the protein becomes further diluted upon multiple rounds of cell division. Bearing this in mind, we will generate animals where the whole retina is mutant for these genes. This will be done using the GMR-hid system (Stowers and Schwarz, 1999).

      Specifically, we will target Dg, Dys and Sgc using:

      Dystroglycan:

      • The dg nonsense mutations, leading to expression of truncated proteins: DgO86 (stop codon at the R87 residue) and dgO43 (stop codon at the W462 residue) (Christoforou et al., 2008). While previous studies have suggested that these alleles are homozygous viable (Christoforou et al., 2008; Zhan et al., 2010), we have obtained this strain from the Bloomington Stock Centre, and note that no homozygous flies make it to adult. In preliminary work, we also note that clones mutant for the dgO86 allele generated with the flp-FRT system are very small, comprised of only one or two cells. This suggests that DG is required for cell proliferation or viability. These dg alleles are available on the G13 FRT which is not compatible with any FRT system designed to eliminate the wild type cells. To use the GMR-hid system, we will have to first recombine these dg alleles onto the appropriate FRT chromosome. Dystrophin:

      • The dys3397 allele, which is semi-lethal P-element insertion in the dys Very few adult flies homozygous for this allele flies are recovered (Christoforou et al., 2008). We will have to recombine this allele onto an FRT chromosome to generate whole mutant retinas.

      • The deficiency Df(3R)Exel6184, which removes the dys coding frame (Christoforou et al., 2008).
      • We will also use dysE17, because it has been used before (Catalani et al., 2021; Cerqueira Campos et al., 2020; Mirouse et al., 2009). This lesion is a Q2807 Stop codon in the C-terminal region common to all 6 dys The Df(3R)Exel6184 and dysE17 alleles have been recombined onto FRT82B, which will allow us to make use of the GMR-hid system to generate whole mutant retinas. Sarcoglycan:

      • Sgc (three subunits in Drosophila) using the deletion allele dscg169 (Allikian et al., 2007). We will have to recombine this mutation onto an FRT chromosome to generate whole mutant retinas. In addition, we will reproduce our RNAi phenotypes using additional available RNAi lines from stock centers and from previous studies, targeting different regions of dg, dys and scg. For dys we will use a validated RNAi line. For dg we will use a second RNAi line previously used in (Cerqueira Campos et al., 2020; Villedieu et al., 2023) For dys, we will use a second line previously used in (Cerqueira Campos et al., 2020). For Sarcoglycans, we will complement our work targeting scgd by also targeting scga.

      Moreover, since a functional endogenously GFP-tagged Dg strain is now available (Villedieu et al., 2023) along with the Dys::GFP strain we have already used, we will target these proteins using the DeGrad-FP system (Caussinus et al., 2013). The main advantage with this system is that, as with RNAi, we can target a specific time window without affecting earlier steps in retinal morphogenesis. In addition, these experiments will address the possibility that DG and Dys might be stable in cells – inhibiting genes expression in flp-FRT induced clones does not always correlate with inhibiting protein function. We think that the well-established deGrad-GFP will be useful here to address the reviewer’s comment.

      We trust these complementary approaches will more than address the reviewers’ comment by further ascertaining that the RNAi phenotypes we report here for Laminin, and the DG and integrin pathway, are specific.

      Please note that we show in Fig.3 that the basal geometry phenotype we report for the talin RNAi, using an RNAi line reported in several previous studies (Lemke et al., 2019; Perkins et al., 2010; Xie and Auld, 2011; Xie et al., 2014), is comparable the phenotype we observed using the Flp-FRT system to induce mys1 mutant clones. So, we are confident this RNAi line is specific of talin. Nevertheless, we will also show results using second RNAi line targeting *talin. *

      *- Authors claimed that laminin RNAi (or MMPs overexpression) affects cell geometry but why it is not analyzed by PCA? It is not consistent with the other figures. *

      __RE: __To address this comment, we will provide the PCA analysis for the Laminin and MMP phenotypes.

      __REVIEWER #2 __

      • Line 208, "we found that LanB2 RNAi leads to defects in bPS/Mys Integrin localization". Here, because the authors use only single RNAi, there remains the possibility that the observed phenotype was caused by an off-target effect. The authors should exclude this possibility by using another RNAi or mutants. In case of LanB2, however, showing that one RNAi against LanB1 shows the same phenotype would be enough, because LanB1 is another single subunit of fly Laminin __RE: __We have now included loss-of-function mutant clones for LanB1, using the LanB1KG003456 allele, showing defects in integrin localization resembling the LanB2 RNAi (please refer to section 3: revision already done, Section). We trust that this is good validation of the LanB2 RNAi strain. These new results have been added to Figure 6 (6E-6F).

      RE:This is the same for all the RNAi experiments”. Please refer to our response to Reviewer 1, above.

      2) *As the authors write "Laminin-rich domains", I suppose that they assume that LanA/B1 accumulates in a restricted region of the BM. However, it has been reported that the majority of Laminin in the fly embryo is soluble and floating in the haemolymph (fly's 'blood' or body fluid) (PMID: 29129537). Therefore, the LanA/B1 observed in the figures might be just floating in the intercellular space and doing nothing on the BM. The authors should exclude this possibility to support their idea that Laminin localised in a specific region of the BM recruits Integrin. For example, does secreted GFP (PMID: 12062063) not behave in the same way as LanA/B1? Can the authors show that the LanA/B1 is indeed incorporated in the BM by FRAP or any methods? *

      RE: While formally possible, our data suggest that it is unlikely that “LanA/B1 is just floating in the intercellular space and doing nothing on the BM”. For instance, our results show that the DG pathway component Scgd is required for accumulation of LanA::GFP (Fig.7E-F). The most likely explanation for this requirement is DG binding to Laminin fibers.

      Nevertheless, we will follow up on the reviewer’s comment and perform FRAP on LanA::GFP, as this is relatively straightforward. We will also try the GFP secretion experiment using the suggested GFPsecr transgene generated by the Vincent lab in 2000.

      3) Line 240. "RNAi against dSarcoglycan led to a decrease in LanA::GFP expression at the presumptive grommet at 20h APF (Figure 7F)". As to this result, the authors seem to interpret that Laminin is not recruited to the "specific BM domain" in grommet in the absence of Dg signalling. However, other possibilities exist, e.g., that the global expression level of Laminin was reduced, or that the intercellular space into which soluble Laminin (see the issue 4 above) flows was narrowed down. The authors should show the data that exclude (or at least reduce) these possibilities.

      __RE: __Addressing Rev2 point (1) will rule out that Laminin is in soluble form. To address the comment that the global expression level of Laminin might be decreased, we will quantify the amount of LanA::GFP that is not at the grommet and compare wild type animals with the scgd ones.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      __REVIEWER #1 __

      • Line 208, "we found that LanB2 RNAi leads to defects in bPS/Mys Integrin localization". Here, because the authors use only single RNAi, there remains the possibility that the observed phenotype was caused by an off-target effect. The authors should exclude this possibility by using another RNAi or mutants. In case of LanB2, however, showing that one RNAi against LanB1 shows the same phenotype would be enough, because LanB1 is another single subunit of fly Laminin __RE: __We have included new results – LanB2 loss of function – showing the role of Laminin in being required for Integrin localization in the secondary and tertiary pigment cells (revised Figure 6 – panels E-F)

      Line 237: For this, we used both RNAi against LanB2 and a loss-of-function allele of LanB1. Consistent with our model, we found that in both cases bPS/Mys Integrin localization was affected. bPS/Mys failed to accumulate at the grommet, and instead was distributed at the basal plasma membrane into punctate domains (Figure 6A-F). In addition, these perturbation experiments affected cell basal geometry remodeling (Figure 6A, 6C, 6E).

      2)* Methods section describing genetic conditions is really sketchy. The genotype corresponding to each figure is not provided and I guess that GMR-Gal4 has been used in all experiments using the Gal4 system but it is never clearly stated. *

      __RE: __We have revisited the Methods section and Figure Legends to ensure all appropriate information is readily accessible to the reader. The reviewer is correct that the retinal GMR-Gal4 driver was used to express the RNAi used in this study.

      3) PCA analysis. - In the WT situation it would be really informative to know which variable(s) is/are really discriminant between the two cell populations and then maybe to focus a bit more on these parameters. For instance, a PCA correlation circle plotting both cells and variables would be very helpful.

      __RE: __We have followed the reviewer’s advice and amended the Methods section accordingly. We now provide the PCA correlation circle plotting both cells and variables in Suppl. Fig. 3, for talin RNAi and MysDN, and Suppl. Fig. 10 for DG and Scgd RNAi

      *Methods: *

      Line 522 : Principle component analysis

      Principal component analysis (PCA) was carried out using the Scikit-learn library in Python. The Standard scaler package was used to standardize the data across all metrics before calculating the principal components. The PCA package was then used to perform the PCA. Metrics included in the PCA were as follows: extent, major axis length, minor axis length, eccentricity, roundness, circularity, area, cell shape index, perimeter.

      The cell types (secondary and tertiary pigment cells) were assigned by following the cells in 3D to the apical surface where the cell types could be identified. Cells that could not be clearly assigned as either secondary or tertiary pigment cells were excluded from the PCA.

      Extent is the area of an object divided by the area or the smallest rectangle (bounding box) that can fit around the object.

      Major axis length is the longest line that can be drawn through an object.

      Minor axis length is the line that can be drawn through an object which is perpendicular to the major axis.

      __Eccentricity __is the ratio of the length of the short (minor) axis to the length of the long

      (major) axis.

      Roundness is a comparison of an object to the best fit circle of an object. The closer the object is to a perfect circle, the more round it will be.

      Circularity is a measure of the smoothness of an object.

      Cell shape index is a dimensionless parameter to describe cell shape. When cells have smaller contacts with their neighbours the cell shape index is small.

      Correlation circle plots were generated using the mlxtend plotting package in python using the plot PCA correlation graph function.

      • Please also see the graphs we now provide in Suppl. Fig.4*. *

      We are also commenting on these results.

      Line 174: To understand which parameters explained most of the variance in the PCA analysis we generated correlation circle plots (Supplementary Figure 4). For wildtype cells, perimeter and circularity contribute most to the variance between secondary and tertiary pigment cells along the PC1 axis. Eccentricity and minor axis length contribute most to variance along the PC2 axis (Supplementary Figure 4A). For talin RNAi and MysDN cells, the correlation circle plots are remarkably similar (Supplementary Figure 4B-C), indicating that these genetic perturbations have similar effects on cell basal geometry. To confirm this result, we performed PCA comparing secondary and tertiary pigment cells for these two genotypes. In both genotypes, cells fail to form discrete clusters (Supplementary Figure 4D-E). For the secondary pigment cells, expressing talin RNAi or MysDN leads to an increase in cell roundness. For the tertiary pigment cell, these genotypes lead to an increase in circularity (Supplementary Figure 4D-E). Examining the original segmentation data confirmed that, relative to wildtype cells, either genetic perturbation has a similar effect on key cell shape parameters (Supplementary Figure 4F-G).

      *- In loss of function conditions, when the tissue is strongly affected, how do the authors recognize the two cell populations if PCA cannot? *

      __RE: __In these genotypes, each cell type is identified based on their apical position and geometry. When a cell cannot be identified it is not included in the analysis. This allowed us to track the cells from apical to basal. We now make this clear in the Methods section.

      Line 529: The cell types (secondary and tertiary pigment cells) were assigned by following the cells in 3D to the apical surface where the cell types could be identified. Cells that could not be clearly assigned as either secondary or tertiary pigment cells were excluded from the PCA.

      - On the opposite, based on the provided image, Dys RNAi seems to have a mild effect and it seems that my eyes can easily recognize those two cell populations based on their shape. So why PCA cannot?

      __RE: __We respectfully disagree with this comment. In the Dys RNAi, one cannot tell which is a secondary and which is a tertiary by visual inspection of the basal surface only. This is consistent with the PCA analysis, now described more thoroughly in Supplemental Figure 4. The Dys RNAi cells tend to remain elongated and they do not round up as much as the Scgd RNAi cells, which gives the false impression that the phenotype is closer to that of the wild type.

      - Based on the proposed images, some phenotypes look clearly different depending on the genotype, e.g. Talin and Mys (figure 3) or Dys and Sgc (Figure 8). In other words, the fact that PCA cannot separate the cell pollutions in these different genotypes does not necessarily mean that their effect is identical. Could authors perform PCA analysis between mutants? If they are different, again it might be very interesting to identify the discriminating parameters.

      RE: We did not claim the defect was identical__. __

      The basal geometries look somewhat different depending on the genotype, and we envisage this is due to differences in RNAi strength and perhaps differences in protein stability. This is the case for Dys and Scgd, as outlined in the preceding point. With respect to talin and mys, none of the authors can distinguish by eye the talin RNAi from mys1 phenotypes. We have informally asked our institutional colleagues, and they were also unable to distinguish these genotypes.

      Nevertheless, we have expanded our PCA analysis between phenotypes, considering one cell type at a time. This analysis shows that these phenotypes show partial overlap, outside of the wildtype range. While there are similarities, it does not reveal, however, any specific relationship between genes of interest (see previous).

      Line 178: For talin RNAi and MysDN cells, the correlation circle plots are remarkably similar (Supplementary Figure 4B-C), indicating that these genetic perturbations have similar effects on cell basal geometry. To confirm this result, we performed PCA comparing secondary and tertiary pigment cells for these two genotypes. In both genotypes, cells fail to form discrete clusters (Supplementary Figure 4D-E). For the secondary pigment cells, expressing talin RNAi or MysDN leads to an increase in cell roundness. For the tertiary pigment cell, these genotypes lead to an increase in circularity (Supplementary Figure 4D-E). Examining the original segmentation data confirmed that, relative to wildtype cells, either genetic perturbation has a similar effect on key cell shape parameters (Supplementary Figure 4F-G).

      *- From what I can understand, each PCA analysis has been done on a single retina. If true, more replicates should be included. If not true, the number of independent retinas should be mentioned. *

      __RE: __All PCA analyses have been done using multiple retinas from different animals. We have clarified this in the figure legends.

      4) Minor comments: - Globally, the article suffers from a lack of details, especially in the methods section and/or in figure legends.

      RE: please see what we have done to address this comment, in section (2) above.

      *- Also, several points could be advantageously discussed. For instance, why MMPs have different effects according to their specificity? Also, what could be the meaning of the nice differential pattern between integrin alpha subunits? *

      __RE: __We were concerned this would be seen as too speculative by our reviewers. Following the reviewer’s advice, we are happy to share our current working model and speculations on this.

      Results:

      Line 242: Moreover, and consistent with basement membrane regulation being important for cell basal geometry remodeling, we found that degrading the basement membrane by expressing Matrix Metalloproteases MMP1 or MMP2 in retinal cells leads to a failure in bPS/Mys localization at the grommet and prevented cell basal geometry remodeling (Figure 6G-J). While recombinant Drosophila MMP1 and 2 can degrade Col-IV, only MMP2 can degrade Laminin (Wen et al., 2020). The MMP2 phenotype we observed in basal surface organization is stronger than that of the MMP1 overexpression. Our results, therefore, suggest that both Col-IV and Laminin play a role in controlling the basal geometry of retinal cells. This suggestion is consistent with our finding that both these basement membrane proteins are enriched at the grommet once cells have acquired their basal geometry.

      Discussion:

      Line 386: Integrins can bind to Col-IV and to Laminin (Hynes, 2002). Our experiments show that MMP2 overexpression leads to a stronger phenotype than MMP1. In addition to catalyzing Collagen-IV proteolysis, MMP2 can degrade Laminin, which is something MMP1 does not seem to be able to do (Wen et al., 2020). Therefore, our results suggest that both Col-IV and Laminin are required for cell basal geometry remodeling.

      Line 408*: *

      The cone cells express two Integrin receptors, ____a____PS1/Mew-____b____PS/Mys and ____a____PS2/if-____b____PS/Mys

      We found that while the interommatidial cells express aPS1/Mew-bPS/Mys, the cone cells express both aPS1/Mew-bPS/Mys and aPS2/if-bPS/Mys. Thus, different cell types express different aPS subunits. It is not clear why the cone cells express two a-subunits. In the developing follicular epithelium of the fly oocyte, cells switch from expressing aPS1/Mew-bPS/Mys, to expressing aPS2/if-bPS/Mys (Delon and Brown, 2009). In this tissue, the developmental switch between aPS1 and aPS2 expression was shown to correlate with a change in stress fiber orientation. In addition, aPS1-bPS/Mys was also shown to be required to control F-actin levels basally. aPS1 mutant cells presented elevated levels of F-actin, a phenotype not seen in aPS2 mutant cells. Remarkably, in this tissue, aPS2-bPS/Mys, but not aPS1/Mew-bPS/Mys was able to recruit the integrin adapter Tensin. The authors envisaged that the aPS2 Tensin interaction might confer robustness in basal surface remodeling. With analogy to the follicular epithelium, we speculate that in the cone cells, aPS1-bPS/Mys and aPS2/Mew-bPS/Mys synergize in mediating robust attachment to the basement membrane, to ensure these cells do not detach as the retina lengthens along the apical-basal axis (Longley and Ready, 1995). We also note that in retinal development, the cone cells form new adherens and septate junctions at their basal feet (Banerjee et al., 2008). These cells, therefore, present two sets of adherens and Septate junctions. It is also possible that the atypical situation seen with the cone cells expressing two a subunits, is linked to the formation of these new junctions at the basal pole of these cells. It will be interesting to examine these possibilities, and to establish the role these two a-subunits play in cone cell morphogenesis. Further, the presence of two distinct integrin subunits within the cone cells may have implications when considering Integrin signaling during cone cell morphogenesis.

      *- In Methods, a list of metrics is given for the PCA analysis but some look very similar and it would be helpful to define them briefly. *

      RE: Please refer to what we have done to address this comment in section (2) above.

      *- Figures are not always color-blind adjusted (e.g. dots on PCA graphs). *

      __RE: __We have rectified this oversight.

      __REVIEWER #2 __

      1)* Line 169, "From these experiments, we conclude that Integrin adhesion is required for cell basal geometry remodeling during retinal morphogenesis". It has been long known that integrin is necessary for the gross morphogenesis of the eye (e.g., Zusman et al. 1993, PMID: 8076515). The authors need to cite these preceding researches and should clarify what new findings this new work adds to the previous knowledge. *

      __RE: __Following the reviewer’s suggestion, we have added this reference which precedes (Longley and Ready, 1995)mentioned in the paper. Both references show that integrins are required for eye integrity and attribute this function to the contraction phase of retinal development. Notably, contraction occurs after cells have remodelled their basal geometry, which we have focused on in this study.

      Line 128: The Integrin bPS subunit (Myspheroid, Mys) is required to maintain surface integrity late in retinal development, as the tissue surface undergoes basal contraction (Longley and Ready, 1995; Zusman et al., 1993).

      4) Line 180, "Using available functional GFP protein traps [49, 50]", the authors investigate the behaviour of Laminin subunits LanA and LanB1. First, ref [50] is not relevant here and should be removed. Moreover, the Laminin-GFPs the authors used are not protein traps, but transgenic strains harbouring genes and most of their regulatory information, with the ORFs tagged with GFP [49]. Furthermore, while the ref [49] reported the functionality of LanB1-GFP, this reference did not fully address the functionality of LanA-GFP. The authors need another reference on it (PMID: 29129537), which demonstrated that LanA-GFP rescues LanA mutants.

      5) Related to the issue above, in addition to LanA and LanB1, the authors examine the localisation of the following BM proteins using GFP-fusion: Perlecan/Trol, Collagen IV/Viking, Nidogen, and SPARC. The authors do not explicitly describe the nature of these GFP fusions, but I am afraid that the authors think all of them are "functional protein traps". However, in fact while Perlecan and Collagen IV are protein traps, Nidogen and SPARC are transgenics including regulatory sequences made in the ref [49]. This must be clarified. Moreover, to rely on the data obtained using these GFP fusions, their functionality must be confirmed by appropriate references or/and the authors' own data. For information, ref [62] showed the functionality of Perlecan-GFP and Collagen IV-GFP protein traps (they are both homozygous viable), and the Nidogen-GFP transgene rescues the BM deficiency of Ndg mutants (PMID: 30260959). These reports must be explained in the text, and I would like the authors collect and show more information.

      __RE: __We have deleted ref 50. We thank the reviewer for flagging the issue with our referencing. We have now amended this section.

      Line 204: To this end, we examined the localization and requirement of the Laminin A and B1 subunits (Laminina, LanA and Lamininb, LanB1), Perlecan/Trol, Collagen-IV/Viking (Col-IV), the glycoprotein Nidogen (Entactin/Ndg), and the secreted glycoprotein protein-acidic-cysteine-rich (Sparc), which are all components of the basement membrane (Walma and Yamada, 2020). For Laminin, Ndg and SPARC, we used strains generated from a fosmid library, and expressing a functional GFP-tagged transgene under the control of their own respective promoter (Dai et al., 2018; Matsubayashi et al., 2017; Sarov et al., 2016). For Col-IV and Perlecan, we used functional GFP exon-trap strains (Morin et al., 2001).

      6) Line 200, "These specific patterns of expression for LamininA/B1, Collagen IV, Perlecan, Nidogen and Sparc". I have several comments here: - 5A. These patterns are discussed only using single optical sections. To highlight the difference in their localisation patterns more objectively, multiple sections and/or 3D images should be shown.

      RE: (a) These are all projections of 3 to 5 confocal sections, and we have amended the manuscript to make this point clearer. (b) Following the reviewer’s advice, we now provide sagittal sections so the reader can better appreciate what is detected above and below the grommet. Please see new Fig. 5.

      5B. Can the authors discuss, hypothesise, or speculate the biological meaning of the difference? * AND*

      *5C. It has been reported that in the mammalian skin BM, different components show distinct localisation patterns (PMID: 33972551). It would be interesting to cite this paper and discuss the generality of the non-uniform distribution of BM components. *

      __RE: __The revised manuscript offers a short discussion in this topic.

      Line: 367 The idea that different cell types in a tissue can express different ECM components, and thus induce localized specialization of a basement membrane is well-supported by recent work in the mouse hair follicle. In this sensory organ, the architecture and composition of the basement membrane is highly specialized depending on the cell-cell and cell-tissue interface considered (Cheng et al., 2018; Fujiwara et al., 2011; Joost et al., 2016). Moreover, different cell populations – epithelial stem cells and fibroblasts, express different ECM components in the hair follicle (Tsutsui et al., 2021), supporting the notion that specific basement membrane organization contributes to cell-cell communication and overall 3D tissue architecture.

      7) Line 215, "However, inhibiting the expression of Collagen IV, Ndg, Perlecan and Sparc individually, by expressing RNAi against these genes in all retinal cells, did not lead to defects in bPS/Mys localization". To conclude so, the authors must demonstrate that the used RNAis efficiently removed its target proteins.

      __RE: __We have removed this section referring to Collagen IV, Ndg, Perlecan and Sparc.

      Instead, we now focus solely on Laminin. Because Laminin accumulation at the presumptive grommet precedes that of the other ECM factors examined in our study, we favor a model in which Laminin plays a key role in promoting integrin localization.

      8)* Line 222, "DG is required to organize the ECM in several experimental settings [42, 43, 45, 51]". Here, the authors must mention to a preceding paper that reported the eye deficiency of Dg mutant flies (PMID: 20463973), and discuss what new findings authors can add to the previous report. *

      __RE: __We have followed this recommendation.

      Line 441: We also note that a previous study showed that early in retinal development, DG localizes at the apical membrane of the photoreceptors. This study proposed that DG promotes elongation of these sensory neurons, independently to any potential role this surface receptor might play in basement membrane organization (Zhan et al., 2010). This conclusion was based on Df(2R)Dg248 mutant clones and trans-heterozygous retinas, where DG function was impaired not only in photoreceptors, but in all interommatidial cell types. Moreover, the basement membrane was not examined in this study. Our work, and the fact the bulk of retinal cell elongation occurs late in retinal development(Longley and Ready, 1995), is consistent with DG playing a role in retinal cell elongation and overall tissue thickening.

      Under “Advance”:

      *The 3D imaging of ommatidia development is beautiful and of good descriptive value. ** However, as mentioned in the major comments 1, 2, 3, and 8 above, I am afraid that the search of preceding literature seems insufficient, and it is often unclear what this manuscript add to existing knowledge. *

      __RE: __The logic of how the reviewer links points 2, and 3 they raise as part of their review, to their assessment of how our work advances the field, is unclear to me. Their Points 2 and 3 have to do with making sure we better explain how the functional ECM transgenes were generated and by whom. The importance the reviewer places on points 2, 3 when considering the Advance our work provides to the field does not appear justified to me.

      Point 1 refers to a previous study by Zusman et al., published in 1993. Using partial loss of function alleles and heat-shock inducible rescue constructs they show that bPS/Mys plays a role in eye development. They note that in adult eyes, retinal cells are not attached to their basement membrane. They show this is accompanied by a failure for the retina to elongate along the apical-basal axis. These phenotypes are consistent with a role for integrins in mediating attachment of epithelial cells to the basement membrane, and we are now referring to this work in the revised manuscript. A much more relevant reference to our work however, is (Longley and Ready, 1995), which we have used repeatedly in our manuscript to stress what was novel about our work.

      Point 8 refers to a previous report implicating DG in photoreceptor elongation, which is a developmental phase that mostly occurs after the process we are studying here (please see Fig.3 of (Longley and Ready, 1995) for quantification using sections). The photoreceptors do no contribute basal profiles at the basal surface of the retina. The DysGFP signal we detect at this tissue surface, in the presumptive and established grommet, is clearly coming from the pigment cells, not from the photoreceptor axons which are found at this basal location. We now discuss this previous report, to make what is clearer what is novel about our own work.

      .

      Minor comments: - Line 85, "This is the case in the follicular epithelium for example". Here, the text would be more reader-friendly if the authors could clarify this is the follicular epithelium of the fly ovary.

      __RE: __We have modified the text to address this comment.

      - Line 203-, regarding all the experiments involving the Gal4-UAS system. Not all the readers are familiar with the system. A brief explanation on it should be added in the main text. Moreover, in the Results section, not in the Methods, the authors should show what Gal4 they used, and where is the Gal4 expressed.

      __RE: __We have amended the manuscript accordingly.

      *- Line 239, "We found that inhibiting the expression of the DG cofactor, dSarcoglycan [53] was most effective in inhibiting this pathway in retinal cells". Here, the authors should show the data. *

      __RE: __This statement is based on the results shown in Fig.8 and Suppl. Fig.9, which make use of a PCA representation to quantify the Dg, Dys and dScg RNAi phenotypes in cell basal geometry. We have re-phrased this statement to make it clear that we are referring to the RNAi-based perturbation of these genes’ expression.

      4. Description of analyses that authors prefer not to carry out

      We will address all the reviewer comments as they will consolidate our findings.

      Our further validation of the few RNAi lines used in our study that have not been used before in publications will also be valuable to the community.

      References:

      Allikian, M.J., Bhabha, G., Dospoy, P., Heydemann, A., Ryder, P., Earley, J.U., Wolf, M.J., Rockman, H.A., and McNally, E.M. (2007). Reduced life span with heart and muscle dysfunction in Drosophila sarcoglycan mutants. Hum Mol Genet 16, 2933-2943.

      Banerjee, S., Bainton, R.J., Mayer, N., Beckstead, R., and Bhat, M.A. (2008). Septate junctions are required for ommatidial integrity and blood-eye barrier function in Drosophila. Dev Biol 317, 585-599.

      Blackie, L., Tozluoglu, M., Trylinski, M., Walther, R.F., Schweisguth, F., Mao, Y., and Pichaud, F. (2021). A combination of Notch signaling, preferential adhesion and endocytosis induces a slow mode of cell intercalation in the Drosophila retina. Development 148.

      Catalani, E., Bongiorni, S., Taddei, A.R., Mezzetti, M., Silvestri, F., Coazzoli, M., Zecchini, S., Giovarelli, M., Perrotta, C., De Palma, C., et al. (2021). Defects of full-length dystrophin trigger retinal neuron damage and synapse alterations by disrupting functional autophagy. Cell Mol Life Sci 78, 1615-1636.

      Caussinus, E., Kanca, O., and Affolter, M. (2013). Protein knockouts in living eukaryotes using deGradFP and green fluorescent protein fusion targets. Current protocols in protein science / editorial board, John E Coligan [et al] 73, Unit 30 32.

      Cerqueira Campos, F., Dennis, C., Alegot, H., Fritsch, C., Isabella, A., Pouchin, P., Bardot, O., Horne-Badovinac, S., and Mirouse, V. (2020). Oriented basement membrane fibrils provide a memory for F-actin planar polarization via the Dystrophin-Dystroglycan complex during tissue elongation. Development 147.

      Cheng, C.C., Tsutsui, K., Taguchi, T., Sanzen, N., Nakagawa, A., Kakiguchi, K., Yonemura, S., Tanegashima, C., Keeley, S.D., Kiyonari, H., et al. (2018). Hair follicle epidermal stem cells define a niche for tactile sensation. Elife 7.

      Christoforou, C.P., Greer, C.E., Challoner, B.R., Charizanos, D., and Ray, R.P. (2008). The detached locus encodes Drosophila Dystrophin, which acts with other components of the Dystrophin Associated Protein Complex to influence intercellular signalling in developing wing veins. Dev Biol 313, 519-532.

      Dai, J., Estrada, B., Jacobs, S., Sanchez-Sanchez, B.J., Tang, J., Ma, M., Magadan-Corpas, P., Pastor-Pareja, J.C., and Martin-Bermudo, M.D. (2018). Dissection of Nidogen function in Drosophila reveals tissue-specific mechanisms of basement membrane assembly. PLoS Genet 14, e1007483.

      Delon, I., and Brown, N.H. (2009). The integrin adhesion complex changes its composition and function during morphogenesis of an epithelium. J Cell Sci 122, 4363-4374.

      Fernandes, V.M., McCormack, K., Lewellyn, L., and Verheyen, E.M. (2014). Integrins regulate apical constriction via microtubule stabilization in the Drosophila eye disc epithelium. Cell reports 9, 2043-2055.

      Fujiwara, H., Ferreira, M., Donati, G., Marciano, D.K., Linton, J.M., Sato, Y., Hartner, A., Sekiguchi, K., Reichardt, L.F., and Watt, F.M. (2011). The basement membrane of hair follicle stem cells is a muscle cell niche. Cell 144, 577-589.

      Hynes, R.O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110, 673-687.

      Joost, S., Zeisel, A., Jacob, T., Sun, X., La Manno, G., Lonnerberg, P., Linnarsson, S., and Kasper, M. (2016). Single-Cell Transcriptomics Reveals that Differentiation and Spatial Signatures Shape Epidermal and Hair Follicle Heterogeneity. Cell Syst 3, 221-237 e229.

      Lemke, S.B., Weidemann, T., Cost, A.L., Grashoff, C., and Schnorrer, F. (2019). A small proportion of Talin molecules transmit forces at developing muscle attachments in vivo. PLoS Biol 17, e3000057.

      Longley, R.L., Jr., and Ready, D.F. (1995). Integrins and the development of three-dimensional structure in the Drosophila compound eye. Dev Biol 171, 415-433.

      Matsubayashi, Y., Louani, A., Dragu, A., Sanchez-Sanchez, B.J., Serna-Morales, E., Yolland, L., Gyoergy, A., Vizcay, G., Fleck, R.A., Heddleston, J.M., et al. (2017). A Moving Source of Matrix Components Is Essential for De Novo Basement Membrane Formation. Curr Biol 27, 3526-3534 e3524.

      Mirouse, V., Christoforou, C.P., Fritsch, C., St Johnston, D., and Ray, R.P. (2009). Dystroglycan and perlecan provide a basal cue required for epithelial polarity during energetic stress. Dev Cell 16, 83-92.

      Morin, X., Daneman, R., Zavortink, M., and Chia, W. (2001). A protein trap strategy to detect GFP-tagged proteins expressed from their endogenous loci in Drosophila. Proc Natl Acad Sci U S A 98, 15050-15055.

      Perkins, A.D., Ellis, S.J., Asghari, P., Shamsian, A., Moore, E.D., and Tanentzapf, G. (2010). Integrin-mediated adhesion maintains sarcomeric integrity. Dev Biol 338, 15-27.

      Sarov, M., Barz, C., Jambor, H., Hein, M.Y., Schmied, C., Suchold, D., Stender, B., Janosch, S., K, J.V., Krishnan, R.T., et al. (2016). A genome-wide resource for the analysis of protein localisation in Drosophila. Elife 5, e12068.

      Stowers, R.S., and Schwarz, T.L. (1999). A genetic method for generating Drosophila eyes composed exclusively of mitotic clones of a single genotype. Genetics 152, 1631-1639.

      Tsutsui, K., Machida, H., Nakagawa, A., Ahn, K., Morita, R., Sekiguchi, K., Miner, J.H., and Fujiwara, H. (2021). Mapping the molecular and structural specialization of the skin basement membrane for inter-tissue interactions. Nat Commun 12, 2577.

      Villedieu, A., Alpar, L., Gaugue, I., Joudat, A., Graner, F., Bosveld, F., and Bellaiche, Y. (2023). Homeotic compartment curvature and tension control spatiotemporal folding dynamics. Nat Commun 14, 594.

      Walma, D.A.C., and Yamada, K.M. (2020). The extracellular matrix in development. Development 147.

      Wen, D., Chen, Z., Zhang, Z., and Jia, Q. (2020). The expression, purification, and substrate analysis of matrix metalloproteinases in Drosophila melanogaster. Protein Expr Purif 171, 105629.

      Xie, X., and Auld, V.J. (2011). Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve. Development 138, 3813-3822.

      Xie, X., Gilbert, M., Petley-Ragan, L., and Auld, V.J. (2014). Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system. Development 141, 3072-3083.

      Zhan, Y., Melian, N.Y., Pantoja, M., Haines, N., Ruohola-Baker, H., Bourque, C.W., Rao, Y., and Carbonetto, S. (2010). Dystroglycan and mitochondrial ribosomal protein L34 regulate differentiation in the Drosophila eye. PLoS One 5, e10488.

      Zusman, S., Grinblat, Y., Yee, G., Kafatos, F.C., and Hynes, R.O. (1993). Analyses of PS integrin functions during Drosophila development. Development 118, 737-750.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      Cell shape remodelling is essential for tissue morphogenesis. To model this event, the fruit fly Drosophila melanogaster has been widely used. In the pupal retina, ommatidial cells change their structure to form the photo-sensing machinery in the compound eye. Previous studies investigating this event mainly focused on the cell shape change at the apical plane. However, the cell shape at the basal side and the three-dimensional (3D) structure of the cells have been little studied.

      In this manuscript, the authors address this issue by combining state-of-art 3D imaging and fly genetics. They report that at the initial stage of eye development, a basement membrane (BM) component Laminin accumulates at the basal side of the ommatidial cells in a manner dependent on the BM-receptor molecule dystroglycan (Dg). The authors propose that this Dg-dependent Laminin accumulation induces the polarisation of integrin at the basal surface, which is essential for proper ommatidia morphogenesis.

      Major comments:

      The beautiful images presented here provide interesting descriptions of the events occurring during eye development. Also, the authors propose an attractive and simple hypothesis that the Dg-dependent recruitment of Laminin leads to integrin polarisation and tissue morphogenesis. However, I'm afraid that this hypothesis is not supported enough by the presented data. In addition, the novelty of some conclusions and the reliability of a number of reagents used are unclear. Specific concerns are described below:

      1. Line 169, "From these experiments, we conclude that Integrin adhesion is required for cell basal geometry remodeling during retinal morphogenesis". It has been long known that integrin is necessary for the gross morphogenesis of the eye (e.g., Zusman et al. 1993, PMID: 8076515). The authors need to cite these preceding researches and should clarify what new findings this new work adds to the previous knowledge.
      2. Line 180, "Using available functional GFP protein traps [49, 50]", the authors investigate the behaviour of Laminin subunits LanA and LanB1. First, ref [50] is not relevant here and should be removed. Moreover, the Laminin-GFPs the authors used are not protein traps, but transgenic strains harbouring genes and most of their regulatory information, with the ORFs tagged with GFP [49]. Furthermore, while the ref [49] reported the functionality of LanB1-GFP, this reference did not fully address the functionality of LanA-GFP. The authors need another reference on it (PMID: 29129537), which demonstrated that LanA-GFP rescues LanA mutants.
      3. Related to the issue above, in addition to LanA and LanB1, the authors examine the localisation of the following BM proteins using GFP-fusion: Perlecan/Trol, Collagen IV/Viking, Nidogen, and SPARC. The authors do not explicitly describe the nature of these GFP fusions, but I am afraid that the authors think all of them are "functional protein traps". However, in fact while Perlecan and Collagen IV are protein traps, Nidogen and SPARC are transgenics including regulatory sequences made in the ref [49]. This must be clarified. Moreover, to rely on the data obtained using these GFP fusions, their functionality must be confirmed by appropriate references or/and the authors' own data. For information, ref [62] showed the functionality of Perlecan-GFP and Collagen IV-GFP protein traps (they are both homozygous viable), and the Nidogen-GFP transgene rescues the BM deficiency of Ndg mutants (PMID: 30260959). These reports must be explained in the text, and I would like the authors collect and show more information.
      4. Line 182-, LanA and LanB1 "accumulate at the center of the ommatidium, in a pattern resembling the grommet structure (Figure 4A and Supplementary Figure 4)"... "LamininA/B1 accumulation at the presumptive grommet precedes Integrin accumulation at this location. It suggests that localized Laminin might control Integrin localization in the interommatidial cells". Based on these results, the authors discuss that "generating specific polygonal geometries at the basal surface of cells starts with organizing the ECM to establish a pattern of Laminin-rich domains, distributed across the tissue basal surface" (Line 267).

      As the authors write "Laminin-rich domains", I suppose that they assume that LanA/B1 accumulates in a restricted region of the BM. However, it has been reported that the majority of Laminin in the fly embryo is soluble and floating in the haemolymph (fly's 'blood' or body fluid) (PMID: 29129537). Therefore, the LanA/B1 observed in the figures might be just floating in the intercellular space and doing nothing on the BM. The authors should exclude this possibility to support their idea that Laminin localised in a specific region of the BM recruits Integrin. For example, does secreted GFP (PMID: 12062063) not behave in the same way as LanA/B1? Can the authors show that the LanA/B1 is indeed incorporated in the BM by FRAP or any methods? 5. Line 200, "These specific patterns of expression for LamininA/B1, Collagen IV, Perlecan, Nidogen and Sparc". I have several comments here: 5A. These patterns are discussed only using single optical sections. To highlight the difference in their localisation patterns more objectively, multiple sections and/or 3D images should be shown. 5B. Can the authors discuss, hypothesise, or speculate the biological meaning of the difference? 5C. It has been reported that in the mammalian skin BM, different components show distinct localisation patterns (PMID: 33972551). It would be interesting to cite this paper and discuss the generality of the non-uniform distribution of BM components. 6. Line 208, "we found that LanB2 RNAi leads to defects in bPS/Mys Integrin localization". Here, because the authors use only single RNAi, there remains the possibility that the observed phenotype was caused by an off-target effect. The authors should exclude this possibility by using another RNAi or mutants. This is the same for all the RNAi experiments. In case of LanB2, however, showing that one RNAi against LanB1 shows the same phenotype would be enough, because LanB1 is another single subunit of fly Laminin. 7. Line 215, "However, inhibiting the expression of Collagen IV, Ndg, Perlecan and Sparc individually, by expressing RNAi against these genes in all retinal cells, did not lead to defects in bPS/Mys localization". To conclude so, the authors must demonstrate that the used RNAis efficiently removed its target proteins. 8. Line 222, "DG is required to organize the ECM in several experimental settings [42, 43, 45, 51]". Here, the authors must mention to a preceding paper that reported the eye deficiency of Dg mutant flies (PMID: 20463973), and discuss what new findings authors can add to the previous report. 9. Line 240. "RNAi against dSarcoglycan led to a decrease in LanA::GFP expression at the presumptive grommet at 20h APF (Figure 7F)". As to this result, the authors seem to interpret that Laminin is not recruited to the "specific BM domain" in grommet in the absence of Dg signalling. However, other possibilities exist, e.g., that the global expression level of Laminin was reduced, or that the intercellular space into which soluble Laminin (see the issue 4 above) flows was narrowed down. The authors should show the data that exclude (or at least reduce) these possibilities. 10. Line 255, "These perturbations led to a failure of bPS/Mys to accumulate at the grommet". Dg mutants are viable (PMID: 18093579); do they show consistent phenotypes?

      Minor comments:

      1. Line 85, "This is the case in the follicular epithelium for example". Here, the text would be more reader-friendly if the authors could clarify this is the follicular epithelium of the fly ovary.
      2. Line 203-, regarding all the experiments involving the Gal4-UAS system. Not all the readers are familiar with the system. A brief explanation on it should be added in the main text. Moreover, in the Results section, not in the Methods, the authors should show what Gal4 they used, and where is the Gal4 expressed.
      3. Line 239, "We found that inhibiting the expression of the DG cofactor, dSarcoglycan [53] was most effective in inhibiting this pathway in retinal cells". Here, the authors should show the data.

      Referee cross-commenting

      This session includes comments from both reviewers

      Reviewer 2: I almost totally agree with Reviewer 1, who is also mainly concerned about the functional analyses part of the paper while being impressed by the authors' beautiful imaging. One issue that Reviewer 1 and I apparently disagree with is the Estimated time to Complete Revisions: while they say 1-3 months, I say 3-6. However, actually I don't think this is a serious discrepancy. Thinking of the time to obtain flies and carry out their crosses necessary for the requested experiments, I'm afraid that the revision cannot be done in 1 month. However, if the authors are fortunate, they may finish the revision in 2-3 months. As I still think that the authors may struggle, I would say the time 2-6 months. I'd be glad if the comments of Reviewer 1 and me could complement with each other to help the revision of the manuscript.

      Reviewer 1:As Reviewer #2 mentioned, there is a strong convergence of our opinions on this article, which should make the work of the authors easier. In fact, I hesitated between 1-3 or 3-6 months for the estimated revision time.

      Reviewer2: Thank you Reviewer #1 for your response. I guess we (Reviewers #1 and #2) have reached an agreement now, haven't we?

      Significance

      General assessment:

      The beautiful images presented here provide interesting descriptions of the events occurring during eye development. Also, the authors' hypothesis on the Dg-dependent recruitment of Laminin leading to integrin polarisation and tissue morphogenesis is simple and attractive. However, I'm afraid that this hypothesis is not supported enough by the presented data. In addition, the novelty of some conclusions and the reliability of a number of reagents used are unclear. Therefore, I cannot say that the conclusions of this manuscript are solid.

      Advance:

      The 3D imaging of ommatidia development is beautiful and of good descriptive value. However, as mentioned in the major comments 1, 2, 3, and 8 above, I am afraid that the search of preceding literature seems insufficient, and it is often unclear what this manuscript add to existing knowledge.

      Audience:

      If the issues mentioned above have been solved, this manuscript would be of general interest to researchers in various fields in cell and developmental biology. Would not be restricted to those using Drosophila.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Walther and colleagues address the role of the cell/ECM interface for cell shape, focusing on the basal domain of epithelial cells. More specifically, they present a thorough descriptive approach on the intricate morphology of the neuroepithelial cells composing Drosophila ommatidia in the retina and relate it to the organization of the basal lamina and the complexes interacting with it, Dystroglycan and integrins. Based on genetics and quantitative imaging approaches, they propose a linear mechanism where 1) Dystroglycan organizes the basal membrane 2) this organization guides the localization of integrins 3) integrin localization defines the shape of the basal domain.

      Major comments:

      First, the 3D description of the ommatidia organization is really nice and interesting, refreshing quite old data using better imaging tools. In particular, it illustrates the extreme difference in morphology between the apical pole and the basal pole of the cells composing the ommatidia, making it a paradigm for understanding how the basal shape is defined independently of the apical one. It also provides a nice and detailed spatiotemporal cartography of basement membrane components, integrin and dystroglycan. However, functional data are less convincing, mainly for technical issues, but could be really improved in a reasonable timeline. My criticisms mainly converge on two aspects of the experimental work :

      1) Genetics :

      • All the genetics experiments are based on RNAi induced knock-down approach. Although such an approach is easy to justify for genes associated with lethality when mutated, it becomes less relevant for non-lethal ones as Dystroglycan complex components (Dg, Dys, Sgc) for which null and viable mutants are published and available. The phenotype of such mutants should be provided.
      • There is no data explaining how these RNAi lines were validated. The fact that it gives the phenotype expected by the authors is obviously not sufficient. This point is essential to exclude off-target effects and to be able to compare the different genotypes (see #2). For instance, the strong effect of sarcoglycan could be questioned. Is it really specific? If yes, is the difference with other Dystroglycan complex members only due to RNAi efficiency or does it have a specific function?
      • Methods section describing genetic conditions is really sketchy. The genotype corresponding to each figure is not provided and I guess that GMR-Gal4 has been used in all experiments using the Gal4 system but it is never clearly stated.

      2) Image analysis by PCA

      After segmentation, authors analyzed their images by PCA using various parameters, which allows them to discriminate between two cell populations that correspond to SC and TC. Then, whatever the genotype they studied, PCA failed to separate those two cell populations leading the authors to propose that they all lead to similar morphological defects, arguing for a linear pathway Dystroglycan / BM / integrins. However, this approach raises many questions: - In the WT situation it would be really informative to know which variable(s) is/are really discriminant between the two cell populations and then maybe to focus a bit more on these parameters. For instance, a PCA correlation circle plotting both cells and variables would be very helpful. - In loss of function conditions, when the tissue is strongly affected, how do the authors recognize the two cell populations if PCA cannot? On the opposite, based on the provided image, Dys RNAi seems to have a mild effect and it seems that my eyes can easily recognize those two cell populations based on their shape. So why PCA cannot? - Based on the proposed images, some phenotypes look clearly different depending on the genotype, e.g. Talin and Mys (figure 3) or Dys and Sgc (Figure 8). In other words, the fact that PCA cannot separate the cell pollutions in these different genotypes does not necessarily mean that their effect is identical. Could authors perform PCA analysis between mutants? If they are different, again it might be very interesting to identify the discriminating parameters. - Authors claimed that laminin RNAi (or MMPs overexpression) affects cell geometry but why it is not analyzed by PCA? It is not consistent with the other figures. - From what I can understand, each PCA analysis has been done on a single retina. If true, more replicates should be included. If not true, the number of independent retinas should be mentioned.

      Minor comments: - Globally, the article suffers from a lack of details, especially in the methods section and/or in figure legends.

      Also, several points could be advantageously discussed. For instance, why MMPs have different effects according to their specificity? Also, what could be the meaning of the nice differential pattern between integrin alpha subunits?

      In Methods, a list of metrics is given for the PCA analysis but some look very similar and it would be helpful to define them briefly.

      Figures are not always color-blind adjusted (e.g. dots on PCA graphs).

      Significance

      This article addresses a relevant and still poorly answered question, which is how the shape of epithelial cells is defined on the side of their basal domain. Indeed, the vast majority of studies tackle this issue for the apical domain with the role of adherens junction and their regulators. Instead, here, the authors explore the role of BM/cell interface. They especially propose a specific sequence of events leading in fine to the proper subcellular targeting of integrins. Whereas many studies on other systems have reached similar conclusions on each of the different steps of this sequence, the main interest of the paper is to bring them together, allowing the proposal of a general framework. Of notice, they made it possible by first doing a nice description of their system. However, functional analysis is somehow superficial and does not really provide mechanistic clues for each step (i.e. how Dystroglycan allows BM assembly and/or secretion, how Integrins controls cell shape.... ).

      Nonetheless, such an article might interest anyone working on tissue morphogenesis in vivo or ex vivo and wondering what the role of cell/BM interplay could be in its own system. Moreover, these protein complexes are highly conserved and involved in many diseases in humans. Thus, getting a more global understanding of their relationships is also relevant for readers working on the aetiology and pathophysiology of those diseases.

      I am a developmental biologist interested in morphogenesis.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The authors presented a comprehensive analysis of the effects of RBM12 on cAMP signaling and cAMP-induced transcription. All data point to hyperactivity in the absence of RBM12, suggesting that RBM12 negatively regulates cAMP signaling, particularly transcriptional response to CAMP in the nucleus. The authors found that increased expression of two adenylyl cyclase isoforms and reduced expression of PKA regulatory subunit and some isoforms of cAMP-destroying PDE is the molecular basis of excessive cAMP signaling in the absence of RBM12. The authors showed that two disease-associated RBM12 mutants are loss-of-function, as, in contrast to WT RBM12, they fail to normalize cAMP signaling and transcriptional response. The authors should be commended for confirming their findings in iPSC-derived neurons. The study is well performed and clearly described.

      Significance

      Identification of earlier unappreciated mechanism regulating cAMP signaling has broad implications.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      The authors have previously carried out a CRISPR screen of b2-AR regulators of transcriptional responses. In this manuscript, the authors proceed to characterize one of the top candidates from this screen, RNA-binding motif 12 (RBM12). They perform numerous studies in HEK293 cells and iPSC-derived neurons to show that loss of RBM12 leads to a hyperactive response of ligand-induced b2AR transcription, cAMP responses and PKA activity. This increase in transcriptional responses is independent in changes of b2AR receptor expression or internalization and can be observed upon activation of other Gs-coupled GPCRs, namely ligands for adenosine A1/2R and dopamine D1R. The hyperactive transcriptional responses can also be mimicked in wild-type cells with forskolin, isoproterenol plus phosphodiesterase inhibitor, or use of cAMP analog 8-CPT-cAMP. The authors also show that variants of RPM12, that lead to familial psychosis, show hyperactive responses to isoproterenol and cannot rescue loss of wild-type RPM12. Finally, transcriptomics of loss of RPM12 in iPSC-derived neurons show altered transcriptional profiles upon stimulation with b2AR agonists.

      Major comments

      Overall this is a comprehensive study of the effects of RBM12 on cAMP-dependent transcriptional responses. The study is highly rigorous and the authors generate several novel findings, supplying a mechanism for disease-altering variants for RBM12. There are a few issues that distract somewhat as detailed below.

      1. The authors are highly focused on the GPCR responses; thus, they fail to discuss the fact that supplemental figures 1D-F show that the effects of RBM12 lie downstream of the receptor and are independent of b2AR. Stimulation with forskolin shows prominent enhancement of cAMP accumulation, pointing to enhancement of adenylyl cyclase and/or decreases in PDE activity. This effect should be quantitated. The is consistent with the fact that stimulation with multiple Gs-coupled receptors show similar enhancements. Given that, much of Fig 2, particularly 2E should be moved to supplemental. The order of figures may need to be re-examined.
        • 1b. The cAMP responses in Supplemental Fig 3 should also be quantitated with statistics.
      2. The use of 8-CPT-cAMP is not appropriate as a pure cAMP analog. It not only activates PKG, but it can also increase cGMP due to inhibition of phosphodiesterases that breakdown cGMP (PDE5).
      3. It is not clear why the authors are overexpressing the b2AR in the iPSC-derived neurons. The application of isoproterenol under conditions of overexpressed receptor is likely similar to stimulating the cell with forskolin or any agonist of an overexpressed Gs-coupled receptor. Thus it appears to be a stretch to call these "b2AR Targets". Moreover, although it is true that loss of PDE activity and/or RII subunits may contribute to loss of compartmentalization of signaling, overexpression of the GPCR could also lead to loss of compartmentalization. This must be discussed.
        • 3b. The actual list of genes in Table 3 should be shown (not just GO terms).
        • 3c. The fact that PDE1C was decreased could point to more than just cAMP-induced transcriptional changes. This is a dual PDE and its decrease may also increase cGMP.

      Minor comments:

      Missing "ISO" labels for Fig S2 C, D Need better labeling of bars for Fig 7B

      Significance

      This is a very rigorous and detailed study to characterize a novel regulator of cAMP signaling systems. Although the data do not support, RBM12 as a specific regulator of beta2AR signaling, it is nevertheless an important regulator of general cAMP signaling and could potentially have effects on cGMP signaling. The study has clinical value, as RPM12 variants drive familial psychosis but this study will also appeal to basic scientists.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      RBM12 is an RNA-binding protein predominantly localized to the nucleus. Mutations in RBM12 have been linked to heritable psychosis and neurodevelopmental defects. The gene appeared in a previously published CRISPRi screen for potential regulators of cAMP signaling. The authors confirm that loss of RPM12 leads to increased basal and induced cAMP, activation of cAMP-dependent protein kinase, and induction of cAMP-CREB induced gene transcription. Similar effects were seen following direct activation of adenylyl cyclase and overexpression of the kinase catalytic subunit. The figures are clearly presented, well controlled, and show significant differences that largely support the central conclusion that RBM12 regulates cAMP. The authors have taken on an extremely challenging problem. The paper is very well written.

      Significance

      The significance of the findings are limited for a number of reasons, which the authors acknowledge as summarized under major comments. We know from prior CRISPRi work that RBM12 regulates cAMP signaling (ref. 8). The findings are publishable, but the advance is modest and the potential target audience is specialized.

      Major comments.

      First, the authors are not able to mechanistically link RBM12 to any particular component of the cAMP pathway. Without a mechanistic link, direct or otherwise, to proteins to make or degrade cAMP, the findings are descriptive.

      OPTIONAL: Does RBM12 bind to and regulate a subset of mRNAs or proteins that are part of the pathway?

      Second, while the link to psychosis and neurodevelopmental defects figures very prominently in the title and text, the link to psychosis is not supported by the approach and most of the text should be removed. The experiments performed here don't come close to recapitulating the physiological setting. Is there ever a situation where individuals don't express any RBM12 (patients with the variants will be heterozygous)?

      OPTIONAL: What happens in a mouse model?

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would truly like to thank all 3 reviewers for insightful, helpful and thus constructive comments.

      Reviewer #1

      Summary

      In this manuscript, Lockyer et al. provide novel insights into the mechanism by which Toxoplasma gondii avoids parasite restriction in IFNγ-activated human cells. To identify potentially secreted proteins supporting parasite survival in IFNγ-activated human foreskin fibroblasts (HFF), the authors designed a CRISPR screen of Toxoplasma secretome candidates based on hyperLOPIT protein localization data. By this approach, they identified novel secreted proteins supporting parasite growth in IFNγ-activated cells. Among the gene identified, they found MYR3 a known component of the putative translocon in charge of protein export through the parasitophorous vacuole membrane. Therefore, the authors focused their investigations on GRA57, a dense granule protein of unknown function, which affects parasite survival to a lesser extent than the MYR component. The resistance phenotype conferred by GRA57 was confirmed by fluorescence microscopy. Importantly, the authors provide evidence that the protective function of GRA57 is not as well conserved in murine cells of the same type (MEF) as in HFF. To further explore the mechanism by which GRA57 protect the parasites in IFNγ-activated cells, the authors searched for protein partners by biochemistry. By immunoprecipitation and tandem mass spectrometry, they identified two other putative dense granule proteins, GRA70 and GRA71, which co-purified with GRA57-HA tagged protein. Noteworthy, both proteins were also found in the CRISPR screens with significant score conferring resistance. High-content imaging analysis confirmed the protective effect conferred by GRA57, GRA70, and GRA71 individually at similar levels. After ruling out an effect of tryptophan deprivation in parasite clearance, or a role of GRA57 in protein export normally mediated by the MYR translocon, and a role on host cell gene expression by RNA-Seq, the authors investigated the ubiquitination of the parasitophorous vacuole membrane, a marker previously thought to initiate parasite clearance. A reduction in ubiquitin labeling around the vacuole of mutant parasites is observed, which is quite surprising given the correlated increase in parasite clearance. The authors concluded that ubiquitin recruitment may not be directly linked to the parasite clearance mechanism.

      Major comments

      • Figure 2C. In this figure, the restriction effect of IFNγ is about 60% (or 40% survival) for RHdeltaUPRT parasites grown in HFFs, which is quite different from the 85% mentioned earlier in the results section. How was actually done the first assay? Settings with 60% restriction sounds reasonable and indicates that a substantial fraction of the parasite population evades the restrictive effect of IFNγ, which provides a clear rationale for the main objective of this study, namely the identification of effectors supporting parasite development in human cells in the presence of IFNγ.

      This discrepancy in restriction likely arises from the differences in the parasites used in these assays and the measurements of restriction. The 85%/90% restriction initially mentioned is from the pooled CRISPR screens using the effector knockout pool. This restriction level was assessed by counting of parasites retrieved following infection of IFNg-stimulated HFFs. The 60% restriction of wildtype parasites seen in Figure 2 is a separate assay. This percentage was calculated by measuring total mCherry fluorescence area within infected HFFs. We expect the restriction of the pooled CRISPR population to be higher than in restriction assays performed with either wild type parasites or single genetic knockouts. We included the 85%/90% numbers to highlight that the HFFs were highly restrictive in the screen, but we have now removed references to these numbers in the results section to avoid confusion with later results that use more accurate measures of survival. We refer to this restriction level instead in the discussion section.

      Optional comment: GRA70 and GRA71 were both copurified with GRA57, but what about GRA71 expression and localization? Is there a reason why this protein partner has not been studied further just like GRA70?

      Tagging of GRA71 was attempted but was not successful in a first attempt. We have not re-attempted this tagging as Krishnamurthy et al 2023 (PMID: 36916910) recently tagged and localised GRA71, demonstrating it is also an intravacuolar dense granule protein with similar localisation to GRA57 and GRA70- we feel there is minimal value in us repeating this.

      *Is there any change in GRA57, GRA70, and GRA71 localization and/or amount when cells were pretreated with IFNγ? *

      Thank you for this suggestion, we have now conducted further investigation to address this. We checked the localisation of GRA57-HA and GRA70-V5 in IFNg-stimulated HFFs and found no change to their localisation. This data has been added in Supplementary Figure S4 in our revised manuscript. Alignment of our RNA-Seq data to the Toxoplasma genome, now included as Supplementary Data 4, also shows there is no significant up or downregulation in expression of any of the three proteins when HFFs are pretreated with IFNg.

      Do they still form a complex in the absence of IFNγ?

      We did not investigate this in this manuscript, however in Krishnamurthy et al 2023 (PMID: 36916910) CoIPs using GRA57 and GRA70 in the absence of IFNγ also identified these three proteins as interaction partners, so formation of the complex is likely IFNg-independent.

      • In the absence of GRA70 or GRA71 is GRA57 expression and/or localization affected?*

      We did not investigate this possibility in this manuscript, however doing so would require the generation of epitope tagged lines in knockout backgrounds. We believe this represents a significant body of work and would therefore be suitable for a future study focused on the further characterisation of this complex. The RNA-Seq data shows that GRA70 and GRA71 expression levels are not significantly different in the RH∆GRA57 strain (Supplementary Data 4) which we have now included as a statement in the results section.

      • *Page 13, result section. To determine whether GRA57 has any direct or indirect effect on host cell gene expression, the authors performed RNA-Seq analysis of HFF cells pretreated or not with IFNγ. First, as for proteomic data, were the data deposited on GEO or another repository database? *

      Second, were any effect detected on parasite gene expression? Reads alignment could be done using the T. gondii reference genome to determine whether IFNg or gra57 KO has any effect on parasite genes. Possibly, other secreted proteins not necessarily expressed at the tachyzoite stage and therefore not captured in the hyperLOPIT protein analysis are specifically expressed in these conditions.

      We will deposit the RNA-Seq data on GEO prior to final publication. We did perform read alignment using the Toxoplasma gondii reference genome, and we agree it would be useful to include this analysis. We have now provided this data in Supplementary Data 4. Comparison of parasite gene expression between RH∆Ku80 and RH∆GRA57 revealed very few major changes (L2FC 2) that were also rescued in the RH∆GRA57::GRA57 line, irrespective of IFNg stimulation. Of the few genes that were up or downregulated in the RH∆GRA57 parasites, these were all uncharacterised. Collectively this data did not provide any mechanistic insight into the function of GRA57, and we think it unlikely the GRA57 phenotype is related to major changes in host or parasite gene expression. We have amended the manuscript to highlight this.

      Optional comment: RNA-Seq analysis points to a clear induction of GBPs upon IFNγ treatment in HFF. Given the clear function of GBP in parasite clearance, have the authors ever hypothesized that GRA57 could be involved in preventing GBP binding to the PVM?

      We have not tested if GBP recruitment is influenced by GRA57, however GBPs have previously been shown to be dispensable for restriction of Toxoplasma growth in HFFs (Niedelman et al 2013, PMID: 24042117) despite being robustly induced by IFNg stimulation (Kim et al 2007, PMID: 17404298). We have modified the manuscript to highlight this.

      Minor comments

      • Page 4, introduction, 8th paragraph. Regarding the role of IST, it might be less prone to controversy to state: 'a condition that may only be met in the early stages of infection.'

      We agree and have changed this.

      • Page 4, end of introduction. Changing '... indicating that the three proteins function in a complex'. Changing to '... indicating that the three proteins function in the same pathway.' might be more appropriate for the conclusion.

      We agree and have changed this.

      • Page 4, result section, first paragraph. 'strain specific and independent effectors'. Are the authors talking about strain-specific and non-strain-specific factors?

      Yes- we have changed the text to reflect this.

      - Page 6, result section. 'GRA25, an essential virulence factor in mice'. It is not clear to the reviewer how a virulence factor is essential since both parasite and mouse survival is achieved in the GRA25 mutant. I suggest to replace 'essential' by 'major'.

      We agree and have changed this.

      - Page 7. 'showing that GRA57 resides in the intravacuolar network (IVN) (Figure 2A)'. From the image shown, GRA57 clearly localizes into the PV, but it is hard to tell whether GRA57 is associated with the intravacuolar network. Colocalization assay or electron microscopy would be necessary to draw such conclusions.

      We agree and have changed all references to this localisation as ‘intravacuolar’ instead of specifically the IVN.

      - 'uprt locus'. Lower case letters and italic are generally preferred to designate mutants, whereas upper case letters are generally used for wild type alleles. (Sibley et al., Parasitology Today, 1991. Proposal for a uniform genetic nomenclature in Toxoplasma gondii).

      We agree and have changed this.

      - The authors mentioned in the introduction that ROP1 contributes to T. gondii resistance to IFNγ in murine and human macrophages. However, they did not comment on whether ROP1 was found important in the screen performed here in human HFF cells. It may be useful to reference ROP1 in Figure 1 as GRA15, GRA25, etc.

      ROP1 was not found to be important in the HFF screens (+IFNg L2FCs in RH: -0.1, PRU: -0.46). As ROP1 was characterised as an IFNg resistance effector in macrophages, this discrepancy may therefore represent a cell type-specific difference, so we feel it is not relevant to highlight for the purposes of the screens presented here.

      - Figure 2D. The authors compared the restriction effect of IFNγ on parasites grown in HFF and MEF host cells. However, as represented - % + IFNγ/- IFNγ - it cannot be estimated whether the parasites grew similarly in the two host cell types in the absence of IFN. Please indicate whether or not the growth was similar in both cell types.

      As these restriction assays were not carried out concurrently and were designed to measure IFNg survival, we feel it would be inaccurate to compare parasite growth between the two cell types using this data. The focus of these experiments was to investigate the restrictive effect of IFNg across parasite strains, using the -IFNg condition to control for differences in growth rate or MOI. Therefore we feel it is appropriate for the focus of our manuscript to represent the data in this way.

      - pUPRT plasmid. Any reference or vector map would be appreciated.

      We have added the reference for this plasmid.

      - Page 9, figure 3A, mass spectrometry analysis. I did not find the MS data in supplementals. Were the data deposited in on PRIDE database or another data repository?

      The table was included as Supplementary Data 2, however this was not referred to in the main text. We have now amended the text to include this. The data will be deposited on PRIDE prior to final publication.

      - Figures 3E and 3F. It might be worth mentioning, at least in the figure legend, that GRA3 localizes at PV membrane and is exposed to the host cell cytoplasm (to mediate interactions with host Golgi). The signal for GRA3 following saponin treatment is here an excellent control that should be highlighted, indicating that saponin effectively permeabilized the host cell membrane.

      We agree and have updated the figure legend and the main text. We have also added a reference to Cygan et al 2021__ (__PMID: 34749525) in support of this data, which found GRA57, but not GRA70 or GRA71, enriched at the PVM.

      • Page 11, section title. I think that the authors meant 'GRA57, GRA70 and GRA71 confer resistance to vacuole clearance in IFNγ-activated HFFs.'

      We agree and have changed this.

      • Page 11, in the result section comparing the effect of GRA57 mutant with MYR component KO, the authors are referring to host pathways that are counteracted by MYR-dependent effectors released into the host cell. It is not clear which pathways the authors are referring to.

      It is not known exactly which host pathways mediate vacuole clearance or parasite growth restriction, or which MYR-dependent parasite effectors specifically resist these defences, therefore we have removed this statement from the text for clarity.

      • Page 16, discussion, end of 4th paragraph. '... to promote parasite survival in IFNγ activated cells' sounds better.

      We agree and have changed this.

      • Page 22-23, Methods section, c-Myc nuclear translocation assays and elsewhere. Please indicate how many events were actually analyzed. For example, in this assay, to determine the median nuclear c-Myc signal, how many infected cells were analyzed for each biological replicate?

      We have updated the methods section for the c-Myc nuclear translocation and ubiquitin-recruitment assays to include details on how many events were analysed.

      **Referees cross-commenting**

      Overall, I agree with most of the co-reviewers' remarks. I agree with reviewer #2 that this manuscript reports interesting data for the field of parasitology, but that the broad interest for immunologists is somewhat limited by the lack of a description of the mechanism by which these effectors oppose IFNgamma-inducible cell-autonomous defenses. I also agree with the other reviewers' comments regarding the GRA57, 70, and 71 heterotrimeric complex, which would require further description. In its present form, the manuscript undoubtedly represents an interesting starting point for further investigations and any additional data regarding the mode of interaction of the identified effectors and their function related or not to ubiquitylation would bring a significant added value.

      Reviewer #1 (Significance (Required)):

      Despite the fact that humans are accidental intermediate hosts for Toxoplasma gondii, the parasite may develop a persistent infection, demonstrating that it has effectively avoided host defenses. While Toxoplasma gondii has been extensively studied in mice, much less is known about the mechanisms by which the parasite establishes a chronic infection in humans. In this context, this article described very interesting data about the way this parasite counteracts human cell-autonomous innate immune system. This is a fascinating and important topic lying at the interface between parasitology and immunology. Indeed, the highly specialized secretory organelles characteristics of apicomplexan parasites are key to govern host-cell and parasite interactions ranging from host cell transcriptome modification to counteracting immune defense mechanisms. Overall, this article presents a significant contribution to the field of parasitology by identifying novel players involved in Toxoplasma gondii's evasion of human cell-autonomous immunity. Most conclusions are generally well supported by cutting-edge approaches and state of the art methods. Despite being a highly competitive field, this article stands out as the first screen designed specifically to identify virulence factors for human cells and extends our understanding of the secreted dense granule proteins resident of the parasitophorous vacuole. Importantly, the authors provide evidence that these players are active in different strain backgrounds and act in a way that is independent of the export machinery in charge of delivering effector proteins directly into the host cell. However, substantial further research is needed to fully understand the mechanism by which these novel players confer resistance to the parasite in IFNγ activated human cells and how their mode of action differs from that mediated by the translocation machinery (MYR complex). As a microbiologist and biochemist, I find this work of a particular interest to a broad audience, especially to parasitologists and immunologists, as it may unveil unexpected aspects of human innate immunity involved in parasite clearance with proteins unique to Apicomplexa phylum.

      Reviewer #2

      This paper reports high-quality genetic screening data identifying three novel Toxoplasma virulence factors (Gra57,70, and 71) that promote survival of two distinct Toxoplasma strains (type I RH and type II Pru) inside IFN-gamma primed human fibroblasts. Follow-up studies, exclusively focused on type I RH Toxoplasma, confirm the screening data. Gra57 IP Mass-Spec data suggest that Gra57, 70, and 71 may form a protein complex, a model supported by comparable IF staining patterns

      Major:

      - It is unclear what statistical metric was used to define screen hits as strain-dependent vs strain-independent. A standard approach would be to use a specific z-score value (often a z-score of 2) above or below best fit linear relationship between L2FCU for RH vs Pru as depicted in Fig.1D. Gra25 and Gra35 appear to be specific for Pru but it would be helpful to approach this type of categorization statistically. Also, such an analysis may reveal that only Pru-specific but not RH-specific hits were identified. Could the authors speculate why that would be?

      We did not use a specific statistical metric to define screen hits as strain-dependent vs strain-independent, but GRA57 was selected as a strain-independent hit based on having a L2FC of RH specific: TGME49_309600 (GRA71) & CST9

      PRU specific: GRA35, GRA25, ROP17, GRA23 & GRA45

      Strain-independent: MYR3, GRA57, TGME49_249990 (GRA70) & MYR1

      This agrees with our selection of strain-independent hits. However, we feel that using either L2FC or Z-score cut-offs is equally arbitrary, and we would therefore prefer to leave the data displayed without these cut-offs. It is indeed interesting that there appear to be more strain-specific hits in the PRU screen, but we cannot speculate as to why this may be as we did not explore this further here.

      *- The paper proposes that Gra57, 70, and 71 form a heterotrimeric complex. This is based on the Mass-spec data from the original Gra57 pulldown, similar IF staining patterns, and comparable phenotypic presentation of the individual KO strains. However, only the MS data provide somewhat direct evidence for the formation a trimeric complex, and these data are by no means definitive. As this is a key finding of the MS, it should be further supported by additional biochemical data. Ideally, the authors should reconstitute the trimeric complex in vitro using recombinant proteins. Admittedly, this could be quite an undertaking with various potential caveats. Alternatively, reciprocal pulldowns of the 3 components could be performed. Super-resolution microscopy of the 3 Gra proteins might present another avenue to obtain more compelling evidence in support of the central claim of this work, *

      We attempted a reciprocal pulldown using our GRA70-V5 line which unfortunately failed to verify the MS data, but we believe this is primarily due to differences in the affinity matrix that we used for this pulldown (anti-V5 vs anti-HA) and would require further optimisation or generation of a GRA70-HA line. However, while these revisions were being performed, another group published data demonstrating through pulldown of GRA57 and GRA70 that these proteins interact with each other, GRA71, and GRA32__ (__Krishnamurthy et al 2023, PMID: 36916910). We also identified GRA32 as enriched in our MS data, but to a less significant degree than GRA70 and GRA71. Together we believe that this independent data set is a robust validation of our findings, and strongly justifies the conclusion that these proteins form a complex.

      We agree with the reviewer that further biochemical characterisation of the complex will be an interesting avenue for future research, but we feel it would require a substantial amount of further work. As suggested, super-resolution microscopy of the 3 proteins would require the generation of either double or triple tagged Toxoplasma lines, or antibodies against one or more of the complex members. Again, we feel this would represent a substantial body of further work. Reconstitution of the complex in vitro would require recombinant expression and purification of multiple large proteins that are all multidomain and possibly membrane associated/integrated. Assuming a 1:1:1 stoichiometric assembly this complex would be 446kDa. Purification of such proteins and reconstitution of the complex in vitro is therefore likely to represent many challenges and we do not feel this would be trivial to accomplish.

      - The ubiquitin observations made in this paper are a bit preliminary and the authors' interpretation of their data is vague. The authors may want to re-consider that ubiquitylated delta Gra57 PVs are being destroyed with much faster kinetics than ubiquitylated WT PVs. The reduced number of ubiquitylated delta Gra57 PVs compared to ubiquitylated WT PVs across three timepoints (as shown by the authors in Fi. S8) does not disprove the 'fast kinetics model.' To test the fast kinetics ubiquitin-dependent null hypothesis, video microscopy could be used to measure the time from PV ubiquitylation onset to PV destruction

      We agree with the reviewer that the possibility remains that GRA57 knockouts are cleared within the first hour of infection, and we have amended our text to reflect this. However, we think this is unlikely given that GRA57 knockouts are also less ubiquitinated in unstimulated cells, yet do not show any growth differences in unstimulated HFFs. Also considering the new data we have provided showing reduced recognition of GRA57 knockouts by the E3 ligase RNF213 (Figure 5D), we expect that the observed reduction in ubiquitination is highly likely to be unlinked to the increased susceptibility of GRA57 knockouts to IFNg. We have amended the discussion to state this conclusion more strongly.

      The recently published manuscript that also identified GRA57/GRA70/GRA71 as effectors in HFFs showed that deletion of these effectors leads to premature egress from IFNg-activated HFFs__ (__Krishnamurthy et al 2023, PMID: 36916910). In light of this new data, we hypothesised that early egress could be causing the apparent reduction in ubiquitination. We have now provided data that disproves this hypothesis (Figure S10), as inhibition of egress did not rescue the ubiquitination phenotype. We also did not observe enhanced restriction of GRA57 knockout parasites at 3 hours post-infection (Figure S10B), suggesting clearance, or egress, happens after this time point.

      We agree with the reviewer that determining the kinetics of IFNg restriction of these knockouts in HFFs would be interesting, however we feel this is more suited to future work. Imaging ubiquitin recruitment in live cells would also require the generation of new reporter host cell lines which would require a substantial amount of further work.

      - Related to the point above. We know that different ubiquitin species are found at the PVM in IFNgamma-primed cells but to what degree each Ub species exerts an anti-parasitic effect is not well established. The paper only monitors total Ub at the PVM. Could it be that delta Gra57 PVs are enriched for a specific Ub species but depleted for another? The authors touch on this in the Discussion but these are easy experiments to perform and well within the scope of the study. At least the previously implicated ubiquitin species M1, K48, and K63 should be monitored and their colocalization with Toxo PVMs quantified

      We agree that these experiments are within the scope of this study. We have now investigated the ubiquitin phenotype further by assessing the recruitment of M1, K48 and K63 ubiquitin linkages to the vacuoles of GRA57 knockouts. We observed depletion of both M1 and K63 linked ubiquitin. This data is now included in Figure 5 and Figure S8.

      The E3 ligase RNF213 has recently been shown to facilitate recruitment of M1 and K63-linked ubiquitin to Toxoplasma vacuoles in HFFs (Hernandez et al 2022, PMID: 36154443 & Matta et al 2022, DOI: https://doi.org/10.1101/2022.10.21.513197 ). We therefore additionally assessed the recruitment of RNF213 to GRA57 knockouts, and found RNF213 recruitment was also reduced. Given that a reduction in RNF213 recruitment should correlate with a decrease in restriction, this data further supports our conclusion that the ubiquitin and restriction phenotypes are not causally linked. The observation that GRA57 knockouts are less susceptible to recognition by RNF213 also opens an exciting avenue for further research into the host recognition of Toxoplasma vacuoles by RNF213, for which currently the target is unknown.

      Minor:

      - For readers not familiar with Toxo genetics, the authors should include a sentence or two in the results section explaining the selection of HXGPRT deletion strains for the generation of Toxo libraries

      We agree and have added this in.

      - the highest scoring hits from the Pru screen (Gra35 &25) weren't investigated further. These hits appear to be specific for Pru. Some discussion as to why there are Pru-specific factors (but maybe not RH-specific factors) seems warranted

      As mentioned above, we agree that it is indeed interesting that there appear to be more strain-specific hits in the PRU screen, but we cannot speculate as to why this may be as we did not explore the reasons for this further in this manuscript. Without substantial further investigation it cannot be determined whether these represent true strain-specific differences or reflect technical variability between the independent screens. We therefore feel it is sufficient to highlight effectors with the strongest phenotypes in each screen, without drawing strong conclusions regarding strain-specificity.

      **Referees cross-commenting**

      My reading of the comments is that there's consensus that this is a high quality study revealing novel Toxo effectors that undermine human cell-autonomous immunity and an important study in the field of parasitology. I might be the outlier that doesn't see much of an advance for the field of immunology since we don't really know what these effectors are doing, and the preliminary studies addressing this point are not well developed, with some confusing results.

      My major comment #2 and rev#1's major comment #2 are, I think, essentially asking for the same thing, namely some more robust data on substantiating the formation of a trimeric complex.

      My co-reviewers made great comments all across and I don't see any real discrepancies between the reviewers' comments - just some variation in what we, the reviewers, focused on

      Reviewer #2 (Significance (Required)):

      The discovery of a novel set of secreted Gra proteins critical for enhanced Toxoplasma survival specifically in IFNgamma primed human fibroblasts (but not mouse fibroblasts) is an important discovery for the Toxoplasma field. However, the study is somewhat limited in its scope as it fails to determine which, if any, specific IFNgamma-inducible cell-autonomous immune pathway is antagonized by Gra57 &Co. Instead, the paper reports that parasitophorous vacuoles (PVs) formed by Gra57 deletion mutants acquire less host ubiquitin than PVs formed by the parental WT strain. Because host-driven PV ubiquitylation is generally considered anti-parasitic, this observation is counterintuitive, and no compelling model is presented to explain these unexpected findings. Overall, this is a well conducted Toxoplasma research study with a few technical shortcomings that need to be addressed. However, in its current form, the study provides only limited insights into possible mechanisms by which Toxoplasma undermines human immunity. This study certainly provides an exciting starting point for further explorations.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary:

      Toxoplasma gondii virulence and immune responsed upon infection in mice are well described. In contrast, little is known about human responses, particularly upon IFNγ-activation. However, host ubiquitination of the parasitophorous vacuole has been shown to be associated with parasite clearence in human cells.

      Targeted CRISPR screens were used in the type I RH and type II Pru strain of Toxoplasma gondii to identify dense granule and rhoptry proteins. Human foreskin fibroblasts (HFFs) stimulated with IFNγ were used for infection of the knock-out parasites to identify guide RNAs and thus their corresponding genes to identify genes conferring growth benefits. Beside components of the MYR translocon, gra57 was identified. This gene was then knock-out or epitope-tagged in RH. The tagged line confirmed GRA57 localisation in the intravacuolar network confirming previously published work from another lab. Knock-out of gra57 lead to a moderate decrease in survival in HFFs, but not in mouse cells. Co-immunoprecipitation experiments with GRA57 identified 2 dense granule proteins that also display IFNγ-specific phenotypes with similar localisation as GRA57, and all are resistance factors in IFNγ-activated HFFs. Knock-out of GRA57 does not impact tryptophan metabolism, effector export of gene expression of the host cells. However, deletion of GRA57 or its interaction partners reduces ubiquitination of the parasitophorous vacuole.

      Major comments:

      This is a well executed study with informative, novel data. Here a few comments and questions:

      - LFC cut-off of the CRISPR screen should be clearly stated.

      We have amended this in the text.

      - What is the rationale for using Prugniaud as the type II strain of choice and not ME49?

      Both ME49 and PRU strains are widely used in the field, but as the PRU strain was used previously by our group for in vivo screens of Toxoplasma effectors (Young et al 2019 PMID: 31481656, Butterworth et al 2022 PMID: 36476844) ,using PRU here allows for direct comparison of our screening datasets.

      - Figure 4A does not list all the significant genes that are then mentioned in the text below. This should be amended.

      It is unclear what the reviewer is referring to here (Figure 4A displays restriction assay data).

      *- RNA-Seq data is inadequately presented. Although, the actual genes regulated may be of secondary importance in this study, it would still be good to have a few key genes mentioned as a quality control statement. *

      This was also raised by reviewer 1. We have now modified the manuscript to highlight that we observed robust induction of interferon-stimulated genes in our IFNg-treated conditions, but minimal differential gene expression between HFFs infected with the different parasite strains.

      *- It is stated that "...GRA57 is not as important for survival in MEFs as in HFFS". With no significant change observed, it should be re-phrased to something like ""...indicatin that GRA57 is s important for survival in MEFs as in HFFS." *

      We have re-phrased this statement.

      *- Optional: GRA57 was described by the Bradley lab to be in the PV in tachyzoites and in the cyst wall in bradyzoites. Although it tissue cysts are not the focus of this paper and the knock-out is created also in a cyst-forming strain, it would have been useful to look for a phenotype of the knockout in cysts, in vitro at least, better both in in vitro and in vivo. In future, this could also be useful for the authors bringing in more citations. *

      We agree with the reviewer that the impact of GRA57 on cyst formation would be an interesting topic for further exploration, however the focus of our study is on the role of secreted Toxoplasma effectors during the acute stages of infection.

      Minor comments:

      - Line numbers would be useful for an efficient review process.

      We have added these to the revised manuscript.

      - Strictly speaking, we have to talk about the sexual development taking place in felid and not feline hosts (Introduction; Felidae versus Felinae).

      We have amended this in the text.

      - Please insert spaces between numbers and units.

      We have corrected this.

      - Domain structures are presented, but maybe the AlphaFold 3D predictions could be added in a supplemental figure?

      For GRA70 and GRA71 the AlphaFold 3D predictions are readily available on ToxoDB, whereas for GRA57 the prediction is not available due its size. We therefore independently analysed GRA57 using the full implementation of AlphaFold 2 (not ColabFold). We attempted submissions of putative discrete domains as well as the full-length protein, however both approaches yielded predictions with low confidence and low structural content, except for a ~100aa region of helical residues. We chose not to include the AlphaFold 3D predictions for all three proteins as the confidence for these predictions is low with pLDDT scores of commonly *- To improve the confidence of the co-immunoprecipitation, it would be necessary to use another tagged protein GRA70 or 71) and see if the same complex can be pulled down. Like this, one could also address what happens in a GRA57KO line? Do GRA70 and 71 stay together in the absence of GR57 forming a dimer? *

      Reviewer 2 raised a similar point regarding the reciprocal pulldown, please see above for our detailed response to this. As suggested, we attempted a reciprocal pulldown using our GRA70-V5 line which unfortunately did not reconstitute the complex, but we believe this was due to technical differences in the epitope tag (V5 vs HA) and affinity matrix used. Overall, we believe that more detailed study of the assembly and biochemistry of this complex will require substantially more work and the generation of further cell lines, which would be beyond the scope of this study.

      Reviewer #3 (Significance (Required)):

      Significance:

      This study endeavours to start closing an important knowledge gab of host defence in non-rodent hosts, especially humans. The data is solid using two different strains and yields novel insights into players of host cell resistance in humans against T. gondii. Using a targeted screening approach of rhoptry and dense granule proteins, they focused their interest on a subcategory of secreted proteins. The authors have not limited themselves to the screening and localisation study, but also investigated effect on host cells and host cell response. The identification of GRA57 being an important resistance factor and forming a heterodimer with GRA70 and GRA71 is novel. This study is of interest to cell biologists in the field of cyst-forming Coccidia, especially T. gondii and researchers interested in host resistance, parasite clearance by the host and parasite virulence.

      I am a cell biologist working in Toxoplasma gondii and other Coccidians.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      Toxoplasma gondii virulence and immune responsed upon infection in mice are well described. In contrast, little is known about human responses, particularly upon IFNγ-activation. However, host ubiquitination of the parasitophorous vacuole has been shown to be associated with parasite clearence in human cells.

      Targeted CRISPR screens were used in the type I RH and type II Pru strain of Toxoplasma gondii to identify dense granule and rhoptry proteins. Human foreskin fibroblasts (HFFs) stimulated with IFNγ were used for infection of the knock-out parasites to identify guide RNAs and thus their corresponding genes to identify genes conferring growth benefits. Beside components of the MYR translocon, gra57 was identified. This gene was then knock-out or epitope-tagged in RH. The tagged line confirmed GRA57 localisation in the intravacuolar network confirming previously published work from another lab. Knock-out of gra57 lead to a moderate decrease in survival in HFFs, but not in mouse cells. Co-immunoprecipitation experiments with GRA57 identified 2 dense granule proteins that also display IFNγ-specific phenotypes with similar localisation as GRA57, and all are resistance factors in IFNγ-activated HFFs. Knock-out of GRA57 does not impact tryptophan metabolism, effector export of gene expression of the host cells. However, deletion of GRA57 or its interaction partners reduces ubiquitination of the parasitophorous vacuole.

      Major comments:

      This is a well executed study with informative, novel data. Here a few comments and questions:

      • LFC cut-off of the CRISPR screen should be clearly stated.
      • What is the rationale for using Prugniaud as the type II strain of choice and not ME49?
      • Figure 4A does not list all the significant genes that are then mentioned in the text below. This should be amended.
      • RNA-Seq data is inadequately presented. Although, the actual genes regulated may be of secondary importance in this study, it would still be good to have a few key genes mentioned as a quality control statement.
      • It is stated that "...GRA57 is not as important for survival in MEFs as in HFFS". With no significant change observed, it should be re-phrased to something like ""...indicatin that GRA57 is s important for survival in MEFs as in HFFS."
      • Optional: GRA57 was described by the Bradley lab to be in the PV in tachyzoites and in the cyst wall in bradyzoites. Although it tissue cysts are not the focus of this paper and the knock-out is created also in a cyst-forming strain, it would have been useful to look for a phenotype of the knockout in cysts, in vitro at least, better both in in vitro and in vivo. In future, this could also be useful for the authors bringing in more citations.

      Minor comments:

      • Line numbers would be useful for an efficient review process.
      • Strictly speaking, we have to talk about the sexual development taking place in felid and not feline hosts (Introduction; Felidae versus Felinae).
      • Please insert spaces between numbers and units.
      • Domain structures are presented, but maybe the AlphaFold 3D predictions could be added in a supplemental figure?
      • To improve the confidence of the co-immunoprecipitation, it would be necessary to use another tagged protein GRA70 or 71) and see if the same complex can be pulled down. Like this, one could also address what happens in a GRA57KO line? Do GRA70 and 71 stay together in the absence of GR57 forming a dimer?

      Significance

      This study endeavours to start closing an important knowledge gab of host defence in non-rodent hosts, especially humans. The data is solid using two different strains and yields novel insights into players of host cell resistance in humans against T. gondii. Using a targeted screening approach of rhoptry and dense granule proteins, they focused their interest on a subcategory of secreted proteins. The authors have not limited themselves to the screening and localisation study, but also investigated effect on host cells and host cell response. The identification of GRA57 being an important resistance factor and forming a heterodimer with GRA70 and GRA71 is novel. This study is of interest to cell biologists in the field of cyst-forming Coccidia, especially T. gondii and researchers interested in host resistance, parasite clearance by the host and parasite virulence.

      I am a cell biologist working in Toxoplasma gondii and other Coccidians.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This paper reports high-quality genetic screening data identifying three novel Toxoplasma virulence factors (Gra57,70, and 71) that promote survival of two distinct Toxoplasma strains (type I RH and type II Pru) inside IFN-gamma primed human fibroblasts. Follow-up studies, exclusively focused on type I RH Toxoplasma, confirm the screening data. Gra57 IP Mass-Spec data suggest that Gra57, 70, and 71 may form a protein complex, a model supported by comparable IF staining patterns

      Specific criticisms

      Major:

      • It is unclear what statistical metric was used to define screen hits as strain-dependent vs strain-independent. A standard approach would be to use a specific z-score value (often a z-score of 2) above or below best fit linear relationship between L2FCU for RH vs Pru as depicted in Fig.1D. Gra25 and Gra35 appear to be specific for Pru but it would be helpful to approach this type of categorization statistically. Also, such an analysis may reveal that only Pru-specific but not RH-specific hits were identified. Could the authors speculate why that would be?
      • The paper proposes that Gra57, 70, and 71 form a heterotrimeric complex. This is based on the Mass-spec data from the original Gra57 pulldown, similar IF staining patterns, and comparable phenotypic presentation of the individual KO strains. However, only the MS data provide somewhat direct evidence for the formation a trimeric complex, and these data are by no means definitive. As this is a key finding of the MS, it should be further supported by additional biochemical data. Ideally, the authors should reconstitute the trimeric complex in vitro using recombinant proteins. Admittedly, this could be quite an undertaking with various potential caveats. Alternatively, reciprocal pulldowns of the 3 components could be performed. Super-resolution microscopy of the 3 Gra proteins might present another avenue to obtain more compelling evidence in support of the central claim of this work
      • The ubiquitin observations made in this paper are a bit preliminary and the authors' interpretation of their data is vague. The authors may want to re-consider that ubiquitylated delta Gra57 PVs are being destroyed with much faster kinetics than ubiquitylated WT PVs. The reduced number of ubiquitylated delta Gra57 PVs compared to ubiquitylated WT PVs across three timepoints (as shown by the authors in Fi. S8) does not disprove the 'fast kinetics model.' To test the fast kinetics ubiquitin-dependent null hypothesis, video microscopy could be used to measure the time from PV ubiquitylation onset to PV destruction
      • Related to the point above. We know that different ubiquitin species are found at the PVM in IFNgamma-primed cells but to what degree each Ub species exerts an anti-parasitic effect is not well established. The paper only monitors total Ub at the PVM. Could it be that delta Gra57 PVs are enriched for a specific Ub species but depleted for another? The authors touch on this in the Discussion but these are easy experiments to perform and well within the scope of the study. At least the previously implicated ubiquitin species M1, K48, and K63 should be monitored and their colocalization with Toxo PVMs quantified

      Minor:

      • For readers not familiar with Toxo genetics, the authors should include a sentence or two in the results section explaining the selection of HXGPRT deletion strains for the generation of Toxo libraries
      • the highest scoring hits from the Pru screen (Gra35 &25) weren't investigated further. These hits appear to be specific for Pru. Some discussion as to why there are Pru-specific factors (but maybe not RH-specific factors) seems warranted

      Referees cross-commenting

      My reading of the comments is that there's consensus that this is a high quality study revealing novel Toxo effectors that undermine human cell-autonomous immunity and an important study in the field of parasitology. I might be the outlier that doesn't see much of an advance for the field of immunology since we don't really know what these effectors are doing, and the preliminary studies addressing this point are not well developed, with some confusing results.

      My major comment #2 and rev#1's major comment #2 are, I think, essentially asking for the same thing, namely some more robust data on substantiating the formation of a trimeric complex.

      My co-reviewers made great comments all across and I don't see any real discrepancies between the reviewers' comments - just some variation in what we, the reviewers, focused on

      Significance

      The discovery of a novel set of secreted Gra proteins critical for enhanced Toxoplasma survival specifically in IFNgamma primed human fibroblasts (but not mouse fibroblasts) is an important discovery for the Toxoplasma field. However, the study is somewhat limited in its scope as it fails to determine which, if any, specific IFNgamma-inducible cell-autonomous immune pathway is antagonized by Gra57 &Co. Instead, the paper reports that parasitophorous vacuoles (PVs) formed by Gra57 deletion mutants acquire less host ubiquitin than PVs formed by the parental WT strain. Because host-driven PV ubiquitylation is generally considered anti-parasitic, this observation is counterintuitive, and no compelling model is presented to explain these unexpected findings. Overall, this is a well conducted Toxoplasma research study with a few technical shortcomings that need to be addressed. However, in its current form, the study provides only limited insights into possible mechanisms by which Toxoplasma undermines human immunity. This study certainly provides an exciting starting point for further explorations.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      In this manuscript, Lockyer et al. provide novel insights into the mechanism by which Toxoplasma gondii avoids parasite restriction in IFNγ-activated human cells. To identify potentially secreted proteins supporting parasite survival in IFNγ-activated human foreskin fibroblasts (HFF), the authors designed a CRISPR screen of Toxoplasma secretome candidates based on hyperLOPIT protein localization data. By this approach, they identified novel secreted proteins supporting parasite growth in IFNγ-activated cells. Among the gene identified, they found MYR3 a known component of the putative translocon in charge of protein export through the parasitophorous vacuole membrane. Therefore, the authors focused their investigations on GRA57, a dense granule protein of unknown function, which affects parasite survival to a lesser extent than the MYR component. The resistance phenotype conferred by GRA57 was confirmed by fluorescence microscopy. Importantly, the authors provide evidence that the protective function of GRA57 is not as well conserved in murine cells of the same type (MEF) as in HFF. To further explore the mechanism by which GRA57 protect the parasites in IFNγ-activated cells, the authors searched for protein partners by biochemistry. By immunoprecipitation and tandem mass spectrometry, they identified two other putative dense granule proteins, GRA70 and GRA71, which co-purified with GRA57-HA tagged protein. Noteworthy, both proteins were also found in the CRISPR screens with significant score conferring resistance. High-content imaging analysis confirmed the protective effect conferred by GRA57, GRA70, and GRA71 individually at similar levels. After ruling out an effect of tryptophan deprivation in parasite clearance, or a role of GRA57 in protein export normally mediated by the MYR translocon, and a role on host cell gene expression by RNA-Seq, the authors investigated the ubiquitination of the parasitophorous vacuole membrane, a marker previously thought to initiate parasite clearance. A reduction in ubiquitin labeling around the vacuole of mutant parasites is observed, which is quite surprising given the correlated increase in parasite clearance. The authors concluded that ubiquitin recruitment may not be directly linked to the parasite clearance mechanism.

      Major comments

      • Figure 2C. In this figure, the restriction effect of IFNγ is about 60% (or 40% survival) for RHdeltaUPRT parasites grown in HFFs, which is quite different from the 85% mentioned earlier in the results section. How was actually done the first assay? Settings with 60% restriction sounds reasonable and indicates that a substantial fraction of the parasite population evades the restrictive effect of IFNγ, which provides a clear rationale for the main objective of this study, namely the identification of effectors supporting parasite development in human cells in the presence of IFNγ.
      • Optional comment: GRA70 and GRA71 were both copurified with GRA57, but what about GRA71 expression and localization? Is there a reason why this protein partner has not been studied further just like GRA70? Is there any change in GRA57, GRA70, and GRA71 localization and/or amount when cells were pretreated with IFNγ? Do they still form a complex in the absence of IFNγ? In the absence of GRA70 or GRA71 is GRA57 expression and/or localization affected?
      • Page 13, result section. To determine whether GRA57 has any direct or indirect effect on host cell gene expression, the authors performed RNA-Seq analysis of HFF cells pretreated or not with IFNγ. First, as for proteomic data, were the data deposited on GEO or another repository database? Second, were any effect detected on parasite gene expression? Reads alignment could be done using the T. gondii reference genome to determine whether IFNg or gra57 KO has any effect on parasite genes. Possibly, other secreted proteins not necessarily expressed at the tachyzoite stage and therefore not captured in the hyperLOPIT protein analysis are specifically expressed in these conditions.
      • Optional comment: RNA-Seq analysis points to a clear induction of GBPs upon IFNγ treatment in HFF. Given the clear function of GBP in parasite clearance, have the authors ever hypothesized that GRA57 could be involved in preventing GBP binding to the PVM?

      Minor comments

      • Page 4, introduction, 8th paragraph. Regarding the role of IST, it might be less prone to controversy to state: 'a condition that may only be met in the early stages of infection.'
      • Page 4, end of introduction. Changing '... indicating that the three proteins function in a complex'. Changing to '... indicating that the three proteins function in the same pathway.' might be more appropriate for the conclusion.
      • Page 4, result section, first paragraph. 'strain specific and independent effectors'. Are the authors talking about strain-specific and non-strain-specific factors?
      • Page 6, result section. 'GRA25, an essential virulence factor in mice'. It is not clear to the reviewer how a virulence factor is essential since both parasite and mouse survival is achieved in the GRA25 mutant. I suggest to replace 'essential' by 'major'.
      • Page 7. 'showing that GRA57 resides in the intravacuolar network (IVN) (Figure 2A)'. From the image shown, GRA57 clearly localizes into the PV, but it is hard to tell whether GRA57 is associated with the intravacuolar network. Colocalization assay or electron microscopy would be necessary to draw such conclusions.
      • 'uprt locus'. Lower case letters and italic are generally preferred to designate mutants, whereas upper case letters are generally used for wild type alleles. (Sibley et al., Parasitology Today, 1991. Proposal for a uniform genetic nomenclature in Toxoplasma gondii).
      • The authors mentioned in the introduction that ROP1 contributes to T. gondii resistance to IFNγ in murine and human macrophages. However, they did not comment on whether ROP1 was found important in the screen performed here in human HFF cells. It may be useful to reference ROP1 in Figure 1 as GRA15, GRA25, etc.
      • Figure 2D. The authors compared the restriction effect of IFNγ on parasites grown in HFF and MEF host cells. However, as represented - % + IFNγ/- IFNγ - it cannot be estimated whether the parasites grew similarly in the two host cell types in the absence of IFN. Please indicate whether or not the growth was similar in both cell types.
      • pUPRT plasmid. Any reference or vector map would be appreciated.
      • Page 9, figure 3A, mass spectrometry analysis. I did not find the MS data in supplementals. Were the data deposited in on PRIDE database or another data repository?
      • Figures 3E and 3F. It might be worth mentioning, at least in the figure legend, that GRA3 localizes at PV membrane and is exposed to the host cell cytoplasm (to mediate interactions with host Golgi). The signal for GRA3 following saponin treatment is here an excellent control that should be highlighted, indicating that saponin effectively permeabilized the host cell membrane.
      • Page 11, section title. I think that the authors meant 'GRA57, GRA70 and GRA71 confer resistance to vacuole clearance in IFNγ-activated HFFs.'
      • Page 11, in the result section comparing the effect of GRA57 mutant with MYR component KO, the authors are referring to host pathways that are counteracted by MYR-dependent effectors released into the host cell. It is not clear which pathways the authors are referring to.
      • Page 16, discussion, end of 4th paragraph. '... to promote parasite survival in IFNγ activated cells' sounds better.
      • Page 22-23, Methods section, c-Myc nuclear translocation assays and elsewhere. Please indicate how many events were actually analyzed. For example, in this assay, to determine the median nuclear c-Myc signal, how many infected cells were analyzed for each biological replicate?

      Referees cross-commenting

      Overall, I agree with most of the co-reviewers' remarks. I agree with reviewer #2 that this manuscript reports interesting data for the field of parasitology, but that the broad interest for immunologists is somewhat limited by the lack of a description of the mechanism by which these effectors oppose IFNgamma-inducible cell-autonomous defenses. I also agree with the other reviewers' comments regarding the GRA57, 70, and 71 heterotrimeric complex, which would require further description. In its present form, the manuscript undoubtedly represents an interesting starting point for further investigations and any additional data regarding the mode of interaction of the identified effectors and their function related or not to ubiquitylation would bring a significant added value.

      Significance

      Despite the fact that humans are accidental intermediate hosts for Toxoplasma gondii, the parasite may develop a persistent infection, demonstrating that it has effectively avoided host defenses. While Toxoplasma gondii has been extensively studied in mice, much less is known about the mechanisms by which the parasite establishes a chronic infection in humans. In this context, this article described very interesting data about the way this parasite counteracts human cell-autonomous innate immune system. This is a fascinating and important topic lying at the interface between parasitology and immunology. Indeed, the highly specialized secretory organelles characteristics of apicomplexan parasites are key to govern host-cell and parasite interactions ranging from host cell transcriptome modification to counteracting immune defense mechanisms. Overall, this article presents a significant contribution to the field of parasitology by identifying novel players involved in Toxoplasma gondii's evasion of human cell-autonomous immunity. Most conclusions are generally well supported by cutting-edge approaches and state of the art methods. Despite being a highly competitive field, this article stands out as the first screen designed specifically to identify virulence factors for human cells and extends our understanding of the secreted dense granule proteins resident of the parasitophorous vacuole. Importantly, the authors provide evidence that these players are active in different strain backgrounds and act in a way that is independent of the export machinery in charge of delivering effector proteins directly into the host cell. However, substantial further research is needed to fully understand the mechanism by which these novel players confer resistance to the parasite in IFNγ activated human cells and how their mode of action differs from that mediated by the translocation machinery (MYR complex). As a microbiologist and biochemist, I find this work of a particular interest to a broad audience, especially to parasitologists and immunologists, as it may unveil unexpected aspects of human innate immunity involved in parasite clearance with proteins unique to Apicomplexa phylum.

  2. Mar 2023
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to reviewers

      We thank all reviewers for their comments and suggestions. In line, below, are our responses, marked in Bold. Textural changes in the manuscript are also marked in Bold.

      Reviewer #1__ (__Evidence, reproducibility and clarity (Required)):

      **Summary:**

      Anuculeate red blood cell (RBC) is one of the interesting biological models that indicate the presence of eukaryotic circadian system independent of transcription-translation feedback. In this manuscript, the authors set up a new method for quantifying the circadian rhythmicity in RBC. The method called "Bloody Blotting" was developed through the careful and insightful investigation of "non-specific band" observed in the western blotting of peroxiredoxin, which has been used for the circadian monitoring of RBC. The authors characterized that the "non-specific' circadian-fluctuating signals, which can be observed by ECL imaging without any antibodies(-HRP), were attributed to ferrous-haem, but not ferric-haem, cross-linked to Hb upon cell lysis. Through the Bloody Blotting, this study suggests that the circadian fluctuation of ferrous-/ferric-haem exist in human and mouse RBC, and the period of rhythmicity is not affected by the canonical clock genes.

      **Major comments:**

      1)Although the authors conducted a careful biochemical evaluation of the "Bloody Blotting" signal, it is still unclear whether the changes in the Hb* (or Hb2*) signal corresponds to the changes in the ferrous-haem level in vivo. A direct perturbation on the level of in vivo ferrous-/ferric-haem is required. For example, is the Hb* (or Hb2*) signal decreased by the administration of amyl nitrite (in mice)?

      __Thank you for the suggestion. We have addressed this and the second reviewer’s comment in a new Figures 4 & S4 and section titled “Effect of rhythms in metHb on vascular flow and body temperature”. __

      For clarity, we have relabelled the schematic in A to “rest phase” and “activity phase” to consolidate data from humans and mice which both feature in the manuscript. We performed two experiments to test the model in Fig 4A and perturb metHb in vivo. The first is a direct perturbation of metHb levels in vivo with sodium nitrite, an oxidising agent that causes methaemoglobinemia. Reflecting our results ex vivo, RBC from differentially entrained mice sampled at the same external time, but 12h apart in terms of the light:dark cycle, contained significantly different metHb levels, with more metHb in the rest phase (revised Figure 4B, C). Whereas, RBCs from mice also given nitrite in their active phase contained more metHb (and thus lower Hb2* activity) than control (revised Figure 4B and S4). The second experiment tests the effect of sodium nitrite on core body temperature. Our hypothesis predicts that nitrite should accentuate the daytime drop in core body temperature, via the increased metHb-mediated production of NO to stimulate increased vasodilation (Ignacio et al 1981 and Cosby et al 2003). Revised figures 4D and E show that the effect of nitrite on body temperature (which has a large active vs inactive difference) is indeed daytime-specific.

      Methods for these experiments have been added to Experimental Procedures.

      2)The authors speculated that the higher PRX-SO2/3 signal during the first 24 hrs in mice is due to the sapling time at the resting phase (line ~235). The effect of sampling time should be easily tested by maintaining the mice group in 12-hr shifted L/D cycles and sampling the blood in the same o'clock (i.e., now the active phase). This type of experiment is also critical for the evaluation of Bloody Blotting because the level of Hb*/Hb2* signals may be affected by not only the circadian timing of mice but also the daily environmental fluctuation of a biochemistry laboratory (this is particularly important for the Bloody Blotting because some of the critical steps including the cross-linking between haem and Hb are supposed to occur in a test tube). If the signal of Bloody Blotting reflects the in vivo circadian rhythmicity, the 12-hr shifted L/D mice RBCs should have 12-hr shifted Bloody Blotting fluctuation pattern.

      __We acknowledge this possibility. To test this, we sampled RBCs from mice kept under DL and LD conditions, as detailed in the new sections in the Experimental Procedures, harvesting blood at the same clock time. This gave us blood from mice in the “active” phase and “rest” phase – labels as per Figure 4B. Figure 4B shows that Hb2* signal significantly differs between mice in active and rest phases, even though these samples were collected and processed at the same external time. __

      Separately from Hb2* activity, upon further reading of the literature we suspect that the higher PRX-SO2/3 signal detected in mouse RBCs (Fig 2) compared with human may be due to blood acidification during animal sacrifice by CO2. Additional text has been added to Supplementary Figure S3 to remark upon this, as follows:

      "Interestingly, compared with human RBC time courses (Henslee et al., 2017; O’Neill and Reddy, 2011), we observed that murine PRX-SO2/3 immunoreactivity was extremely high during the first 24 hours of each 72-hour time course (Figure S3A). We attribute this to the different conditions under which blood was collected: blood was collected from mice culled by CO2 asphyxiation during their habitual rest phase by cardiac puncture and exposed immediately to atmospheric oxygen levels, whereas human blood was collected from subjects during their habitual active phase through venous collection into a vacuum-sealed collection vial. Thus, the initial high PRX-SO2/3 signal in mice may be related to CO2-acidification of the blood during culling, which affects PRX-SO2/3 but does not affect Hb oxidation status____."

      3)Do the casein kinase inhibitors (ref: Beale, JBR 2019) affect the period of Bloody Blotting signals?

      We have not experimentally addressed this as we consider it beyond the scope of the current study, which has instead focused on the in vivo relevance of the rhythms in metHb. Nevertheless, given the identical periodicity of PRX rhythms and Hb* rhythms (this paper), and the periodicity of PRX rhythms and rhythms in membrane conductance (Henslee et al, Nat Commun, 2018), we see no reason why the period lengthening of rhythms in membrane conductance reported in Beale et al, JBR, 2019 would not also been seen in PRX or Hb* rhythms.

      **Minor comments:**

      4)The authors quantify the dimer of Hb (Hb2*). This is important information but only explained in the supplementary figure legend. It should be explained in the main text. In addition, it is difficult to evaluate the fluctuation of Hb* (not Hb2*) because, as the authors stated, most of the Hb* signals are saturated. The saturation problem should be easily solved by reducing the sample loading volume. Quantification of Hb* is important at least experiments shown in figure 1A-G because the dimerization of Hb can be also affected by factors other than the in vivo ferrous-/ferric-haem conversion.

      Thank you for pointing this out. Indeed the data throughout the original manuscript is Hb2*. We have brought this explanation into Figure 1 legend and labelled all figures consistently with Hb2*. We include quantification of Hb* and Hb2* of the in vivo metHb perturbation experiment (Figure 4) in the uncropped membranes shown in Supplementary Figure 4. The quantification of Hb* (Supplementary Figure 4D) gives the same result as the quantification of Hb2* (Figure 4B).

      5)In the quantification of Hb2* (Figure 1A, 2E, 3C), were the signals normalized to Total Hb?

      In the quantification of Hb2* throughout, signals were normalised to total protein through coomassie stain, apart from Figure 4B which used SYPRO Ruby. Each figure presents the Hb band of coomassie or SYPRO Ruby for simplicity, but the full gels are included in Supplementary Figures 1, 3 and 4.

      6)The explanation and interpretation of the experiment shown in figure 3D should be more careful. The pulse-oximetry was conducted in normal working day conditions (real world setting) and thus should be affected by environmental and social daily signals.

      __We have changed the section to the following (edits in bold): __

      "Remarkably, in contrast to total Hb (SpHb) that displayed no significant 24h variation, the proportion of metHb (SpMet) in the blood exhibited a striking daily variation that rose during the evening and peaked during the night (Figure 3D). These subjects were in a real-world setting, and thus affected by environmental and social cues from a normal working day. However, the evening rise and night-time peak is consistent with ____the reduction in Hb2* activity at the end of the waking period in laboratory conditions (Figure 3B)____."

      7)Typos at figure indicators in supplementary figure legends. Sup figure 1A legend refers to main figure "2" (should be 1), and figure S3 legend refers to main figure 1 (should be 3).

      Thank you for pointing this out. We have corrected these legends.

      Reviewer #1 (Significance (Required)):

      The detection of circadian oscillation in RBC has been not easy because the experiment requires careful sample preparation and specific antibodies (Milev Methods Enzymol 2016) or a specific instrument for dielectrophesis (Henslee). The Bloody Blotting technic developed in this study will overcome this technical problem because Bloody Blotting does not rely on specific antibody and only requires conventional tools for western blotting. Because circadian biology of RBC is particularly important in the field of circadian research to evaluate the presence of eukaryotic circadian oscillator without transcription-translation feedback loops, this study will be interested a wide community of circadian clock researchers. This reviewer has expertise in the field of circadian genomics, biochemistry, animal experiments in mice as well as human.

      Thank you for taking the time to read and constructively comment on our work

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): **Summary**

      The study aims to provide a new tool for detecting the hemoglobin oxidative status named "Bloody blotting". It is based on redox- sensitive covalent linkage between the haem and the haemoglobin. This linkage is a consequence of an artifactual reaction provoked by the protein extraction, due to the lysis buffer's properties. In addition, using an in vitro (red blood cells) or in vivo (patients' blood) model the authors provide insight in the oscillating nature in the oxygen-carrying and nitrite reductase capacity of the blood, which is unaffected by the mutation of CK1εtau/tau and Fbxl3aafh/fh

      **Major comments:**

      In my honest opinion, the work does not provide interesting addition to what it is known in literature. The conclusions are summarized into a model (Fig.4) t, which is too speculative related to the amount and quality of results showed in the paper.

      __We are disappointed by the reviewer's response. The physiological basis for daily rhythms in body temperature cooling is not currently understood, this work provides a testable basis for understanding it. Whilst we understand that the reviewer might not find immediate value in the biochemical mechanisms that initially informed our investigation, the recent publication of our investigation of human brain temperature rhythms (Rzechorzek et al., Brain, 2022) demonstrates that daily biological temperature rhythms are of broad interest (Altmetric score >2000). Daily temperature rhythms have almost exclusively been assumed to result from daily rhythms in heat production, yet the evidence for a contribution via daily rhythms of cooling is equally strong yet has received scant attention. __

      __The speculative model that the reviewer refers to was a hypothesis that drew together multiple lines of published evidence for future experimental testing, not a conclusion, and was labelled as such in the original manuscript. To accommodate the reviewer's critique, however, we tested the model with new experiments, that are included in the revised Figure 4 and section titled “Effect of rhythms in metHb on vascular flow and body temperature”. __

      For clarity, we have relabelled the schematic in A to “rest phase” and “active phase” to consolidate data from humans and mice which both feature in the manuscript, and described it as a hypothesis to avoid confusion. We performed two experiments to test this model. The first is a direct perturbation of metHb levels in vivo with sodium nitrite, an oxidising agent that causes methaemoglobinemia. RBCs from mice given nitrite in their active phase contain more metHb (and thus lower Hb2* activity) than control (Figure 4B). Reflecting our results ex vivo, RBC from mice sampled 12h apart contain significantly different metHb levels, with more metHB in the rest phase (Figure 4B, C). The second experiment tests the effect of sodium nitrite on core body temperature. Our model predicts that nitrite should further reduce core body temperature in the daytime, via the increased production of metHb (Figure 4C) and vasodilation (Ignacio et al 1981 and Cosby et al 2003). Figure 4D and E show that body temperature (which has a large active vs inactive difference) is further lowered upon nitrite treatment, and that this effect is restricted to the daytime, consistent with our hypothesis.

      __Methods for these experiments have been added to Experimental Procedures. __

      The title is misleading. The authors did not use any mutant for clock factors, but they used a kinase (CK1εtau/tau) and a ubiquitin ligase (Fbxl3aafh/afh) mutant, which are important in the regulation of proteins belonging to the clock machinery.

      We respectfully disagree that the title was misleading. Mice and cultured cells/tissues that are mutant for CK1 and FBXL3 demonstrably show altered clock gene activity (See Godhino et al, Science, 2007, also Meng et al, Neuron, 2008, also Fig 2). Moreover, CK1 and FBXL3 are generally regarded as key components of the circadian clock due to their critical function in the regulation of clock proteins (e.g., Hirano et al, Nat. Struct. Mol. Biol., 2016). Being anucleate, RBCs lack the capacity for changes in clock gene activity and the period of oscillation is not affected by mutations that affect the activity and period of clock gene-oscillations in nucleated cells and whole mice. Since the rhythms of Hb oxidation persist in isolated RBCs, they cannot be dependent on clock gene activity and so must be considered to function independent of clock genes.

      In light of the new data on mouse body temperature presented in revised Fig 4D/E, however, we have changed the title to better communicate the revised scope of the manuscript, as follows:

      "Mechanisms and physiological function of daily haemoglobin oxidation rhythms in red blood cells"

      Speaking of the specific points described in the paper, there are aspects that are not convincing. First, the bloody blotting is a consequence of a specific reagent contained in the lysis buffer used for the protein extraction, which reacts with the haemoglobin beta and alpha (as shown by Mass Spec). The peroxidase reaction is an artifact coming from this reaction, which simply follows the rhythmicity of peroxiding accumulation in the red blood cells, whose rhythmicity is known to be circadian. I do not really understand the utility of this technique, which anyway is limited to the specific lysis buffer, but for scientific reasons, researchers need often a different kind of lysis buffer. This means that the approach shows strong limitation to the chemical environment of the lysis buffer. I do not see in it a useful tool that can replace antibodies.

      Apologies, we have not been clear enough. The bloody blotting is indeed a consequence of lysis, since that lysis condition fixes the cellular state at the time of lysis. In this case, the variation in Hb oxidation status is fixed at the time of lysis. The peroxidase activity we report is indeed revealed on membranes by the covalent interaction of the haem and Hb, which occurs at the point of lysis, and reports the oxidation state of the haem at the point of lysis. As we detail, haem exhibits peroxidase activity, so the signal we observe at molecular weights corresponding to Hb and Hb2 is peroroxidase activity due to covalently bound haem, where the peroxidase activity varies with the oxidation state of the haem. We have reorganised text associated with Figure 1, including changes to the final paragraph of the section to make explicitly clear that that the rhythm is due to a fixing of the redox state of Hb at the time of lysis – that a true underlying rhythm is revealed.

      This technique is indeed limited to the observation of haem-peroxidase activity in RBCs on membranes. But as we explain in the manuscript, this is a far quicker and simpler method of observing RBC circadian rhythms than other methods, including immunoblotting for peroxiredoxins. Furthermore, it is common to change lysis buffer according to the downstream purpose.

      Second, the oscillation in the peroxidase activity of PRX-SO2/3 is well known to be circadian (Edgar et al., 2012. doi:10.1038/nature11088.).

      Many apologies, we do not understand the point. It is indeed correct that PRX-SO2/3 abundance oscillations have been reported in RBCs and other cells and organisms. Here we report another rhythm, separate to PRX: the rhythm in Hb:metHb. The PRX-SO2/3 blots serve as a positive control for rhythmicity.

      Finally the circadian rhythms of red blood cells is already described and the corresponding author already published different papers about. The info provided in this paper do not add any new piece to the puzzle.

      Respectfully, we report a novel rhythm in RBCs and demonstrate its functional relevance in vivo in humans (Figure 3) and mice (Figure 4), i.e., it is the identity of the rhythmic species that is novel, not that there are rhythms. What we further add with this study is that rhythms are not influenced by the cellular/organismal environment during RBC development (Figure 2), occur in vivo, in freely moving people (Figure 3) and metHb has a functionally significant role in body temperature rhythms (Figure 4). Furthermore, we report a novel technique for uncovering this rhythm in RBCs.

      At this stage I do not consider the paper suitable for a publication. Other observations. Authors should describe how cells were synchronized.

      RBCs in vitro were not synchronised by external cues. As reported in the Methods section, they were maintained at constant temperature after isolation. Fibroblasts were synchronised by temperature cycles as detailed and employed previously.

      In experiments performed in vitro should be used the SD instead of the SEM.

      We respectfully disagree. The SEM quantifies how precisely you know the true mean of the population - in each case we use it, we also present replicates’ data from which the mean is calculated (e.g. Fig 1A, Fig 2E, Fig 3B and Fig 4B). This gives the real scatter of the data, as a SD would.

      **Minor comments:**

      There are many English mistakes in the article, also errors in naming figures in the figure legends.

      We have carefully re-examined the manuscript to find and fix these errors.

      Figure 1B needs an appropriate loading control.

      We have added the coomassie loading control to revised Figure 1B, with uncropped membranes shown in revised Supplementary Figure 1B

      In experiments performed in vitro should be used the SD instead of the SEM.

      SD vs SEM, see reply above.

      Reviewer #2 (Significance (Required)):

      Nature and significance of the advance At this stage I do not see any significance or advance in the field.

      Compared to existing published knowledge. The The bloody blotting seems to be an original approach although full of limitation and based on artifactual reactions. PRX-SO2/3 is well known to be circadian (Edgar et al., 2012. doi:10.1038/nature11088.), therefore the paper does not add any new insight. The clock mutation do not affect the circadian rhythm in RBC is also known (O' Neill and Reddy, 2011). Therefore the results showed in the figure 3 support already published observations but do not add any particular insight.

      It is unclear to us how the reviewer has misunderstood the scope and focus of the manuscript to such an extent. All previous work in this area by our own and other labs has been appropriately acknowledged. To reiterate the novel elements of this work:

      - A daily rhythm of Hb redox state in mouse and human red blood cells, in vitro and in vivo. This was speculated about in O'Neill & Reddy (Nature, 2011) but never directly tested until now.

      - That clock gene mutations that post-translationally regulate circadian period in nucleated mammalian cells do not affect circadian period in anucleate mammalian cells. O'Neill & Reddy (Nature, 2011) did not show this, rather we looked at (nucleated) fibroblasts that were deficient for Cry1/2 (a transcriptional repressor).

      - A novel assay for measuring mammalian RBC rhythms - nowhere is it proposed that the assay would be useful in any other context, as the reviewer seems to imply.

      - A mechanistic basis for understanding how daily rhythms in cooling of body temperature might arise, a poorly studied aspect of mammalian physiology.

      __The elements in this work that are not completely novel are included as controls, they are not the focus of the manuscript e.g. PRX-SO2/3 rhythms have not previously been shown under these conditions in mouse RBCs, only human, so these blots are included as a control for rhythmicity in Fig2. Similarly, the period of oscillation of a genetically-encoded Cry1:Luc reporter in mouse fibroblasts would be predicted to be longer and shorter in Fbxl3 and Ck1 mutants, respectively, but nowhere this been published so we have included it as a control. __

      Audience Chronobiologists, and medical science.

      Fild of expertises (reviewer) Chronobiology, molecular biology, medical science.

      **Referees cross-commenting**

      I read your comment and they were very detailed. From my point of view I am very skeptical, as I discussed about the utility of the Bloody Blotting. Also the results showed in the paper are not very innovative fro my point of view. I would like to know what do you think about.

      The rhythmicity is given by the elements present in the protein extraction. The reaction is given by the specific lysis buffer used in that experiment. Using another lysis buffer would not allow anybody to see some signal without a proper antobody. The authors claim that bloody blotting is useful because a researcher does not need to buy an antibody, but what if you don't work with a total total extract of proteins? In that case, you need to change the lysis buffer, and, therefore, the bloody blotting is not useful anymore. However, If you believe in that way, and you are two people agreeing in that, I will not oppose myself although I do not agree.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): **Summary:** Provide a short summary of the findings and key conclusions (including methodology and model system(s) where appropriate).

      The manuscript "Clock gene-independent daily regulation of haemoglobin oxidation in red blood cells" describes a new assay for quantification of haemoglobin oxidation status (bloody blotting) in anucleate red blood cells". This study furthers our understanding of the role of a post-translational oscillator (PTO) in generating circadian rhythms in biology. The authors first describe how earlier work demonstrated 24h rhythms in the intensity of chemiluminescent bands on membranes blotted with protein from red blood cells (RBCs) in the absence of antibodies after exposure to ECL. They go on to address what these bands represent (through various approaches including the use of chemical inhibitors and mass spectrometry) and conclude that they are observing haemoglobin oxidation status. It is proposed that this assay represents a novel manner (complementary to earlier work) in which to report circadian rhythms in RBCs. The manuscript goes on to demonstrate the persistence of 24h rhythms in haemoglobin oxidation status in murine RBCs, including cells isolated from two clock mutant mice. Finally, the study utilises RBCs collected from human volunteers maintained under controlled conditions and demonstrate robust rhythms via "blood blotting", this data is presented alongside pulse co-oximetry data to examine physiological relevance of these rhythms.

      **Major comments:** -Are the key conclusions convincing?

      The key conclusions are well supported by the data. The discussion does become quite speculative, and this needs to be addressed.

      -Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      The discussion around the physiological relevance of daily regulation of haemoglobin redox status is extensive (lines 366-403) as is the discussion on RBCs and the TTFL-less clock mechanisms (lines 405-429). Whilst interesting and well thought out, and well supported by the literature, these sections are very speculative and in my opinion should be toned down.

      Thank you to the reviewer for both the compliment and suggestion. Indeed, these discussion sections were too long. We have reorganised the physiological relevance section to reduce its length and better accommodate the new data presented in the new experiments in Figure 4.

      We have cut the TTFL-less section text by more than half.

      -Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      Further experiments would be required to support the discussion about the role of daily rhythms in haemoglobin oxidation status in regulating oxygen carrying capacity of the blood, vascular tone, body temperature and sleep-wake cycle. As the authors state, these experiments are beyond the scope of this study, but are of course of major interest. It would be more appropriate to limit the discussion to what has been demonstrated directly by the data presented, with just a few sentences speculating on physiological relevance.

      __As above, we acknowledge that we were speculative in that section and we have curtailed the discussion as suggested. __

      -Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      If the focus of the discussion is shifted as suggested, there is no need to pursue any further experiments. -Are the data and the methods presented in such a way that they can be reproduced? Yes. The methods are complete, and data presented very well. -Are the experiments adequately replicated and statistical analysis adequate?

      Yes

      **Minor comments:**

      -Specific experimental issues that are easily addressable.

      1.In the murine fibroblasts/RBC experiments in Figure 2 - what genotype were the wildtype controls? The main text suggests PER2::luc (line 226) but methods suggest Cry1:luc - could the authors clarify this?

      __Thank you for pointing out this mistake, corrected text to Cry1:luciferase __

      2.In figure 2B and 2D the blots show two samples for each time point (except for 72h where there is just one) are these technical repeats? This should be clarified.

      Apologies, the labelling of this figure was not clear – for space reasons we only labelled every 2nd timepoint – the time course was 3-hourly. We have corrected the figure to label each timepoint.

      3.The controls for the bloody blots are referred to as coomassie in Figure 1. In Figure 2, the controls for PRX-SO2/3 are referred to as "loading" but are coomassie stained gels - could this be standardised? Also Figure 2D - no controls? In Figure 3B controls are referred to as 'Total Hb from coomassie staining - I wasn't clear what this was.

      Thank you. Throughout we have now labelled loading controls by their method (coomassie or SYPRO Ruby). Figure 2D is taken from the same gel as Figure 2B and so the same coomassie gel stain is used as a loading control. We have altered the figure legend to reflect this. Each figure presents the Hb band of coomassie or SYPRO Ruby for simplicity, but the full gels are included in Supplemetary Figures 1, 3 and 4. We have changed each figure legend to reflect: “coomassie stained gels were used as loading controls; the Hb band from the coomassie stained gel is shown”.

      4.Figure 3A "S1" and "S2" stated in legend but only "S" used in the schematic

      Many thanks for pointing this out. We have corrected the schematic to S1 and S2.

      -Are prior studies referenced appropriately? Yes absolutely. -Are the text and figures clear and accurate? Mostly, few comments above.

      -Do you have suggestions that would help the authors improve the presentation of their data and conclusions? No

      Reviewer #3 (Significance (Required)): -Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      The study describes a rapid and relatively simple assay for observing 24h rhythms in RBC function. On a technical basis - this will likely be of significant use to others in the field. Further work examining rhythms in haemoglobin oxidation in RBCs in clock mutant mice confirms independence from the transcriptional-translational feedback loop, which further supports earlier work in this field. Finally, studies in humans (bloody blotting in combination with pulse co-oximetry) provide a glimpse into the functional relevance of these daily oscillations

      -Place the work in the context of the existing literature (provide references, where appropriate).

      The authors have done an excellent job of reviewing the literature in the field and contextualising their data. This current data is a significant advance in the field.

      -State what audience might be interested in and influenced by the reported findings.

      This work will be of interest to circadian biologists and adds weight to the relatively new concept of a post-translational oscillator (PTO). Further work showing the relevance of this PTO on physiological function will be of great interest.

      -Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Circadian, Clock genes, mouse models,

      I do not have a background in biochemistry and do not feel overly qualified to comment constructively on approaches taken to address what is driving the observed rhythmic peroxidase activity in RBCs (e.g NiNTA affinity chromatography, use of reductants to reduce thioester bonds and use of NEM to alkylate Hb cysteine residues).

      **Referees cross-commenting**

      In terms of the utility, as my review indicated, I do feel that this manuscript advances the field, providing a rapid and relatively simple way to measure rhythms in RBCs. Reviewer 1 explained this nicely in their significance summary.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      Provide a short summary of the findings and key conclusions (including methodology and model system(s) where appropriate).

      The manuscript "Clock gene-independent daily regulation of haemoglobin oxidation in red blood cells" describes a new assay for quantification of haemoglobin oxidation status (bloody blotting) in anucleate red blood cells". This study furthers our understanding of the role of a post-translational oscillator (PTO) in generating circadian rhythms in biology. The authors first describe how earlier work demonstrated 24h rhythms in the intensity of chemiluminescent bands on membranes blotted with protein from red blood cells (RBCs) in the absence of antibodies after exposure to ECL. They go on to address what these bands represent (through various approaches including the use of chemical inhibitors and mass spectrometry) and conclude that they are observing haemoglobin oxidation status. It is proposed that this assay represents a novel manner (complementary to earlier work) in which to report circadian rhythms in RBCs. The manuscript goes on to demonstrate the persistence of 24h rhythms in haemoglobin oxidation status in murine RBCs, including cells isolated from two clock mutant mice. Finally, the study utilises RBCs collected from human volunteers maintained under controlled conditions and demonstrate robust rhythms via "blood blotting", this data is presented alongside pulse co-oximetry data to examine physiological relevance of these rhythms.

      Major comments:

      • Are the key conclusions convincing?

      The key conclusions are well supported by the data. The discussion does become quite speculative, and this needs to be addressed.

      • Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      The discussion around the physiological relevance of daily regulation of haemoglobin redox status is extensive (lines 366-403) as is the discussion on RBCs and the TTFL-less clock mechanisms (lines 405-429). Whilst interesting and well thought out, and well supported by the literature, these sections are very speculative and in my opinion should be toned down.

      • Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      Further experiments would be required to support the discussion about the role of daily rhythms in haemoglobin oxidation status in regulating oxygen carrying capacity of the blood, vascular tone, body temperature and sleep-wake cycle. As the authors state, these experiments are beyond the scope of this study, but are of course of major interest. It would be more appropriate to limit the discussion to what has been demonstrated directly by the data presented, with just a few sentences speculating on physiological relevance.

      • Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      If the focus of the discussion is shifted as suggested, there is no need to pursue any further experiments.

      • Are the data and the methods presented in such a way that they can be reproduced?

      Yes. The methods are complete, and data presented very well.

      • Are the experiments adequately replicated and statistical analysis adequate?

      Yes

      Minor comments:

      • Specific experimental issues that are easily addressable.

      1.In the murine fibroblasts/RBC experiments in Figure 2 - what genotype were the wildtype controls? The main text suggests PER2::luc (line 226) but methods suggest Cry1:luc - could the authors clarify this?

      2.In figure 2B and 2D the blots show two samples for each time point (except for 72h where there is just one) are these technical repeats? This should be clarified.

      3.The controls for the bloody blots are referred to as Coomassie in Figure 1. In Figure 2, the controls for PRX-SO2/3 are referred to as "loading" but are Coomassie stained gels - could this be standardised? Also Figure 2D - no controls? In Figure 3B controls are referred to as 'Total Hb from Coomassie staining - I wasn't clear what this was.

      4.Figure 3A "S1" and "S2" stated in legend but only "S" used in the schematic

      • Are prior studies referenced appropriately?

      Yes absolutely.

      • Are the text and figures clear and accurate?

      Mostly, few comments above.

      • Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      No

      Significance

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      The study describes a rapid and relatively simple assay for observing 24h rhythms in RBC function. On a technical basis - this will likely be of significant use to others in the field. Further work examining rhythms in haemoglobin oxidation in RBCs in clock mutant mice confirms independence from the transcriptional-translational feedback loop, which further supports earlier work in this field. Finally, studies in humans (bloody blotting in combination with pulse co-oximetry) provide a glimpse into the functional relevance of these daily oscillations

      • Place the work in the context of the existing literature (provide references, where appropriate).

      The authors have done an excellent job of reviewing the literature in the field and contextualising their data. This current data is a significant advance in the field.

      • State what audience might be interested in and influenced by the reported findings.

      This work will be of interest to circadian biologists and adds weight to the relatively new concept of a post-translational oscillator (PTO). Further work showing the relevance of this PTO on physiological function will be of great interest.

      • Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Circadian, Clock genes, mouse models,

      I do not have a background in biochemistry and do not feel overly qualified to comment constructively on approaches taken to address what is driving the observed rhythmic peroxidase activity in RBCs (e.g NiNTA affinity chromatography, use of reductants to reduce thioester bonds and use of NEM to alkylate Hb cysteine residues).

      Referees cross-commenting

      In terms of the utility, as my review indicated, I do feel that this manuscript advances the field, providing a rapid and relatively simple way to measure rhythms in RBCs. Reviewer 1 explained this nicely in their significance summary.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      The study aims to provide a new tool for detecting the hemoglobin oxidative status named "Bloody blotting". It is based on redox-sensitive covalent linkage between the haem and the haemoglobin. This linkage is a consequence of an artifactual reaction provoked by the protein extraction, due to the lysis buffer's properties. In addition, using an in vitro (red blood cells) or in vivo (patients' blood) model the authors provide insight in the oscillating nature in the oxygen-carrying and nitrite reductase capacity of the blood, which is unaffected by the mutation of CK1εtau/tau and Fbxl3aafh/fh

      Major comments:

      In my honest opinion, the work does not provide interesting addition to what it is known in literature. The conclusions are summarized into a model (Fig.4) t, which is too speculative related to the amount and quality of results showed in the paper. The title is misleading. The authors did not use any mutant for clock factors, but they used a kinase (CK1εtau/tau) and a ubiquitin ligase (Fbxl3aafh/afh) mutant, which are important in the regulation of proteins belonging to the clock machinery.

      Speaking of the specific points described in the paper, there are aspects that are not convincing. First, the bloody blotting is a consequence of a specific reagent contained in the lysis buffer used for the protein extraction, which reacts with the haemoglobin beta and alpha (as shown by Mass Spec). The peroxidase reaction is an artifact coming from this reaction, which simply follows the rhythmicity of peroxiding accumulation in the red blood cells, whose rhythmicity is known to be circadian. I do not really understand the utility of this technique, which anyway is limited to the specific lysis buffer, but for scientific reasons, researchers need often a different kind of lysis buffer. This means that the approach shows strong limitation to the chemical environment of the lysis buffer. I do not see in it a useful tool that can replace antibodies.

      Second, the oscillation in the peroxidase activity of PRX-SO2/3 is well known to be circadian (Edgar et al., 2012. doi:10.1038/nature11088.). Finally the circadian rhythms of red blood cells is already described and the corresponding author already published different papers about. The info provided in this paper do not add any new piece to the puzzle.

      At this stage I do not consider the paper suitable for a publication. Other observations. Authors should describe how cells were synchronized. In experiments performed in vitro should be used the SD instead of the SEM.

      Minor comments:

      There are many English mistakes in the article, also errors in naming figures in the figure legends. Figure 1B needs an appropriate loading control. In experiments performed in vitro should be used the SD instead of the SEM.

      Significance

      Nature and significance of the advance At this stage I do not see any significance or advance in the field.

      Compared to existing published knowledge. The The bloody blotting seems to be an original approach although full of limitation and based on artifactual reactions. PRX-SO2/3 is well known to be circadian (Edgar et al., 2012. doi:10.1038/nature11088.), therefore the paper does not add any new insight. The clock mutation do not affect the circadian rhythm in RBC is also known (O' Neill and Reddy, 2011). Therefore the results showed in the figure 3 support already published observations but do not add any particular insight.

      Audience Chronobiologists, and medical science.

      Fild of expertises (reviewer) Chronobiology, molecular biology, medical science.

      Referees cross-commenting

      I read your comment and they were very detailed. From my point of view I am very skeptical, as I discussed about the utility of the Bloody Blotting. Also the results showed in the paper are not very innovative fro my point of view. I would like to know what do you think about.

      The rhythmicity is given by the elements present in the protein extraction. The reaction is given by the specific lysis buffer used in that experiment. Using another lysis buffer would not allow anybody to see some signal without a proper antobody. The authors claim that bloody blotting is useful because a researcher does not need to buy an antibody, but what if you don't work with a total extract of proteins? In that case, you need to change the lysis buffer, and, therefore, the bloody blotting is not useful anymore. However, If you believe in that way, and you are two people agreeing in that, I will not oppose myself although I do not agree.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Anuculeate red blood cell (RBC) is one of the interesting biological models that indicate the presence of eukaryotic circadian system independent of transcription-translation feedback. In this manuscript, the authors set up a new method for quantifying the circadian rhythmicity in RBC. The method called "Bloody Blotting" was developed through the careful and insightful investigation of "non-specific band" observed in the western blotting of peroxiredoxin, which has been used for the circadian monitoring of RBC. The authors characterized that the "non-specific' circadian-fluctuating signals, which can be observed by ECL imaging without any antibodies(-HRP), were attributed to ferrous-haem, but not ferric-haem, cross-linked to Hb upon cell lysis. Through the Bloody Blotting, this study suggests that the circadian fluctuation of ferrous-/ferric-haem exist in human and mouse RBC, and the period of rhythmicity is not affected by the canonical clock genes.

      Major comments:

      1. Although the authors conducted a careful biochemical evaluation of the "Bloody Blotting" signal, it is still unclear whether the changes in the Hb (or Hb2) signal corresponds to the changes in the ferrous-haem level in vivo. A direct perturbation on the level of in vivo ferrous-/ferric-haem is required. For example, is the Hb (or Hb2) signal decreased by the administration of amyl nitrite (in mice)?
      2. The authors speculated that the higher PRX-SO2/3 signal during the first 24 hrs in mice is due to the sapling time at the resting phase (line ~235). The effect of sampling time should be easily tested by maintaining the mice group in 12-hr shifted L/D cycles and sampling the blood in the same o'clock (i.e., now the active phase). This type of experiment is also critical for the evaluation of Bloody Blotting because the level of Hb/Hb2 signals may be affected by not only the circadian timing of mice but also the daily environmental fluctuation of a biochemistry laboratory (this is particularly important for the Bloody Blotting because some of the critical steps including the cross-linking between haem and Hb are supposed to occur in a test tube). If the signal of Bloody Blotting reflects the in vivo circadian rhythmicity, the 12-hr shifted L/D mice RBCs should have 12-hr shifted Bloody Blotting fluctuation pattern.
      3. Do the casein kinase inhibitors (ref: Beale, JBR 2019) affect the period of Bloody Blotting signals?

      Minor comments:

      1. The authors quantify the dimer of Hb (Hb2). This is important information but only explained in the supplementary figure legend. It should be explained in the main text. In addition, it is difficult to evaluate the fluctuation of Hb (not Hb2) because, as the authors stated, most of the Hb signals are saturated. The saturation problem should be easily solved by reducing the sample loading volume. Quantification of Hb* is important at least experiments shown in figure 1A-G because the dimerization of Hb can be also affected by factors other than the in vivo ferrous-/ferric-haem conversion.
      2. In the quantification of Hb2* (Figure 1A, 2E, 3C), were the signals normalized to Total Hb?
      3. The explanation and interpretation of the experiment shown in figure 3D should be more careful. The pulse-oximetry was conducted in normal working day conditions (real world setting) and thus should be affected by environmental and social daily signals.
      4. Typos at figure indicators in supplementary figure legends. Sup figure 1A legend refers to main figure "2" (should be 1), and figure S3 legend refers to main figure 1 (should be 3).

      Significance

      The detection of circadian oscillation in RBC has been not easy because the experiment requires careful sample preparation and specific antibodies (Milev Methods Enzymol 2016) or a specific instrument for dielectrophesis (Henslee). The Bloody Blotting technic developed in this study will overcome this technical problem because Bloody Blotting does not rely on specific antibody and only requires conventional tools for western blotting. Because circadian biology of RBC is particularly important in the field of circadian research to evaluate the presence of eukaryotic circadian oscillator without transcription-translation feedback loops, this study will be interested a wide community of circadian clock researchers.

      This reviewer has expertise in the field of circadian genomics, biochemistry, animal experiments in mice as well as human.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC- 2023-01819

      Corresponding author(s): Gernot Längst and Harald Wodrich

      Full revision of the manuscript

      1. General Statements [optional]

      This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

      2. Point-by-point description of the revisions

      Dear Reviewers, thank you very much for your appreciation of our study and your input. In this point-to-point response, we amended our text marked in blue colour.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The authors have addressed the nucleoprotein structure of human adenovirus during the very early stages of infection, and its relationship to onset of expression of viral genes, using a combination of RNA-seq, MNase-seq, ChIP-seq and single genome imaging. They show that in the virion and the newly-infecting DNA, protein VII is precisely position at specific sites on the viral DNA, with greater accessibility at early gene promoters compared to other regions. Nucleosomes containing H3.3 replace specific protein VII at distinct positions at the transcription start sites of genes, which are then acetylated. Association with histones and nucleosomes occurs prior to transcription. These studies confirm and greatly expand on results already in the literature, and also elucidate a novel role for protein VII in orchestrating positioning of nucleosomes prior to initiation of transcription.

      The authors provide excellent data in support of their conclusions and, in many instances, use alternative experiments (i.e. two different approaches) to support their claims. The details of methods are adequate (with small exceptions outlined below) and statistical methods appropriate.

      Minor comments:

      Line 561 "Protein VII molecules were exchanged for positioned nucleosomes at the +1 site of actively transcribed genes". This statement seems to suggest that the +1 position almost acts as a nucleating site, where replacement of a single, specific protein VII molecule at +1 is an initiating event, which then spreads from that site and into the rest of the gene. Data shown in Figure 6G and 6H shows that H3.3 appears to be found equally along the full length of E1A as early as 1 hr post infection (with no real "enhancement" at the +1 position), and that the overall levels simply increase over the next 4 hrs.

      As the reviewer pointed out, the histone ChIP-seq peaks are broader than the +1 nucleosome region, extending into the transcribed regions of the gene. This is expected, as the mean length of the immunoprecipitated DNA is about 400bp long. Still, ChIP-seq peaks are in proximity to the transcription start site and overlap with the position of the +1 nucleosome. As we do not have the required resolution, we toned done our statement. The text now reads as follows: “Protein VII molecules were exchanged for nucleosomes downstream of the transcription start site, overlapping the +1 nucleosome site, of actively transcribed genes“ (line 568 ff).

      Curiously, the authors chose not to use a wildtype virus for their studies - the virus contains a deletion in the E3 region. For clarity, I suggest that the authors should preferentially use an alternative designation for their virus rather than HAd-C5. Perhaps HAd-C5delE3 to differentiate this work from studies that truly use wildtype virus.

      As requested by the reviewer we have updated the nomenclature to HAd-C5dE3 throughout the text and the figures.

      The obvious limitation of the studies using the fluorescent TAF1-beta to label Ad genomes is that as protein VII is replaced by nucleosomes, the genomes would have declining detection by this method. Genomes devoid of protein VII would be "invisible".

      Our MNase data show that within the first 4h only a fraction of pVII is removed from the viral genome e.g. at early genes, while most of the genome remains bound by protein VII. This should provide enough binding sites for TAF1-beta to label Ad genomes without a significant drop in the signal. Furthermore, our recent work (PMID:29997215, Fig. 1D) compared the TAF1-beta labelling system with a second in vivo detection system (AnchOR3) that directly labels the viral DNA independently of protein VII in the same cells. This direct comparison of two technically non-related methods to detect individual incoming adenoviral genomes in living cells showed the equivalence of both methods, at least for the first hours of infection showing that partial removal of protein VII does not affect the fluorescent TAF1-beta staining.

      Line 275 "Interestingly, a central region of the viral genome (Late3) and a region between the E3 and E4 genes exhibited almost no peaks" for protein VII. The virus utilized in this study lacked at least part of the E3 region. Did this deletion "cause" this region to be devoid of protein VII? Is the same absence of protein VII peaks observed in a fully wildtype virus? Also, can the authors provide any speculation as to why the Late3 region also lacks protein VII?

      We confirm the reviewer's observation. The region marked as Late3 and the region between E3 and E4 is present in the genome and is, as the reviewer observed, not chromatinized in our analysis. At this point, we can only speculate. We have two not mutually exclusive hypotheses. First, both regions could be involved in the proper packaging of the viral genome into the capsid. Physical constraints during packaging may preclude this region from being packaged into pVII. Second, as we observed that pVII positioning correlates with distinct DNA sequence patterns (revised Fig.4 D and E, see response to reviewer 3 for details), it might be that the sequence composition at the pVII depleted regions disfavour pVII assembly to keep those regions available for cellular factors that drive processes post genome delivery, such as transcription. Our time-resolved MNase analysis shows that indeed post genome delivery, this site in the Late3 region becomes protected (Fig. 5C), suggesting the binding of one or more cellular factors. As shown in Figure S6 we find conserved binding sites for several transcription factors at this MNase protected site.

      Whether the chromatinization devoid regions would shift in position, remain in place or be chromatinized in a wildtype virus has to be addressed in the future and cannot be answered at this point. To address the comment, we have expanded the discussion (line 620 ff)

      Line 569 "Reasons could be that the few genomes undergoing nucleosome assembly and active transcription produce the replication enzymes, whereas the bulk of genomes enters replication without activation as an elegant way to avoid repeated chromatinization." This argument may make sense in the context of a high MOI infection, but would certainly limit virus function during normal, pathogenic infection where the MOI is likely extremely low. Essentially, the authors data predicts that 80% of normal, low MOI infections don't progress to gene expression (at least during the first 4 hrs analyzed in this study).

      We follow the argument of the reviewer. The high MOI in our study was necessary to perform the combined ‘omics’ approach to arrive at meaningful data within reasonable sequencing depth. To have equivalence we also used high MOI for the imaging approach. A detailed analysis for the effect of low MOI as well as positioning effects (see reviewer comment below) on transcriptional activation is an important question and will be addressed in future studies that require different techniques in addition. To address this comment, we have updated the discussion to emphasize the importance of MOI and positioning effects (line 587 ff).

      Line 576 "This observation is in agreement with recent pVII-ChIP experiments showing transcription and replication independent pVII removal in early infection (Giberson et al., 2018; Komatsu and Nagata, 2012; Komatsu et al., 2011)." The authors can also state that histone and nucleosome deposition is also independent of transcription and replication, as has been alluded to in the same cited studies but proven more directly in this study.

      We have changed the text accordingly (line 576 and 598).

      Line 672 - the authors should be more definitive in the MOI that are used in all of their experiments. Line 672 states that an MOI of 3000 physical particles are applied per cell. There can be great variation between cell lines in how much virus binds to (and enters) a cell based on the surface levels of Ad receptors on different cell types. However, in general, 3000 is very high. Work by Wang et al. (PMID:24139403) showed that at an MOI of 200 or below most Ad will traffic correctly to the nucleus, whereas at an MOI above 200 there is a significant defect in Ad trafficking within the cell. How is this expected to affect all of the results in this study?

      We agree with this and the other reviewer that this is an important issue. The actual dose of virus that enters a given cell is dependent on the concentration of virus particles in the inoculum and the time and temperature this inoculum is in contact with the cells and the cells respective susceptibility to the virus. We applied an infection dose of 3000 physical particles per cell in a defined volume (1ml) at 37˚C for 30min followed by inoculum removal. We prefer this description because with these infection conditions, we find on average well below 100 virus particles that enter the cell (=> This is e.g., reflected in the number of accumulating genomes shown in figure 2A). In contrast, this permits to have enough viruses inside the cell to perform the different “omics” techniques applied in our study to obtain meaningful results at reasonable sequencing depths. This experimental setting was carefully chosen in full awareness of the work by Wang et al., cited by the reviewer, to avoid e.g., overloading the nuclear import rate. Thus, our experimental conditions do not exceed the “MOI of >200” that would affect nuclear import rates. The number (>200) in the Wang et al. study refers to the number of virus particles inside the cell, the infection condition used in the Wang study was an MOI of 30 bound to Hela cells in the cold for 30min and warmed for 150min which is significantly more virus than we have used in our study. We have expanded the information on the MOI used in the material and methods section to clarify this point (line 685 ff).

      Figure 5 is of low resolution and was difficult to read.

      We thank the reviewer for spotting it. It seems that the Figure quality was compromised during the PDF conversion. We updated the Figures and checked the resolution after PDF conversion.

      Figure S3 is missing a box from the top set of images indicating the region that is expanded in the detail picture.

      We updated Figure S3

      While I realize it is supplemental data, the difference in quality between the agarose gels shown in Figure S4A and S5A is shocking.

      The nature of the experiments is very different and therefore the expected MNase digestion profiles on agarose gels look different. In Figure S5 viral particles were digested with MNase, resulting in a smeary decrease in DNA size. This looks very different from the regular MNase pattern of whole cells that is dominated by the regularly spaced nucleosomes in the heterochromatic regions of the genome. As pVII protects only about 70bp of DNA and its spacing is not as homogenous as the nucleosomal spacing, the pictures shown in Figure S5A were expected as they are.

      Figure S7 is of low resolution.

      We updated the Figures and checked the resolution after PDF conversion.

      Reviewer #1 (Significance (Required)):

      At least in the field of adenovirus research, this is a very important study. There has been considerable debate in the field regarding the timing and degree of protein VII removal and histone deposition, and the necessity of active transcription for these two events. The data provided in this manuscript clearly shows that some protein VII is removed from early active genes and replaced by nucleosomes, and that these events occur prior to initiation of transcription. The authors speculate that the specific placement of protein VII, a protamine-like protein, on the Ad genome prescribes where nucleosomes are placed. This finding should be of interest to a broad general audience, as it provides novel information on chromatin assembly within mammalian cell. Key words for this reviewer: adenovirus research, HAdV nucleoprotein structure

      Reviewer #2 (Evidence, reproducibility and clarity (Required))

      The submitted manuscript presents a detailed and comprehensive analysis of the adenoviral nucleoprotein complexes as infection progresses, starting with the "adenosome" assembled with pVII which are then progressively replaced with H3.3.-containing nucleosomes as the infection progresses. The submission presents a combination of in situ and populational analyses of the viral DNA accessibility and complexes through infection. I brief, the infecting viral genomes are assembled in some 250 adenosomes with pVII, which become progressively replaced as infection progresses with nucleosomes containing H3.3 and acetylated H3K17, starting at the active promoters of the E genes. Chromatin remodeling precedes transcription, and the accessibility differs for genes of different kinetic classes at differ times after infection, although there is no correlation between accessibility and H3.3. or acetylation content. Only about 20% of the genomes become transcriptionally active, though, which somewhat complicates the analyses of the populational studies of accessibility and occupancy. Overall, the study is well conceived, performed and presented. A few issues that deserve further analyses and discussion, as described below.

      Major issues.

      As figure 2 nicely shows, only about 20% of the intranuclear genomes become transcriptionally active. However, MNase and ChIP analyses cannot differentiate these genomes from the 80% that are transcriptionally inactive. The interpretation of the positioning of pVII (figure 4) or the changes in compaction of the adenoviral chromatin at different loci (figure 5) does not appear to consider this heterogeneity other than for a brief comment about the stringent MNase digestion in page 11. The authors favor a model in which the changes in compaction shown in figure 5, at mild MNase digestions, directly correlate with transcription of the respective genes. This could well be correct, and in fact the correlation may be underestimated as 80% of the genomes may not undergo any changes, but it may also be incorrect. The analyses presented cannot differentiate whether the changes in chromatin compaction occur in only a subset of genomes or in all the genomes, regardless of whether they are transcribed or not, or even only in the non-transcribed genomes (which appears extremely unlikely). This intrinsic limitation to the methods used (and I know of no better alternative) should be acknowledged and discussed for the benefit of the reader. This limitation also impacts the analyses of the lack of correlation between H3.3 and acetylated H3K27 occupancy and compaction.

      A discussion is amended and located starting from line 571 in the text. “The heterogeneity of 80% inactive genomes and 20% activated genomes complicates the analysis of the MNase-seq data. High MNase concentrations do not differentiate between both states, and we suggest that low MNase conditions capture the dynamic viral proportion, changing and preparing its genome for gene activation. The data nicely suggest such a scenario, but there is the caveat that we catch an effect of the mixed population that we cannot differentiate.”

      The analysis of the histone ChIP is discussed below.

      Perhaps out of necessity to reach the required sensitivity, a high multiplicity of infection was used (although the actual moi is not stated, there are about 25-30 pVII foci/ per nuclei). The presentation, analyses and discussion of the results should emphasize this context. For example, one would presume that at low moi, when only one genome enters each cell, the percentage of transcriptionally active genomes in a given cell will be either 0 or 100%, but the "system" becomes saturated as more and more genomes enter the nucleus at higher moi resulting in only a subset of them being transcriptionally active. Along this line of reasoning, it is intriguing that the percentage of genomes estimated to be in nucleosomes at 4 hpi (14%) approaches the percentage of transcribed genomes.

      This issue was also raised by reviewer 1 (see detailed comment above). The reviewer is correct that we chose to use a higher MOI to reach the required sensitivity in our different “Omics” assays. The imaging approach was adapted to reach the morphological equivalence to fit this analysis. We agree that it would be interesting to also study the MOI effect on transcriptional activation (as well as positioning effects, see comment below) but this requires different approaches and will be addressed in a future study. To address this comment (and others in this review) we revised the text in the discussion to emphasize the importance of MOI and possible other effects such as positioning (line 587 ff).

      The changes in chromatin compaction presented in figure 5 are in some respect puzzling. The compaction of most of the late genes increases as infection progresses, at least for the first four hours, as the authors discuss. However, the L genes appear to be at least as accessible as the E ones at the early times, when only the E are transcribed to high levels. This appears counterintuitive, and may not be consistent with the main conclusion that increase accessibility to a given gen directly correlates to its transcriptional activity level. The data presented in Figure 5C deserves a more nuanced analysis and discussion, parsing out the changes in accessibility to each given gene at different times from the different accessibility to the different genes at any given time. The later does not appear to support the main conclusion reached by the authors that accessibility to each individual gen correlates with its transcriptional level.

      We thank the reviewer for raising this point. While the viral genomes enter the nucleus, the viral chromatin structure is tightly condensed. Therefore, it is unlikely that after nuclear entry the viral chromatin undergoes further compaction. With our analysis, we expect to detect only decompaction of genomic sites relative to 0 hpi, when the virus has not entered the nucleus yet. At some sites and particularly at the Late genes the signal is decreasing, most likely due to normalization to sequencing depth and the variation in the number of viral genomes but not due to changes in compaction. We realized that the negative accessibility scores we used in the study are misleading and give a false impression. Therefore, we changed the analysis in that way, that negative values were not permitted and converted to zeros.

      Additionally, we raised the temporal resolution of the analysis and compared the accessibility at all available timepoints against 0 hpi as suggested by the reviewer. Now, we clearly observe, that most accessibility changes are accomplished rapidly after nuclear import, already at 1 hpi and do not change much after, until 4 hpi. Regions of decompaction coincide with early expressed genes and occur before transcription, underscoring the conclusions made in the study. Nevertheless, while most genomic regions covering late genes do not show decompaction, we observed some local sites showing a high accessibility score. As transcription at those sites appears later in the life cycle of the virus, we can only speculate about the function e.g. as enhancer elements.

      The Text and Figures were changed accordingly (line 347 ff).

      New legend:

      __C) __Profile illustrates HAd-C5dE3 genome coverage by low MNase-seq fragments. The average of two replicates is shown, except at timepoint 0 hpi where only one replicate was available. The accessibility score was calculated as the log(fold-change) between the indicated timepoint and 0 hpi. The score was assessed for each pVII peak (orange bars) and negative scores were set to 0. A new accessibility peak arising during infection in the Late3 region is marked by an asterisk. __D) __Boxplot showing the accessibility score distribution in each domain at each tested timepoint after infection.

      Minor comments

      The authors may wish to highlight in the discussion that the analyses are so far limited to a single adenovirus.

      We have taken up the suggestion of the reviewer and included it in the discussion part, starting at line 607:

      “The structural analysis is still limited to a single adenovirus genotype and it will be interesting to test whether these dynamic changes are conserved among other adenoviruses. Furthermore, reproducing such organization in adenoviral vectors could result in efficient and sustained transgene expression.”

      The y-axes in the transcriptome figures (figure 1 B, S2) could be presented in Log(2) scale, such that transcript levels at all times can be appreciated in the same graph (the earlier times are just not visible in a linear scale)

      As requested by the reviewer we changed the data to log2 scale. As there is no qualitative difference to the log10 scale, presented in the original version, we would like to keep the figure as it is. To highlight changes at early time points we generated the average expression of early genes in Fig1C.

      As an information for the reviewer, we provide here the data plotted as log2 scale.

      The (lack of) phenotype of the 24xMS2 binding site recombinant adenovirus used should be shown.

      We observed no difference in phenotype between the parental and the MS2 modified virus. We updated Figure S3 and included a gel analysis and specific infectivity data to show this absence of difference.

      The kymograph analyses presented in figure 3B appear to show that there are some sites of transcript accumulation sites which do not harbor viral genomes (i.e., green only tracks). Moreover, the interpretation of the TAF1beta-mCherry signal is complicated by the (fully expected) significant "background" signal. Although these results are consistent with those obtained by RNAscope/pVII staining, there appears to be intrinsic limitations to the system, which preclude reaching strong conclusions from it. These confirmatory analyses should probably be moved to the supplementary information section and removed from the main text and figures. The longer evaluation data mentioned as not shown in page 8 is critical to the conclusions and should be shown.

      Here we disagree with the reviewer and prefer to keep the data as main figure. All (immobile) transcript accumulation sites are identified by the kymograph analysis and coincide with a genome while free transcripts show a high mobility that is not picked up in the kymograph analysis. This is independently verified in the provided supplemental movies. Depending on the positioning of the genome inside the living cell, accumulating transcripts can appear adjacent to or on top of a genome. This explains the slight shift between RNA and DNA signal for some genomes in the merged image of the kymograph. This is expected as only fully transcribed transcripts and not nascent transcripts are marked by MS2 (the MS2 loops are positioned in the 3’UTR). Also, all genomes (transcribing and non-transcribing) can be identified in the kymograph above background level. To clarify the representation, we have added labels to the kymograph to show which signal is DNA and RNA and a merge respectively. We are convinced that this data set is in strong support of our study, as it is the only technique that permits the discrimination of transcribing and non-transcribing genomes in living cells at real time.

      As requested, we have also added two additional examples for a longer observation period (10min) into the supplemental data Fig. S3C.

      Although the plot of cleavage frequency presented in figure S5 is clear, it would be beneficial to the reader if the actual peaks were also presented to compare their distribution (if any) in gDNA and virus particle.

      In Figure S5 we wanted to test whether the regions lacking pVII peaks are resulting from the absence of pVII, protecting the DNA, and therefore being fully hydrolyzed by MNase, or whether this region is tightly packed by pVII thereby protecting DNA from MNase digestion. To test both possibilities we used a very limited MNase digestion approach, where even free DNA is not fully hydrolyzed, allowing the capture of DNA fragments. Therefore, the sequenced fragments comprise a mixture of protected and un-protected fragments. In this assay, the pVII protected fragments are not fully digested to the monomeric state, but a mix of mono-, di- and other multimers are present. As reflected by the fragment size distribution with the peak between 100-200 bp (Fig S5B), pVII dimers are predominantly enriched when compared to the high MNase digestion used to map pVII positions (compare to Fig4 B). Therefore, the peaks in the S5 data set have a low resolution and do not provide exact pVII positions (see below). Therefore, we would like to keep S5 as it is. We clarified this point in the text (line 279 ff)

      Legend:

      Fragment coverage plot of MNase digestions of gDNA (black) or Ad chromatin in virus particles (purple).

      The mRNA analyses of selected transcription factors provides little information, as there is no context, there is variability between experiments, and in most cases the changes appear modest. As these results are not critical to the conclusions or analyses, perhaps the authors may wish to remove them from the manuscript. Alternatively, more in-depth analyses would be required.

      We agree with the reviewer, that more information for the reader is needed. Therefore, we performed a statistical analysis of expression changes between 0 hpi and 4 hpi of the shown transcription factors using DESeq2. We added the corresponding log2(fold-change) and p-values to the figure. And adapted the text (line 471) and figure accordingly.

      Legend:

      Gene expression changes of transcription factors over the infection time course. P-values and log2(fold-changes) from differential gene expression analysis between 4 hpi and 0 hpi using DESeq2 are indicated. ns = not significant

      It is unclear why the even distribution of H3.1-flag signal across the genome is considered indicative of no specific recruitment. The results presented are equally consistent with equal incorporation across the genome. Perhaps the authors have some additional information, such as an irrelevant antibody, input DNA, or the like, to support the conclusion. If so, that evidence should be presented and discussed. If not, the interpretation should be revisited. As an added complexity, endogenous H3.1 is normally expressed during S-phase. It is possible that Adenovirus infection may induce higher levels of expression of (untagged)endogenous H3.1, which would outcompete the tagged ectopically expressed histone. These analyses deserve a more nuanced and in-depth analysis.

      We have taken several measures in the study to address the concern of the reviewer. We consider timepoint 0 hpi as background control as the viral genome has not entered the nucleus yet. Consistently, we observe very few reads mapped to the Ad genome regardless of antibody and construct used (Fig 6B). Additionally, all samples at 0 hpi cluster together in PCA (Fig 6C) and correlation analysis (Fig S7D)

      H3.1 Flag tagged samples show at later timepoints (1 - 4hpi) slightly higher percentages of mapped reads to Ad, but plateau already at 1 hpi (Fig 6B) and cluster together in PCA (Fig 6C) and correlation analysis (Fig S7D) with 0 hpi samples. The low background signal starting at 1 hpi for H3.1 might arise due to the change of Ad genome location to the nucleus.

      Even though, the number of Ad mapped reads at later timepoints was low in H3.1 Flag tagged samples, it could still be that they accumulate at few sites on the Ad genome indicating a specific deposition. We tested this by plotting the signal across the whole Ad genome (Fig S7E) and zooming into the data (compare scale of H3.3 and H3.1 plot), but we could not detect any reproducible local enrichments. To enable the reader a better comparison between the levels of H3.1 incorporation with H3.3 we put now both on the same scale (Fig 6D and Fig S7D) clearly showing that we cannot detect H3.1 incorporation at Ad genomes in the first 4 hours of infection. The H3.1 signal corresponds to the background noise. We think for two reasons, that it is very unlikely that endogenous H3.1 outcompetes the tagged H3.1:

      • The time scale for the cells to transition into S-Phase and upregulate endogenous H3.1 would be only 1-2 hours in our timeseries experiments and therefore too short. To also show these experimentally we amended an experiment for the reviewer that is not included in the manuscript. The Western blots below show that the protein amount of H3 does not increase in the first 4hours of infection. Cells were infected and whole cell extracts were prepared 4hpi.
      • As most cells are not in S-phase in our experiments, the expression levels of H3.3 variant is higher than H3.1. With the Flag ChIPs we can clearly show that the tagged H3.3 are not outcompeted by endogenous H3.3. As there is a high sequence similarity between H3.3 and H3.1 it is very unlikely that they behave in that regard differently.

        It is highly unlikely that the somewhat higher H3K27ac signal observed in the H3.3 than in the H3.1 expressing cells may result from higher H3.3. occupancy in the viral genome as speculated in page 13. The total levels of H3.3. are unlikely to increase by the ectopically expressed one, and even if they did it is not likely that the occupancy of the viral genome would be limited by the levels of H3.3. This speculation should be removed.

      We removed the speculation.

      Materials and methods are too concise. A longer more detailed version, as supplementary information, would be highly desirable.

      We extended the materials and methods part.

      Reviewer #2 (Significance (Required)):

      The major strengths of this manuscript lie on its comprehensiveness, using several in situ and populational approaches to address biologically critical questions regarding the regulation of viral replication by chromatin and epigenetics. Experiments appears very well designed and performed and are mostly clearly presented. The interpretation analyses and discussion of the results may benefit from a more nuanced analysis of the issues posed by the existence of different populations of viral genomes in the cells infected at high moi and the accessibility across different genes at any given time versus the levels of transcription of the different genes, which appears not to be fully consistent with one of the main conclusions reached.

      This study makes a very significant contribution, describing the dynamic changes in the adenoviral nucleoprotein complexes at the early times of infection and providing a full description of both the adenosomes and the nucleosomes in more and less transcribed loci. The results are properly analyzed in context of what is known about the regulation of viral gene transcription by chromatin dynamics in other systems, including similarities and differences. This study is likely to be of high interest to a wide audience, ranging from virologist to epigeneticists, to those working in gene therapy and vectored vaccines.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The manuscript "Adenoviral chromatin organization primes for early gene activation" combines RNA-seq, MNase-seq, ChIP-seq, and single genome and transcript imaging (immunofluorescence, RNA-scope, and live cell techniques) during early Adenovirus infection in vitro to characterise the spatiotemporal dynamics of viral chromatin organisation and association with gene transcription. The manuscript is an interesting read and the authors have combined multiple complimentary techniques to make a substantial contribution to understanding the early events occurring after nuclear import of viral genomes. Adenoviruses are important causes of human and animal pathology, are a useful model of non-integrating extra-chromosomal DNA virus infection in mammalian cells, and are useful vectors for vaccination and the discoveries may influence gene therapy DNA vector design. The chromatin organisation in adenovirus infection is distinct from other DNA viruses, and is relatively poorly understood compared to, for example, SV40 or herpesviruses. The manuscript describes an early transition from purely viral chromatin with Adenovirus protein pVII packaging the virus in virions, to a viral-human hybrid chromatin pattern with apparently strategically positioned H3.3 nucleosomes and viral pVII "Adenosomes" in the early hours after nuclear import of the viral genome. The data shows that packaged Adenoviruses are in a transcriptionally accessible form and gene expression occurs rapidly after infection, the combination of the MNase-seq data with ChIP-seq data is particularly interesting demonstrating and average ~238 adenosomes positioned by specific DNA code protecting 60-70bp of DNA, and that the genome is accessible at loci that also decondense on infection, with adenosomes being replaced by cellular H3.3 containing nucleosomes at distinct sites. Particularly they show that +1 H3K27 acetylated nucleosomes are acquired at the TSS of key early genes. The authors argue that their spatiotemporal data imply that this chromatin transition "primes" for early gene transcription. The manuscript is well written, uncovers important viral chromatin biology by combining multiple experimental techniques, and the data is generally very clearly presented. A few comments follow. Major concerns: • Abstract and Title: o the abstract and title suggest that because the chromatin changes are observed coincidentally or before transcriptional changes, and that this means that these chromatin changes "prime" (title) or are "required" and play a "central role" (abstract) in early gene expression. The temporal relationship would be consistent with chromatin changes being required for transcriptional changes, but do not imply necessity. Experiments to demonstrate the necessity of these changes for early gene transcription are lacking, and I recommend amending the text or additional experiments to provide this evidence directly.

      We observe a clear timing of events, with chromatin opening, nucleosome assembly at the 5’ end of the gene followed by transcriptional activation, suggesting that these structural changes are essential for gene activation. Still, we cannot prove the direct dependency. Therefore we toned down the title of our manuscript and formulate the findings more conservatively.

      The title now reads: “Changes in adenoviral chromatin organization precede early gene activation”

      Results:o The IF data in Fig S1 is convincing, showing viral particles are accessible quickly in the nucleus. Although no statistics are provided for S1B and C, pVII foci appear at 0.5hpi and appear to mostly accumulate between 0.5hpi and 1hpi with further import between 1hpi and 4hpi. Can the authors be sure that a single pVII IF focus represents a single genome? If genomes tend to aggregate as they accumulate the number of foci per nucleus may not increase linearly with the number of genomes imported. Have the authors considered analysing the intensity of the individual pVII foci over the time points? A related question is whether the authors assume that all packaged virions contain intact complete viral genomes? Many viruses comprise some mixture of complete and incomplete packaged genomes, and the subsequent analyses determine the proportion of transcriptionally active copies with RNA-Scope to a single transcript E1A which lies at one end of the viral genome. Please comment explicitly on whether this is assumed and whether this assumption is realistic in light of known Adenovirus biology.

      We appreciate the reviewer's concern. Several studies in the adenovirus field have shown equivalence between protein VII nuclear foci and individual genomes, including our own (PMID: 26332038). Probably the most accurate study was performed by Daniel Engels lab PMID: 19406166, who used nuclear protein VII foci to titrate viral as well as vector genomes. In contrast, a different study from Patrick Hearings lab PMID: 21345950 showed that past 4hpi, the number of nuclear protein VII foci gradually declines. Based on our experience and because our study is limited to 4 hpi we are confident that protein VII foci accurately reflect individual viral genomes.

      Concerning genome packaging, adenovirus particles contain a single viral genome that is protected at each end by a covalently attached protein preventing its degradation. The packaging of adenoviruses is extremely efficient and only complete genomes are packaged into fully assembled particles. All viruses used in this study have been purified by double CsCl gradient purification. This density gradient based purification protocol removes all particles that are either empty or damaged or would contain partial genomes.

      o The RNA-Seq data in Fig 1 and Fig S2 and Table S1 demonstrates transcription of early genes is barely observable at 1hpi but is observable by 2hpi and is clearly much increased by 4hpi. Fig 2C, visualising pVII foci directly within single cells, suggests that approximately 80% of foci are observed by 1hpi and a further 20% between 1hpi and 2hpi and little thereafter. These data convincingly demonstrate that nuclear import is rapid, typically occurring in the first hour. The E1A RNA-Scope data in figure 2, visualising individual mRNA transcripts of E1A, is more sensitive than the bulk RNA-Seq, and shows transcripts at 1hpi with clearly discernible transcription by 2hpi (2A&D) which suggests that transcription occurs early, by 2hpi. Thus transcription lags nuclear genome import by approximately one hour by these methods. However, the conclusions of the subsequent analyses depend on the chromatin changes clearly preceding, rather than being approximately coincident with transcription, therefore transcription being evident by 2hpi is relevant as figure 6A and D suggest that the chromatin remodelling is subtle before 2hpi on the bulk sequencing analyses. The authors should comment on this given the importance to their argument.

      As stated by the reviewer we observe a clear lag between nuclear import and transcriptional activation. And we do also observe the largest changes in nucleosome occupancy (ChIP-seq data) between 1 and 2 hpi (Fig6A and D). Compared to 0hpi, we observe the strongest increase of nucleosome occupancy between 1hpi and 2hpi (4-8fold effect), whereas depending on the area a 2-3fold increase in occupancy can be observed from 2hpi to 4hpi (Fig6D). An effect that one would expect with chromatin structure preceding gene activation. Furthermore, the timing of nucleosome assembly perfectly matches the increase of MNase accessibility at 1 hpi, supporting our conclusions.

      o The validation of the E1A probe specificity in Fig 2B looks convincing, but there are no data presented for multiple cells to reassure that this image is representative. The equivalent figure for 2D for the Ad5-GFP control would address this.

      We include a large field overview with multiple cells for virus and vector control as new supplemental figure S2B showing that the RNAscope detection of the E1A transcript is highly specific.

      o Figure 2E is presented as a colocalization analysis but appears to be a ratio of mRNA foci to pVII foci per cell. If this is an incorrect interpretation then some clarification in the figure legend would be helpful. If this interpretation of these data is correct, then it is not truly a colocalization analysis, as a single genome may give rise to multiple transcripts and so a ratio We apologize that this figure was not clear. The data are based on real colocalizations and represent the number of pVII dots positive for E1A normalized with the total number of nuclear pVII. We have clarified the figure legend accordingly.

      o The live cell imaging experiments are elegant and convincing, but the agreement in Fig 3D of the % colocalization in MS2-BP data with the RNA-scope data is potentially misleading for the reasons outlined in the prior comment. Is the data in Fig 2E the same as the data in the right hand panel of Fig 3D. If so please comment on the n discrepancy (n=30 in 2E vs n=22 in 3D). The observation that 20% of genomes are transcriptionally active, via bursting or otherwise, is interesting, and would be consistent with the Suomalainen et al reference. The authors discuss two hypotheses to explain these findings: transcriptional bursting or a subset ~20% of genomes being transcriptionally active. This is an interesting and begs the question as to why this may occur. Assuming all imported genomes are intact (previous comment), it appears from the presented images that the foci at the radial periphery of the nucleus may be more frequently transcriptionally active, despite the nuclear periphery being enriched for heterochromatin. The authors might consider analysing the radial position of their TAF1B-mCherry genomes (active and inactive) as this might support position effect variegation rather than bursting as an explanation and they appear to already have the data to perform such analyses.

      o In the presented images (Fig 3A and Fig S3) it appears a higher proportion of genomes than 20% appear to be transcriptionally active, particularly in the low MOI experiment. The authors may wish to comment on this and quantify whether the proportion of transcribing genomes was affected by the input MOI.

      This and the previous comment concerning the influence of MOI, transcriptional bursting and the positioning effect of the genome on the transcriptional activity have also been in part raised above. As stated in our response to reviewer 1 we have used a high MOI in our experiments to have equivalence between all experimental approaches. We agree with the reviewers that all aspects (dose, bursting and positioning) merit a detailed investigation, which we plan in future studies. To be consistent and comparable in our comprehensive approach we decided to not include such studies here as they would address a different question. Nevertheless, to address this (and the above) comments we now mention positioning effects in the results (line 214) and enlarged the discussion (line 587 ff) where we especially raised awareness that such pertinent questions can be addressed with the tools presented in our study.

      We also decided to visually separate the comparison of MS2 and RNAscope data to avoid misleading the reader. Furthermore, the RNAscope data have been replaced. The RNAscope data are indeed from Fig. 2. The difference in n was due to our mistake showing two different normalized data sets. Data were either normalized using total amount of nuclear protein VII (Fig. 2E) or the total amount of nuclear E1A signals (Fig 3D), which due to the more heterogenous signal did not include all cells. In the updated version both figures display data normalized by total amount of nuclear protein VII

      o Fig 4C suggests that there is a large GC preference (or bias) in the pVII occupied regions. The authors may wish to comment on this and present a track with Adenovirus GC composition in Fig 4D.

      We thank the reviewer for raising this point. As suggested by the reviewer we analysed the GC content under pVII peaks and in the linker DNA. Indeed, pVII occupied regions have a significant higher GC content indicating that pVII preferentially positions at GC rich regions. We included this analysis as an additional Figure 4E (line 302 f).

      Legend:

      Boxplot showing GC content of pVII occupied (pVII) or free (linker) regions. Two biological replicates are shown side by side and the p-value of a students t-test of the corresponding pairs is indicated above.

      o Figure 6 presents convincing data showing H3.3. nucleosome positioning and acetylation at E1A and the data is nicely presented showing these changes occur early being observable by 2 and 4 hpi. Again, these changes are not convincingly prior to early gene activation but are certainly occurring early, and may occur prior to early gene activation at the level of individual foci, however, this is not demonstrated definitively.

      This question belongs to the same context addressed by the reviewer above. Please refer to the answer given above.

      Minor comments:

      Introduction: o Paragraph 1 - Introduction for DNA viruses in general, but the authors appear to be talking about Adenoviruses specifically, "little is known about the structural organization of the genome" and "nuclear viral genomes could undergo different parallel fates", arguably these statements are not accurate for other DNA viruses (e.g. Epstein Barr Virus) suggest amending the wording for clarity.

      The manuscript text was updated as suggested.

      o paragraph 2 - Why do the authors say that Adenoviruses are prototypic DNA viruses?

      We removed the term prototypic.

      o Paragraph 3 - A recent study is referenced but multiple references are given.

      The references were updated

      o "Protein VII stays associated with the viral genome imported to the nucleus, while pV dissociates from the viral DNA following ubiquitylation (Puntener et al., 2011). The fate of the μ-peptide is not known". - The reference suggests that pV dissociates on entry to the cytoplasm and during capsid disassembly at the nuclear pore. I find this sentence confusing as it doesn't make it clear that pV is lost before nuclear entry which is important for interpreting the data.

      We clarified this in the manuscript text

      Results:

      o Figure 5 is almost unreadable due to low resolution.

      We updated the Figures and checked the resolution after PDF conversion.

      o Reference to Fig 4C in text comes after Fig4D.

      The order of Figure panels was changed accordingly.

      Reviewer #3 (Significance (Required)):

      The manuscript is well written, uncovers important viral chromatin biology by combining multiple experimental techniques, and the data is generally very clearly presented

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The manuscript "Adenoviral chromatin organization primes for early gene activation" combines RNA-seq, MNase-seq, ChIP-seq, and single genome and transcript imaging (immunofluorescence, RNA-scope, and live cell techniques) during early Adenovirus infection in vitro to characterise the spatiotemporal dynamics of viral chromatin organisation and association with gene transcription. The manuscript is an interesting read and the authors have combined multiple complimentary techniques to make a substantial contribution to understanding the early events occurring after nuclear import of viral genomes.

      Adenoviruses are important causes of human and animal pathology, are a useful model of non-integrating extra-chromosomal DNA virus infection in mammalian cells, and are useful vectors for vaccination and the discoveries may influence gene therapy DNA vector design. The chromatin organisation in adenovirus infection is distinct from other DNA viruses, and is relatively poorly understood compared to, for example, SV40 or herpesviruses. The manuscript describes an early transition from purely viral chromatin with Adenovirus protein pVII packaging the virus in virions, to a viral-human hybrid chromatin pattern with apparently strategically positioned H3.3 nucleosomes and viral pVII "Adenosomes" in the early hours after nuclear import of the viral genome. The data shows that packaged Adenoviruses are in a transcriptionally accessible form and gene expression occurs rapidly after infection, the combination of the MNase-seq data with ChIP-seq data is particularly interesting demonstrating and average ~238 adenosomes positioned by specific DNA code protecting 60-70bp of DNA, and that the genome is accessible at loci that also decondense on infection, with adenosomes being replaced by cellular H3.3 containing nucleosomes at distinct sites. Particularly they show that +1 H3K27 acetylated nucleosomes are acquired at the TSS of key early genes.

      The authors argue that their spatiotemporal data imply that this chromatin transition "primes" for early gene transcription. The manuscript is well written, uncovers important viral chromatin biology by combining multiple experimental techniques, and the data is generally very clearly presented. A few comments follow.

      Major concerns:

      • Abstract and Title:
        • the abstract and title suggest that because the chromatin changes are observed coincidentally or before transcriptional changes, and that this means that these chromatin changes "prime" (title) or are "required" and play a "central role" (abstract) in early gene expression. The temporal relationship would be consistent with chromatin changes being required for transcriptional changes, but do not imply necessity. Experiments to demonstrate the necessity of these changes for early gene transcription are lacking, and I recommend amending the text or additional experiments to provide this evidence directly.
      • Results:
        • The IF data in Fig S1 is convincing, showing viral particles are accessible quickly in the nucleus. Although no statistics are provided for S1B and C, pVII foci appear at 0.5hpi and appear to mostly accumulate between 0.5hpi and 1hpi with further import between 1hpi and 4hpi. Can the authors be sure that a single pVII IF focus represents a single genome? If genomes tend to aggregate as they accumulate the number of foci per nucleus may not increase linearly with the number of genomes imported. Have the authors considered analysing the intensity of the individual pVII foci over the time points? A related question is whether the authors assume that all packaged virions contain intact complete viral genomes? Many viruses comprise some mixture of complete and incomplete packaged genomes, and the subsequent analyses determine the proportion of transcriptionally active copies with RNA-Scope to a single transcript E1A which lies at one end of the viral genome. Please comment explicitly on whether this is assumed and whether this assumption is realistic in light of known Adenovirus biology.
        • The RNA-Seq data in Fig 1 and Fig S2 and Table S1 demonstrates transcription of early genes is barely observable at 1hpi but is observable by 2hpi and is clearly much increased by 4hpi. Fig 2C, visualising pVII foci directly within single cells, suggests that approximately 80% of foci are observed by 1hpi and a further 20% between 1hpi and 2hpi and little thereafter. These data convincingly demonstrate that nuclear import is rapid, typically occurring in the first hour. The E1A RNA-Scope data in figure 2, visualising individual mRNA transcripts of E1A, is more sensitive than the bulk RNA-Seq, and shows transcripts at 1hpi with clearly discernible transcription by 2hpi (2A&D) which suggests that transcription occurs early, by 2hpi. Thus transcription lags nuclear genome import by approximately one hour by these methods. However, the conclusions of the subsequent analyses depend on the chromatin changes clearly preceding, rather than being approximately coincident with transcription, therefore transcription being evident by 2hpi is relevant as figure 6A and D suggest that the chromatin remodelling is subtle before 2hpi on the bulk sequencing analyses. The authors should comment on this given the importance to their argument.
        • The validation of the E1A probe specificity in Fig 2B looks convincing, but there are no data presented for multiple cells to reassure that this image is representative. The equivalent figure for 2D for the Ad5-GFP control would address this.
        • Figure 2E is presented as a colocalization analysis but appears to be a ratio of mRNA foci to pVII foci per cell. If this is an incorrect interpretation then some clarification in the figure legend would be helpful. If this interpretation of these data is correct, then it is not truly a colocalization analysis, as a single genome may give rise to multiple transcripts and so a ratio <1 could be expected even if all pVII foci were transcribing genomes. In addition, the text suggests that because there is no statistically significant difference between 2hpi and 4hpi a plateau has been reached. However, the difference between 1h and 2h is barely significant (p=0.04) and the mean is increased between 2h and 4h, albeit non-significantly, so the plateau is not convincingly demonstrated. If the authors wish to perform a colocalization analysis rather than a ratio, they might assign each transcript to the nearest pVII IF focus within the nucleus and count the proportion of pVII foci with any transcripts assigned over time. Alternatively, they can amend the description of this analysis in the figure and text.
        • The live cell imaging experiments are elegant and convincing, but the agreement in Fig 3D of the % colocalization in MS2-BP data with the RNA-scope data is potentially misleading for the reasons outlined in the prior comment. Is the data in Fig 2E the same as the data in the right hand panel of Fig 3D. If so please comment on the n discrepancy (n=30 in 2E vs n=22 in 3D). The observation that 20% of genomes are transcriptionally active, via bursting or otherwise, is interesting, and would be consistent with the Suomalainen et al reference. The authors discuss two hypotheses to explain these findings: transcriptional bursting or a subset ~20% of genomes being transcriptionally active. This is an interesting and begs the question as to why this may occur. Assuming all imported genomes are intact (previous comment), it appears from the presented images that the foci at the radial periphery of the nucleus may be more frequently transcriptionally active, despite the nuclear periphery being enriched for heterochromatin. The authors might consider analysing the radial position of their TAF1B-mCherry genomes (active and inactive) as this might support position effect variegation rather than bursting as an explanation and they appear to already have the data to perform such analyses.
        • In the presented images (Fig 3A and Fig S3) it appears a higher proportion of genomes than 20% appear to be transcriptionally active, particularly in the low MOI experiment. The authors may wish to comment on this and quantify whether the proportion of transcribing genomes was affected by the input MOI.
        • Fig 4C suggests that there is a large GC preference (or bias) in the pVII occupied regions. The authors may wish to comment on this and present a track with Adenovirus GC composition in Fig 4D.
        • Figure 6 presents convincing data showing H3.3. nucleosome positioning and acetylation at E1A and the data is nicely presented showing these changes occur early being observable by 2 and 4 hpi. Again, these changes are not convincingly prior to early gene activation but are certainly occurring early, and may occur prior to early gene activation at the level of individual foci, however, this is not demonstrated definitively.

      Minor comments:

      • Introduction:
        • Paragraph 1 - Introduction for DNA viruses in general, but the authors appear to be talking about Adenoviruses specifically, "little is known about the structural organization of the genome" and "nuclear viral genomes could undergo different parallel fates", arguably these statements are not accurate for other DNA viruses (e.g. Epstein Barr Virus) suggest amending the wording for clarity.
        • paragraph 2 - Why do the authors say that Adenoviruses are prototypic DNA viruses?
        • Paragraph 3 - A recent study is referenced but multiple references are given.
        • "Protein VII stays associated with the viral genome imported to the nucleus, while pV dissociates from the viral DNA following ubiquitylation (Puntener et al., 2011). The fate of the μ-peptide is not known". - The reference suggests that pV dissociates on entry to the cytoplasm and during capsid disassembly at the nuclear pore. I find this sentence confusing as it doesn't make it clear that pV is lost before nuclear entry which is important for interpreting the data.
      • Results:
        • Figure 5 is almost unreadable due to low resolution.
        • Reference to Fig 4C in text comes after Fig4D.

      Significance

      The manuscript is well written, uncovers important viral chromatin biology by combining multiple experimental techniques, and the data is generally very clearly presented

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The submitted manuscript presents a detailed and comprehensive analysis of the adenoviral nucleoprotein complexes as infection progresses, starting with the "adenosome" assembled with pVII which are then progressively replaced with H3.3.-containing nucleosomes as the infection progresses. The submission presents a combination of in situ and populational analyses of the viral DNA accessibility and complexes through infection. I brief, the infecting viral genomes are assembled in some 250 adenosomes with pVII, which become progressively replaced as infection progresses with nucleosomes containing H3.3 and acetylated H3K17, starting at the active promoters of the E genes. Chromatin remodeling precedes transcription, and the accessibility differs for genes of different kinetic classes at differ times after infection, although there is no correlation between accessibility and H3.3. or acetylation content. Only about 20% of the genomes become transcriptionally active, though, which somewhat complicates the analyses of the populational studies of accessibility and occupancy. Overall, the study is well conceived, performed and presented. A few issues that deserve further analyses and discussion, as described below.

      Major issues.

      As figure 2 nicely shows, only about 20% of the intranuclear genomes become transcriptionally active. However, MNase and ChIP analyses cannot differentiate these genomes from the 80% that are transcriptionally inactive. The interpretation of the positioning of pVII (figure 4) or the changes in compaction of the adenoviral chromatin at different loci (figure 5) does not appear to consider this heterogeneity other than for a brief comment about the stringent MNase digestion in page 11. The authors favor a model in which the changes in compaction shown in figure 5, at mild MNase digestions, directly correlate with transcription of the respective genes. This could well be correct, and in fact the correlation may be underestimated as 80% of the genomes may not undergo any changes, but it may also be incorrect. The analyses presented cannot differentiate whether the changes in chromatin compaction occur in only a subset of genomes or in all the genomes, regardless of whether they are transcribed or not, or even only in the non-transcribed genomes (which appears extremely unlikely). This intrinsic limitation to the methods used (and I know of no better alternative) should be acknowledged and discussed for the benefit of the reader. This limitation also impacts the analyses of the lack of correlation between H3.3 and acetylated H3K27 occupancy and compaction.

      Perhaps out of necessity to reach the required sensitivity, a high multiplicity of infection was used (although the actual moi is not stated, there are about 25-30 pVII foci/ per nuclei). The presentation, analyses and discussion of the results should emphasize this context. For example, one would presume that at low moi, when only one genome enters each cell, the percentage of transcriptionally active genomes in a given cell will be either 0 or 100%, but the "system" becomes saturated as more and more genomes enter the nucleus at higher moi resulting in only a subset of them being transcriptionally active. Along this line of reasoning, it is intriguing that the percentage of genomes estimated to be in nucleosomes at 4 hpi (14%) approaches the percentage of transcribed genomes.

      The changes in chromatin compaction presented in figure 5 are in some respect puzzling. The compaction of most of the late genes increases as infection progresses, at least for the first four hours, as the authors discuss. However, the L genes appear to be at least as accessible as the E ones at the early times, when only the E are transcribed to high levels. This appears counterintuitive, and may not be consistent with the main conclusion that increase accessibility to a given gen directly correlates to its transcriptional activity level. The data presented in Figure 5C deserves a more nuanced analysis and discussion, parsing out the changes in accessibility to each given gene at different times from the different accessibility to the different genes at any given time. The later does not appear to support the main conclusion reached by the authors that accessibility to each individual gen correlates with its transcriptional level.

      Minor comments

      The authors may wish to highlight in the discussion that the analyses are so far limited to a single adenovirus.

      The y-axes in the transcriptome figures (figure 1 B, S2) could be presented in Log(2) scale, such that transcript levels at all times can be appreciated in the same graph (the earlier times are just not visible in a linear scale)

      The (lack of) phenotype of the 24xMS2 binding site recombinant adenovirus used should be shown.

      The kymograph analyses presented in figure 3B appear to show that there are some sites of transcript accumulation sites which do not harbor viral genomes (i.e., green only tracks). Moreover, the interpretation of the TAF1beta-mCherry signal is complicated by the (fully expected) significant "background" signal. Although these results are consistent with those obtained by RNAscope/pVII staining, there appears to be intrinsic limitations to the system, which preclude reaching strong conclusions from it. These confirmatory analyses should probably be moved to the supplementary information section and removed from the main text and figures. The longer evaluation data mentioned as not shown in page 8 is critical to the conclusions and should be shown.

      Although the plot of cleavage frequency presented in figure S5 is clear, it would be beneficial to the reader if the actual peaks were also presented to compare their distribution (if any) in gDNA and virus particle.

      The mRNA analyses of selected transcription factors provides little information, as there is no context, there is variability between experiments, and in most cases the changes appear modest. As these results are not critical to the conclusions or analyses, perhaps the authors may wish to remove them from the manuscript. Alternatively, more in-depth analyses would be required.

      It is unclear why the even distribution of H3.1-flag signal across the genome is considered indicative of no specific recruitment. The results presented are equally consistent with equal incorporation across the genome. Perhaps the authors have some additional information, such as an irrelevant antibody, input DNA, or the like, to support the conclusion. If so, that evidence should be presented and discussed. If not, the interpretation should be revisited. As an added complexity, endogenous H3.1 is normally expressed during S-phase. It is possible that Adenovirus infection may induce higher levels of expression of (untagged)endogenous H3.1, which would outcompete the tagged ectopically expressed histone. These analyses deserve a more nuanced and in-depth analysis.

      It is highly unlikely that the somewhat higher H3K27ac signal observed in the H3.3 than in the H3.1 expressing cells may result from higher H3.3. occupancy in the viral genome as speculated in page 13. The total levels of H3.3. are unlikely to increase by the ectopically expressed one, and even if they did it is not likely that the occupancy of the viral genome would be limited by the levels of H3.3. This speculation should be removed.

      Materials and methods are too concise. A longer more detailed version, as supplementary information, would be highly desirable.

      Significance

      The major strengths of this manuscript lie on its comprehensiveness, using several in situ and populational approaches to address biologically critical questions regarding the regulation of viral replication by chromatin and epigenetics. Experiments appears very well designed and performed and are mostly clearly presented. The interpretation analyses and discussion of the results may benefit from a more nuanced analysis of the issues posed by the existence of different populations of viral genomes in the cells infected at high moi and the accessibility across different genes at any given time versus the levels of transcription of the different genes, which appears not to be fully consistent with one of the main conclusions reached.

      This study makes a very significant contribution, describing the dynamic changes in the adenoviral nucleoprotein complexes at the early times of infection and providing a full description of both the adenosomes and the nucleosomes in more and less transcribed loci. The results are properly analyzed in context of what is known about the regulation of viral gene transcription by chromatin dynamics in other systems, including similarities and differences. This study is likely to be of high interest to a wide audience, ranging from virologist to epigeneticists, to those working in gene therapy and vectored vaccines.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The authors have addressed the nucleoprotein structure of human adenovirus during the very early stages of infection, and its relationship to onset of expression of viral genes, using a combination of RNA-seq, MNase-seq, ChIP-seq and single genome imaging. They show that in the virion and the newly-infecting DNA, protein VII is precisely position at specific sites on the viral DNA, with greater accessibility at early gene promoters compared to other regions. Nucleosomes containing H3.3 replace specific protein VII at distinct positions at the transcription start sites of genes, which are then acetylated. Association with histones and nucleosomes occurs prior to transcription. These studies confirm and greatly expand on results already in the literature, and also elucidate a novel role for protein VII in orchestrating positioning of nucleosomes prior to initiation of transcription.

      The authors provide excellent data in support of their conclusions and, in many instances, use alternative experiments (i.e. two different approaches) to support their claims. The details of methods are adequate (with small exceptions outlined below) and statistical methods appropriate.

      Minor comments:

      1. Line 561 "Protein VII molecules were exchanged for positioned nucleosomes at the +1 site of actively transcribed genes". This statement seems to suggest that the +1 position almost acts as a nucleating site, where replacement of a single, specific protein VII molecule at +1 is an initiating event, which then spreads from that site and into the rest of the gene. Data shown in Figure 6G and 6H shows that H3.3 appears to be found equally along the full length of E1A as early as 1 hr post infection (with no real "enhancement" at the +1 position), and that the overall levels simply increase over the next 4 hrs.
      2. Curiously, the authors chose not to use a wildtype virus for their studies - the virus contains a deletion in the E3 region. For clarity, I suggest that the authors should preferentially use an alternative designation for their virus rather than HAd-C5. Perhaps HAd-C5delE3 to differentiate this work from studies that truly use wildtype virus.
      3. The obvious limitation of the studies using the fluorescent TAF1-beta to label Ad genomes is that as protein VII is replaced by nucleosomes, the genomes would have declining detection by this method. Genomes devoid of protein VII would be "invisible".
      4. Line 275 "Interestingly, a central region of the viral genome (Late3) and a region between the E3 and E4 genes exhibited almost no peaks" for protein VII. The virus utilized in this study lacked at least part of the E3 region. Did this deletion "cause" this region to be devoid of protein VII? Is the same absence of protein VII peaks observed in a fully wildtype virus? Also, can the authors provide any speculation as to why the Late3 region also lacks protein VII?
      5. Line 569 "Reasons could be that the few genomes undergoing nucleosome assembly and active transcription produce the replication enzymes, whereas the bulk of genomes enters replication without activation as an elegant way to avoid repeated chromatinization." This argument may make sense in the context of a high MOI infection, but would certainly limit virus function during normal, pathogenic infection where the MOI is likely extremely low. Essentially, the authors data predicts that 80% of normal, low MOI infections don't progress to gene expression (at least during the first 4 hrs analyzed in this study).
      6. Line 576 "This observation is in agreement with recent pVII-ChIP experiments showing transcription and replication independent pVII removal in early infection (Giberson et al., 2018; Komatsu and Nagata, 2012; Komatsu et al., 2011)." The authors can also state that histone and nucleosome deposition is also independent of transcription and replication, as has been alluded to in the same cited studies but proven more directly in this study.
      7. Line 672 - the authors should be more definitive in the MOI that are used in all of their experiments. Line 672 states that an MOI of 3000 physical particles are applied per cell. There can be great variation between cell lines in how much virus binds to (and enters) a cell based on the surface levels of Ad receptors on different cell types. However, in general, 3000 is very high. Work by Wang et al. (PMID:24139403) showed that at an MOI of 200 or below most Ad will traffic correctly to the nucleus, whereas at an MOI above 200 there is a significant defect in Ad trafficking within the cell. How is this expected to affect all of the results in this study?
      8. Figure 5 is of low resolution and was difficult to read.
      9. Figure S3 is missing a box from the top set of images indicating the region that is expanded in the detail picture.
      10. While I realize it is supplemental data, the difference in quality between the agarose gels shown in Figure S4A and S5A is shocking.
      11. Figure S7 is of low resolution.

      Significance

      At least in the field of adenovirus research, this is a very important study. There has been considerable debate in the field regarding the timing and degree of protein VII removal and histone deposition, and the necessity of active transcription for these two events. The data provided in this manuscript clearly shows that some protein VII is removed from early active genes and replaced by nucleosomes, and that these events occur prior to initiation of transcription.

      The authors speculate that the specific placement of protein VII, a protamine-like protein, on the Ad genome prescribes where nucleosomes are placed. This finding should be of interest to a broad general audience, as it provides novel information on chromatin assembly within mammalian cell.

      Key words for this reviewer: adenovirus research, HAdV nucleoprotein structure

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      *Summary: This paper illustrates the role of GDF15 in ganglionic eminence featuring the influence on neurogenesis and progenitor proliferation. Using the conventional knockout GDF-15 mouse lines, the authors provide a series of counting data indicating that GDF15 controls neurogenesis in the late embryonic or adult neural stem cells in the ventral forebrain. *

      We would like to thank the reviewer to reading our manuscript and providing comments. As the reviewer highlights, we have used a conventional GDF15 knock-in knock-out model since the growth factor is expressed not only at tissue levels but also at a systemic level. Therefore, targeted ablation of GDF15 would be complicated and the results difficult to interpret. Moreover, GDF15 and its receptor GFRAL in normal conditions are expressed at very low levels in adult mice and mutant mice do not display any obvious developmental phenotype. However, GDF15 is characteristically expressed during development and our previous data have shown that its expression is particularly increased at later developmental ages and particularly in neural precursors, which are both the focus of our analysis. Although these previous analyses have long highlighted that GDF15 is particularly expressed in the V-SVZ and in the choroid plexus, its physiological role in this system remains to the best of our knowledge unknown. It is important to investigate this issue because, as we mention below, GDF15 expression is increased, including in NSCs, upon brain injury and aging. As the reviewer rightly mentions, using this conventional approach and straightforward quantitative analyses, instruments available and normally used for the investigation of biological phenomena, we have discovered that GDF15 directly affects the number of ependymal cells and neural stem cells thereby providing a first function for the expression of the growth factor in this region.

      Major comments:

      The entire story in this manuscript seems similar to the previous findings where the authors demonstrated the role of GDF15 in the hippocampal neural stem cells in relation to EGF and CXCR4.

      As the reviewer rightly mentions we have in a previous paper investigated the effect of GDF15 on the stem cells of the hippocampus. However, we would like respectfully to disagree with the reviewer that our current manuscript describes similar findings. Whereas we have previously shown that the effect of GDF15 in hippocampal stem cells and neurogenesis is a transient inhibition of proliferation due to reduced EGFR expression, we here found that absence of GDF15 leads instead to increased proliferation and a permanent increase of stem cell number, besides of ependymal cells. As the reviewer rightly mentions, on the basis of our previous observations, also in this study we have analyzed EGFR expression and signalling. However, although our data clearly show that EGFR expression and more importantly signalling are altered also in this niche, we could show that the effect of GDF15 is more complex than altering EGFR signalling. Since we show for the first time in this study, that besides GDF15, neural progenitors also express GFRAL, our data point at a selective effect of GDF15 in the development of neural stem cell in the GE and in the deriving adult niche, which include change in EGFR signalling.

      *The data and the conclusion presented here sound reasonable to me. The current manuscript, however, gave me the impression that the story is less impactful and rather descriptive. To improve the quality of the current draft, the authors may wish to clearly highlight the novelty of the findings, not simply apply the previous strategy to the other anatomical brain regions. Alternatively, the draft could emphasize the similarity of utilising the same biological strategies to control the number of adult stem cells in the distinct stem cell niche. *

      We would like to thank again the reviewer for the positive consideration of our quantitative analyses, although we cannot agree with the referee’s conclusion about the impact of our current study. In particular, we would like to focus here not only on the specific findings of the two studies that, as we mentioned above, reach different conclusions, but also on the general meaning of our new study in the context of understanding the role of GDF15. Besides during development and aging, GDF15 expression is promptly upregulated in several pathologies including, cancer, injury and neurodegeneration. Indeed, a growing body of evidence has highlighted the possible role of GDF15 as stress hormone and mitokine, which could be part of a conserved mechanism of the body to signal and respond to stress. Within this context, it would be very important to understand the effect of GDF15 on stem cells, as it may prompt not only understanding of the physiological role of GDF15 but also of the mechanism underlying the response and contribution of stem cell to stress and injury. Supporting this view, it was recently shown that GDF15 is upregulated in quiescent neural stem cells following brain injury (Llorens-Bobadilla et al., 2015). However, the main problem in investigating the physiological role of GDF15 is that the expression of its recently discovered receptor is very limited in the brain. Therefore, our data here are important not only because of the novel effect that they describe for GDF15 in NSC development, but also because they show that GDF15 directly affects stem cell behavior. We have now followed the suggestion of the reviewer and re-edited several parts of the manuscript including editorial changes to highlight the relevance of our findings and the figures to better illustrate them. In particular, we have added also additional analyses to support our conclusions. These include data illustrated in Fig.1B, C; Fig. 4B, G and Fig. 5G.

      *I also have two concerns which may help to improve the current draft. Firstly, I would suggest considering the data presentation as many of the counting data are not accompanied by representative images or a detailed description of the methods, which could impede the credibility of the data. For instance, it is not clear to me how the authors judged the apical vs subapical progenitor counting as neither the pictures nor the methods clearly specified how these are distinguished. Same to the Figures 3 and 8. *

      We thank the reviewer for these suggestions, which we have now implemented in our revised manuscript. These changes include addition of representative images to Figs. 1, 2, 3, 4, 5, 6, as well as an illustration of how apical vs subapical cells were counted in Fig. 2A, an illustration showing how ependymal and single-ciliated cells were determined in Fig. 8A, and more detailed descriptions in the materials and methods section.

      *I would also suggest the authors may wish to carefully review the text as many abbreviations are not properly stated (for example, what are P+ progenitors?), or not properly explained why the particular gene expression is analysed (EGF, Sox2, CXCR4). This is also applied to the anatomical jargon (like apical, subapical etc), which can be specified in the figure by introducing the cartoons or point-on images. *

      We thank the reviewer for pointing these shortcomings out. We have now done a careful proofreading of the text and implemented changes in the relative figures.

      The changes include: Explanation of Prominin-1-expressing (P+) progenitors (p. 10, line 35) and apical and subapical progenitors (p.3, line 11-23), as well as more detailed reasoning for the analysis of gene expression for EGFR, Sox2 and CXCR4 (p. 9, line 5-7; p.12, line 44 and following)

      *Last not least, I should point out that the author uses less commonly used terminology. To my knowledge, the SVZ progenitors in the GE are now called basal progenitors (Bandler et al 2017 for example) and the word intermediate progenitors is used for the Tbr2+ IP cells in the developing cortex. MASH-1 is an old gene name as it is revised as Ascl1 (please refer to any recent papers and web databases such as Mouse Genome Informatics, and NCBI, for instance). The use of prevailed wording will help the readers to understand the presented story. *

      We have now revised the terminology according to the reviewer’s suggestion.

      Minor comments:

      Abstract Line 12-15 is confusing: What does "genotype" means?

      We used the term to refer to the genetic differences between WT and GDF15 mutant mice with respect to GDF15 expression. We apologize for the lack of clarity. We have now modified the paragraph in an effort to improve its clarity.

      Introduction Despite the focus of this paper being on the proliferation in GE, the introduction mixed up the references describing the dorsal telencephalon. It's better to cite the ventral GE as some progenitor behaviours are different from the ones in the dorsal. Maybe it's better to dedicate more to describing the lineage trajectory in the ventral GE and the molecular players (such as EGF), which makes it harder to understand the rationales of the several experiments.

      We would like to thank the reviewer for making this helpful comment. In the introduction we have tried to make two points: firstly, to clarify how the different progenitor types in the VZ can be distinguished based on the localization of their site of mitosis and secondly the importance of studying GDF15 in the context of NSCs in the subependymal zone of the lateral ventricle. For the first point we have several studies referring to dividing dynamics of radial glia in the developing cortex. This reflect the fact that many papers have studied both apical and subapical radial glia within the context of the developing cortex, unlike subapical progenitors, which were first discovered in the developing ganglionic eminence. A similar problem applies to the analysis of EGFR expression in the context of VZ progenitors, although we agree with the reviewer that it should introduced for a better understanding of our analyses. Therefore, we have now introduced several changes in our introduction to eliminate the shortcomings and to offset the imbalance in terms of citations.

      Results

      Fig1: V/SVZ -> VZ? I think V means ventricles while VZ is for the ventricular zone. Single-channel images should be presented to demonstrate the positive or negative cells for each antigen. Only a subset of progenitors in the adult SVZ is GDF15 positive although this is not described in the text.

      We have now replaced V/SVZ with V-SVZ, meaning ventricular-subventricular zone, throughout the manuscript and added single channel images to all figures where it is relevant.

      *Why the GDP15 staining was performed only in the adult sections, but not in E18 while the GFRAL is shown in both stages? The text claims "GDF15 is particularly expressed in the germinal region of the GE" but I did not find the data shown in this draft. *

      The fact that GDF15 is expressed in the choroid plexus and in the subependymal region of the lateral ventricle was first observed in the neonatal rat brain and prompted us to investigate the hypothesis that GDF15 may affect NSCs. Moreover, in our previous manuscript we have confirmed that GDF15 is expressed in neural progenitors of the embryonic murine GE (Carrillo-Garcia et al., 2014). In this new manuscript, we have complemented these data by adding the missing information concerning the expression of the protein in the adult V-SVZ. Notably, we also investigate for the first time the expression of the receptor in this area. This is key issue in the field, since the expression of GFRAL has been reported only in few regions of the brain, which is in apparent contrast with the growing list of effects in which GDF15 has been involved. For completeness of information and to further strengthen our conclusions we have now added new set of images in figure 1B, C showing co-expression of GFRAL and EGFR.

      *Line 24-25: I did not understand this statement. *

      The sentence refers to the results published in our previous paper, as mentioned in our reply above, which illustrate expression of GDF15 in the GE at different ages of development and in the adult V-SVZ. In an effort to improve its clarity, we have now modified the sentence into: “Consistent with these observations, we have previously reported that in the GE, Gdf15 transcripts increase at late developmental age and remain high in the adult V-SVZ.”

      Fig. 2 Line 33: what are apical P+ progenitors?

      We apologize for this shortcoming. P+ is the abbreviation for Prominin-1 immunopositive progenitors. This information has been now added to the text.

      *Fig. 2A: The total analysed cells are not described in M&M. *

      We have now added this information in the relevant section of the manuscript (p. 7, lines 36-43).

      *Fig 2 C and D. While the counting of apical or subapical progenitors has been done respectively, the representative images of which regions are judged as apical or subapical are not shown. This comment also applies to Line 41: I did not get the logic of how this analysis will be able to distinguish apical or subapical cell division. *

      Mitotic apical and subapical progenitors have been detected on the basis of the position of their nuclei. Namely, mitosis was considered apical if the nucleus of the dividing cell was within two nuclei distance (~ 10 µm) of the apical surface, and considered subapical if the nuclei of the dividing cells was at a greater distance from the apical surface. Besides adding this information to the manuscript, see “Image analysis” in the “Materials and Methods” section, we have now illustrated our approach in the new Fig. 2B.

      *Fig. 2 E and F: I am not sure why the proliferation was assessed in vitro whole mount cultures. IP injection in vivo animals would be more convincing. *

      We have used the same whole mount preparation to determine changes in proliferation upon acute fixation of the tissue. We have then determined the effect of growth factors and pharmacological modulators in whole-mount explants preparation as this would allow us to test their effect in standardized conditions. For the sake of consistency, we have then used the same whole mount explant setting to investigate proliferation by means of IdU incorporation. We selected this mean of analysis because changes in proliferation were already detected upon tissue fixation, and direct exposure of the tissue to the pharmacological modulators allowed us to investigate the direct effect of the drugs on proliferation behavior. Using this setting, we have obtained data that are compatible and consistent with our analysis on acutely fixed preparations. We agree with the reviewer that these experiments could be also repeated by injecting the IdU in vivo, however this would be against the current animal 3R guidelines that prompt to minimize the use of animal in vivo experiments and only when they cannot be replaced by alternative approaches in vitro or ex vivo.

      *Fig. 3 I am not sure the mitotic spindle orientation analysis is very informative to stand out as one independent figure. In some contexts (Noctor et al 2008), it does not correlate to the asymmetric or symmetric division modes. *

      We would like to like to respectfully disagree on this issue. The reason why we think this data set is important is twofold. Firstly, previous papers pointing at changes in the number of NSCs in the GE, have established that this was caused by a change in the spindle orientation leading to the generation of extra SNP (Falk et al., 2017), indicating a role for the orientation of the mitotic spindle in this context. Since we observed that GDF15 promotes not only progenitor proliferation but also apical divisions, it is important to show that this effect does not reflect a change in spindle orientation. Secondly, these data set highlights an age-dependent effect on the orientation of the mitotic spindle that is fully consistent with previously published data supporting the solidity of our findings. However, since we did not see any significant differences between the WT and Gdf15-/- animals, we have decided to move this data to a supplementary figure (new supplementary figure S3).

      *Fig. 4 I am not convinced by this data since how the fluorescent intensity is measured is not described. If the internal controls to adjust the staining variation among samples are not used, the data is not convincing to me. The representative pictures are not convincing either to claim the substantial differences. Perhaps immunoblotting is better to be employed to quantify the protein expression difference. *

      We have now added additional pictures with higher magnification to show the difference in EGFR intensity, including a calibration bar (Fig. 4). Quantitative analysis showed a trend decrease at E18 which is strongly significant in the adult V-SVZ. We now also show analysis of phEGFR and modified extensively the relative result section (see also our reply to the comment on Evidence, reproducibility and clarity of reviewer 2). Furthermore, we have added the following paragraph to the methods section:

      “For fluorescence intensity measurements of EGFR, slices stained at the same time with the same antibody solutions, and imaged on the same day with constant confocal microscope settings (laser intensity, gain, pixel dwell time), were measured using Fiji/ImageJ. Raw immunofluorescence intensity was normalized by subtracting background fluorescence levels, i.e. fluorescence in cells considered negative for EGFR. To rule out any unspecific secondary antibody binding, fluorescence was compared to slices incubated with secondary, but not primary antibodies (2nd only control); no difference was found between 2nd only control and cells considered negative in EGFR-labelled samples, or between 2nd only controls of different genotypes.”

      *Fig. 5 This is very busy figure composed of mainly counting graphs of different experiments. I think at least it is better to separate the data in vivo or culture. *

      We have now rearranged the figure according to the reviewer’s suggestion. We have moved, also according to Reviewer 2’s suggestions, some less relevant data to supplementary figure S4 (that is, previous panels G-J) and added confocal images to illustrate the results of previous panels C-E. We hope that this improved the focus and clarity of this figure.

      *Fig. 6. Pictures of Day 2 and Day 7 should be presented to highlight the difference between them. *

      We have now added pictures showing the cell culture at DIV2 and DIV7, as well as the different treatments, in Fig. 6A.

      *Fig. 7 Mash-1 should be rephrased as Ascl1. *

      We have now changed the name of the gene throughout the manuscript.

      Fig. 8 A: I am not sure why these pictures are B&W even though the two antigens are stained. The main text needs more description since no explanation of FOP, b-catenin etc. The picture of GFD15 KO looks having massive numbers of FOP+ cells, which is not correlated to the counting, I guess?

      We apologize for the lack of clarity. We have now added additional panels (Fig. 8A) to illustrate the rationale behind the analysis and to demonstrate how ependymal and single-ciliated cells were counted. We have added the following sections to the manuscript text:

      Materials and methods:

      “Both the β-catenin and fibroblast growth factor receptor 1 oncogene partner (FOP) primary antibodies are mouse monoclonal antibodies of the same immunoglobulin class. Therefore, for this double immunostaining both antigens were revealed using the same secondary antibody and each was distinguished based on the localization and morphology of the labelling, which is lining the cell boundaries or at the basal body of the cilia for β-catenin and FOP, respectively.”

      Results:

      “We here used β-catenin to label cell-cell contacts, thereby visualizing cell boundaries, and fibroblast growth factor receptor 1 oncogene partner (FOP), a centrosomal protein, to visualize the basal body of the cilia. As both β-catenin and FOP-antibodies where derived from the same host species, the antigens were labelled in a single fluorescent channel and differentiated based on label localisation and intensity (Fig. 8A). Cells with a single centrosome or centrosome pair (one to two FOP+ dots) were counted as single-ciliated (SC), whereas cells with more than two centrosomes, i.e. multiciliated cells, were counted as ependymal (Epen; Fig. 8A).”

      We have also added the following paragraph to the figure legend:

      “(A) Schematic showing counting of ependymal (Epen) and single-ciliated (SC) cells using FOP and β-catenin as markers. (a’) Closeup of WT image in (B), showing β-catenin, indicating cell-cell-contacts, and FOP, indicating ciliary basal bodies/centrosomes, in a single channel. Scale bar = 10 µm. (a’’) β-catenin and FOP labels are distinguished by location, morphology and label intensity, with FOP being single dots that are more intense than β-catenin and located within the cell boundaries. (a’’’) Cells containing one or two centrosomes were considered SC cells (red), while cells with more than two centrosomes were considered multiciliated and therefore Epen (blue).”

      We would also like to point out to the reviewer that since FOP was used as a label for the ciliary base, the “massive numbers of FOP+ cells” (i.e., multiciliated cells) were indeed quantified in Fig. 8B (now 8C) as ependymal cells (Epen).

      ** Referees cross-commenting**

      I agree with Reviewer #2's comment that despite the amount of data presented, they are not presented in a coherent manner. I would suggest revising carefully before submitting to any journals. As detailed above the manuscript has been revised to improve clarity and coherence according the reviewer’s suggestions.

      Reviewer #1 (Significance (Required)):

      *The presented finding of the role of GDF15 in the ventral progenitors are evident and a new finding has not been reported. Since the same effects and signalling pathways involved in adult hippocampus neurogenesis are previously published by the same authors, the impact of the current manuscript is limited. I think heightening the role of GDF15 in the biological context of ventral progenitors, or alternatively, making a comparison to the previous finding would greatly improve the quality of the draft. In my opinion, this work would be appealing to the community of neural stem cells but maybe not to the broad audience. My expertise is neurodevelopmental biology focusing on neuronal lineages and neurogenesis. *

      We have already clarified that the effect that we report here of GDF15 on NSCs is not only novel, but is also very different from what we have previously observed in the hippocampus (see also our reply above to the comment on evidence, reproducibility and clarity of reviewer 1). Although many environmental signals and growth factors have been implicated in the regulation of NSC proliferation and self-renewal, GDF15 is, to our knowledge, one of the few factors directly regulating the number of apical NSCs. Following the suggestion of the reviewer, we have now revised our manuscript in order to highlight the difference between the two studies. Besides being important within the field of NSCs, we believe that our data are also important for understanding the physiological role of GDF15, whose expression is increased during development and in the response to a growing list of stressors. For such an understanding, it is essential to identify target cell populations which can directly respond to the growth factor. Our finding that the GDF15 receptor is expressed in NSCs provide first evidence that GDF15 can directly modulate stem cell development, providing a first function for the increase in its expression. Moreover, our observation that GFRAL continues to be expressed in adult NSCs opens up to the possibility that the increase in the expression of the growth factor in the stress response is to recruit/modulate stem cell behavior. Consistent with this scenario, it was recently observed that brain injury promoted and increase of GDF15 expression in NSCs (Llorens-Bobadilla et al., 2015).

      • Reviewer #2 (Evidence, reproducibility and clarity (Required)): *

      * Here the authors explore the role of GDF15 during development of the adult neural stem cell niche at the lateral wall of the lateral ventricle using GDF15 knock-out mice. They find increased progenitor proliferation at neonatal stages and at 8weeks, compensated by neuronal death. Further they report that EGFR+ cells are arranged differently in the GDF15 mutants (in clusters rather than columns) with also lower levels of EGFR. This is surprising to me, as the authors observe an increase in proliferation. They then report that addition of EGF leads to an increase in prominin+ progenitors in the GDF15KO, but not the WT, but there is lower levels of EGFR in the KOs. They then block CXCR4, which is allegedly required for GDF15 to modulate EGFR expression, and they find that this blocking reduces proliferation mostly in WT cells. As can be seen from this summary, to me, the model of how GDF15 loss is supposed to increase proliferation is not clear. Even less so, when in adult SVZ, EGFR+ progenitors were increased, while EGFR was reduced at postnatal stages. Beyond this, the authors show convincingly that ependymal cells are increased at adult stages, while I see no data supporting their claim of NSCs to be increased (at least not reaching levels of significance).*

      • Taken together, this manuscript contains a lot of data, but to me no coherent picture emerges. If the picture is that the higher proliferation rate of apical progenitors at E18 generates more ependymal cells, then this should be shown (by including analysis e.g. at P5 when ependymal cells emerge). How GDF15 would affect proliferation in general is also not clear to me - maybe an unbiased analysis by RNA-seq could help to separate the main effects from diving into known candidates that seem not to explain the main aspects.*

      The reviewer mentions multiple aspects of our study that we would like to clarify. Therefore, we apologize for our lengthy reply.

      Firstly, the apparent contradiction between the increase in progenitor proliferation despite the concomitant decrease in EGFR levels. It is long known activation of EGFR regulates multiple aspects of progenitor behavior including proliferation, migration and differentiation. It is also known that responsiveness of NSCs to EGF increases during development, a process that is paralleled by an increase in expression of EGFR expression increase with developmental age, peaking around the perinatal age. However, since NSCs start to slow their cell cycle and enter quiescence exactly at the same time in which the increase in responsiveness to EGF and in EGFR expression in NSCs during this same period, it is clear that there is not a linear correlation between NSC proliferation and EGFR expression. A possible explanation for this apparently counterintuitive observation is that the increase in EGFR expression is paralleled by an increase in the expression of Lrig1, a developmental negative regulator of EGFR (Jeong et al., 2020). Moreover, in our study we report that lack of GDF15 leads to a decrease in the expression of EGFR protein and not in the levels of EGFR mRNA. In light of the well-known feedback mechanism by which in the presence of high EGFR activation the receptor transits to late endosome for degradation, a decrease in the protein levels could actually represent a higher level of activation EGFR signalling in the mutant progenitors than in the wild type counterpart. This is consistent with the characteristics of punctuate EGFR immunostaining we see in the mutant tissue and our analysis of EGFR activation. Our data show that despite difference in activation kinetics, wild type and mutant progenitors similarly respond to exogenous stimulation with EGF. Moreover, there is no difference between the two genotypes in the expression of EGFR in mitotic cells, and blockade of EGFR more dramatically affects the proliferation of mutant than WT progenitors. Finally, exposure to exogenous EGF promotes the proliferation of WT but not mutant progenitors. Taken together, these observations suggest that endogenous activation of EGFR driving proliferation is higher in mutant than WT progenitors. Consistent with this hypothesis, our new data illustrated in Fig. 5A-G of the revised manuscript, show that EGFR is similarly phosphorylated in mutant and in WT progenitors and that levels of Phospho-EGFR are observed in regions with low levels of EGFR expression, especially in the postnatal V-SVZ.

      With respect to the effect of CXCR4, we have investigated its effect with respect to the ability of GDF15 to promote EGFR expression at the cell surface and secondly with respect to affect proliferation in vivo and in vitro. Both experiments reveal a permissive role of the receptor, whose activity is necessary for GDF15 to promote EGFR expression at the cell surface and for cell to undergo proliferation. While these observations confirm in part our previously published data, the molecular mechanisms underlying these effects remain unclear. However, since AMD on its own does not affect EGFR expression in either WT or mutant progenitors, the two effects are not related. Despite the absence of a clear mechanism by which CXCR4 affects proliferation, our data indicate that the permissive effect of CXCR4 is more important for the proliferation of TAPs rather than for NSCs. Therefore, the different effect of CXCR4 inhibition between WT and mutant progenitors likely reflect the fact that the latter are enriched in NSCs.

      Finally, the evidence that NSCs are significantly increased in the mutant V-SVZ is reported in Fig. 8. In this figure, it is clearly reported that compared to the WT counterpart at early postnatal stages, only the multiciliated ependymal cells are significantly increased in the mutant niche, whereas uniciliated progenitors display only a trend increase (Panel C). However, the total number of apical cells is increased in the mutant V-SVZ, indicating that the number of both cell types are likely increased. Consistent with this hypothesis, in panel G of the same figure we show that in the adult V-SVZ, when the ependymal cells are fully differentiated, also apical GFAP+ NSCs are significantly increased. Notably, in this figure we show that GFAP+ NSCs also display a primary cilium, an elongated morphology and lack multiple cilia, and therefore are not atypical ependymal cells. Finally, in supplementary table S6, we show no difference in terms of % of clone forming cells between dissociated cell preparations of the WT and mutant V-SVZ. These observations and our finding of increased Ki67 apical expression in the adult V-SVZ, illustrated in supplementary figure S2B, clearly show that apical NSCs are increased.

      We have now introduced multiple modification in text and figures to clarify the mechanisms underlying the effect of GDF15 ablation on EGFR expression and activation and the differential effect of CXCR4 on WT and mutant progenitors. The new data set illustrating phosphoEGFR are illustrated in figure 4B, G. We have also modified figure 8 in an effort to illustrate more clearly the effect of lack of GDF15 on NSC number.

      *Major comments: *

      *1) Inconsistencies start already in Figure 1: The authors show expression of the receptor at neonatal stages (much higher) and adult stages, but GDF15 is shown only in adult stages and the citations of their previous work suggests that indeed it may not be present at this early stage in the GE VZ (p.8, line 10). If it is, please show. If it isn't, could it be that it is in the CSF and signals only to apical cells? *

      As the reviewer rightly mentions, GDF15 is present in the CSF and signals mainly to apical cells, as it is known to be secreted by the choroid plexus (Böttner et al., 1999; Schober et al., 2001). However, we would like to respectfully disagree with the reviewer. In our previous work, we clearly showed that GDF15 expression increases at E16 and is highest at E18 in the GE, which is the reason we specifically chose this timepoint for analysis (compare Carrillo-Garcia et al. (2014), Fig. 1A). In this manuscript we have also shown that EGFR expressing progenitors in the GE express GDF15. As the expression of GDF15 at embryonic and neonatal ages has already been investigated by us and others for two decades (see also Schober et al. (2001)), we refrained from showing expression of GDF15 at these ages again. However, we have now modified the relevant result section to clearly highlight the existence of this previous findings.

      *2) An overview of the KO phenotype by lower power pictures would be helpful. For example an overview over the GE and PH3 immunostaining WT and KO at comparable section levels. *

      Our analysis is based on whole-mount preparation of the whole GE. To standardize our analysis the same number of pictures were taken at similar locations to obtain a quantification representative of the apical surface of the whole GE. Therefore, the areas of interest were not selected on the basis of the number of mitotic cells and the differences observed do not reflect a positional effect. Lower power pictures illustrating the whole GE, are unlikely to be helpful, because they would not show the nuclear immunostaining. However, we have now modified the relevant Material and Methods section as follows to describe the standardization of our quantitative analysis: “Whole mounts were imaged using a Leica TCS SP8 confocal microscope with a 40x or 63x oil immersion objective and LASX software (Leica). For the quantification, an average of three different regions of interest were chosen at fixed rostral, dorsal and ventral position of the GE or V-SVZ and averaged for the collection of a single data set.”

      * 3) Figure 2B- where is the apical surface, where are we in the GE? Where was quantification done? *

      We have now added images detailing the localization of apical and subapical cells in new Fig. 2A, as well as further clarifications of the imaging and quantification in the materials and methods section.

      * 4) Clarify the part with EGF signaling and/or take a more comprehensive view by a proteomic or transcriptomic approach, as EGFR and CXCR4 which were already investigated previously, may not explain the phenotype. *

      We agree with the reviewer that our data should prompt a more comprehensive approach. However, this is surely a work worthy of a separate manuscript, since we agree with the reviewer that changes in EGFR and CXCR4 do not fully explain the effect of GDF15 on proliferation. We have now clarified our conclusions about EGF signalling, modifying the relevant part in the result section. We have also modified the abstract as follows:

      “From a mechanistic point of view, we show that active EGFR is essential to maintain proliferation in the developing GE and that GDF15 affects EGFR trafficking and signal transduction. Consistent with a direct involvement of GDF15, exposure of the GE to the growth factor normalized proliferation and EGFR expression and it decreased the number of apical progenitors. A similar decrease in the number of apical progenitors was also observed upon exposure to exogenous EGF. However, this effect was not associated with reduced proliferation, illustrating the complexity of the effect of GDF15.”

      *5) Do the authors actually think that the effects on EGFR are in the cells expressing the GDF15 receptor? Then please show co-localization. *

      As both EGFR and GFRAL are widely expressed in the embryonic GE (see Figs 1B and 4B), making overlap inevitable, we did previously not assume the need to show co-localization. We have now added images showing co-localization of EGFR and GFRAL in E18 and adult brain sections in Fig. 1B.

      *6) Figure 5D shows virtually no apical mitosis in WT, but indeed there are apical mitosis in WT E18 GE as one can also see in panel 5A. *

      We apologize for the confusion. In the manuscript, we use Ki67 and analysis of nuclear morphology to determine the number of cells undergoing cell division, i.e. in meta-, ana- or telophase and immunostaining with antibody with phH3+, which stains additionally cells also at late G2 and early mitotic stages. Consistent with this, the number of mitotic cells scored with Ki67 and quantified in Fig. 5D is smaller than the number of phH3+ cells that is illustrated in Fig. 5A. Throughout the manuscript, cells labeled by phH3 immunoreactivity are named “phH3+ cells”, as quantified in Fig. 5B, whereas with “dividing cells” we refer to cells with Ki67 labeling that show nuclear morphology of meta-, ana- or telophase. We have, also according to the suggestions of reviewer 1, added images of the whole mounts analyzed for Fig. 5D, as well as the following text in the materials and methods section: “Cells were considered dividing if the nuclei were labelled with Ki67 and the nuclear morphology showed signs of division, i.e. meta-, ana- or telophase, in DAPI and Ki67-channels. For the sake of clarity, “dividing cells” only refers to this way of detection, while cells positive for phH3 are termed “phH3+ cells”, as phH3 also labels cells in interphase and prophase, as well as late G2 phase.”

      *7) For the effect on ependymal cell generation it could be good to include an intermediate age, such as P5-7, when ependymal cells differentiate, staining e.g. for Lynkeas or Mcidas, known fate determinants regulating ependymal cell differentiation at that time. *

      Most of our research was performed in either E18 or adult animals, where ependymal cells are either not yet present or already fully differentiated. Since ependymal cell differentiation starts at birth, we used P2 animals to look at ependymal cell differentiation. As shown in Fig. 8B, C this age is appropriate to study early ependymal differentiation, as a lot of multiciliated ependymal cells are already present at this age, and the difference between WT and Gdf15-/- animals is clearly visible and significant. While another age or additional markers might be interesting, we argue that it would not add to the conclusion or significance of this paper, as we can see this phenotype already at age P2 and it can still be detected it in adult animals.

      *Minor comments: *

      *-) p. 8, subapical progenitors are mentioned in line 42 without explaining how they are defined. *

      We have now added more detailed definitions of apical and subapical progenitors to the introduction.

      *-) p.8, line 44: the word increased in mentioned 2x *

      We have removed the additional word.

      *-) In the description of Figure 8 C and D seem to have been mixed up. *

      We have changed the description of Fig. 8.

      * ** Referees cross-commenting***

      *I also fully agree with the point that this manuscript is very difficult to read. I think that anyhow the results have to be reorganized to focus on the most important data, so rewriting will have to be done for clarity either way. *

      We apologize for the lack of clarity we have now extensively modified and re-edited the manuscript in an effort to improve its clarity.

      * Reviewer #2 (Significance (Required)): *

      * Exploring signmalling factors important for the stem cell niche is important, and the GDF15 indeed seems to have an effect there. The problem is, that much has been done with this factor already, but of course a mechanistic understanding of whats going on is important and could be the strength of this manuscript. However, it is really not clear, which mechanisms causes what. What is clear, is that the increased proliferation of neuronal progenitors is counterbalanced by death. Its also clear that ependymal cells are increased, which is an interesting effect. But how and why is not clear and may be the best to focus in this paper. *

      As the reviewer mentions, several publications focus on GDF15. However, there is only one publication investigating the effect of GDF15 on neural stem cells and this focuses on the hippocampus. Therefore, we would like to respectively disagree with the conclusion of the reviewer “that much has been done with this factor”. Moreover, a serious problem with previous studies investigating GDF15 is the fact that its receptor is scarcely expressed and therefore it is not clear if these studies investigate direct or indirect effects of the growth factor. Since we here for the first time show that neural stem cells in the GE and V-SVZ express GDF15-receptor GFRAL, our study for the first time show a direct involvement of GDF15 on proliferation, number of ependymal cells and, as detailed in our reply above, apical NSCs. This knowledge is not only relevant to the field of normal and cancer stem cells, but also within the context of the role of GDF15 as mitokine and as stress hormone (see also our reply to major comments 2 of reviewer 1). Therefore, although we agree with the reviewer that the molecular mechanisms underlying the effect of GDG15 need further investigation, our data are novel and of relevance to the general scientific community.

      References:

      Böttner, M., Suter-Crazzolara, C., Schober, A., Unsicker, K., 1999. Expression of a novel member of the TGF-beta superfamily, growth/differentiation factor-15/macrophage-inhibiting cytokine-1 (GDF-15/MIC-1) in adult rat tissues. Cell Tissue Res 297, 103-110.

      Carrillo-Garcia, C., Prochnow, S., Simeonova, I.K., Strelau, J., Hölzl-Wenig, G., Mandl, C., Unsicker, K., von Bohlen Und Halbach, O., Ciccolini, F., 2014. Growth/differentiation factor 15 promotes EGFR signalling, and regulates proliferation and migration in the hippocampus of neonatal and young adult mice. Development 141, 773-783.

      Falk, S., Bugeon, S., Ninkovic, J., Pilz, G.A., Postiglione, M.P., Cremer, H., Knoblich, J.A., Gotz, M., 2017. Time-Specific Effects of Spindle Positioning on Embryonic Progenitor Pool Composition and Adult Neural Stem Cell Seeding. Neuron 93, 777-791 e773.

      Jeong, D., Lozano Casasbuenas, D., Gengatharan, A., Edwards, K., Saghatelyan, A., Kaplan, D.R., Miller, F.D., Yuzwa, S.A., 2020. LRIG1-Mediated Inhibition of EGF Receptor Signaling Regulates Neural Precursor Cell Proliferation in the Neocortex. Cell Rep 33, 108257.

      Llorens-Bobadilla, E., Zhao, S., Baser, A., Saiz-Castro, G., Zwadlo, K., Martin-Villalba, A., 2015. Single-Cell Transcriptomics Reveals a Population of Dormant Neural Stem Cells that Become Activated upon Brain Injury. Cell Stem Cell 17, 329-340.

      Schober, A., Böttner, M., Strelau, J., Kinscherf, R., Bonaterra, G.A., Barth, M., Schilling, L., Fairlie, W.D., Breit, S.N., Unsicker, K., 2001. Expression of growth differentiation factor-15/ macrophage inhibitory cytokine-1 (GDF-15/MIC-1) in the perinatal, adult, and injured rat brain. J Comp Neurol 439, 32-45.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Here the authors explore the role of GDF15 during development of the adult neural stem cell niche at the lateral wall of the lateral ventricle using GDF15 knock-out mice. They find increased progenitor proliferation at neonatal stages and at 8weeks, compensated by neuronal death. Further they report that EGFR+ cells are arranged differently in the GDF15 mutants (in clusters rather than columns) with also lower levels of EGFR. This is surprising to me, as the authors observe an increase in proliferation. They then report that addition of EGF leads to an increase in prominin+ progenitors in the GDF15KO, but not the WT, but there is lower levels of EGFR in the KOs. They then block CXCR4, which is allegedly required for GDF15 to modulate EGFR expression, and they find that this blocking reduces proliferation mostly in WT cells. As can be seen from this summary, to me, the model of how GDF15 loss is supposed to increase proliferation is not clear. Even less so, when in adult SVZ, EGFR+ progenitors were increased, while EGFR was reduced at postnatal stages. Beyond this, the authors show convincingly that ependymal cells are increased at adult stages, while I see no data supporting their claim of NSCs to be increased (at least not reaching levels of significance). Taken together, this manuscript contains a lot of data, but to me no coherent picture emerges. If the picture is that the higher proliferation rate of apical progenitors at E18 generates more ependymal cells, then this should be shown (by including analysis e.g. at P5 when ependymal cells emerge). How GDF15 would affect proliferation in general is also not clear to me - maybe an unbiased analysis by RNA-seq could help to separate the main effects from diving into known candidates that seem not to explain the main aspects.

      Major comments:

      1. Inconsistencies start already in Figure 1: The authors show expression of the receptor at neonatal stages (much higher) and adult stages, but GDF15 is shown only in adult stages and the citations of their previous work suggests that indeed it may not be present at this early stage in the GE VZ (p.8, line 10). If it is, please show. If it isn't, could it be that it is in the CSF and signals only to apical cells?
      2. An overview of the KO phenotype by lower power pictures would be helpful. For example an overview over the GE and PH3 immunostaining WT and KO at comparable section levels.
      3. Figure 2B- where is the apical surface, where are we in the GE? Where was quantification done?
      4. Clarify the part with EGF signaling and/or take a more comprehensive view by a proteomic or transcriptomic approach, as EGFR and CXCR4 which were already investigated previously, may not explain the phenotype.
      5. Do the authors actually think that the effects on EGFR are in the cells expressing the GDF15 receptor? Then please show co-localization.
      6. Figure 5D shows virtually no apical mitosis in WT, but indeed there are apical mitosis in WT E18 GE as one can also see in panel 5A.
      7. For the effect on ependymal cell generation it could be good to include an intermediate age, such as P5-7, when ependymal cells differentiate, staining e.g. for Lynkeas or Mcidas, known fate determinants regulating ependymal cell differentiation at that time.

      Minor comments:

      • p. 8, subapical progenitors are mentioned in line 42 without explaining how they are defined.
      • p.8, line 44: the word increased in mentioned 2x
      • In the description of Figure 8 C and D seem to have been mixed up.

      ** Referees cross-commenting**

      I also fully agree with the point that this manuscript is very difficult to read. I think that anyhow the results have to be reorganized to focus on the most important data, so rewriting will have to be done for clarity either way.

      Significance

      Exploring signmalling factors important for the stem cell niche is important, and the GDF15 indeed seems to have an effect there. The problem is, that much has been done with this factor already, but of course a mechanistic understanding of whats going on is important and could be the strength of this manuscript. However, it is really not clear, which mechanisms causes what. What is clear, is that the increased proliferation of neuronal progenitors is counterbalanced by death. Its also clear that ependymal cells are increased, which is an interesting effect. But how and why is not clear and may be the best to focus in this paper.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      This paper illustrates the role of GDF15 in ganglionic eminence featuring the influence on neurogenesis and progenitor proliferation. Using the conventional knockout GDF-15 mouse lines, the authors provide a series of counting data indicating that GDF15 controls neurogenesis in the late embryonic or adult neural stem cells in the ventral forebrain.

      Major comments:

      The entire story in this manuscript seems similar to the previous findings where the authors demonstrated the role of GDF15 in the hippocampal neural stem cells in relation to EGF and CXCR4.

      The data and the conclusion presented here sound reasonable to me. The current manuscript, however, gave me the impression that the story is less impactful and rather descriptive. To improve the quality of the current draft, the authors may wish to clearly highlight the novelty of the findings, not simply apply the previous strategy to the other anatomical brain regions. Alternatively, the draft could emphasize the similarity of utilising the same biological strategies to control the number of adult stem cells in the distinct stem cell niche.

      I also have two concerns which may help to improve the current draft.

      Firstly, I would suggest considering the data presentation as many of the counting data are not accompanied by representative images or a detailed description of the methods, which could impede the credibility of the data. For instance, it is not clear to me how the authors judged the apical vs subapical progenitor counting as neither the pictures nor the methods clearly specified how these are distinguished. Same to the Figures 3 and 8.

      I would also suggest the authors may wish to carefully review the text as many abbreviations are not properly stated (for example, what are P+ progenitors?), or not properly explained why the particular gene expression is analysed (EGF, Sox2, CXCR4). This is also applied to the anatomical jargon (like apical, subapical etc), which can be specified in the figure by introducing the cartoons or point-on images.

      Last not least, I should point out that the author uses less commonly used terminology. To my knowledge, the SVZ progenitors in the GE are now called basal progenitors (Bandler et al 2017 for example) and the word intermediate progenitors is used for the Tbr2+ IP cells in the developing cortex. MASH-1 is an old gene name as it is revised as Ascl1 (please refer to any recent papers and web databases such as Mouse Genome Informatics, and NCBI, for instance). The use of prevailed wording will help the readers to understand the presented story.

      Minor comments:

      Abstract Line 12-15 is confusing: What does "genotype" means?

      Introduction Despite the focus of this paper being on the proliferation in GE, the introduction mixed up the references describing the dorsal telencephalon. It's better to cite the ventral GE as some progenitor behaviours are different from the ones in the dorsal.

      Maybe it's better to dedicate more to describing the lineage trajectory in the ventral GE and the molecular players (such as EGF), which makes it harder to understand the rationales of the several experiments.

      Results

      Fig1: V/SVZ -> VZ? I think V means ventricles while VZ is for the ventricular zone

      Single-channel images should be presented to demonstrate the positive or negative cells for each antigen. Only a subset of progenitors in the adult SVZ is GDF15 positive although this is not described in the text. Why the GDP15 staining was performed only in the adult sections, but not in E18 while the GFRAL is shown in both stages? The text claims "GDF15 is particularly expressed in the germinal region of the GE" but I did not find the data shown in this draft.

      Line 24-25: I did not understand this statement.

      Fig. 2 Line 33: what are apical P+ progenitors ?

      Fig. 2A: The total analysed cells are not described in M&M.

      Fig 2 C and D. While the counting of apical or subapical progenitors has been done respectively, the representative images of which regions are judged as apical or subapical are not shown. This comment also applies to Line 41: I did not get the logic of how this analysis will be able to distinguish apical or subapical cell division.

      Fig. 2 E and F: I am not sure why the proliferation was assessed in vitro whole mount cultures. IP injection in vivo animals would be more convincing.

      Fig. 3 I am not sure the mitotic spindle orientation analysis is very informative to stand out as one independent figure. In some contexts (Noctor et al 2008), it does not correlate to the asymmetric or symmetric division modes.

      Fig. 4 I am not convinced by this data since how the fluorescent intensity is measured is not described. If the internal controls to adjust the staining variation among samples are not used, the data is not convincing to me. The representative pictures are not convincing either to claim the substantial differences. Perhaps immunoblotting is better to be employed to quantify the protein expression difference.

      Fig. 5 This is very busy figure composed of mainly counting graphs of different experiments. I think at least it is better to separate the data in vivo or culture.

      Fig. 6. Pictures of Day 2 and Day 7 should be presented to highlight the difference between them.

      Fig. 7 Mash-1 should be rephrased as Ascl1.

      Fig. 8 A: I am not sure why these pictures are B&W even though the two antigens are stained. The main text needs more description since no explanation of FOP, b-catenin etc. The picture of GFD15 KO looks having massive numbers of FOP+ cells, which is not correlated to the counting, I guess? written

      ** Referees cross-commenting**

      I agree with Reviewer #2's comment that despite the amount of data presented, they are not presented in a coherent manner. I would suggest revising carefully before submitting to any journals.

      Significance

      The presented finding of the role of GDF15 in the ventral progenitors are evident and a new finding has not been reported. Since the same effects and signalling pathways involved in adult hippocampus neurogenesis are previously published by the same authors, the impact of the current manuscript is limited. I think heightening the role of GDF15 in the biological context of ventral progenitors, or alternatively, making a comparison to the previous finding would greatly improve the quality of the draft. In my opinion, this work would be appealing to the community of neural stem cells but maybe not to the broad audience. My expertise is neurodevelopmental biology focusing on neuronal lineages and neurogenesis.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      General comments:

      We thank the reviewers for recognizing the importance of our work and for their supportive and insightful comments.

      Our planned revisions focus on addressing all the comments and especially in further elucidating the molecular mechanism underpinning our observations, their consequences for cell phenotypes and reproducing our observations in an additional cell line. Our revision plan is backed up in many cases by preliminary data.

      Our submitted manuscript demonstrated that DNMT3B’s recruitment to H3K9me3-marked heterochromatin was mediated by the N-terminal region of DNMT3B. Data generated since submission suggest that DNMT3B binds indirectly to H3K9me3 nucleosomes through an interaction mediated by a putative HP1 motif in its N-terminal region.

      Specifically, we have found that DNMT3B can pull down HP1a and H3K9me3 from cell extracts and that this interaction is abrogated when we remove the N-terminal region of DNMT3B (revision plan, figure 1a). Using purified proteins in vitro, we have shown binding of DNMT3B to HP1a that is dependent on the presence of DNMT3B’s N-terminus suggesting that the interaction with HP1a is direct and that this mediates DNMT3B’s recruitment to H3K9me3 (revision plan, figure 1b). Alphafold multimer modelling identified that DNMT3B's N-terminus binds the interface of a HP1 dimeric chromoshadow domain through a putative HP1 motif. Two point mutations in this motif ablate DNMT3B’s interaction with HP1a in vitro (revision plan, figure 1b - DNMT3B L166S I168N).

      We propose to further characterize DNMT3B’s interaction with HP1a in vitro and determine the significance of these observations in cells by microscopy in a revised manuscript. Together with the other proposed experiments and analyses, we believe the extra detail regarding the molecular mechanisms through which DNMT3B is recruited to H3K9me3 heterochromatin will help address the reviewer’s comments.

      Point by point response:

      We have reproduced the reviewer’s comments in their entirety and highlighted them in blue italics.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): Summary:

      This paper by Francesca Taglini, Duncan Sproul, and their coworkers, examines the mechanisms of DNA methylation in a human cancer cell line. They use the human colorectal cancer line HCT116, which has been very widely used to look at epigenetics in cancer, and to dissect the contribution of different proteins and chromatin marks to DNA methylation.

      The authors focus on the role of the de novo methyltransferase DNMT3B. It has been shown in ES cells in 2015 that its PWWP domain directs it to H3K36me3, typically found in gene bodies. More recently, the authors showed similar conclusions in colorectal cancer (Masalmeh Nat Comm 2021). Here they examine, more specifically, the role of the PWWP. The conclusions are described below.

      Major comments:

      • *1-I feel that this paper has several messages that are somewhat muddled. The main message, as expressed in the title and in the model, is that the PWWP domain of DNMT3B actively drags the protein to H3K36me3-marked regions. Inactivation of this domain by a point mutation, or removal of the Nter altogether, causes DNMT3B to relocate to other genomic regions that are H3K9me3-rich, and that see their DNA methylation increase in the mutant conditions. This first message is clear.

      We thank the reviewer for their positive comments on our observations. However, we note that our results suggest that removal of the N-terminal region has a different effect to point mutations in the PWWP domain. The data we present suggest that the N-terminus facilitates recruitment to H3K9me3 regions.

      The second message has to do with ICF. A mutant form of DNMT3B bearing a mutation found in ICF, S270P, is actually unstable and, therefore, does not go to H3K9me3 regions. I feel that here the authors go on a tangent that distracts from message #1. This could be moved to the supp data. At any rate, HCT116 are not a good model for ICF. In addition, a previous paper has looked at the S270P mutant, and it did not seem unstable in their hands (Park J Mol Med 2008, PMID: 18762900). So I really feel the authors do not do themselves a favor with this ICF angle.

      While we agree with the reviewer that HCT116 cells as a cancer cell line are not a good model for ICF1 syndrome, our observation that S270P destabilizes DNMT3B is important to consider in the context of this disease. In addition, the S270P mutant was reported to abrogate the interaction between DNMT3B and H3K36me3 (Baubec et al 2015 Nature PMID: 25607372) making it important to compare it to the other mutations we examine. In our revised version of the manuscript, we propose to move these data to the supplementary materials and add a statement to the discussion noting the caveat that HCT116 cells are likely not to model many aspects of ICF1.

      With regard to the differences between our results and that of Park et al, we note that stability of the S270P mutant was not assessed in that study whereas we directly assess stability in vitro and in cells. We propose to add discussion of this previous study to the revised manuscript.

      2-I feel that some major confounders exist that endanger the conclusions of the work. The most worrisome one, in my opinion, is the amount of WT or mutant DNMT3B in the cells. It is clear in figure 4C that the WT rescue construct is expressed much more than the W263A mutant (around 3 or 4 times more). Unless I am mistaken, we are never shown how the level of exogenous rescue protein compares to the level of DNMT3B in WT cells. This bothers me a lot. If the level is too low, we may have partial rescue. If it is too high, we might have artifactual effects of all that DNMT3B. I would also like to see the absolute DNA methylation values (determined by WGBS) compared to the value found in WT. From figure S1A, it looks like WT is aroun 80% methylation, and 3BKO is around 77% or so. I wonder if the rescue lines may actually have more methylation than WT?

      The rescue cell lines do express DNMT3B to a greater level than observed endogenously. In our manuscript we controlled for this effect by generating the knock-in W263A cells and, as reported in the manuscript, we observe similar effects to the rescue cells (manuscript, figure 2d) suggesting that our observations are not driven by the overexpression.

      We also expressed ectopic DNMT3B from a weaker promoter (EF1a) in DNMT3B KO cells but did not include these data in the submitted manuscript. We have previously shown that this promoter expresses DNMT3B at lower levels than the CAG promoter used in the submitted manuscript (Masalmeh et al 2021 Nature Communications PMID: 33514701). Bisulfite PCR of representative non-repetitive loci within heterochromatic H3K9me3 domains show that we observe similar gains of methylation with DNMT3BW263A (revision plan, figure 2).

      Revision plan figure 2. Expression of DNMT3BW236A from a weaker promoter leads to increased DNA methylation at selected H3K9me3 loci. Barplot of mean methylation by BS-PCR at H3K9me3 loci alongside the H3K4me3-marked BRCA2 promoter in DNMT3B mutant cells were DNMT3B is expressed from the EF1 promoter. P-values are from two-sided Wilcoxon rank sum tests.

      To reinforce that our conclusions are not solely a result of the level of DNMT3B expression, we propose to include these data in the revised manuscript.

      The reviewer is also correct that by WGBS, the rescue cell lines have higher levels of overall DNA methylation than HCT116 cells. We will note this in revised manuscript and include HCT116 cells in a revised version of Figure S1e.

      3-I guess the unarticulated assumption is that the gain of DNA methylation seen at H3K9me3 region upon expression of a mutant DNMT3B is due to DNMT3B itself. But we do not know this for sure, unless the authors test a double mutant (PWWP inactive, no catalytic activity). I am not necessarily asking that they do it, but minimally they should mention this caveat.

      The hypothesis that the gains in DNA methylation at H3K9me3 loci result from the direct catalytic activity of DNMT3B is supported by our observation that a catalytic dead DNMT3B does not remethylate heterochromatin (manuscript, figures 1d and e). However, we acknowledge that we have not formally shown that the additional DNA methylation seen with DNMT3BW263A are a direct result of its catalytic activity. We will conduct an analysis of the effect of catalytically dead DNMT3BW263A on DNA methylation at Satellite II and selected H3K9me3 loci and include this in the revised manuscript.

      4-I am confused as to why the authors look at different genomic regions in different figures. In figure 1 we are looking at a portion of the "left" arm of chr 16. But in figure 2B, we now look at a portion of the "right" arm of the same chromosome, which has a large 8-Mb block of H3K9me3, and is surprisingly lowly methylated in the 3BKO. This seems quite odd, and I wonder if there is a possible artifact, for instance mapping bias, deletion, or amplification in HCT116. Showing the coverage along with the methylation values would eliminate some of these concerns.

      By choosing different regions of the genome for different figures, we intended to reassure the reader that our results were not specific to any one region of the genome. In the revised manuscript, we propose to display a consistent genomic region between these figures.

      With regard to the low levels of DNA methylation in H3K9me3 domains in DNMT3B KO cells, H3K9me3 domains are partially methylated domains which have reduced methylation in HCT116 cells (see page 5 of the manuscript):

      … we found that hidden Markov model defined H3K9me3 domains significantly overlapped with extended domains of overall reduced methylation termed partially methylated domains (PMDs) defined in our HCT116 WGBS (Jaccard=0.575,p=1.07x10-6, Fisher’s test).

      These domains lose further DNA methylation in DNMT3B KO cells leading to the low methylation level noted by the reviewer. The methylation percentages calculated from WGBS are based on the ratio of methylated to total reads. Thus, a lack of coverage generates errors from division by zero rather than the low values observed in this domain in DNMT3B KO cells.

      We include a modified version of figure 2b from the manuscript below. This includes coverage for the 3 cell lines (revision plan, figure 3). Although WGBS coverage is slightly reduced in H3K9me3 domains, reads are still present and overall coverage equal between different cell lines.

      While we could potentially include the coverage tracks in revised versions of figures, we note that doing so for multiple cell lines would make these figures extensively cluttered and it would likely be difficult to observe the differences in DNA methylation in these figure panels due to shrinkage of the other tracks.

      Minor comments:

      1-The WGBS coverage is not very high, around 2.5X on average, occasionally 2X. I don't believe this affects the findings, as the authors look at large H3K9me3 regions. But the info in table S2 was hard to find and it is important. I would make it more accessible.

      In the revised manuscript we will specify the mean coverage in the text to ensure this is clearer.

      2-It would be nice to have a drawing showing exactly what part of the Nter was removed.

      We will add this in the figure in the revised manuscript.

      3-some figures could be clearer. I was not always sure when we were looking at a CRISPR mutant clone (W263A) versus a piggyBac rescue.

      In the revised manuscript we will clarify in the figure labels to ensure it is clear which data were generated using CRISPR clones.

      4-unless I am mistaken, all the ChIP-seq data (H3K9me3, H3K36me3 etc) come from WT cells. It is not 100% certain that they remain the same in the 3BKO, is it? This should be discussed.

      We performed ChIP-seq on both HCT116 and 3BKO cell lines and used ChIP-seq data from the 3BKO cell line for the rescue experiments where DNMT3Bs were expressed in 3BKO cells. We will ensure this is clearer in the revised version.

      Reviewer #1 (Significance (Required)):

      Strengths:

      The experiments are for the most part well done and well interpreted (save for the limitations mentioned above). The techniques are appropriate and well mastered by the team. The paper is well written, the figures are nice. The authors know the field well, which translates into a good intro and a good discussion. The bioinformatics are convincing.

      Limitations:

      All the work is done in a single cancer cell line. One might assume the conclusions will hold in other systems, but there is no certainty at this point.

      We acknowledge this limitation. To demonstrate that our results are applicable beyond HCT116 cells, we will include analysis of experiments on an independent cell line in the revised manuscript.

      HCT116 are not the best model system to study ICF, which mostly affects lymphocytes

      At present, I feel that the biological relevance of the findings is fairly unclear. The authors report what happens when DNMT3B has no functional PWWP domain. I am convinced by their conclusions, but what do they tell us, biologically? Are there, for instance, mutant forms of DNMT3B expressed in disease that have a mutant PWWP? Are there isoforms expressed during development or in certain cell types that do not have a PWWP? In these cell types, does the distribution of DNA methylation agree with what the authors predict?

      As stated in response to point 1, although we acknowledge the limitations of HCT116 cells as a model of ICF, we believe are finding that the S270P mutation results in unstable DNMT3B are still important to consider for ICF syndrome.

      We are not aware of reports of mutations affecting the residues of DNMT3B’s PWWP domain we have studied. Our preliminary analysis suggests that although mutations in DNMT3B’s PWWP domain are frequent, residues in the aromatic cage such as W263 and D266 are absent from the gnomAD catalogue (Karczewski et al 2020 Nature, PMID: 32461654). This suggests that they are incompatible with healthy human development.

      A number of different DNMT3B splice isoforms have been reported. These include DDNMT3B4 which lacks the PWWP domain and a portion of the N-terminal region (Wang et al 2006 International Journal of Oncology, PMID: 16773201). DDNMT3B4 is proposed to be expressed in non-small cell lung cancer (Wang et al 2006 Cancer Research, PMID: 16951144).

      We will include analysis of gnomAD and discussion of these points in the revised manuscript.

      In its present state, I feel the appeal of the findings is towards a semi-specialized audience, that is interested in aberrant DNA methylation in cancer and other diseases. This is not a small audience, by the way.

      We thank the reviewer for their comments and the suggestion that our findings are of interest to a cross-section of researchers.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Note, we have added numbers to the comments made by reviewer 2 to aid cross-referencing.

      In this manuscript, Taglini et al., describe an increased activity of DNMT3B at H3K9me3-marked regions in HCT cells. They first identify that DNA methylation at K9me3-marked regions is strongly reduced in absence of DNMT3B. Next, the authors re-express DNMT3B and DNMT3B mutant variants in the DNMT3B-KO HCT cells and assess DNA methylation by WGBS where they identify a strong preference for re-methylation of K9me3 sites. Based on genome-wide binding maps for DNMT3B, including the mutant variants, they address how the localization of DNMT3B relates to the observed changes in methylation.

      Major points:

      • The authors show increased reduction of mCG at H3K9me3 (and K27me3) sites in absence of DNMT3B. This is based on correlating delta %mCG with histone modifications in 2kb bins. I find this approach to not fully support the major claim. First, the correlation coefficients are very small -0.124 for K9me3 and -0.175 for K27me3, and just marginally better compared to, for example, K36me3 that does not seem to have any influence on mCG according to Sup Fig S1b. While I agree that mCG seems more reduced at K9me3 in absence of DNMT3B (e.g. in Fig 1a), is there a better way to visualize the global effect? The delta mCG Boxplots based on bins are not ideal (this applies to many figures using the same approach in the current manuscript).*

      Our choice to examine the global effects using correlations in windows across the genome was motivated by similar previous analyses in other studies (for example: Baubec et al. 2015 Nature PMID 25607372, Weinberg at al 2021 Nature PMID:33986537, Neri et al 2017 Nature PMID: 28225755). These global analyses result in modest correlation coefficients because the vast majority of genomic windows are negative for a given mark. For this reason, we included specific analyses of H3K36me3, H3K9me3 and H3K27me3 domains in the manuscript (eg manuscript figure 1b, c and d) which reinforce the conclusions drawn from our global analyses.

      However, we acknowledge that while our data support a specific activity at H3K9me3 marked heterochromatin, these are not the only changes in DNMT3B KO cells as DNMTs are promiscuous enzymes that are localized to multiple genomic regions. We will add discussion of this point to the revised manuscript.

      2. Second, the calculation based on delta mCpG does not allow to see how much methylation was initially there. For example, S1b shows a median decrease of ~ 10% in K9me3 and ~7-8% in H3K4me3. What does this mean given that the starting methylation for both marks is completely different?

      Following this point, the authors mention that mCG is already low at K9me3 domains in HCT cells (compared to other sites in the genome). I am curious if this may influence the accelerated loss of methylation in absence of DNMT3B? Any comments on this?

      The observation that there is a greater loss at H3K9me3 domains than H3K27me3-only domains which also have low DNA methylation levels in HCT116 argue that the losses are not solely driven by the lower initial level of methylation in H3K9me3 domains. Our analyses later in the manuscript also support a specific activity at H3K9me3. In addition, we propose to reinforce this point through further data on exploring how DNMT3B interacts with HP1a (see general comments, revision plan figure 1).

      However, we acknowledge the possibility that part of the loss seen at H3K9me3 domains in DNMT3B KO cells could be in part a result of their low initial level of methylation. In the revised manuscript we propose to include discussion of this possibility.

      3. One issue is the lack of correlation in DNMT3B binding to H3K9me3 sites in WT cells (Fig 3). How does this explain the requirement for DNMT3B for maintenance of methylation at H3K9me3? While some of the tested mutants show some weak increase at K9me3 sites, these are not comparable to the strong binding preferences observed at K36me3 for the wt or delta N- term version.

      Using ChIP-seq we cannot say that DNMT3BWT does not bind at H3K9me3, only that it binds here to a lower level than at K36me3-marked loci. The normalized DNMT3BWT signal at H3K9me3 domains is higher than the background signal from DNMT3B KO cells (manuscript figure 3d) supporting the hypothesis that DNMT3BWT localizes to H3K9me3. This hypothesis is also supported by the observation that the correlation between DNMT3BDN and H3K9me3 is reduced compared to that of DNMT3BWT (manuscript figure 6c compared to figure 3c).

      There are several reasons why the apparent enrichment of DNMT3B at H3K9me3 may appear weaker than at H3K36me3 by ChIP-seq. Previous work has also suggested that formaldehyde crosslinking fails to capture transient interactions in cells (Schmiedeberg et al. 2009 PLoS One PMID: 19247482). H3K9me3-marked heterochromatin is also resistant to sonication (Becker et al. 2017 Molecular Cell PMID: 29272703) and this could further affect our ability to detect DNMT3B in these regions using ChIP-seq. Our new data also suggest that DNMT3B binds to H3K9me3 indirectly through HP1a (see general comments, revision plan figure 1) and this may also lead to weaker ChIP-seq enrichment at H3K9me3 compared to the direct interaction with H3K36me3 through DNMT3B’s PWWP domain.

      We propose to add discussion of these issues to the revised manuscript.

      4. Following the above comment, what about other methyltransferases in HCT cells? Could DNMT1 or DNMT3A function be altered in absence of DNMT3B, and the observed methylation changes could be indirectly influenced by DNMT3B? The authors could create a DNMT-TKO HCT cell line and re-introduce DNMT3B in this background and measure methylation to exclude that DNMT1 or DNT3A could have an influence. In this case, only H3K9me3 should gain DNA methylation.

      As discussed in response to reviewer 1 (point 3), we propose to examine the changes in DNA methylation upon expression of catalytically dead DNMT3BW263A to further strengthen the evidence that DNMT3BW263A is directly responsible for the increased DNA methylation at H3K9me3-marked loci.

      5. DNMT3B lacking N-terminal shows reduced K9me3 methylation & some localization by imaging. While the presented experiments show some support for this conclusion, I suggest to re-introduce a W263A mutant lacking the N-terminal part and measure changes in DNA methylation at H3K9. This should help to test the requirement for the N-terminal regions and further indicate which protein part (PWWP or N-term) is more important in regulating the balance between K9me3 and K36me3.

      We have performed this experiment and the data are shown in manuscript figure S6c and d. The results of these experiments show that DNMT3BΔN+W263A cells showed less methylation at H3K9me3 loci than DNMT3BW263A cells, supporting a role for the N-terminus in recruiting DNMT3B to H3K9me3-marked heterochromatin. In the revised version, we will ensure that these data are more clearly indicated.

      In the first paragraph of the discussion, the authors state: "Our results demonstrate that DNMT3B is recruited to and methylates heterochromatin in a PWWP- independent manner that is facilitated by its N-terminal region." Same statement is found in the abstract. This contradicts the ChIP-seq results that do not indicate a recruitment of DNMT3B to heterochromatin, and the N- terminal deletions are not fully supporting a role in this targeting since there is no localization to K9me3 to begin with. While changes in methylation are observed, it remains to be determined if this is indeed through direct DNMT3B delocalization or indirectly through influencing the remaining DNMTs.

      As discussed above, there are several potential reasons why DNMT3B ChIP-seq signal at H3K9me3 is weak (reviewer 2, point 3). The additional experiments we propose to include in the revised manuscript could reinforce this statement by clarifying whether DNMT3B is directly responsible for methylating H3K9me3-marked regions (reviewer 1, point 3) and by delineating the role of the putative HP1a motif in DNMT3B’s N-terminal region (general comments, revision plan figure 1).

      Reviewer #2 (Significance (Required)):

      Advance: detailed analysis of DNMT3B mutants in relation to K9me3. Builds up on previous studies. Audience: specialised audience

      We thank the reviewer for their insights.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      • *In this work, Taglini et al. examine how the de novo DNA methyltransferase DNMT3B localizes to constitutive heterochromatin marked by the repressive histone modification H3K9me3. The authors utilize a previously generated DNMT3B KO colorectal carcinoma cell line, HCT116 to study recruitment and activity of DNMT3B at constitutive H3K9me3 heterochromatin. The authors noted preferential decrease of DNA methylation (DNAme) at regions of the genome marked with H3K9me3 in DNMT3B KOs. The authors then rescued the deficiency through overexpression of WT and catalytic dead DNMT3A/B and confirmed that DNA methylation increase at H3K9me3+ region in the WT DNMT3B, but not catalytically inactive mutant nor DNMT3A. To examine which protein domains may be mediating DNMT3B's recruitment to H3K9me3 regions, the authors designed a series of mutants, primarily focusing on the PWWP domain which normally recognizes H3K36me3. In the PWWP mutants, DNMT3B binding to the genome is altered, showing depletion at some H3K36me3-marked regions and gain at H3K9me3 heterochromatin, which coincides with DNAme increase at satellites. In contrast, the clinically relevant ICF1 mutation S270P, shows DNMT3B protein destabilization and no such loss of DNAme at heterochromatin. Finally, the authors truncate the N-terminal portion of DNMT3B, and saw that this region of the protein is necessary for heterochromatin localization and subsequent DNAme of H3K9me3+ regions.

      The experiments are well done with extensive controls, and the results are interesting and convincing. The structure of the manuscript could be improved for clarity and flow - for example, the PWWP mutations and truncations should be mentioned and compared together. I also found the section on ICF1 mutant to be out-of-place.

      As described above (reviewer 1, point 1), we propose to move these data to the supplementary materials in the revised manuscript.

      • *

      More emphasis should be placed on the N- terminal mutant as this region seems to be critical to heterochromatin recruitment, and this may address whether the interaction to H3K9me3 is direct or indirect.

      As described above (general comments), the revised manuscript will include experiments clarifying the nature of DNMT3B’s interaction with H3K9me3. Our preliminary data support that it is an indirect interaction mediated through HP1a (revision plan figure 1).

      Finally, while the epigenetic crosstalk is well-examined in this work, I would strongly urge the authors to add RNA-seq data to determine the transcriptional consequence of such chromatin disruptions (e.g. are repetitive sequences up-regulated in DNMT3B KOs?).

      As suggested by the reviewer, we propose to generate and analyse RNA-seq data in the revised manuscript to understand the impact of DNMT3B on transcriptional programs.

      Comments

      1. A potential caveat to the study is the use of a single cell line - colorectal cancer cell HCT116 - to draw major conclusions on the function of DNMT3B. It is worth noting the Baubec et al. study examining DNMT3B recruitment to H3K36me3 was mainly performed in murine embryonic stem cells (mESCs). It would greatly strengthen the study if the authors could perform similar type of data analysis on an independent DNMT3B KO cell line. For example, does DNMT3B localize to H3K9me3 regions in WT mESCs?

      As described above in response to reviewer 1, we will include analysis in an additional cell line in the revised manuscript to demonstrate that our results are generalizable beyond HCT116 cells.

      2. Did the PWWP mutant W263A show the expected loss of DNAme at H3K36me3-marked regions? In other words, was there evidence of DNAme redistribution in loss at H3K36me3+ regions and inappropriate gain at H3K9me3+ regions? Please perform intersection analysis of DMRs with other epigenomic marks (e.g. H3K27me3, H3K36me3, CpG shores) in the PWWP mutants.

      Our analysis of DNMT3B KO cells (manuscript figure s1d) show that losses of DNA methylation in these cells are not correlated with H3K36me3 in gene bodies suggesting that DNMT3A and DNMT1 are sufficient to compensate in maintaining their methylation in DNMT3B KO cells. To clarify this point for the DNMT3BW263A knock in clones, in the revised manuscript we will directly examine whether these cells show loss of methylation at H3K36me3 marked gene bodies in a similar analysis and add discussion of these results.

      The study would also be strengthen greatly with the in addition of biochemical studies to confirm direct loss of binding, and possibly gain of H3K9me3 binding, in the DNMT3B PWWP mutants.

      As detailed above (general comments, revision plan figure 1), our data suggest that DNMT3B interacts indirectly with H3K9me3 through an HP1 motif in its N-terminal region. We will undertake further biochemical studies on this interaction which will be included in the revised manuscript. Specifically we will focus on using EMSAs with synthetic nucleosomes to clarify the degree to which the HP1a interaction is responsible for binding of DNMT3B to H3K9me3 modified nucleosomes.

      We also propose to undertake in vitro biochemical characterization of the effect of DNMT3B PWWP mutations on interaction with H3K36me3 using synthetic nucleosomes. However, we note that in the manuscript we have shown similar effects using two independent point mutations that are predicted to affect H3K36me3 binding (W263A and D266A) and deletion of the entire PWWP domain.

      3. Examining the tracks in Figure 3A,B, the PWWP mutants showed almost indiscriminate increase across the genome, and not specifically to H3K9me3-marked regions. Would ask the authors to speculate as to why the ChIP-seq of DNMT3B mutants do not recapitulate the heterochromatin co-localization shown by immunofluorescence.

      As discussed in response to reviewer 2 (point 3) we believe that the weak DNMT3B ChIP-seq signal at H3K9me3 loci is likely due to the nature of the interaction that DNMT3B has with chromatin in these regions. We will add discussion of these points to the revised manuscript.

      4. It's a shame that the ICF1 mutation S270P was not characterized to the same extent as the PWWP mutants. Would consider adding WGBS for this clinically relevant mutation.

      We have shown that this mutant does not produce stable protein in vitro or in our cells and we observe little difference in DNA methylation at selected loci. As WGBS is expensive, we believe that carrying out this experiment is not an efficient use of limited research resources.

      5. Figure 7 - please draw in the ICF1 and the N-terminal mutations in the model figure. Also provide legends.

      We will modify the manuscript to include these details in the revised manuscript.

      Reviewer #3 (Significance (Required)):

      This is an intersting study on a timely subject. It will be of interest to multiple fields from epigenetics to development and cancer. My expertise is in cancer, epigenetics, development.

      We thank the reviewer for highlighting the broad interest of our study.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this work, Taglini et al. examine how the de novo DNA methyltransferase DNMT3B localizes to constitutive heterochromatin marked by the repressive histone modification H3K9me3. The authors utilize a previously generated DNMT3B KO colorectal carcinoma cell line, HCT116 to study recruitment and activity of DNMT3B at constitutive H3K9me3 heterochromatin. The authors noted preferential decrease of DNA methylation (DNAme) at regions of the genome marked with H3K9me3 in DNMT3B KOs. The authors then rescued the deficiency through overexpression of WT and catalytic dead DNMT3A/B and confirmed that DNA methylation increase at H3K9me3+ region in the WT DNMT3B, but not catalytically inactive mutant nor DNMT3A. To examine which protein domains may be mediating DNMT3B's recruitment to H3K9me3 regions, the authors designed a series of mutants, primarily focusing on the PWWP domain which normally recognizes H3K36me3. In the PWWP mutants, DNMT3B binding to the genome is altered, showing depletion at some H3K36me3-marked regions and gain at H3K9me3 heterochromatin, which coincides with DNAme increase at satellites. In contrast, the clinically relevant ICF1 mutation S270P, shows DNMT3B protein destabilization and no such loss of DNAme at heterochromatin. Finally, the authors truncate the N-terminal portion of DNMT3B, and saw that this region of the protein is necessary for heterochromatin localization and subsequent DNAme of H3K9me3+ regions.

      The experiments are well done with extensive controls, and the results are interesting and convincing. The structure of the manuscript could be improved for clarity and flow - for example, the PWWP mutations and truncations should be mentioned and compared together. I also found the section on ICF1 mutant to be out-of-place. More emphasis should be placed on the N-terminal mutant as this region seems to be critical to heterochromatin recruitment, and this may address whether the interaction to H3K9me3 is direct or indirect. Finally, while the epigenetic crosstalk is well-examined in this work, I would strongly urge the authors to add RNA-seq data to determine the transcriptional consequence of such chromatin disruptions (e.g. are repetitive sequences up-regulated in DNMT3B KOs?).

      Comments

      1. A potential caveat to the study is the use of a single cell line - colorectal cancer cell HCT116 - to draw major conclusions on the function of DNMT3B. It is worth noting the Baubec et al. study examining DNMT3B recruitment to H3K36me3 was mainly performed in murine embryonic stem cells (mESCs). It would greatly strengthen the study if the authors could perform similar type of data analysis on an independent DNMT3B KO cell line. For example, does DNMT3B localize to H3K9me3 regions in WT mESCs?
      2. Did the PWWP mutant W263A show the expected loss of DNAme at H3K36me3-marked regions? In other words, was there evidence of DNAme redistribution in loss at H3K36me3+ regions and inappropriate gain at H3K9me3+ regions? Please perform intersection analysis of DMRs with other epigenomic marks (e.g. H3K27me3, H3K36me3, CpG shores) in the PWWP mutants. The study would also be strengthen greatly with the in addition of biochemical studies to confirm direct loss of binding, and possibly gain of H3K9me3 binding, in the DNMT3B PWWP mutants.
      3. Examining the tracks in Figure 3A,B, the PWWP mutants showed almost indiscriminate increase across the genome, and not specifically to H3K9me3-marked regions. Would ask the authors to speculate as to why the ChIP-seq of DNMT3B mutants do not recapitulate the heterochromatin co-localization shown by immunofluorescence.
      4. It's a shame that the ICF1 mutation S270P was not characterized to the same extent as the PWWP mutants. Would consider adding WGBS for this clinically relevant mutation.
      5. Figure 7 - please draw in the ICF1 and the N-terminal mutations in the model figure. Also provide legends.

      Significance

      This is an intersting study on a timely subject. It will be of interest to multiple fields from epigenetics to development and cancer.

      My expertise is in cancer, epigenetics, development.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, Taglini et al., describe an increased activity of DNMT3B at H3K9me3-marked regions in HCT cells. They first identify that DNA methylation at K9me3-marked regions is strongly reduced in absence of DNMT3B. Next, the authors re-express DNMT3B and DNMT3B mutant variants in the DNMT3B-KO HCT cells and assess DNA methylation by WGBS where they identify a strong preference for re-methylation of K9me3 sites. Based on genome-wide binding maps for DNMT3B, including the mutant variants, they address how the localization of DNMT3B relates to the observed changes in methylation.

      Major points:

      The authors show increased reduction of mCG at H3K9me3 (and K27me3) sites in absence of DNMT3B. This is based on correlating delta %mCG with histone modifications in 2kb bins. I find this approach to not fully support the major claim.

      First, the correlation coefficients are very small -0.124 for K9me3 and -0.175 for K27me3, and just marginally better compared to, for example, K36me3 that does not seem to have any influence on mCG according to Sup Fig S1b. While I agree that mCG seems more reduced at K9me3 in absence of DNMT3B (e.g. in Fig 1a), is there a better way to visualize the global effect? The delta mCG Boxplots based on bins are not ideal (this applies to many figures using the same approach in the current manuscript).

      Second, the calculation based on delta mCpG does not allow to see how much methylation was initially there. For example, S1b shows a median decrease of ~ 10% in K9me3 and ~7-8% in H3K4me3. What does this mean given that the starting methylation for both marks is completely different?

      Following this point, the authors mention that mCG is already low at K9me3 domains in HCT cells (compared to other sites in the genome). I am curious if this may influence the accelerated loss of methylation in absence of DNMT3B? Any comments on this?

      One issue is the lack of correlation in DNMT3B binding to H3K9me3 sites in WT cells (Fig 3). How does this explain the requirement for DNMT3B for maintenance of methylation at H3K9me3? While some of the tested mutants show some weak increase at K9me3 sites, these are not comparable to the strong binding preferences observed at K36me3 for the wt or delta N-term version.

      Following the above comment, what about other methyltransferases in HCT cells? Could DNMT1 or DNMT3A function be altered in absence of DNMT3B, and the observed methylation changes could be indirectly influenced by DNMT3B? The authors could create a DNMT-TKO HCT cell line and re-introduce DNMT3B in this background and measure methylation to exclude that DNMT1 or DNT3A could have an influence. In this case, only H3K9me3 should gain DNA methylation.

      DNMT3B lacking N-terminal shows reduced K9me3 methylation & some localization by imaging. While the presented experiments show some support for this conclusion, I suggest to re-introduce a W263A mutant lacking the N-terminal part and measure changes in DNA methylation at H3K9. This should help to test the requirement for the N-terminal regions and further indicate which protein part (PWWP or N-term) is more important in regulating the balance between K9me3 and K36me3.

      In the first paragraph of the discussion, the authors state: "Our results demonstrate that DNMT3B is recruited to and methylates heterochromatin in a PWWP- independent manner that is facilitated by its N-terminal region." Same statement is found in the abstract. This contradicts the ChIP-seq results that do not indicate a recruitment of DNMT3B to heterochromatin, and the N-terminal deletions are not fully supporting a role in this targeting since there is no localization to K9me3 to begin with. While changes in methylation are observed, it remains to be determined if this is indeed through direct DNMT3B delocalization or indirectly through influencing the remaining DNMTs.

      Significance

      Advance: detailed analysis of DNMT3B mutants in relation to K9me3. Builds up on previous studies.

      Audience: specialised audience

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      This paper by Francesca Taglini, Duncan Sproul, and their coworkers, examines the mechanisms of DNA methylation in a human cancer cell line. They use the human colorectal cancer line HCT116, which has been very widely used to look at epigenetics in cancer, and to dissect the contribution of different proteins and chromatin marks to DNA methylation.

      The authors focus on the role of the de novo methyltransferase DNMT3B. It has been shown in ES cells in 2015 that its PWWP domain directs it to H3K36me3, typically found in gene bodies. More recently, the authors showed similar conclusions in colorectal cancer (Masalmeh Nat Comm 2021). Here they examine, more specifically, the role of the PWWP. The conclusions are described below.

      Major comments:

      1. I feel that this paper has several messages that are somewhat muddled. The main message, as expressed in the title and in the model, is that the PWWP domain of DNMT3B actively drags the protein to H3K36me3-marked regions. Inactivation of this domain by a point mutation, or removal of the Nter altogether, causes DNMT3B to relocate to other genomic regions that are H3K9me3-rich, and that see their DNA methylation increase in the mutant conditions. This first message is clear.

      The second message has to do with ICF. A mutant form of DNMT3B bearing a mutation found in ICF, S270P, is actually unstable and, therefore, does not go to H3K9me3 regions. I feel that here the authors go on a tangent that distracts from message #1. This could be moved to the supp data. At any rate, HCT116 are not a good model for ICF. In addition, a previous paper has looked at the S270P mutant, and it did not seem unstable in their hands (Park J Mol Med 2008, PMID: 18762900). So I really feel the authors do not do themselves a favor with this ICF angle. 2. I feel that some major confounders exist that endanger the conclusions of the work. The most worrisome one, in my opinion, is the amount of WT or mutant DNMT3B in the cells. It is clear in figure 4C that the WT rescue construct is expressed much more than the W263A mutant (around 3 or 4 times more). Unless I am mistaken, we are never shown how the level of exogenous rescue protein compares to the level of DNMT3B in WT cells. This bothers me a lot. If the level is too low, we may have partial rescue. If it is too high, we might have artifactual effects of all that DNMT3B. I would also like to see the absolute DNA methylation values (determined by WGBS) compared to the value found in WT. From figure S1A, it looks like WT is aroun 80% methylation, and 3BKO is around 77% or so. I wonder if the rescue lines may actually have more methylation than WT? 3. I guess the unarticulated assumption is that the gain of DNA methylation seen at H3K9me3 region upon expression of a mutant DNMT3B is due to DNMT3B itself. But we do not know this for sure, unless the authors test a double mutant (PWWP inactive, no catalytic activity). I am not necessarily asking that they do it, but minimally they should mention this caveat.<br /> 4. I am confused as to why the authors look at different genomic regions in different figures. In figure 1 we are looking at a portion of the "left" arm of chr 16. But in figure 2B, we now look at a portion of the "right" arm of the same chromosome, which has a large 8-Mb block of H3K9me3, and is surprisingly lowly methylated in the 3BKO. This seems quite odd, and I wonder if there is a possible artifact, for instance mapping bias, deletion, or amplification in HCT116. Showing the coverage along with the methylation values would eliminate some of these concerns.

      Minor comments:

      1. The WGBS coverage is not very high, around 2.5X on average, occasionally 2X. I don't believe this affects the findings, as the authors look at large H3K9me3 regions. But the info in table S2 was hard to find and it is important. I would make it more accessible.
      2. It would be nice to have a drawing showing exactly what part of the Nter was removed.
      3. some figures could be clearer. I was not always sure when we were looking at a CRISPR mutant clone (W263A) versus a piggyBac rescue.
      4. unless I am mistaken, all the ChIP-seq data (H3K9me3, H3K36me3 etc) come from WT cells. It is not 100% certain that they remain the same in the 3BKO, is it? This should be discussed.

      Significance

      Strengths:

      The experiments are for the most part well done and well interpreted (save for the limitations mentioned above). The techniques are appropriate and well mastered by the team. The paper is well written, the figures are nice. The authors know the field well, which translates into a good intro and a good discussion. The bioinformatics are convincing.

      Limitations:

      All the work is done in a single cancer cell line. One might assume the conclusions will hold in other systems, but there is no certainty at this point.

      HCT116 are not the best model system to study ICF, which mostly affects lymphocytes

      At present, I feel that the biological relevance of the findings is fairly unclear. The authors report what happens when DNMT3B has no functional PWWP domain. I am convinced by their conclusions, but what do they tell us, biologically? Are there, for instance, mutant forms of DNMT3B expressed in disease that have a mutant PWWP? Are there isoforms expressed during development or in certain cell types that do not have a PWWP? In these cell types, does the distribution of DNA methylation agree with what the authors predict?

      In its present state, I feel the appeal of the findings is towards a semi-specialized audience, that is interested in aberrant DNA methylation in cancer and other diseases. This is not a small audience, by the way.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements

      We thank all the reviewers for their time and effort in the peer-review process. We appreciate the positive reflections on the study and the feedback comments which were well thought-out and articulated. Considering these comments has led us to deeper reflections on the conceptualization of the mechanisms at play, and we hope that our responses here and revisions of the manuscript have improved the presentation of the data and our interpretation of these complex matters. As a result, we have now incorporated a new supplementary figure 5 and present a new model figure with the corresponding comments in the text.

      1. Point-by-point description of the revisions

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this manuscript Sanchez-Martinez et al investigated the function of ntc, a Drosophila homologue of FBXO7. The mechanisms by which mutations in this protein cause autosomal recessive PD are poorly understood. The protein has previously been implicated in PINK1/Parkin mitophagy however the mechanistic detail is lacking. The data presented here provide an important insight into the molecular functions of ntc as well as mitophagy in vivo in general. Ntc was found to promote ubiquitination of mitochondrial proteins which is counteracted by USP30. The basal ubiquitination regulated by these two enzymes is proposed to act as a permissive factor for the initiation of Pink1/Parkin mitophagy. The conclusions are based on strong data in vivo and there is a lot to like about this paper. The analyses are done rigorously, conclusions are balanced and well supported and there is a lot of conceptual novelty in the dataset. At the same time the paper raises some questions with regard to the role of mitophagy, at least in Drosophila. Not all of these could be answered during revisions but it would be useful to address the points outlined below.

      1. The functional measurements such as climbing, flight and lifespan are used to complement the data on mitophagy and mitochondrial health. However, it is clear that these do not correlate. Ntc KOs and Pink1/Parkin flies have reduced climbing and flight ability, however ntc KO does not affect mitochondrial function. In case of Pink1/Parkin the assumption is that impaired fly functionality is due to damaged mitochondria. This is clearly not the case with Ntc. How relevant is climbing/flight/lifespan to the role of Ntc in mitophagy?
      • The reviewer raises a very good point, and we agree that there isn’t a strict, linear connection between the cellular process of mitophagy and the presentation of organismal neuromuscular phenotypes such as motor behaviours and lifespan. Considering this point further, starts to highlight the complexity of the situation at hand: it is becoming clear that there are many different forms of mitophagy, and these perform different functions in cellular remodelling and homeostasis. And, of course, there are many ways to interfere with neuromuscular function (as well as lifespan). So, it follows that some forms of mitophagy may dramatically impact neuromuscular homeostasis when disrupted, while others may not. We and others have described that basal mitophagy is minimally by loss of Pink1/parkin in vivo, so the organismal phenotypes clearly do not relate to this biology. But it is currently unclear how the phenotypes may relate to physiologically relevant stress-induced mitophagy as the precise nature of this, as well as the methods to experimentally manipulate it, are lacking.

      Here, we are initially documenting new phenotypes for ntc, with no bias for the mechanistic cause, all of which are worthy of description to gain a holistic view of the overall contribution of this gene function to organismal integrity. It is clear from the literature that ntc/FBXO7 has multiple functions, for instance, regulating proteasome function and caspase activation, so it follows that genetic loss is likely to impinge on multiple cellular functions causing pleiotropic effects.

      We have always been careful not to consider (or claim) that the organismal phenotypes, such as motor function or lifespan, are specifically due to defective mitophagy but are an overall readout of the health and functioning of the neuromuscular system. Nevertheless, these phenotypes are useful in investigating manipulations that improve or worsen the effect of Pink1/parkin (or ntc) mutants, which, a priori, may or may not also modulate mitophagy. While we have documented these new organismal phenotypes of ntc mutants and analysed the impact on basal and stress- induced mitophagy, we have not drawn a cause-effect link between the two but a correlation at least. Nevertheless, this issue raises some important considerations for the field in terms of the different kinds of mitophagy, and when they may be needed, and the impact on cells, systems or whole-organisms when they are defective. This issue is explored more in answer to Q3 below.

      1. Fig 3 is somewhat patchy, mitophagy is shown for USP30 and ntc KO epistasis but climbing index used in OE setting. These data do not match, and it feels like experiments that are shown are the ones that worked. The relevance of climbing index to mitophagy is unclear as mentioned above. Does KO/OE of ntc and USP30 affect levels of mitochondria, e.g. Marf used as a maker for mitochondria in Fig. 1? And if not why not, considering that ntc/USP30 but not PINK/Parkin control basal mitophagy?
      • The main purpose of the data in Figure 3 was to document the impact of ntc manipulation on basal mitophagy, and by extension to link this to the known mitophagy regulator, USP30, whose loss of function has been documented to promote stress-induced mitophagy. Here, we successfully demonstrated USP30 RNAi and ntc OE cause an increase in mitophagy, and established their genetic relationship. However, it is very important to our modus operandi that we have orthogonal evidence for this relationship and understand the impact at an organismal level. As the reviewer indicates, the obvious choice that would align with the mitophagy data would be to assess whether loss of ntc prevents a USP30 RNAi phenotype. However, in our hands USP30 knockdown using the same RNAi line had no discernible impact on viability or behaviour in adult flies, precluding this experiment. Of note, we did observe a detrimental impact of USP30 knockdown on adult viability using a different RNAi line (KK) but this has 2 known off-targets so this result is unreliable. An alternative approach to genetically test the antagonistic relationship between USP30 and ntc, and equally valid in our view, is to assess whether ntc OE can counteract a USP30 OE phenotype. Here, we were fortunate that USP30 OE does indeed provoke an organismal phenotype, and this was suppressed by ntc OE consistent with the mitophagy data. It is unfortunate that the more obvious option was not workable on this occasion, but we hold that the genetic relationship was nevertheless substantiated as expected, albeit with alternative manipulations. Importantly, we established the validity of this approach by demonstrating the known genetic interaction between USP30 and parkin, whereby USP30 OE locomotor phenotype is suppressed by parkin OE (now, Fig. S3D). To substantiate this approach more clearly, we have now added to the text (lines 200-201) and figure (Fig. S3C) the lack of observable effect by USP30 knockdown as noted above.

      As to the second point, assessing whether levels of mitochondria are changed by ntc/USP30 manipulations; according to the immunoblot presented in new Supplementary Figure 5A (and replicates), the levels of ATP5a are not notably changed by ntc O/E or USP30 RNAi. Marf levels are also unchanged though this is not shown. This is in line with our expectations since, as discussed above, ntc/USP30 are only one set of regulators of one type of mitophagy and several others exist. The reviewer will likely be aware that the levels of mitochondria are tightly regulated and fine-tuned for the specific need in different tissue types, and that substantial changes to mitochondrial content can be catastrophic for cell and tissue viability. While this is relatively straightforward to achieve in cultured cells, substantial reductions in mitochondrial content are non-viable in an in vivo context. Of course, in physiological conditions, rates of degradation are kept in fine-balance with biogenesis and proliferation so non-catastrophic alterations in mitochondrial content are usually counteracted by compensatory changes in proliferation or degradation.

      1. What is the role of mitophagy in the maintenance of mitochondrial function in Drosophila in general? Pink1/Parkin KO assumed to result in dysfunctional mitochondria due to impairment of damage-induced mitophagy which is a minor contributor to mitophagy as has previously been published by the authors and confirmed in this dataset using mitophagy reporter. At the same time ntc is clearly required for mitophagy, but mitochondria remains structurally and functionally intact in ntc KO. The most straightforward interpretation of these data is that Pink1/Parkin contribute little to mitophagy in flies and their effect on mitochondria and fly function is independent of mitophagy. Instead ntc (and USP30) strongly regulate mitophagy but mitophagy is not important for the maintenance of mitochondrial function. The effect of ntc on fly function is also independent of its role in mitophagy/mitochondria. Unless there is an alternative explanation the entire dataset would need to be reinterpreted and discussed differently.
      • We agree that this is an important point raised by the study findings and needs to be clearly articulated in the text, but we don’t think it is as simple as whether ‘mitophagy’ contributes to mitochondrial and organismal integrity. First, as mentioned above, it is becoming apparent that it is crucial for the field to clearly and consciously distinguish between basal and induced forms of mitophagy. Basal mitophagy is likely, though not yet proven, to be an important component of mitochondrial quality control in metazoans and largely act in a house-keeping manner providing continual surveillance of mitochondrial quality and quantity. As such, like many other critical biological processes, it is likely to be supported in a ‘belt-and-braces’ manner by several mechanisms working in parallel with a degree of functional redundancy. In contrast, induced mitophagy is presumed to be quiescent until stimulated into action at specific times for specific purposes. For instance, it is assumed, though not yet proven, that PINK1/Parkin stress-induced mitophagy is stimulated in response to some kind of physiological stress or damage to mitochondria that may be catastrophic if left unchecked.

      We and others have shown before that PINK1/Parkin are minimally involved in basal mitophagy in vivo but they are well-established to promote stress-induced mitophagy. In contrast, we have found that ntc regulates basal mitophagy and, we posit, facilitates PINK1/Parkin mitophagy by providing the initiating ubiquitination. How does this map onto the mitochondrial/organismal phenotypes? There are clear disruptions to energy-intensive, mitochondria-rich tissues inPink1/parkin mutants which are not grossly affected in ntc mutants. On the other hand, ntc mutants show a dramatically short lifespan, much shorter than Pink1/parkin mutants, while other measures of mitochondrial integrity are fine.

      The Pink1/parkin phenotypes are consistent with a catastrophic loss of tissue integrity caused by the lack of a crucial protective measure (induced mitophagy) for a specific circumstance (we think, mitochondrial ‘damage’ arising from a huge metabolic burst). In contrast, while loss of ntc causes a partial (but not complete) loss of basal mitophagy, these same tissues appear to be able to cope with this impact on house-keeping QC but importantly are also able to mount a stress-induced response via Pink1/parkin still being present. On the other hand, it should be remembered that ntc is known to perform other important cellular functions, such as regulating proteasome function and caspase activation, and it is perhaps loss of these functions that causes the dramatic loss of vitality.

      Importantly, although Pink1/parkin do not contribute to basal (steady-state) mitophagy, we think it is not appropriate to think of Pink1/parkin mitophagy as a ‘minor’ contribution. Since, under the particular triggering conditions of damage or stress that stimulate Pink/parkin mitophagy, apparently only Pink1/parkin can perform this role in certain Drosophila tissues, and this stress- induced mitophagy is crucial to tissue integrity, as exemplify by the fact that increasing basal mitophagy via ntc O/E still is not sufficient to rescue Pink1 mutants. In this specific context, this is a major mitophagy pathway.

      In summary, the connection between mitochondrial autophagic degradation and mitochondrial/organismal health is not a simple one and we would avoid conflating different aspects of mitochondrial QC with the expectation that the consequences of their dysfunction would be the same. Nevertheless, these well-considered feedback comments have crystallised the need to elaborate these ideas in the Discussion where we have added a new section (lines 359-387).

      Reviewer #1 (Significance (Required)):

      Very strong genetic data presented; novel functions for human Park15 homologue in Drosophila; mechanistic insight into the ubiquitination of mitochondria by two opposing enzymes. Overall very interesting paper but interpretation is less clear which needs to be addressed.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this ms. Sanchez-Martinez and colleagues study the role of the ub ligase FBXO7, in regulating mitophagy - highlighting that mutations in FBXO7 associate with Parkinson's disease and defects in mitochondrial homeostasis. Using the fly as model, they carry out a series of expts. investigating ntc (Drosophila ortholog of FBX07) demonstrating that it can functionally rescue Parkin but not PINK1 deficiency. Expanding on this, they propose a model whereby ntc/FBX07 regulates basal mitophagy and also acts as a priming Ub-ligase for Parkin mediated mitophagy, finding that the dub USP30 counteracts these ntc function. Overall the data are robust and support the authors' conclusions and model, the manuscript is well written and I think can be accepted as is.

      • We thank the reviewer for their appreciation of the work and the time taken to provide supportive feedback.

      While outside the scope of this study to understand why, I find it very interesting that ntc cannot rescue the PINK1 deficient phenotype, argues that PINK1 may be having additional effects beyond regulating mitochondrial ubiquitylation.

      • We entirely agree with the reviewer, this is a very intriguing finding. Indeed, there are several examples in the literature showing that PINK1 performs additional functions than just triggering mitophagy. But in the current context we interpret these data as further support for a clear mechanistic distinction between basal mitophagy and stress-induced mitophagy as discussed at length to the other reviewers’ comments.

      Reviewer #2 (Significance (Required)):

      Importance for understanding the role of FBX07 function - relevant for Parkinson's disease, also demonstrates a role for it in priming for PINK1/Parkin dependent mitophagy.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, Sanchez-Martinez et al characterise the role of nutracker (ntc), the presumed Drosophila orthologue of human FBXO7 (whose gene is mutated in autosomal recessive PD), in mitophagy and phenotypes associated with neurodegeneration in flies (climbing index, dopaminergic neuron loss, rough eye phenotype, and others). FBXO7 (human) has been previously shown to restore parkin (not Pink1) phenotypes and mitochondrial morphology in Drosophila and implicated in Pink1-parkin mitophagy, however the role of ntc in basal mitophagy and its genetic interaction with USP30 has not been previously reported. Key findings include: evidence for functional homology between ntc and FBXO7, and that Ntc/FBXO7 is required for basal mitophagy (and reverses USP30 function) in a Pink1-parkin independent manner.

      FBXO7/ntc is clearly an important regulator of mitophagy and its overexpression can suppress Parkin phenotypes, however FBX07/ntc has not been studied as intensively as Parkin and Pink1, therefore this work represents important insight into mitophagy regulators (broad interest to many overlapping fields).

      However, in addition to minor points and controls requested below, some further characterisation of the signals on the mitochondria induced by ntc/FBXO7 would improve the novelty of the study and the mechanistic insight provided. For example, the authors look at total ubiquitin and pS65- Ub, whereas if they looked at specific substrates that they mention in the discussion (e.g. OMM and translocon proteins) it would allow a less speculative discussion.

      Figure 1: The authors show that overexpression of ntc can rescue Parkin null phenotypes but not Pink1 phenotypes. In very similar experiments, overexpression of FBXO7 (human) has been shown to rescue Parkin phenotypes but not pink1 phenotypes (Burchell), appropriately mentioned by the authors.

      The western blots are not terribly clear and would benefit from quantification (particularly H).

      • We had previously performed the quantification on replicate experiments but had considered that the result was clear enough without quantification, and that including a quantification may make the figure too crowded. However, we have now added the quantification to the figure to support these results.

      Specific ubiquitylated substrates like translocon proteins would be very interesting (alternatively, this could be provided in figure 7).

      • We agree that this would be a very interesting aspect to investigate, but we feel that since the emphasis of the current study is clearly on the regulation of mitophagy, and not on specific substrates as has been published elsewhere (Phu et al., Mol Cell, 2020 (Ref. 42); Ordureau et al., Mol Cell, 2020 (Ref. 39)), investigating the impact of ntc and USP30 on the ubiquitination of the translocon would be a distraction to the focus of the study.

      If the rough eye phenotype is highly homogenous, state in text otherwise, a relative roughness quantification would be more informative.

      • The rough eye phenotype described here is indeed highly stereotyped and homogeneous. We have added this comment to the text for clarity (lines 124-126).

      Figure 2: Although mainly in agreement with Burchell et al findings (that there is no disruption of mito morphology or dopaminergic neuron loss caused by ntc loss), the loss flight ability in the ntc mutant is partially discrepant with Burchell et al (results not shown in Burchell et al). Can the authors explain the discrepancy? It is important finding that the ntc functionally orthogue of FBXO7 and differs from the Burchell et al conclusions.

      • The reviewer raises a good point regarding discrepant interpretations with earlier preliminary work that we didn’t specifically elaborate in the current manuscript. For the Burchell et al study we performed a series of non-exhaustive analyses with reagents that were most readily available at the time. The flight data described in Burchell et al (as ‘data not shown’) were done with what we now know to be a hypomorphic allele, which did not give a strong flight defect that we were expecting to see as a phenocopy of parkin mutants. Moreover, experiments aimed at testing the functional homology sought to rescue the only reported ntc phenotype at that time – male sterility – which did not work. It is worth noting that GAL4/UAS-mediated expression is known to be very inefficient in the male germline, so we originally interpreted the lack of rescue with this caveat in mind. It is also worth adding that, subsequent to the Burchell et al study, we have seen that expression of FBXO7 can rescue the caspase-3 activation in ntc mutant spermatocytes, supporting their functional homology. Importantly, during the Burchell et al study we did not have reagents to test the effects of ntc overexpression, obtained subsequently, which have provided compelling data that support a functional homology between ntc and FBXO7. At the time of writing the current manuscript we did not specifically revisit the Burchell et al text to note this strongly stated conclusion. We realise that this requires unequivocal clarification and thank the reviewer for pointing this out. We have amended the text to clarify this important point (lines 285-293).

      Figure 7: A,B. It is not clear that mitochondria have been enriched - can the authors show on mitochondria or show the fractionation quality?

      • Mitochondrial enrichment is a standard procedure in our lab, with consistently acceptable results, so we apologize for omitting a demonstration of this. We have now added these data to a new supplementary figure S5A. The corresponding information has also been added to the text (line 253). We have also extended this analysis to now show that total ubiquitination is not changed in ntc OE or USP30 RNAi, highlighting the specificity for accumulated ubiquitination on the mitochondria. This has been added to supplementary figure S5Band text lines 253-254.

      C/D. The text that accompanies these figures needs further explanation and clarification and I found this result hard to understand without referring to the discussion. I think the authors are concluding that pS65 is ubiquitylated by FBXO7? I think this should be re-written in the results section. If it is a major point that the authors want to make, a complementary approach would be advised - possibly human cells/mass spectrometry.

      • We apologise that this was confusing and have simplified the text accordingly to improve the clarity (lines 260-262). While this specific analysis is not a major point of the study, it provides a useful additional measure of how ntc/USP30 contributes to mitochondrial ubiquitination which *is* a key focus of the study so we have revised the Discussion to better highlight this point (lines359- 387).

      As for Figure 1, specific ubiquitylated substrates at the OMM such as the translocon subunits would be informative.

      • As discussed above, the role of USP30, at least, on ubiquitination of protein import in the translocon has been documented elsewhere and further specific analysis on this here would be a distraction from the main focus of the study.

      Minor points

      Figure 8 model and discussion: Nice discussion. However, unless protein import/ubiquitylation of translocon factors/localisation of FBXO7 to the translocon is shown in the manuscript, I would recommend more clarity in the figure legend to emphasise what is speculation based on other papers and what are new findings from the paper.

      • This is a fair point and we agree that it is good to be clear about which aspects of the working model are reflections of the data presented here and which are extrapolation/speculation from the literature. We have modified the figure and the figure legend accordingly.

      Reviewer #3 (Significance (Required)):

      FBXO7/ntc is clearly an important regulator of mitophagy however its mechanism of action has not been studied as intensively as Parkin and Pink1, therefore this work contains important insight into mitophagy regulators.

      It will be of broad interest to many overlapping fields, and has translational impact in that mitophagy is disrupted in many diseases and FBXO7 itself is mutated in Parkinson's disease.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript, Sanchez-Martinez et al characterise the role of nutracker (ntc), the presumed Drosophila orthologue of human FBXO7 (whose gene is mutated in autosomal recessive PD), in mitophagy and phenotypes associated with neurodegeneration in flies (climbing index, dopaminergic neuron loss, rough eye phenotype, and others). FBXO7 (human) has been previously shown to restore parkin (not Pink1) phenotypes and mitochondrial morphology in Drosophila and implicated in Pink1-parkin mitophagy, however the role of ntc in basal mitophagy and its genetic interaction with USP30 has not been previously reported. Key findings include: evidence for functional homology between ntc and FBXO7, and that Ntc/FBXO7 is required for basal mitophagy (and reverses USP30 function) in a Pink1-parkin independent manner.

      FBXO7/ntc is clearly an important regulator of mitophagy and its overexpression can suppress Parkin phenotypes, however FBX07/ntc has not been studied as intensively as Parkin and Pink1, therefore this work represents important insight into mitophagy regulators (broad interest to many overlapping fields).

      However, in addition to minor points and controls requested below, some further characterisation of the signals on the mitochondria induced by ntc/FBXO7 would improve the novelty of the study and the mechanistic insight provided.

      For example, the authors look at total ubiquitin and pS65-Ub, whereas if they looked at specific substrates that they mention in the discussion (e.g. OMM and translocon proteins) it would allow a less speculative discussion.

      Figure 1: The authors show that overexpression of ntc can rescue Parkin null phenotypes but not Pink1 phenotypes. In very similar experiments, overexpression of FBXO7 (human) has been shown to rescue Parkin phenotypes but not pink1 phenotypes (Burchell), appropriately mentioned by the authors.

      The western blots are not terribly clear and would benefit from quantification (particularly H). Specific ubiquitylated substrates like translocon proteins would be very interesting (alternatively, this could be provided in figure 7).

      If the rough eye phenotype is highly homogenous, state in text otherwise, a relative roughness quantification would be more informative.

      Figure 2: Although mainly in agreement with Burchell et al findings (that there is no disruption of mito morphology or dopaminergic neuron loss caused by ntc loss), the loss flight ability in the ntc mutant is partially discrepant with Burchell et al (results not shown in Burchell et al). Can the authors explain the discrepancy? It is important finding that the ntc functionally orthogue of FBXO7 and differs from the Burchell et al conclusions.

      Figure 7: A,B. It is not clear that mitochondria have been enriched - can the authors show on mitochondria or show the fractionation quality? C/D. The text that accompanies these figures needs further explanation and clarification and I found this result hard to understand without referring to the discussion. I think the authors are concluding that pS65 is ubiquitylated by FBXO7? I think this should be re-written in the results section. If it is a major point that the authors want to make, a complementary approach would be advised - possibly human cells/mass spectrometry.

      As for Figure 1, specific ubiquitylated substrates at the OMM such as the translocon subunits would be informative.

      Minor points

      Figure 8 model and discussion: Nice discussion. However, unless protein import/ubiquitylation of translocon factors/localisation of FBXO7 to the translocon is shown in the manuscript, I would recommend more clarity in the figure legend to emphasise what is speculation based on other papers and what are new findings from the paper.

      Significance

      FBXO7/ntc is clearly an important regulator of mitophagy however its mechanism of action has not been studied as intensively as Parkin and Pink1, therefore this work contains important insight into mitophagy regulators.

      It will be of broad interest to many overlapping fields, and has translational impact in that mitophagy is disrupted in many diseases and FBXO7 itself is mutated in Parkinson's disease.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this ms. Sanchez-Martinez and colleagues study the role of the ub ligase FBXO7, in regulating mitophagy - highlighting that mutations in FBXO7 associate with Parkinson's disease and defects in mitochondrial homeostasis. Using the fly as model, they carry out a series of expts. investigating ntc (Drosophila ortholog of FBX07) demonstrating that it can functionally rescue Parkin but not PINK1 deficiency. Expanding on this, they propose a model whereby ntc/FBX07 regulates basal mitophagy and also acts as a priming Ub-ligase for Parkin mediated mitophagy, finding that the dub USP30 counteracts these ntc function. Overall the data are robust and support the authors' conclusions and model, the manuscript is well written and I think can be accepted as is.

      While outside the scope of this study to understand why, I find it very interesting that ntc cannot rescue the PINK1 deficient phenotype, argues that PINK1 may be having additional effects beyond regulating mitochondrial ubiquitylation.

      Significance

      Importance for understanding the role of FBX07 function - relevant for Parkinson's disease, also demonstrates a role for it in priming for PINK1/Parkin dependent mitophagy.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript Sanchez-Martinez et al investigated the function of ntc, a Drosophila homologue of FBXO7. The mechanisms by which mutations in this protein cause autosomal recessive PD are poorly understood. The protein has previously been implicated in PINK1/Parkin mitophagy however the mechanistic detail is lacking. The data presented here provide an important insight into the molecular functions of ntc as well as mitophagy in vivo in general. Ntc was found to promote ubiquitination of mitochondrial proteins which is counteracted by USP30. The basal ubiquitination regulated by these two enzymes is proposed to act as a permissive factor for the initiation of Pink1/Parkin mitophagy. The conclusions are based on strong data in vivo and there is a lot to like about this paper. The analyses are done rigorously, conclusions are balanced and well supported and there is a lot of conceptual novelty in the dataset. At the same time the paper raises some questions with regard to the role of mitophagy, at least in Drosophila. Not all of these could be answered during revisions but it would be useful to address the points outlined below. 1. The functional measurements such as climbing, flight and lifespan are used to complement the data on mitophagy and mitochondrial health. However, it is clear that these do not correlate. Ntc KOs and Pink1/Parkin flies have reduced climbing and flight ability, however ntc KO does not affect mitochondrial function. In case of Pink1/Parkin the assumption is that impaired fly functionality is due to damaged mitochondria. This is clearly not the case with Ntc. How relevant is climbing/flight/lifespan to the role of Ntc in mitophagy? 2. Fig 3 is somewhat patchy, mitophagy is shown for USP30 and ntc KO epistasis but climbing index used in OE setting. These data do not match, and it feels like experiments that are shown are the ones that worked. The relevance of climbing index to mitophagy is unclear as mentioned above. Does KO/OE of ntc and USP30 affect levels of mitochondria, e.g. Marf used as a maker for mitochondria in Fig. 1? And if not why not, considering that ntc/USP30 but not PINK/Parkin control basal mitophagy? 3. What is the role of mitophagy in the maintenance of mitochondrial function in Drosophila in general? Pink1/Parkin KO assumed to result in dysfunctional mitochondria due to impairment of damage-induced mitophagy which is a minor contributor to mitophagy as has previously been published by the authors and confirmed in this dataset using mitophagy reporter. At the same time ntc is clearly required for mitophagy, but mitochondria remains structurally and functionally intact in ntc KO. The most straightforward interpretation of these data is that Pink1/Parkin contribute little to mitophagy in flies and their effect on mitochondria and fly function is independent of mitophagy. Instead ntc (and USP30) strongly regulate mitophagy but mitophagy is not important for the maintenance of mitochondrial function. The effect of ntc on fly function is also independent of its role in mitophagy/mitochondria. Unless there is an alternative explanation the entire dataset would need to be reinterpreted and discussed differently.

      Significance

      Very strong genetic data presented; novel functions for human Park15 homologue in Drosophila; mechanistic insight into the ubiquitination of mitochondria by two opposing enzymes. Overall very interesting paper but interpretation is less clear which needs to be addressed.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      To the Editor,

      We thank the reviewers for their generous efforts on behalf of our manuscript. We were very pleased to see that reviewer #1 considered our manuscript a “very detailed, high quality paper” that “serves as an important resource for the field.” And that Reviewer #2 concurred, writing that our manuscript is “valuable because it generates large datasets on the NK/ILC family from human blood that can be deposited in repositories”, and that it is of “special relevance to the HIV field because it examines viral infection effects on these subsets.”

      We believe the revisions made in response to the reviewers suggestions have improved the presentation of our data. Our responses to each reviewer comment are listed below in bold font. References mentioned here are listed in a bibliography at the end of this document.Changes to the text are also highlighted in the manuscript.






      1. Point-by-point description of the revisions

      This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *


      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Wang and colleagues present a very detailed, high quality paper describing phenotyping, transcriptional, epigenetic and functional differences between NK cells and ILCs in human peripheral blood. They overlay these studies which descriptions of differences in these populations in healthy and HIV infected (viremia, ART-treated, controllers), extending a their previous 2020 study.

      Overall, this paper serves as an important resource for the field. There are areas in which the manuscript could be modified to improve clarity and detail regarding rigor.

      My comments below are all addressable and therefore I class them all as 'major'.

      1. The authors describe ILCs as being 'permanently deleted' in HIV infection. As written, this can be misinterpreted to suggest complete ablation of this cell subset. This is clearly not the case. Moreover, there looks to be some restoration of ILCs in ART-treated participants. I suggest revising text to quantify the level of cell loss or replace the word deleted with reduced. The reviewer is correct that ILCs are not completely ablated. In response to this important point we have clarified the text, as follows:

      - As indicated on page 5, we have changed the text to, “ILCs are decreased in the blood and intestinal lamina propria in people living with HIV-1, even after viremia has been suppressed by antiviral therapy”.

      - In the Results on page 13, we have changed the text to “ILCs were decreased in all subgroups of people living with HIV-1”.

      __- The text on page 18 was changed to, “The percentage of ILCs in the Lin–CD56– population decreased from 37.5% in HIV-1– controls to 7.34% in people living with HIV-1 who are viremic; the reduction in ILCs was not fully restored by ART (24.38%) or in spontaneous controllers (18.16%)” __

      - As indicated on page 26 in the Discussion, we have changed the text to “HIV-1 infection permanently reduces ILCs but not NK cells”.

      1. The HIV EC are not clearly discussed in the paper and are not distinguished from viremic controllers. If ILCs are permanently reduced in this group, what does this suggest for the role of this cell subset in HIV control? Plasticity between ILC and NK cells is described. Is this plasticity relevant at all for HIV control, elite or otherwise? We thank the reviewer for asking us to clarify these important points in the manuscript:

      2. Though elite controllers suppress HIV-1 viremia to undetectable levels, ILC numbers are still decreased in these individuals. Additionally, we do not detect an inverse correlation between ILC numbers and viremia. Further, our previous publication showed that ILC reductions in HIV-1 infection correlate inversely with markers of systemic inflammation, for example sCD14 _(Wang et al_, 2020b)_. Like other people living with HIV-1 infection, elite controllers have elevated microbial translocation, suggestive of disturbed gut homeostasis (Brenchley _et al, 2006)_. Some studies have even reported higher rates of cardiovascular disease in elite controllers, presumably as a result of higher levels of systemic inflammation_ (Crowell et al. 2015; Caetano et al. 2022).____ Taken together, these observations suggest that ILCs play no direct role in control of HIV-1 replication. These points are discussed on page 26-27. __

      3. The fascinating question of plasticity between ILCs and NK cells is one we have explored extensively, both in our previous work and in the current manuscript. Plasticity has been reported between intraepithelial ILC1s and NK cells from tumor tissue, and between ILC3s and NK cells in tonsil _(Moreno-Nieves et al_, 2021; Raykova _et al, 2017; Cortez _et al, 2017)_. When ILC2s are cultured in vitro with IL-12, IFN-γ and TBX21 expression are upregulated to the levels of CD56hiNK cell (Lim _et al, 2016)_, indicating possible plasticity between ILC2 and CD56hiNK cells under certain inflammatory conditions. In HIV-1 infection, we do not detect correlations between the decrease in ILCs and increase in NK cells. In fact, the total NK cells did not change in HIV-1+ people who are viremic, on ART, or viremic controllers [(Figure 2A and 2B in (Wang _et al, 2020b)____]. Our transcriptome analysis indicates that, during HIV-1 infection, ILCs are likely depleted by inflammation-induced apoptosis (Figure 4I and Supplemental Table 6). However, whether blood ILCs (ILCPs or ILC2s) can upregulate TBX21 and EOMES to give rise to NK cells during HIV-1 infection is an interesting question worth further investigation. We now discuss the reviewer’s question on pages 27. __ III. The authors write that ILCs have a primary role in cytokine secretion and then distinguish the ILCs from NKs....but NKs also secrete cytokines. Can the authors please clarify their text?

      __The reviewer is correct that, in this context, our statement is confusing. We have therefore deleted the sentence “Typical of cells with a primary role in secretion of cytokines…” on page 10. This change helps to focus the text on the specific genes that distinguish these subsets. __

      1. Discussion (an also Results) - The authors use pseudotime analysis to show that CD56+NK cells sit between the ILCs and CD56-NKs. When initially described in the Discussion they don't really interpret this in terms of their (and others' observations) that CD56-NKs are increased in disease. Other groups have suggested CD56-NKs are dysfunctional. Here you show different granzyme profiles between CD56+ and CD56- NKs. Elsewhere you distinguish CD56dim and CD56- NKs in terms of functionality in HIV+ donors, though these cells cluster on the pseudotime analysis. The IL-2 and CD4+ T cell data add another layer of complexity.
      2. Altogether, I am unclear on the authors' interpretation of their collective data.
      3. Can you please clarify whether you are suggesting that CD56dimNKs are a distinct from CD56+ NKs but functional as opposed to CD56-NKs that are dysfunctional? __It would be best to respond to these two questions together. It is important to remember that our manuscript describes the characterization of these cells using several techniques. __

      - By flow cytometry, NK cells can be separated into CD56hi, CD56dim, and CD56neg populations (Figure 1F). Pseudotime analysis of our single cell RNA-Seq data showed that, at the transcriptional level, CD56dim and CD56neg NK cells are very similar to each other and cluster together (Figures 3A and 3F). Nonetheless, as compared with CD56dim NK cells, CD56neg NK cells express lower levels of GZMA and PRF1 (Supplemental Figure 4A), and produce less IFN-γ upon cytokine stimulation (Figures 8H and 8J). And when CD56neg NK cells are sorted and assessed by Bulk RNA-Seq, which gives deeper coverage than single cell RNA-Seq, metabolic gene expression is altered with respect to CD56dim NK cells (Figure 9).

      __- Our pseudotime analysis based on single cell RNA-Seq showed that CD56hiNK cells form a distinct cluster, but that they share some transcriptional features with both the ILC cluster and the CD56dim/CD56–NK cell cluster (Figures 3A-3C and 3F). __

      - In people living with HIV-1, as assessed by flow cytometry, CD56neg NK cells increase in number at the expense of CD56dim NK cells (Figure 7C). And yes, we show here that CD56neg NK cells expand in tissue culture if CD4+ T cells are depleted from the PBMCs, and addition of exogenous IL-2 prevents the switch from CD56dimNK cells to CD56–NK cells (Figures 8A-8C). These points are covered in the Results and Discussion on pages 11 and page 29-30.

      1. Are CD56-NKs end-stage or can they be rescued? IL-2 treatment of CD56–NK cells from people living with HIV-1 can be converted back to CD56dimNK cells, though function is not fully restored to the level of CD56dimNK cells ____(Mavilio ____et al_, 2005)_. ____In our manuscript, we showed that IL-2 or IL-15 treatment can prevent CD56dimNK cells from becoming dysfunctional CD56–NK cells, and that these cytokines maintain mTOR activity (Figure 8A-D, 8G, 8I and Figure 10). Taking together our data with the published data, CD56–NK cells appear to be an end-stage dysfunctional cell. Whether conditions can be found for full restorage of function is an important question that is worth pursuing. This point is now stated on page 30.

      2. CD8 T cell number remain high post ART and very much drive the ongoing inverted CD4:CD8 ratio. Have the authors consider how and if the need of these cells for IL-2 impact recovery of NK cell populations? __Two orthogonal experiments indicate that IL-2 secreted by CD4+ T cells, but not from CD8+ T cells, is responsible for the recovery of CD56dimNK cells after treatment with ART. In our ex vivo culture of PBMCs, depletion of CD4+ T cells , but not of CD8+ T cells, was associated with increased numbers of CD56–NK cells (Supplemental Figure 6A). Additionally, the IL-2 concentration in plasma from people living with HIV-1 correlated with CD4+ T cell numbers, but not with CD8+ T cell numbers (Figures 8N and 8O). __

      3. Discussion: It would be very helpful if the authors can pull this large volume of data together in a summary paragraph and possibly also a graphic. __We thank the reviewer for the suggestion. We have now summarized our data in the discussion (page 31). Additionally, we have added bullet points with a 2 sentence summary to accompany our graphic abstract (page 3). __

      4. "Thus, GZMK+CD8+T cells appear to be the adaptive counterpart of CD56hiNK cells, representing an intermediate state between cytokine producing CD4+T cells and cytotoxic CD8+T cells" For me, the 'cytokine-producing CD4+ T cells' comes from in from left field here. Can the authors please clarify or was the intent to write cytokine-producing CD8+ T cells? To clarify what we meant we need to discuss two points:

      First, NK cells can be considered as the innate immune counterparts of CD8+T cells, in that both cell types are cytotoxic killer cells. In contrast, ILCs may be considered as the innate counterparts of non-cytotoxic CD4+ T helper cells. For example, like Th1 cells, ILC1 cells are TBX21+ producers of IFN-γ. And like Th2 cells, ILC2s are GATA3+ producers of IL-13. The relationship between ILCs and NK cells is similar to the relationship between CD4+T help cells and CD8+ cytotoxic T cells _(Vivier et al_, 2018)____. __

      Second, previous studies showed that GZMK+CD8+T cells are distinguished from other CD8+T cells by higher expression of IL7R, TCF7, IFN-γ and TNF-α, and by decreased cytotoxic activity ____(Jonsson ____et al_, 2022)_. Thus, the relationship between GZMK+CD8+T cells and GZMK–CD8+T cells may be similar to the relationship between CD56hiNK cells (GZMK+, IL7R+, TCF7+, higher IFN-γ production and lower cytotoxicity) and cells from the CD56dim and CD56–NK cell cluster (GZMK–, IL7R–, TCF7–, lower IFN-γ production and higher cytotoxicity). In response to this comment we have modified the text on page 25-26 to make these points more clear.

      VII. Methods: Were Pearson correlations applied because of the large 'n' or were data first tested for normality?

      After checking the normality, nonparametric spearman correlation was performed for panels that failed the normality test. For panels with smaller n, the normality test may be not applicable, and Pearson correlation was performed.

      VIII. Methods: Please clearly justify the use of t-tests throughout the manuscript rather than non-parametric based tests.

      We tested the normality before performing parametric or nonparametric test. The t-test, Wilcoxon test or Mann-Whitney test used in our analysis was now specified for each panel in the legend. For panels that calculate cell percentage or numbers with smaller n, normality test may be not applicable, t-test was performed as done previously in these papers, Figure 7C and 7D in _(Wang et al_, 2020a)_, and in Figure 3 and 4 in (Xue _et al, 2022)____. We confirmed these analyses with two statisticians in our institute. __

      1. Methods: How many cells were acquired in flow cytometry? How many ILCs were acquired in healthy/HIV+ donors for these studies? Did this create limitations on interpretation of phenotypic data? ILCs constitute roughly 1,000 cells per million PBMCs. To assess ILCs, we acquired data from 500,000 PBMCs, or roughly 500 ILCs per sample. NK cells constitute roughly 100,000 cells per million PBMCs, we acquired data from 200,000 PBMCs, or roughly 20,000 NK cells per sample. For each patient group, whether HIV-1-negative, HIV-1 viremic, etc, we analyzed PBMCs from at least 19 blood donors. This information is now stated in the “Flow cytometry” section in “Methods”, on page 35.

      2. Methods: How was the cytokine concentrations used for in vitro assays determined? The cytokine concentrations were determined according to previous publication and our previous studies ____(Romee ____et al_, 2016, 2012; Wang _et al_, 2020b; Silverstein _et al_, 2022)_. We have added the related references to the “Stimulation conditions” section in “Method”, on page 36.

      3. Figure: In Figure 4A, should it be '+ILC- ' or '+ILC' (no negative symbol)? __Yes, the reviewer is correct. We have deleted the typo “-”. __

      XII. It's unclear from you single cell analysis how many cells were acquired for each of the 4 subsets. I assume less ILCs were analyzed. If so, can you please clarify for the non-bioinformatician how your bioinformatic analysis took these differences into account?

      Indeed, we were concerned that we might have too few ILCs and therefore set up conditions so that similar numbers of each cell type were assessed. To accumulate enough ILCs for single cell analysis, ILCs were sorted from 3 donors. ILCs, CD56hi, CD56dim and CD56–NK cells were sorted in parallel from the same 3 donors. The sorting strategy is shown in Supplemental Figure 1D. Equal numbers of ILCs, CD56hi, CD56dim and CD56–NK cells were sorted and then mixed together before library preparation. In total, libraries were generated from 5,210 single cells using 10 x genomics. 1,478 ILC2s, 897 ILCPs, 1,116 CD56hiNK cells, and 1,486 CD56dim and CD56–NK cells were shown in UMAP. We have added this information in Figure 3 legend.

      Reviewer #1 (Significance (Required)):

      Overall, this paper serves as an important resource for the field.

      There are areas in which the manuscript could be modified to improve clarity and detail regarding rigor (see above). The overall message of this work for understanding HIV pathogenesis is unclear but can be addressed.

      __We appreciate the reviewer’s efforts on behalf of our manuscript. By carefully addressing the reviewer’s questions and comments, we believe that the rigor of our manuscript is improved and that the message regarding HIV-1-induced abnormalities of ILCs and NK cells are clarified. __

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: This manuscript makes use of RNA sequencing, ATAC-Seq and single cell sequencing to compare transcriptomes and identify relationships between various ILC/NK cell subsets in blood from uninfected controls. The authors describe differences in genes and pathways between subsets and determine that CD56high NK cells are an intermediate-connecting cell type between ILC progenitors and CD56dim NK cells. The authors show how HIV infection (viremic, ART+ or controllers) effect ILC/NK cell gene expression and pathways. One of the genes enhanced in NK cells is AREG which the authors demonstrate to be upregulated in IL/NK subsets in response to PMAI/I stimulation or stimulation with IL-2 or IL-15. The authors demonstrate that TGFB1 or knockout of RUNX3 modulates the frequency of AREG+ NK cells, implicating the Wnt signaling pathway in AREG regulation. Authors show that in PLWH, the frequency of AREG+ NK cells is altered. Authors also report that with HIV infection there is an increase in CD56neg NK cells with corresponding loss of CD56dim cells. Using healthy control PBMCs, the authors suggest differentiation of CD56dim into CD56neg is prevented by CD4 T cell production of IL-2 but promoted by TGFB1. Also in healthy controls, the authors run metabolomics to describe how CD56dim are more metabolically functional than CD56neg and link this to MTOR activity.

      Major:

      • Which population(s) of NK cells (high, dim or negative for CD56) are responding to stimulation with IL-2 and IL-15 by upregulating AREG in Figure 5? Does this NK population have higher expression of receptors for IL-2 and IL-15 (in single cell seq data or by flow) and if so how does receptor expression change in PLWH? We thank the reviewer for these excellent questions. In response, we have added the new figure below to Supplemental Figure 4E. In general, CD56hi NK cells have higher AREG RNA and protein than do the other NK cell subsets. After IL-2 or IL-15 stimulation, all three NK cell populations upregulate AREG, though CD56hiNK cells produce significantly higher levels of AREG than do either CD56dim or CD56negNK cells.





      __Consistent with the above results, the expression of IL2RB, IL2RG and IL15RA was higher in CD56hiNK cells than in CD56dimNK cells (new Supplemental Figure 4F). __






      We examined IL2RA, IL2RB, IL2RG, and IL15RA expression in the different NK cell subsets from the three groups of people living with HIV-1, ART, viremic, and controllers. As compared with cells from HIV-1-negative people, the only clearly significant difference for these four genes was a reduction in IL2RB expression in CD56– and CD56dim NK cells from viremic people. These points are now mentioned on page 15.

      • Does signaling through IL-2 or IL-15 converge on the TCF7/Wnt signaling pathway? For example, is it possible to knockdown TCF7 then stimulate with IL-2 or IL-15 and measured AREG+ cells with the idea that loss of TCF7 would result in reduced cytokine-induced activation of AREG if mediated through the Wnt pathway? Indeed, this question was very important to us and we attempted to answer it with lentiviral vector-mediated knockdown with shRNA and with electroporation of Cas9 ribonucleoprotein complexes (RNPs). Though we were successful in decreasing TCF7 protein, to render NK cells competent for lentiviral transduction or for electroporation with the Cas9 RNPs, NK cells must first be cultured for at least 7 days in high concentration IL-2. This treatment with IL-2 activates AREG production before TCF7 protein is decreased. These points are now discussed in the manuscript on page 29.

      • In Figure 8 the authors demonstrate that CD4 T cells promote the maintenance of CD56dim NK cells likely through production of IL-2. Was AREG expression examined in these studies and if so could you conclude that CD4 T cells also promote AREG expression in this population? Yes, indeed, CD4+T cells, or IL-2, promote AREG production by CD56dimNK cells. Depletion of CD4+T cells from PBMCs decreased AREG production and addition of exogenous IL-2 was sufficient to restore AREG production by NK cells when CD4+ T cells were depleted (see figure below, left panel). Additionally, IL-2 neutralizing antibodies decreased AREG production by NK cells in total PBMC cultures (right panel). These results are now included as Supplemental Figure 6G and 6H in the revised manuscript.

      • In Figure 8D, although significant, the increase in percentage from 2-4% of the CD56neg is a minimal change. Could a higher dose of IL-2 be tested to see more substantial changes? Similar comment for Figure 10D, although significant, the increase in percentage from 2-4% of the NK population to CD56neg is not a large change with rapamycin. Could a higher dose be tested (that does not kill the cells) or a different inhibitor be used to see more substantial changes? More robust changes would strengthen the conclusions. First to clarify, as concerns figure 8D, we believe the reviewer is referring to IL-2 neutralizing antibody, not IL-2. Regarding Figure 8D, which used IL-2 neutralizing antibody at 4 ug/ml, we tried a higher dose (10 ug/ml) but this caused cell death. We also tried longer culture time with 4 ug/ml IL-2 neutralizing antibody, and found the cell viability decreases after 7 days culture. Similarly, the limited in vitro culture time in the presence of anti-IL-2 antibody restricted experimental conditions in Figure 10D.

      • In Figure 10, was the increase in pmTOR with IL-2/IL-15 stimulation specifically observed in CD56dim cells (rather than total NK cells or CD56neg cells)? This would strength the conclusion that CD56dim is more metabolically functional than CD56neg. Our data indicate that the mTOR response to IL2 in CD56–NK cells was similar to that in CD56+NK cells (including CD56dim and CD56hi) (see figure below). This result is consistent with a previous report showing that, when stimulated with exogenous IL-2, sorted CD56– NK cells become CD56dimNK cells ____(Mavilio ____et al_, 2005)_. Our data extend this observation by showing that upregulation of CD56 on CD56neg NK cells by IL-2 correlates with mTOR upregulation.






      Minor

      • Approximately how many ILC from PLWH were submitted for single cell sequencing: Since this cell population was depleted in HIV+, was there a sufficient number of cells to interpret/publish DEG results in Figure 4? In Figure 4, ILCs were sorted from HIV-1 negative donors and different groups of PLWH, and then these cells were subjected to bulk-RNA seq using CEL-Seq2. In Figure 4, for most blood donors, whether HIV-1 negative or PLWH, well over 1,000 ILCs were sorted and used to construct high quality libraries (see figure below, was included as new Supplemental Figure 3C). PCA plots also showed that all ILC libraries clustered together as a distinct population (Figure 4A), indicating the quality of all ILC libraries was comparable.






      • On page 13 of text, it is a bit disconcerting to jump to Figure 7 then back to Figure 4. Would recommend reorganizing text or figure panels to flow better. __We have deleted the premature mention of Figure 7A. __

      • Supplemental Figure 1 and 2: Dots for ILC population are purple in color but legend is mislabeled as pink color.

      • Supplemental Figure 4: Dots for HIV+ controller are purple in color, but legend is mislabeled as pink in color. Thank you, these mistakes in the labeling of the colors have been corrected.

      • Would recommend adding quantification of Figure 5A for all donors tested. In fact, the AREG production by CD56hi, CD56dim, CD56–NK cells and ILCs from HIV-1 negative donors were quantified in Figure 6A.

      • Figure 5B for IFNg it appears that part of the positive population is not gated on and thus percentages are likely higher if the gate is adjusted. We thank the reviewer for the suggestion. The gating for IFN-γ has been adjusted in the revised manuscript, as suggested. The original Figure 5B and associated histogram Figure 5C were replaced accordingly. Please see the newly gated figure below:















      • For Figure 5F, need to add to text and panel that PMA/I was used to stimulate as described in figure legend. Current figure and text read that the Wnt agonist alone was responsible for levels depicted in NK subsets. We now state that PMA+ionomycin was used to stimulate the cells in Figure 5F and 5G, and in the text (page 16 and 28).

      • On the x-axis of Figure 6F-J does "Lin-TBX21+" refer to Total NK cells? If so then would recommend sticking with nomenclature "Total NK" as in Figure 6A-B. The x-axis of Figure 6F-J was changed to “total NK (Lin–TBX21+)”.

      • Would recommend labeling gates for populations of interest in Supplemental Figure 5B-C, Supplement Figure 6A, Figure 8A. The populations of interest (CD56dimNK, CD56–NK, and ILCs) were labeled as suggested.

      • Other groups have shown that CD56neg are increased in HIV, functionally impaired and correlate with loss of CD4 T cells. Would recommend citing their studies. The original manuscript had mentioned only Mavilio et al. The revised manuscript now has a more complete list of references ____(Cao ____et al_, 2021; Mavilio _et al_, 2005; Cocker _et al_, 2022; Alter _et al_, 2005; Barker _et al_, 2007)_. These references are cited in the Introduction (page 5) and in the Results (page 20).

      • Would recommend adding quantification of Figure 8A for all donors tested. Also, for the 3rd flow plot does "NK+CD4" mean purified NK cells + autologous CD4 T cells? If so, then would clarify in figure legend. It may strengthen conclusion for IL-2/IL-15 to show differentiation of NK cells is not contact dependent with T cell via transwell assay. __Quantification for all donors in Figure 8A has been added to the revised manuscript (Figure 8A, right panel). The figure legend has been modified accordingly. As far as the comment about contact-dependence, the fact that CD56dimNK cells were maintained by IL-2 in the absence of CD4+ T cells demonstrates that direct contact with CD4+ T cells is not required. __

      Reviewer #2 (Significance (Required)):

      Significance: This study is valuable because it generates large datasets on the NK/ILC family from human blood that can be deposited in repositories and of special relevance to the HIV field because it examine show viral infection (controlled or not) effects these subsets.

      The strengths of the study are the cohort of PBMC samples utilized (HIV-, HIV+ viremic, HIV+ ART+ and HIV+ controlled), the multi-omics approach for transcriptome and epigenetics and the in vitro mechanistic studies identifying key regulators of NK cell differentiation/function.

      The study advances the field "mechanistically" by providing key targets that may be subject to therapeutic modulation in PLWH such as AREG, IL-2 signaling, IL-15 signaling, Wnt signaling, and mTOR activity (although more work will need to be done to examine these pathways using PBMCs from HIV+). This study advances the field "conceptually" by providing large datasets for others to mine if deposited.

      The audience for this study "basic research" such as immunologists in the HIV field or immunologist interested in ILC/NK biology.

      My field of expertise is infectious disease (HIV, SARS-CoV-2), basic immunology (ILC, NK, B cell) and autoimmune disease. Would recommend additional reviewers for assessment of metabolic genes/pathways in Figure 9-10.

      __We were very pleased to see that the reviewer thought our manuscript makes a valuable contribution to HIV-1 immunology and ILC/NK biology, that it advances mechanistic understanding of pathogenesis in people living with HIV-1, and that it provides a valuable data resource. __

      - In Figure 9, the metabolism related genes were defined as canonical targets of, or regulated by, MTOR signaling, in previous publications ____(Saxton & Sabatini, 2017; Bayeva ____et al_, 2012)_.

      - In Figure 10, we used pMTOR, pAKT, p4EBP1, pS6 and CD71 to monitor MTOR pathway activation as reported previously by others ____(Marçais ____et al_, 2014)_. We have cited this paper on pages 23 and 24.


      References for Response to Reviewers

      Alter G, Teigen N, Davis BT, Addo MM, Suscovich TJ, Waring MT, Streeck H, Johnston MN, Staller KD, Zaman MT, et al (2005) Sequential deregulation of NK cell subset distribution and function starting in acute HIV-1 infection. Blood 106: 3366–3369

      Barker E, Martinson J, Brooks C, Landay A & Deeks S (2007) Dysfunctional natural killer cells, in vivo, are governed by HIV viremia regardless of whether the infected individual is on antiretroviral therapy. AIDS 21: 2363–2365

      Bayeva M, Khechaduri A, Puig S, Chang H-C, Patial S, Blackshear PJ & Ardehali H (2012) mTOR regulates cellular iron homeostasis through tristetraprolin. Cell Metab 16: 645–657

      Brenchley JM, Price DA, Schacker TW, Asher TE, Silvestri G, Rao S, Kazzaz Z, Bornstein E, Lambotte O, Altmann D, et al (2006) Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med 12: 1365–1371

      Caetano DG, Ribeiro-Alves M, Hottz ED, Vilela LM, Cardoso SW, Hoagland B, Grinsztejn B, Veloso VG, Morgado MG, Bozza PT, et al (2022) Increased biomarkers of cardiovascular risk in HIV-1 viremic controllers and low persistent inflammation in elite controllers and art-suppressed individuals. Sci Rep 12: 6569

      Cao W-J, Zhang X-C, Wan L-Y, Li Q-Y, Mu X-Y, Guo A-L, Zhou M-J, Shen L-L, Zhang C, Fan X, et al (2021) Immune Dysfunctions of CD56neg NK Cells Are Associated With HIV-1 Disease Progression. Front Immunol 12: 811091

      Cocker ATH, Liu F, Djaoud Z, Guethlein LA & Parham P (2022) CD56-negative NK cells: Frequency in peripheral blood, expansion during HIV-1 infection, functional capacity, and KIR expression. Front Immunol 13: 992723

      Cortez VS, Ulland TK, Cervantes-Barragan L, Bando JK, Robinette ML, Wang Q, White AJ, Gilfillan S, Cella M & Colonna M (2017) SMAD4 impedes the conversion of NK cells into ILC1-like cells by curtailing non-canonical TGF-β signaling. Nat Immunol 18: 995–1003

      Crowell TA, Gebo KA, Blankson JN, Korthuis PT, Yehia BR, Rutstein RM, Moore RD, Sharp V, Nijhawan AE, Mathews WC, et al (2015) Hospitalization Rates and Reasons Among HIV Elite Controllers and Persons With Medically Controlled HIV Infection. J Infect Dis 211: 1692–1702

      Jonsson AH, Zhang F, Dunlap G, Gomez-Rivas E, Watts GFM, Faust HJ, Rupani KV, Mears JR, Meednu N, Wang R, et al (2022) Granzyme K+ CD8 T cells form a core population in inflamed human tissue. Sci Transl Med 14: eabo0686

      Lim AI, Menegatti S, Bustamante J, Le Bourhis L, Allez M, Rogge L, Casanova J-L, Yssel H & Di Santo JP (2016) IL-12 drives functional plasticity of human group 2 innate lymphoid cells. J Exp Med 213: 569–583

      Marçais A, Cherfils-Vicini J, Viant C, Degouve S, Viel S, Fenis A, Rabilloud J, Mayol K, Tavares A, Bienvenu J, et al (2014) The metabolic checkpoint kinase mTOR is essential for IL-15 signaling during the development and activation of NK cells. Nat Immunol 15: 749–757

      Mavilio D, Lombardo G, Benjamin J, Kim D, Follman D, Marcenaro E, Angeline O’Shea M, Kinter A, Kovacs C, Moretta A, et al (2005) Characterization of CD56–/CD16+ natural killer (NK) cells: A highly dysfunctional NK subset expanded in HIV-infected viremic individuals. Proc Natl Acad Sci U S A 102: 2886–2891

      Moreno-Nieves UY, Tay JK, Saumyaa S, Horowitz NB, Shin JH, Mohammad IA, Luca B, Mundy DC, Gulati GS, Bedi N, et al (2021) Landscape of innate lymphoid cells in human head and neck cancer reveals divergent NK cell states in the tumor microenvironment. Proc Natl Acad Sci U S A 118

      Raykova A, Carrega P, Lehmann FM, Ivanek R, Landtwing V, Quast I, Lünemann JD, Finke D, Ferlazzo G, Chijioke O, et al (2017) Interleukins 12 and 15 induce cytotoxicity and early NK-cell differentiation in type 3 innate lymphoid cells. Blood Adv 1: 2679–2691

      Romee R, Rosario M, Berrien-Elliott MM, Wagner JA, Jewell BA, Schappe T, Leong JW, Abdel-Latif S, Schneider SE, Willey S, et al (2016) Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukemia. Sci Transl Med 8: 357ra123

      Romee R, Schneider SE, Leong JW, Chase JM, Keppel CR, Sullivan RP, Cooper MA & Fehniger TA (2012) Cytokine activation induces human memory-like NK cells. Blood 120: 4751–4760

      Saxton RA & Sabatini DM (2017) mTOR Signaling in Growth, Metabolism, and Disease. Cell 169: 361–371

      Silverstein NJ, Wang Y, Manickas-Hill Z, Carbone C, Dauphin A, Boribong BP, Loiselle M, Davis J, Leonard MM, Kuri-Cervantes L, et al (2022) Innate lymphoid cells and COVID-19 severity in SARS-CoV-2 infection. Elife 11

      Vivier E, Artis D, Colonna M, Diefenbach A, Di Santo JP, Eberl G, Koyasu S, Locksley RM, McKenzie ANJ, Mebius RE, et al (2018) Innate Lymphoid Cells: 10 Years On. Cell 174: 1054–1066

      Wang J, Xu Y, Chen Z, Liang J, Lin Z, Liang H, Xu Y, Wu Q, Guo X, Nie J, et al (2020a) Liver Immune Profiling Reveals Pathogenesis and Therapeutics for Biliary Atresia. Cell 183: 1867–1883.e26

      Wang Y, Lifshitz L, Gellatly K, Vinton CL, Busman-Sahay K, McCauley S, Vangala P, Kim K, Derr A, Jaiswal S, et al (2020b) HIV-1-induced cytokines deplete homeostatic innate lymphoid cells and expand TCF7-dependent memory NK cells. Nat Immunol 21: 274–286

      Xue R, Zhang Q, Cao Q, Kong R, Xiang X, Liu H, Feng M, Wang F, Cheng J, Li Z, et al (2022) Liver tumour immune microenvironment subtypes and neutrophil heterogeneity. Nature 612: 141–147

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      This manuscript makes use of RNA sequencing, ATAC-Seq and single cell sequencing to compare transcriptomes and identify relationships between various ILC/NK cell subsets in blood from uninfected controls. The authors describe differences in genes and pathways between subsets and determine that CD56high NK cells are an intermediate-connecting cell type between ILC progenitors and CD56dim NK cells. The authors show how HIV infection (viremic, ART+ or controllers) effect ILC/NK cell gene expression and pathways. One of the genes enhanced in NK cells is AREG which the authors demonstrate to be upregulated in IL/NK subsets in response to PMAI/I stimulation or stimulation with IL-2 or IL-15. The authors demonstrate that TGFB1 or knockout of RUNX3 modulates the frequency of AREG+ NK cells, implicating the Wnt signaling pathway in AREG regulation. Authors show that in PLWH, the frequency of AREG+ NK cells is altered. Authors also report that with HIV infection there is an increase in CD56neg NK cells with corresponding loss of CD56dim cells. Using healthy control PBMCs, the authors suggest differentiation of CD56dim into CD56neg is prevented by CD4 T cell production of IL-2 but promoted by TGFB1. Also in healthy controls, the authors run metabolomics to describe how CD56dim are more metabolically functional than CD56neg and link this to MTOR activity.

      Major:

      • Which population(s) of NK cells (high, dim or negative for CD56) are responding to stimulation with IL-2 and IL-15 by upregulating AREG in Figure 5? Does this NK population have higher expression of receptors for IL-2 and IL-15 (in single cell seq data or by flow) and if so how does receptor expression change in PLWH?
      • Does signaling through IL-2 or IL-15 converge on the TCF7/Wnt signaling pathway? For example, is it possible to knockdown TCF7 then stimulate with IL-2 or IL-15 and measured AREG+ cells with the idea that loss of TCF7 would result in reduced cytokine-induced activation of AREG if mediated through the Wnt pathway?
      • In Figure 8 the authors demonstrate that CD4 T cells promote the maintenance of CD56dim NK cells likely through production of IL-2. Was AREG expression examined in these studies and if so could you conclude that CD4 T cells also promote AREG expression in this population?
      • In Figure 8D, although significant, the increase in percentage from 2-4% of the CD56neg is a minimal change. Could a higher dose of IL-2 be tested to see more substantial changes? Similar comment for Figure 10D, although significant, the increase in percentage from 2-4% of the NK population to CD56neg is not a large change with rapamycin. Could a higher dose be tested (that does not kill the cells) or a different inhibitor be used to see more substantial changes? More robust changes would strengthen the conclusions.
      • In Figure 10, was the increase in pmTOR with IL-2/IL-15 stimulation specifically observed in CD56dim cells (rather than total NK cells or CD56neg cells)? This would strength the conclusion that CD56dim is more metabolically functional than CD56neg.

      Minor

      • Approximately how many ILC from PLWH were submitted for single cell sequencing: Since this cell population was depleted in HIV+, was there a sufficient number of cells to interpret/publish DEG results in Figure 4?
      • On page 13 of text, it is a bit disconcerting to jump to Figure 7 then back to Figure 4. Would recommend reorganizing text or figure panels to flow better.
      • Supplemental Figure 1 and 2: Dots for ILC population are purple in color but legend is mislabeled as pink color.
      • Supplemental Figure 4: Dots for HIV+ controller are purple in color, but legend is mislabeled as pink in color.
      • Would recommend adding quantification of Figure 5A for all donors tested.
      • Figure 5B for IFNg it appears that part of the positive population is not gated on and thus percentages are likely higher if the gate is adjusted.
      • For Figure 5F, need to add to text and panel that PMA/I was used to stimulate as described in figure legend. Current figure and text read that the Wnt agonist alone was responsible for levels depicted in NK subsets.
      • On the x-axis of Figure 6F-J does "Lin-TBX21+" refer to Total NK cells? If so then would recommend sticking with nomenclature "Total NK" as in Figure 6A-B.
      • Would recommend labeling gates for populations of interest in Supplemental Figure 5B-C, Supplement Figure 6A, Figure 8A.
      • Other groups have shown that CD56neg are increased in HIV, functionally impaired and correlate with loss of CD4 T cells. Would recommend citing their studies.
      • Would recommend adding quantification of Figure 8A for all donors tested. Also, for the 3rd flow plot does "NK+CD4" mean purified NK cells + autologous CD4 T cells? If so, then would clarify in figure legend. It may strengthen conclusion for IL-2/IL-15 to show differentiation of NK cells is not contact dependent with T cell via transwell assay.

      Significance

      This study is valuable because it generates large datasets on the NK/ILC family from human blood that can be deposited in repositories and of special relevance to the HIV field because it examine show viral infection (controlled or not) effects these subsets.

      The strengths of the study are the cohort of PBMC samples utilized (HIV-, HIV+ viremic, HIV+ ART+ and HIV+ controlled), the multi-omics approach for transcriptome and epigenetics and the in vitro mechanistic studies identifying key regulators of NK cell differentiation/function.

      The study advances the field "mechanistically" by providing key targets that may be subject to therapeutic modulation in PLWH such as AREG, IL-2 signaling, IL-15 signaling, Wnt signaling, and mTOR activity (although more work will need to be done to examine these pathways using PBMCs from HIV+). This study advances the field "conceptually" by providing large datasets for others to mine if deposited.

      The audience for this study "basic research" such as immunologists in the HIV field or immunologist interested in ILC/NK biology.

      My field of expertise is infectious disease (HIV, SARS-CoV-2), basic immunology (ILC, NK, B cell) and autoimmune disease. Would recommend additional reviewers for assessment of metabolic genes/pathways in Figure 9-10.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Wang and colleagues present a very detailed, high quality paper describing phenotyping, transcriptional, epigenetic and functional differences between NK cells and ILCs in human peripheral blood. They overlay these studies which descriptions of differences in these populations in healthy and HIV infected (viremia, ART-treated, controllers), extending a their previous 2020 study.

      Overall, this paper serves as an important resource for the field. There are areas in which the manuscript could be modified to improve clarity and detail regarding rigor.

      My comments below are all addressable and therefore I class them all as 'major'.

      1. The authors describe ILCs as being 'permanently deleted' in HIV infection. As written, this can be misinterpreted to suggest complete ablation of this cell subset. This is clearly not the case. Moreover, there looks to be some restoration of ILCs in ART-treated participants. I suggest revising text to quantify the level of cell loss or replace the word deleted with reduced.
      2. The HIV EC are not clearly discussed in the paper and are not distinguished from viremic controllers. If ILCs are permanently reduced in this group, what does this suggest for the role of this cell subset in HIV control? Plasticity between ILC and NK cells is described. Is this plasticity relevant at all for HIV control, elite or otherwise?
      3. The authors write that ILCs have a primary role in cytokine secretion and then distinguish the ILCs from NKs....but NKs also secrete cytokines. Can the authors please clarify their text?
      4. Discussion (an also Results) - The authors use pseudotime analysis to show that CD56+NK cells sit between the ILCs and CD56-NKs. When initially described in the Discussion they don't really interpret this in terms of their (and others' observations) that CD56-NKs are increased in disease. Other groups have suggested CD56-NKs are dysfunctional. Here you show different granzyme profiles between CD56+ and CD56- NKs. Elsewhere you distinguish CD56dim and CD56- NKs in terms of functionality in HIV+ donors, though these cells cluster on the pseudotime analysis. The IL-2 and CD4+ T cell data add another layer of complexity.
        • a. Altogether, I am unclear on the authors' interpretation of their collective data.
        • b. Can you please clarify whether you are suggesting that CD56dimNKs are a distinct from CD56+ NKs but functional as opposed to CD56-NKs that are dysfunctional?
        • c. Are CD56-NKs end-stage or can they be rescued?
        • d. CD8 T cell number remain high post ART and very much drive the ongoing inverted CD4:CD8 ratio. Have the authors consider how and if the need of these cells for IL-2 impact recovery of NK cell populations?
      5. Discussion: It would be very helpful if the authors can pull this large volume of data together in a summary paragraph and possibly also a graphic.
      6. "Thus, GZMK+CD8+T cells appear to be the adaptive counterpart of CD56hiNK cells, representing an intermediate state between cytokine producing CD4+T cells and cytotoxic CD8+T cells" For me, the 'cytokine-producing CD4+ T cells' comes from in from left field here. Can the authors please clarify or was the intent to write cytokine-producing CD8+ T cells?
      7. Methods: Were Pearson correlations applied because of the large 'n' or were data first tested for normality?
      8. Methods: Please clearly justify the use of t-tests throughout the manuscript rather than non-parametric based tests.
      9. Methods: How many cells were acquired in flow cytometry? How many ILCs were acquired in healthy/HIV+ donors for these studies? Did this create limitations on interpretation of phenotypic data?
      10. Methods: How was the cytokine concentrations used for in vitro assays determined?
      11. Figure: In Figure 4A, should it be '+ILC- ' or '+ILC' (no negative symbol)?
      12. It's unclear from you single cell analysis how many cells were acquired for each of the 4 subsets. I assume less ILCs were analyzed. If so, can you please clarify for the non-bioinformatician how your bioinformatic analysis took these differences into account?

      Significance

      Overall, this paper serves as an important resource for the field.

      There are areas in which the manuscript could be modified to improve clarity and detail regarding rigor (see above). The overall message of this work for understanding HIV pathogenesis is unclear but can be addressed.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):


      Summary:

      In this manuscript, Roberts et al. hypothesised that the 5:2 diet (a popular form of IF, a dietary strategy within the Intermittent fasting that is thought to increase adult hippocampal neurogenesis - AHN) would enhance AHN in a ghrelin-dependent manner. To do this, the Authors used immunohistochemistry to quantify new adult-born neurons and new neural stem cells in the hippocampal dentate gyrus of adolescent and adult wild-type mice and mice lacking the ghrelin receptor, following six weeks on a 5:2 diet. They report an age-related decline in neurogenic processes and identify a novel role for ghrelin-receptor in regulating the formation of new adult

      born neural stem cells in an age-dependent manner. However, the 5:2 diet did not affect new neuron or neural stem cell formation in the dentate gyrus, nor did alter performance on a spatial learning and memory task. They conclude that the 5:2 diet used in their study does not increase AHN or improve associated spatial memory function.

      Major comments:

      One criticism might be the fact that many aspects are addressed at the same time. For instance it is not fully clear the role of ghrelin with respect to testing the DR effects on AHN. Although the link between ghrelin, CR and AHN is explained by citing several previous studies, it is difficult to identify the main focus of the study. Maybe this is due to the fact that the Authors analyse and comment throughout the paper the different experimental approaches used by different

      Authors to study effect of DR to AHN. This is not bad in principle, since I think the Authors have a deep knowledge of this complex matter, but all this results in a difficulty to follow the flow of the rationale in the manuscript.

      We appreciate the reviewer’s critique regarding the rationale of the studies presented in the manuscript.

      The role of ghrelin in the regulation of AHN by dietary interventions such as CR and IF is a major interest of our lab and is the main focus of the study. We, and others, have shown that ghrelin mediates the beneficial effects of CR on AHN. It is often assumed that ghrelin will elicit similar effects in other DR paradigms. We selected the 5:2 diet since it is widely practiced by humans, but it has not been well tested experimentally.

      We sought to empirically test how the neurogenic response to 5:2 differed between mice with functional and impaired ghrelin signaling.

      Given that plasma ghrelin levels and AHN are reduced during ageing, we also wanted to determine if 5:2 diet could slow or even prevent neurogenic decline in ageing mice.

      We will re-write the manuscript to ensure that our primary aim is clearly presented. We will also reanalyze the data, with genotype and 5:2 diet as key variables. To help maintain focus, the variable of age will be analyzed separately. This amendment will, we hope, help the reader follow the narrative of our manuscript.

      Another major point: the Discussion is too long. The Authors analyse all the possible reasons why different studies obtained different results concerning the effectiveness of DR in stimulating adult neurogenesis. Thus, the Discussion seems more as a review article dealing with different methods/experimental approaches to evaluate DR effects. We know that sometimes different results are due to different experimental approaches, yet, when an effect is strong and clear, it occurs in different situations. Thus, I think that the Authors must be less shy in expressing their conclusions, also reducing the methodological considerations. It is also well known that sometimes different results can be due to a study not well performed, or to biases from the Authors.

      In our discussion, we felt that it was particularly important to be as rigorous as possible in contextualizing our findings with other published data, whilst highlighting methodological differences. Our aim was to be as precise as possible when comparing findings across studies, however, this resulted in the narrative drifting from the key objectives of our study – namely, to determine the effect of 5:2 diet on neurogenesis and whether or not ghrelin-signalling regulated the process. We will amend the text of the discussion to ensure that the key points of our study are only compared and contrasted with relevant studies in the field. We thank the reviewer for their candid comment.


      Minor comments:

      • This sentence: "There is an age-related decline in adult hippocampal neurogenesis" cannot be put in the HIGHLIGHTS, since is a well known aspect of adult hippocampal neurogenesis

      The reviewer is correct to state this. Our study replicates this interesting age-related phenomenon. However, we will remove it from the ‘Highlights’ section.

      • Images in Figure 5 are not good quality.

      We apologise for this oversight. We will review each figure and panel to ensure that high-resolution images, that are appropriately annotated, are used throughout the manuscript.

      • In general, there are not a lot of images referring to microscopic/confocal photographs across the entire manuscript.

      We structured the manuscript with a limited number of figures and associated microscope captured panels, with the aim of presenting representative images to illustrate the nature and quality of the IHC protocols. However, we will amend the figures for the revised manuscript to provide representative microscopy images, with each group included and clearly annotated.

      • The last sentence of the Discussion "These findings suggest that distinct DR regimens differentially regulate neurogenesis in the adult hippocampus and that further studies are required to identify optimal protocols to support cognition during ageing" is meaningless in the context of the study, and in contrast with the main results. Honestly, my impression is that the Authors do not want to disappoint the conclusions of the previous studies; an alternative is that other Reviewers asked for this previously.

      We do not believe that this statement is contradictory to our findings, as distinct DR paradigms do appear to regulate AHN in different ways. However, we agree that we can be more explicit with regards to our own study findings and will prioritize the conclusions of our study over those of the entire field during revision.

      Reviewer #1 (Significance (Required)):

      value the significance of publishing studies that will advance the field.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):


      In this manuscript, Roberts et al. investigate the effect of the 5:2 diet on adult hippocampal neurogenesis (AHN) in mice via the ghrelin receptor. Many studies have reported benefits of dietary restriction (DR) on the brain that include increasing neurogenesis and enhancing cognitive function. However, neither the mechanisms underlying the effects of the 5:2 diet, nor potential benefits on the brain, are well understood. The authors hypothesize that the 5:2 diet enhances AHN and cognitive function via ghrelin-receptor signaling. To test this, they placedadolescent and adult ghrelin receptor knockout or wild type mice on either the 5:2 or ad libitum (AL) diet for 6 weeks, followed by spatial memory testing using an object in place (OIP) task. The authors also assessed changes in AHN via IHC using multiple markers for cell proliferation and neural stem cells. The authors observed a decrease in AHN due to age (from adolescent to adult), but not due to diet or ghrelin-receptor signaling. While loss of the ghrelin-receptor impaired spatial memory, the 5:2 diet did not affect cognitive function. The authors conclude that the 5:2 diet does not enhance AHN or spatial memory.

      We thank the reviewer for this summary. We note that there was a significant reduction in new neurones (BrdU+/NeuN+) cells in GHS-R null animals, regardless of age or diet (3 way ANOVA of age, genotype and diet (sexes pooled): Genotype P = 0.0290). These data suggest that the loss of ghrelin receptor signalling does impair AHN. However, we will re-analyse our data in light of reviewer 1 comments to remove ‘age’ as a variable. The new analyses and associated discussion will be presented in our revised manuscript.

      The authors use a 5:2 diet but fail to provide a basic characterization of this dietary intervention. For example, was the food intake assessed? In addition to the time restriction of the feeding, does this intervention also represent an overall caloric restriction or not? According to the provided results, the 5:2 diet does not appear to regulate adult hippocampal neurogenesis contrary to the authors' original hypothesis. Did the authors measure the effects of the 5:2 diet on any other organ system? Do they have any evidence that the intervention itself resulted in any well documented benefits in other cell types? Such data would provide a critical positive control for their intervention.

      This is an important point raised by the reviewer. Currently, we carefully quantified weight change across the duration of the study. However, we do not know whether the 5:2 diet reduced overall food intake or whether it impacted the timing of feeding events. To overcome this limitation, we will now test what impact the 5:2 dietary regime has on food intake and the timing of feeding. This study will allow us to correlate any changes with 5:2 diet. In addition, we have collected tibiae to quantify skeletal growth and have collected both liver and plasma (end point) samples which will be used to assess changes in the GH-IGF-1 axis. These additional studies will allow us to characterise the effects of the 5:2 paradigm on key indicators of physiological growth. These new data will be incorporated into the revised manuscript.

      Based on the effects of ghrelin in other dietary interventions, the authors speculate that the effect of the 5:2 diet is similarly mediated through ghrelin. However, the authors do not provide any basic characterization of ghrelin signaling to warrant this strong focus on the GSH-R mice. While the GSH-R mice display changes in NSC homeostasis and neurogenesis, none of these effects appear to be modified by the 5:2 diet. Thus, the inclusion of the GSH-R mice does not seem warranted and detracts from the main 5:2 diet focus of the manuscript.

      The role of ghrelin signalling via its receptor, GHSR, is a central tenet of our hypothesis. The loxTB-GHS-R null mouse is a well validated model of impaired ghrelin signalling, in which insertion of a transcriptional blocking cassette prevents expression of the ghrelin receptor (ZIgman et al.2005 JCI). We have previously shown that this mouse model is insensitive to calorie restriction (CR) mediated stimulation of AHN, in contrast to WT mice (Hornsby et al. 2016), justifying its suitability as a model for assessing the role of ghrelin signalling in response to DR interventions, such as the 5:2 paradigm. Whilst our findings do not support a role for ghrelin signalling in the context of the 5:2 diet studied, we did follow the scientific method to empirically test the stated hypothesis. While critiques of experimental design are welcome, the removal of these data may perpetuate publication bias in favour of positive outcomes and is something we wish to avoid.

      Neurogenesis is highly sensitive to stress. The 5:2 diet may be associated with stress which could counteract any benefits on neurogenesis in this experimental paradigm. Did the authors assess any measures of stress in their cohorts? Were the mice group housed or single housed?

      We thank the reviewer for raising this point. We have open-field recordings that will now be analysed to assess general locomotor activity, anxiety and exploration behaviour. Additionally, we will assess levels of the stress hormone, ACTH, in end point plasma samples. These datasets will be incorporated into the revised manuscript.

      The authors state that the 5:2 diet led to a greater reduction in body weight (31%) in adolescent males compared to other groups. However, it appears that the cohorts were not evenly balanced and the adolescent 5:2 male mice started out with a significantly higher starting weight (Supplementary Figure 1). The difference in starting weight at such a young age is significantly confounding the conclusion that the 5:2 diet is more effective at limiting weight gain specifically in this group.

      We thank the reviewer for highlighting this limitation. In the revision we will re-focus our discussion around the Δ Body weight repeated measures data, which compares the daily body weight of each group to its baseline value - thereby normalising any intergroup differences in starting weight. Furthermore, we will restructure figures 1 and S1 so that figure 1 presents only the repeated measure Δ Body weight data, while data for body weight both at baseline and on the final day of the study will be presented in figure S1.

      The authors count NSCs as Sox2+S100b- cells. However, the representative S100b staining does not look very convincing. Instead, it would be more appropriate to count Sox2+GFAP+ cells with a single vertical GFAP+ projection. Alternatively, the authors could also count Nestin-positive cells. Additionally, the authors label BrdU+ Sox2+ S100B- cells as "new NSCs". However, it appears that the BrdU labeling was performed approximately 6 weeks before the tissue was collected (Figure 1A). Thus, these BrdU-positive NSCs most likely represent label retaining/quiescent NSCs that divided during the labeling 6 weeks prior but have not proliferated since. As such, the term "new NSC" is misleading and would suggest an NSC that was actively dividing at the time of tissue collection.

      We apologise for presenting low-resolution images – these will be replaced by high-resolution images in the revised manuscript. In this study we have quantified the actively dividing BrdU+/Sox2+/S100B- cells that represent type II NSCs (rather than GFAP+ or Nestin+ type I NSCs) that have incorporated BrdU within the time period of the 6-week intervention. We appreciate the reviewer’s comments concerning the “new NSCs” terminology. We agree that we should be more specific in clarifying that the NSCs identified are those labelled during the 1st week of the 6-week intervention. We will amend this throughout the revised manuscript by re-naming these cells as 6-week old NSCs.

      Overall, this manuscript lacks a clear focus and narrative. Due to a lack of an affect by the 5:2 diet on hippocampal neurogenesis, the authors mostly highlight already well-known effects of aging and Grehlin/GSH-R on neurogenesis. Moreover, the authors repeatedly use age-related decline and morbidities as a rational for their study. However, they assess the effects of the 5:2 diet on neurogenesis only in adolescent and young mature but not aged mice.

      To provide greater clarity, and in accordance with reviewer 1’s comments, we will amend the text throughout to provide a focus on the data obtained. The objective of the changes will be to re-enforce the original study narrative. In relation to the use of the term ‘age-related decline’ or ‘age-related changes’, we think that these are appropriate to our study. Physiological ageing doesn’t begin at a specific point of chronological time, but is a process that is continuously ongoing. Indeed, our data is in agreement with previous studies reporting an age-related reduction in AHN at 6 months of age (e.g Kuhn et al.1996).

      Minor Points

      The authors combine the data from both male and female mice for most bar graphs. While this does not appear to matter for neurogenesis or behavioral readouts, there are very significant sexually dimorphic differences with respect to body size and weight. As such, male and female mice in Figure 1D,F should not be plotted in the same bar graph.

      We agree that sexual dimorphism exists with respect to body size and weight. We used distinct male and female symbols for each individual animal on these bar graphs, but do agree with the reviewer that sexual dimorphic differences should be emphasized. To achieve this, we will include additional supplementary graphs presenting the sex differences in starting weight, final weight, and weight change versus starting weight.

      The Figure legends are very brief and should be expanded to include basic information of the experimental design, statistical analyses etc.

      We thank the reviewer for this comment. We will provide specific experimental detaisl in the revised figure legends.

      Many figures include a representative image. However, it is often unclear if that is a representative image of a WT or mutant mouse, or a 5:2 or control group (Figure 2A, 3A, 4A, 5A).

      We structured the manuscript with a limited number of figures and associated microscope captured panels, with the aim of presenting representative images to illustrate the nature and quality of the IHC protocols. However, we will amend the figures for the revised manuscript to provide representative microscopy images, with each group included and clearly annotated.

      It would be helpful to provide representative images of DCX-positive cells in Figure 3A-F. Additionally, the authors should include a more extensive description of how this quantification was performed in the method section.

      We will revise the manuscript to provide representative high-resolution Dcx+ images displaying cells of each category. The method will also be revised to include a detailed description of how the quantification and classification was performed.

      The authors state "the hippocampal rostro-caudal axis (also known as the dorsoventral[] axis". However, the rostral-caudal and dorsal-central axis are usually considered perpendicular to one another.

      We agree that the dorso-ventral and rostral-caudal axes are anatomically distinct. The terms are often used interchangeably in the literature, which can lead misinterpretations (e.g the caudal portion of dorsal hippocampus is often mislabelled as ventral hippocampus). To avoid ambiguity, mislabelling or misidentification, we will include a supplementary figure detailing our anatomical definitions of the rostral and caudal poles of the hippocampus, alongside representative images and the bregma coordinates.

      Reviewer #2 (Significance (Required)):


      Understanding the mechanisms of a popular form of intermittent fasting (5:2 diet) that is not well understood is an interesting topic. Moreover, examining the effect of this form of intermittent fasting on the brain is timely. Notwithstanding, while the authors use multiple markers to validate the effect of the 5:2 diet on adult hippocampal neurogenesis, concerns regarding experimental design, validation, and data analysis weaken the conclusions being drawn.

      We thank reviewer 2 for this significance statement. We will revise the manuscript, as mentioned above, to clarify the experimental design, improve presentation of the data, and re-focus the narrative of the primary aims of the study.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):


      Summary


      In this study, Roberts and colleagues used a specific paradigm of intermitted fasting, the 5:2 diet, meaning 5 days ad libitum food and 2 non-consecutive days of fasting. They exposed adolescent and adult wild-type mice and ghrelin receptor knockout mice (GHS-R-/-) for 6 weeks to this paradigm, followed by 1 week ad libitum food. They further used the "object in place task" (OIP) to assess spatial memory performance. At the end of the dietary regime, the authors quantified newborn neurons and neural stem cells (NSCs) by immunohistochemistry. Roberts

      et al. show that the 5:2 diet does not change the proliferation of cells in the hippocampus, but report an increased number of immature neurons (based on DCX) in all the mice exposed to the 5:2 diet. This change however did not result in an increased number of mature adult-born neurons, as assessed by a BrdU birthdating paradigm. The authors further show diet-independent effects of the ghrelin receptor knockout, leading to less adult born neurons, but more NSCs in the adolescent mice and a lower performance in the OIP task.

      Major comments:

      The main conclusion of this study is that a specific type of intermitted fasting (5:2 diet) has no effects on NSC proliferation and neurogenesis. As there are several studies showing beneficial effects of intermitted fasting on adult neurogenesis, while other studies found no effects, it is important to better understand the effects of such a dietary paradigm.

      The experimental approaches used in this manuscript are mostly well explained, but it is overall rather difficult to follow the results part, as the authors always show the 4 experimental groups together (adolescent vs adult and wt vs GHS-R-/-). They highlight the main effects comparing all the groups, which most of the time is the factor "age". Age is a well-known and thus not surprising negative influencer of adult neurogenesis. Instead of focusing on the main tested factor, namely the difference in diet, the authors show example images of the two age classes

      (adolescent vs adult), which does not underly the major point they are making. Most of the time, they do not provide a post hoc analysis, so it is difficult to judge if the results with a significant main effect would be significant in a direct 1 to 1 comparison of the corresponding groups. The authors point out themselves that previous rodent studies did not use such a 5:2 feeding pattern, so having diet, age and genotype as factors at the same time makes the assessment of the diet effect more difficult.

      The manuscript would improve if the authors restructure their data to compare first the diet groups (adolescent wt AL vs 5:2 and in a separate comparison adult wt AL vs 5:2) and only in a later part of the results check if the Ghrelin receptor plays a role or not in this paradigm.

      We thank the reviewer for these comments. In line with comments from the other reviewers we will re-formulate the presentation of our datasets. We will remove ‘age’ as a key variable as age related changes are to be expected. For the revision, we will separate the adolescent and adult mouse data sets, plotting individual graphs for both. This should provide a clearer focus on 5:2 responses in both assessed genotypes.

      This re-configuration will impact the data being analysed and, therefore, the statistical analysis presented. In our original manuscript post hoc analyses were performed, however, only significant post hoc comparisons were highlighted (e.g figure 5). Non-significant post hoc comparisons have not been presented. In the method section of the revised manuscript, we will clarify that we’ll report post hoc differences when they are observed.

      During our study design, we decided to assess diet and genotype in parallel - as part of the same analysis. This seemed to us to be the most appropriate statistical method, so that we assessed dietary responses in both WT and GHS-R null mice.

      As this 5:2 is a very specific paradigm, it is furthermore difficult to compare these results to other studies and the conclusions are only valid for this specific pattern and timing of the intervention (6 weeks). It remains unclear why the authors have not first tried to establish a study with wildtype mice and a similar duration as in previous studies observing beneficial effects of intermitted fasting on neurogenesis. Like this, it would have been possible to make a statement if the 5:2 per se does not increase neurogenesis or if the 6 weeks exposure were just too short.

      The reviewer raises this relevant point which we considered during the study design period. Given that we had previously reported significant modulation of AHN with a relatively short period of 30% CR (14 days followed by 14 days AL refeeding (Hornsby et al.2016)), we predicted that a 6 week course on the 5:2 paradigm (totalling 12 days of complete food restriction over the 6 week period) would provide a similar dietary challenge. The fact that we did not observe similar changes in AHN with this 5:2 paradigm is notable.

      The graphical representation of the data could also be improved. Below are a few

      examples listed:

      1.) Figure 1 B and C, the same symbol and colours are used for the adolescent and adult animals, which makes the graphs hard to read. One colour and symbol per group throughout the manuscript would be better.

      We thank the reviewer for this comment. We will amend the presentation of the graphs throughout the manuscript to ensure that they are easier to interpret.

      2.) The authors found no differences in the total number of Ki67 positive cells in the DG. However, Ki67 staining does not allow to conclude the type of cell which is proliferating. It would thus strengthen the findings if this analysis was combined with different markers, such as Sox2, GFAP and DCX.

      Double labelling of Ki67 positive cells would allow for further insight into the identity of distinct proliferating cell populations. However, quantifying Ki67 immunopositive cells within the sub-granular zone of the GCL, as a single marker, is commonly used in studies of AHN. Given that studies of intermittent fasting, calorie restriction and treatment with exogenous acyl-ghrelin report no effect on NPC cell division, we decided not to pursue this line of inquiry.

      3.) In Figure 3, the authors say that the diet increases the number of DCX in adolescent and adult mice, which is not clear when looking at the graph in 3B. Are there any significant differences when directly comparing the corresponding groups, for instance the WT AL vs the WT 5:2? It is further not clear how the authors distinguished the different types of DCX morphology-wise. The quantification in C and D would need to be illustrated by example images. Furthermore, the colour-code used in these graphs is not explained and remains unclear

      While the 3 way ANOVA does yield a significant overall effect for diet, we agree that it is indeed difficult to see a difference on the graph, although the mean values of the adolescent 5:2 animals are more prominent than the AL counterparts. Mean +/- SEM will be provided in the supplementary section of the revised manuscript. Furthermore, we will clarify the method used to identify distinct DCX+ morphologies, include representative high-resolution images of each DCX+ cell category, and amend the colour coding to avoid misinterpretation.

      4) In Figure 5, the authors show that the number of new NSCs is significantly increased in the adolescent GHS-R-/- mice, independent of the diet, but this increase does not persist in the adult mice. They conclude that "the removal of GHS-R has a detrimental effect on the regulation of new NSC number..." this claim is not substantiated and needs to be reformulated. As the GHS-R-/- mice have a transcriptional blockage of Ghrs since start of its expression, would such an effect on NSC regulation not result in an overall difference in brain development, as ghrelin is also important during embryonic development?

      This is an interesting point. However, we disagree that the statement "the removal of GHS-R has a detrimental effect on the regulation of new NSC number..." is unsubstantiated, since it does not exclude any developmental deficits in these mice that may account for the differences observed. Nonetheless, we will rephrase the sentence to clarify our intended point and remove any ambiguity.

      5.) In Figure 6, the authors asses spatial memory performance with a single behavioral test, the OIP. As these kind of tests are influenced by the animal's motivation to explore, it's anxiety levels, physical parameters (movement) etc., the interpretation of such a test without any additional measured parameters can be problematic. The authors claim that the loss of GHS-R expression impairs spatial memory performance. As the discrimination ratio was calculated, it is not possible to see if there is an overall difference in exploration time between genotypes. This would be a good additional information to display.

      We thank the reviewer for this insight. We have open-field recordings that will now be analysed to assess general locomotor activity, anxiety and exploration behaviour. These data, alongside exploratory time of the mice during the OIP task will be incorporated into the revised manuscript.

      Besides these points listed above, the methods are presented in such a way that they can be reproduced. The experiments contained 10-15 mice per group, which is a large enough group to perform statistical analyses. As mentioned above, the statistical analysis over all 4 groups with p-values for the main effects should be followed by post hoc multiple comparison tests to allow the direct comparison of the corresponding groups.

      Reviewer #3 (Significance (Required)):

      In the last years, growing evidences suggested that IF might have positive effect on health in general and also for neurogenesis. However, a few recent studies report no effects on neurogenesis, using different IF paradigms. This study adds another proof that not all IF paradigms influence neurogenesis and shows that more work needs to be done to better understand when and how IF can have beneficial effects. This is an important finding for the neurogenesis field, but the results are only valid for this specific paradigm used here, which limits its significance. The reporting of such negative findings is however still important, as it shows that IF is not just a universal way to increase neurogenesis. In the end, such findings might have the potential to bring the field together to come up with a more standardized dietary intervention paradigm, which would be robust enough to give similar results across laboratories and mouse strains, and would allow to test the effect of genetic mutations on dietary influences of neurogenesis.

      We thank the reviewer for their insightful and thorough feedback.

      1. Description of the revisions that have already been incorporated in the transferred manuscript

      Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. If no revisions have been carried out yet, please leave this section empty.

      The manuscript has not been revised at this stage.

      2. Description of analyses that authors prefer not to carry out

      Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

      • *

      We have included in our replies to the reviewers a description of the amendments that we will make to our manuscript. Two requested revisions stand out as being unnecessary or cannot be provided within the scope of a revision.

      The first was the request to perform the 5:2 study in older mice. This an interesting suggestion, however, the expense and time needed to maintain mice into old age (e.g >18 months) cannot be provided within the scope of our revision. In addition, given that we report no effect of the 5:2 paradigm on AHN in adolescent (7 week old) and adult (7 month old) mice, there is less justification for such a study in older mice.

      The second request, that we disagree with, was to remove data relating to the GHS-R null mice (see reviewer 2, point 2). The role of ghrelin signalling via its receptor, GHS-R, is a central tenet of our hypothesis. Whilst our findings do not support a role for ghrelin signalling in the context of the 5:2 diet studied, we followed the scientific method to empirically test the stated hypothesis. While critiques of experimental design are welcome, the removal of such data may perpetuate publication bias in favour of positive outcomes and is something we wish to avoid.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this study, Roberts and colleagues used a specific paradigm of intermitted fasting, the 5:2 diet, meaning 5 days ad libitum food and 2 non-consecutive days of fasting. They exposed adolescent and adult wildtype mice and ghrelin receptor knockout mice (GHS-R-/-) for 6 weeks to this paradigm, followed by 1 week ad libitum food. They further used the "object in place task" (OIP) to assess spatial memory performance. At the end of the dietary regime, the authors quantified newborn neurons and neural stem cells (NSCs) by immunohistochemistry. Roberts et al. show that the 5:2 diet does not change the proliferation of cells in the hippocampus, but report an increased number of immature neurons (based on DCX) in all the mice exposed to the 5:2 diet. This change however did not result in an increased number of mature adult-born neurons, as assessed by a BrdU-birthdating paradigm. The authors further show diet-independent effects of the ghrelin receptor knockout, leading to less adult born neurons, but more NSCs in the adolescent mice and a lower performance in the OIP task.

      Major comments:

      The main conclusion of this study is that a specific type of intermitted fasting (5:2 diet) has no effects on NSC proliferation and neurogenesis. As there are several studies showing beneficial effects of intermitted fasting on adult neurogenesis, while other studies found no effects, it is important to better understand the effects of such a dietary paradigm.

      The experimental approaches used in this manuscript are mostly well explained, but it is overall rather difficult to follow the results part, as the authors always show the 4 experimental groups together (adolescent vs adult and wt vs GHS-R-/-). They highlight the main effects comparing all the groups, which most of the time is the factor "age". Age is a well-known and thus not surprising negative influencer of adult neurogenesis. Instead of focusing on the main tested factor, namely the difference in diet, the authors show example images of the two age classes (adolescent vs adult), which does not underly the major point they are making. Most of the time, they do not provide a post hoc analysis, so it is difficult to judge if the results with a significant main effect would be significant in a direct 1 to 1 comparison of the corresponding groups. The authors point out themselves that previous rodent studies did not use such a 5:2 feeding pattern, so having diet, age and genotype as factors at the same time makes the assessment of the diet effect more difficult. The manuscript would improve if the authors restructure their data to compare first the diet groups (adolescent wt AL vs 5:2 and in a separate comparison adult wt AL vs 5:2) and only in a later part of the results check if the Ghrelin receptor plays a role or not in this paradigm.

      As this 5:2 is a very specific paradigm, it is furthermore difficult to compare these results to other studies and the conclusions are only valid for this specific pattern and timing of the intervention (6 weeks). It remains unclear why the authors have not first tried to establish a study with wildtype mice and a similar duration as in previous studies observing beneficial effects of intermitted fasting on neurogenesis. Like this, it would have been possible to make a statement if the 5:2 per se does not increase neurogenesis or if the 6 weeks exposure were just too short.

      The graphical representation of the data could also be improved. Below are a few examples listed:

      1. Figure 1 B and C, the same symbol and colours are used for the adolescent and adult animals, which makes the graphs hard to read. One colour and symbol per group throughout the manuscript would be better.
      2. The authors found no differences in the total number of Ki67 positive cells in the DG. However, Ki67 staining does not allow to conclude the type of cell which is proliferating. It would thus strengthen the findings if this analysis was combined with different markers, such as Sox2, GFAP and DCX.
      3. In Figure 3, the authors say that the diet increases the number of DCX in adolescent and adult mice, which is not clear when looking at the graph in 3B. Are there any significant differences when directly comparing the corresponding groups, for instance the WT AL vs the WT 5:2? It is further not clear how the authors distinguished the different types of DCX morphology-wise. The quantification in C and D would need to be illustrated by example images. Furthermore, the colour-code used in these graphs is not explained and remains unclear.
      4. In Figure 5, the authors show that the number of new NSCs is significantly increased in the adolescent GHS-R-/- mice, independent of the diet, but this increase does not persist in the adult mice. They conclude that "the removal of GHS-R has a detrimental effect on the regulation of new NSC number..." this claim is not substantiated and needs to be reformulated. As the GHS-R-/- mice have a transcriptional blockage of Ghrs since start of its expression, would such an effect on NSC regulation not result in an overall difference in brain development, as ghrelin is also important during embryonic development?
      5. In Figure 6, the authors asses spatial memory performance with a single behavioral test, the OIP. As these kind of tests are influenced by the animal's motivation to explore, it's anxiety levels, physical parameters (movement) etc., the interpretation of such a test without any additional measured parameters can be problematic. The authors claim that the loss of GHS-R expression impairs spatial memory performance. As the discrimination ratio was calculated, it is not possible to see if there is an overall difference in exploration time between genotypes. This would be a good additional information to display.

      Besides these points listed above, the methods are presented in such a way that they can be reproduced. The experiments contained 10-15 mice per group, which is a large enough group to perform statistical analyses. As mentioned above, the statistical analysis over all 4 groups with p-values for the main effects should be followed by post hoc multiple comparison tests to allow the direct comparison of the corresponding groups.

      Minor comments:

      The authors should provide more information in the figure legends and always show representative images of the parameters analyzed. Some of the images are also of low resolution and should be replaced with higher resolution images (for instance Fig. 5A). The significant P values of the multiple comparison between groups should be added into the figures.

      Significance

      In the last years, growing evidences suggested that IF might have positive effect on health in general and also for neurogenesis. However, a few recent studies report no effects on neurogenesis, using different IF paradigms. This study adds another proof that not all IF paradigms influence neurogenesis and shows that more work needs to be done to better understand when and how IF can have beneficial effects. This is an important finding for the neurogenesis field, but the results are only valid for this specific paradigm used here, which limits its significance. The reporting of such negative findings is however still important, as it shows that IF is not just a universal way to increase neurogenesis. In the end, such findings might have the potential to bring the field together to come up with a more standardized dietary intervention paradigm, which would be robust enough to give similar results across laboratories and mouse strains, and would allow to test the effect of genetic mutations on dietary influences of neurogenesis.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, Roberts et al. investigate the effect of the 5:2 diet on adult hippocampal neurogenesis (AHN) in mice via the ghrelin receptor. Many studies have reported benefits of dietary restriction (DR) on the brain that include increasing neurogenesis and enhancing cognitive function. However, neither the mechanisms underlying the effects of the 5:2 diet, nor potential benefits on the brain, are well understood. The authors hypothesize that the 5:2 diet enhances AHN and cognitive function via ghrelin-receptor signaling. To test this, they placed adolescent and adult ghrelin receptor knockout or wild type mice on either the 5:2 or ad libitum (AL) diet for 6 weeks, followed by spatial memory testing using an object in place (OIP) task. The authors also assessed changes in AHN via IHC using multiple markers for cell proliferation and neural stem cells. The authors observed a decrease in AHN due to age (from adolescent to adult), but not due to diet or ghrelin-receptor signaling. While loss of the ghrelin-receptor impaired spatial memory, the 5:2 diet did not affect cognitive function. The authors conclude that the 5:2 diet does not enhance AHN or spatial memory.

      Major Points

      1. The authors use a 5:2 diet but fail to provide a basic characterization of this dietary intervention. For example, was the food intake assessed? In addition to the time restriction of the feeding, does this intervention also represent an overall caloric restriction or not? According to the provided results, the 5:2 diet does not appear to regulate adult hippocampal neurogenesis contrary to the authors' original hypothesis. Did the authors measure the effects of the 5:2 diet on any other organ system? Do they have any evidence that the intervention itself resulted in any well documented benefits in other cell types? Such data would provide a critical positive control for their intervention.
      2. Based on the effects of grehlin in other dietary interventions, the authors speculate that the effect of the 5:2 diet is similarly mediated through grehlin. However, the authors do not provide any basic characterization of grehlin signaling to warrant this strong focus on the GSH-R mice. While the GSH-R mice display changes in NSC homeostasis and neurogenesis, none of these effects appear to be modified by the 5:2 diet. Thus, the inclusion of the GSH-R mice does not seem warranted and detracts from the main 5:2 diet focus of the manuscript.
      3. Neurogenesis is highly sensitive to stress. The 5:2 diet may be associated with stress which could counteract any benefits on neurogenesis in this experimental paradigm. Did the authors assess any measures of stress in their cohorts? Were the mice group housed or single housed?
      4. The authors state that the 5:2 diet led to a greater reduction in body weight (31%) in adolescent males compared to other groups. However, it appears that the cohorts were not evenly balanced and the adolescent 5:2 male mice started out with a significantly higher starting weight (Supplementary Figure 1). The difference in starting weight at such a young age is significantly confounding the conclusion that the 5:2 diet is more effective at limiting weight gain specifically in this group.
      5. The authors count NSCs as Sox2+S100b- cells. However, the representative S100b staining does not look very convincing. Instead, it would be more appropriate to count Sox2+GFAP+ cells with a single vertical GFAP+ projection. Alternatively, the authors could also count Nestin-positive cells. Additionally, the authors label BrdU+ Sox2+ S100B- cells as "new NSCs". However, it appears that the BrdU labeling was performed approximately 6 weeks before the tissue was collected (Figure 1A). Thus, these BrdU-positive NSCs most likely represent label-retaining/quiescent NSCs that divided during the labeling 6 weeks prior but have not proliferated since. As such, the term "new NSC" is misleading and would suggest an NSC that was actively dividing at the time of tissue collection.
      6. Overall, this manuscript lacks a clear focus and narrative. Due to a lack of an affect by the 5:2 diet on hippocampal neurogenesis, the authors mostly highlight already well-known effects of aging and Grehlin/GSH-R on neurogenesis. Moreover, the authors repeatedly use age-related decline and morbidities as a rational for their study. However, they assess the effects of the 5:2 diet on neurogenesis only in adolescent and young mature but not aged mice.

      Minor Points

      1. The authors combine the data from both male and female mice for most bar graphs. While this does not appear to matter for neurogenesis or behavioral read-outs, there are very significant sexually dimorphic differences with respect to body size and weight. As such, male and female mice in Figure 1D,F should not be plotted in the same bar graph.
      2. The Figure legends are very brief and should be expanded to include basic information of the experimental design, statistical analyses etc.
      3. Many figures include a representative image. However, it is often unclear if that is a representative image of a WT or mutant mouse, or a 5:2 or control group (Figure 2A, 3A, 4A, 5A).
      4. It would be helpful to provide representative images of DCX-positive cells in Figure 3A-F. Additionally, the authors should include a more extensive description of how this quantification was performed in the method section.
      5. The authors state "the hippocampal rostro-caudal axis (also known as the dorso-ventral [] axis". However, the rostral-caudal and dorsal-central axis are usually considered perpendicular to one another.

      Significance

      Understanding the mechanisms of a popular form of intermittent fasting (5:2 diet) that is not well understood is an interesting topic. Moreover, examining the effect of this form of intermittent fasting on the brain is timely. Notwithstanding, while the authors use multiple markers to validate the effect of the 5:2 diet on adult hippocampal neurogenesis, concerns regarding experimental design, validation, and data analysis weaken the conclusions being drawn.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, Roberts et al. hypothesised that the 5:2 diet (a popular form of IF, a dietary strategy within the Intermittent fasting that is thought to increase adult hippocampal neurogenesis - AHN) would enhance AHN in a ghrelin-dependent manner. To do this, the Authors used immunohistochemistry to quantify new adult-born neurons and new neural stem cells in the hippocampal dentate gyrus of adolescent and adult wild-type mice and mice lacking the ghrelin receptor, following six weeks on a 5:2 diet. They report an age-related decline in neurogenic processes and identify a novel role for ghrelin-receptor in regulating the formation of new adult born neural stem cells in an age-dependent manner. However, the 5:2 diet did not affect new neuron or neural stem cell formation in the dentate gyrus, nor did alter performance on a spatial learning and memory task. They conclude that the 5:2 diet used in their study does not increase AHN or improve associated spatial memory function.

      Major comments:

      I think that the key conclusions are convincing and no further experiments are required. Maybe some parts of the text should be rewritten (see below). The methods are presented in such a way that they can be reproduced, and the experiments adequately replicated with proper statistical analysis.

      • One criticism might be the fact that many aspects are addressed at the same time. For instance it is not fully clear the role of ghrelin with respect to testing the DR effects on AHN. Although the link between ghrelin, CR and AHN is explained by citing several previous studies, it is difficult to identify the main focus of the study. Maybe this is due to the fact that the Authors analyse and comment throughout the paper the different experimental approaches used by different Authors to study effect of DR to AHN. This is not bad in principle, since I think the Authors have a deep knowledge of this complex matter, but all this results in a difficulty to follow the flow of the rationale in the manuscript.
      • Another major point: the Discussioni is too long. The Authors analyse all the possible reasons why different studies obtained different results concerning the effectiveness of DR in stimulating adult neurogenesis. Thus, the Discussion seems more as a review article dealing with different methods/experimental approaches to evaluate DR effects. We know that sometimes different results are due to different experimental approaches, yet, when an effect is strong and clear, it occurs in different situations. Thus, I think that the Authors must be less shy in expressing their conclusions, also reducing the methodological considerations. It is also well known that sometimes different results can be due to a study not well performed, or to biases from the Authors.

      Minor comments:

      • This sentence: "There is an age-related decline in adult hippocampal neurogenesis" cannot be put in the HIGHLIGHTS, since is a well known aspect of adult hippocampal neurogenesis
      • Images in Figure 5 are not good quality.
      • In general, there are not a lot of images refferring to microscopic/confocal photographs across the entire manuscript.
      • The last sentence of the Discussion "These findings suggest that distinct DR regimens differentially regulate neurogenesis in the adult hippocampus and that further studies are required to identify optimal protocols to support cognition during ageing" is meaningless in the context of the study, and in contrast with the main results.

      Honestly, my impression is that the Authors do not want to disappoint the conclusions of the previous studies; an alternative is that other Reviewers asked for this previously.

      Significance

      The significance of this study relies on the fact that adult neurogenesis field (AN) has been often damaged by the search of "positive" results, aiming at showing that AN does occur "always and everywhere" and that most internal/external stimuli do increase it. This attitude created a bias in the field, persuading many scientists that a result in AN is worthy of publication (or of high impact factor publication) only when a positive result is found.

      The Author cite in the Discussion the work by Gabarro-Solanas et al. (preprint), which share the same conclusion although analysing different aspect of neurogenesis. Both seems sound studies, substantially balanced in their conclusions.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript, Veen and colleagues investigate a role for hairy-related 6 (her6) and prospero homeobox 1 (prox1) in the regeneration of photoreceptors in the zebrafish retina. The candidate genes, her6 and prox1 were chosen for investigation based on initial analyses of genes implicated in the dedifferentiation of cells in the Drosophila brain. Using a chemogenetic approach to ablate long-wavelength cone photoreceptors (red cones), the authors investigate the role of her6 and prox1 in mediating the regenerative response of Müller glia and progenitors derived from these cells in the production of photoreceptors. They use morpholinos to identify that her6 and prox1 likely cross regulate each other.

      The authors state that the loss of Her6 leads to an increase in the number of photoreceptors after injury. However, the marker they use is a Zpr1 antibody, which marks both red and green cones but no other cone type nor rods. Thus what they show is an increase in red and green cones, not all photoreceptors. More markers would be needed to make that point. It also remains possible that the loss of Her6 leads to an increase in the number of overall cells generated after red cone ablation and thus Her6 is not exclusively linked with photoreceptor regeneration. Previous work has shown that while the regenerative response is biased toward the production of cell-types lost as a result of injury, other cell-types are also generated (Powell et al., 2016). It would be important to follow up whether other retinal cell-types are also generated. While her6 and prox1 in conjunction might regenerate (some?) photoreceptors, her6 alone might have a broader effect.

      The segue between the first and second sections of the results felt abrupt to me. I wonder whether the authors could instead follow this sequence:

      1. Identifying candidate genes that regulate de-differentiation in the Drosophila. 2.Investigating whether the candidate genes play a role in the dedifferentiation that Müller cells must go through in their regenerative response.
      2. To test point 2, set up an ablation paradigm - MTZ mediated red cone ablation etc. etc.<br /> The authors noted several genes as being mediators of dedifferentiation in the Drosophila. What was their reasoning for choosing the 2 they ended up pursuing in the zebrafish retina?

      I do not understand why an increase in the number of PH3+ cells in Her6 MO treated retinae indicates a faster cell-cycle? Could it also mean that cells are stuck in the G2-M phase (marked by PH3) longer? There are other approaches to measure whether cell-cycle is sped up, as the authors suggest.

      Minor suggestions to improve clarity:

      Introduction: Noel et al., 2021, in my view, is not necessarily the reference most appropriate for a broad statement of how vision works. It appears to be specifically about zebrafish photoreceptors.

      Methods:<br /> Fish husbandry and set up<br /> The authors state that the light/dark cycle in their fish facility is 12/12h. To my knowledge, this is not the standard practice; it is usually 14/10h light/dark respectively. (See Aleström et al., Laboratory Animals 2020, Vol. 54(3) 213-224).

      No references are given for the Tg(lws2:nfsb-mCherry) and the Tg (her4.1:dRFP) lines. Additionally, the reference for Tg(gfap:eGFP) is incorrect. This should be Bernardos and Raymond 2006 Gene Expr Patterns 2006 Oct;6(8):1007-13. doi: 10.1016/j.modgep.2006.04.006.

      Immunostaining fish samples<br /> 'The slides were covered with Parafilm and tissue was dampened.....'<br /> Here a reader may be confused by whether the authors refer to retinal tissue - presumably the authors mean paper tissue to create a humidified chamber.

      Microscopy and analysis<br /> A bit more detail here would help - for example, are the 40x and 60x objective air or immersion objectives?

      Analysis of zebrafish retinal sections<br /> It is unusual to quantify the percentage of cells expressing specific markers by counting voxels. Can the authors clarify why they took this approach?

      Are the micrographs depicted in the figures, single confocal planes, max. intensity projections of several confocal planes?

      mCherry labelled photoreceptors are sometimes difficult to appreciate in the micrographs of the main figures - eg. Fig 2C. Here it appears that mCherry is not expressed by the entire cell. It would help to show just the mCherry on its own.

      Fig 4 -GHI - it would help to see the double labelled cells prox1 and zpr1 at higher magnification

      Supplementary Fig 3 - PCNA, not GS is depicted in pink. GS not GFAP is in green?

      Significance

      This is an interesting study that pursues candidate genes derived from Drosophila screens to highlight pathways that might operate in the regeneration of cells that were previously ablated in the vertebrate CNS.

      Approaches such as the ones used in this study contribute to our overall knowledge about coaxing regeneration in the context of the mammalian CNS.<br /> The work here should be of interest to biologists interested in regeneration.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript by Veen and colleagues assesses two transcription factors, and makes the novel conclusion that they regulate each other in a manner that is required for photoreceptor regeneration in zebrafish. The work is potentially exciting, because similar findings from zebrafish have found traction in translation to mammals, where regeneration of photoreceptors has surprising promise to treat blindness.

      The authors have been ambitious in there approach to the problem by disrupting these genes in the adult retina, which is the appropriate context required to assess photoreceptor regeneration. Because technologies for conditional gene ablation are not very available in zebrafish, these authors use electroporation of morpholinos to accomplish their goals. Where most researchers have abandoned this very challenging approach, it seems these authors have found some success.

      Together the technical feat and intriguing conclusions combine, in my opinion, to make this paper worthy of serious consideration for publication. I would hate to see it not be made available for public consumption. Its' merits are strong, but some shortcomings in communication and interpretation nevertheless should be addressed. I suggest Major and minor concerns below.

      I suspect that doing further experiments would be asking a lot of the authors at this point, but I point out some possible experiments that would improve the manuscript if my suspicion is wrong. Without further experiments, I suggest much of the writing needs to be carefully qualified and less deterministic.

      Major concerns:

      1. The authors need to quantify impacts of MO without MTZ (or with MTZ on wildtype fish without the nfsb Tg). Alternatively, the interpretation needs to be softened considerably. Observations made include increased proliferation and more PR, but these are not clearly connected by the data in a way that allows you to claim "more regeneration". A plausible alternative is that the MO was protective, and the MTZ did not kill as many PR cells when the genes were knocked down. Moreover, Figure 3 shows that only one of two proliferation markers is increased (how to explain?) and only at one timepoint, so this may be a fluke. I suggest softening the conclusions to state that gene knockdown increased proliferation and led to increased PR abundance, thus implying improved regeneration (and provide the alternative interpretation). E.g. the punchy titles of Figures 3, 5, 7 are not supported by the data; neither is text in Discussion bottom of page 15.
      2. Fig 5 quantification of proliferation is needed if the interpretation is about regeneration (see comment 1). Instead, the conclusions could be reworked to match the data.
      3. I'm unclear on why these experiments couldn't have been completed in mutant zebrafish. Are they not viable?
      4. Sequence and chemistry of the MO knockdown reagents must be provided. If they are similar to previously published MO reagents (several for both gene targets have been published) then this might be used to improve confidence of MO efficacy. Were the MOs modified to facilitate electroporation? The gene targets also must be listed with less ambiguity, e.g. when "prox1" is mentioned, do you mean prox1a? Without these details, the experiments fail to provide enough info to permit replication.
      5. A suggestion to improve the text [no need for new experiments]: The Discussion should address assumptions about MO knockdowns in regards to: a) efficacy, and b) specificity. E.g. (a) future experiments might challenge the efficacy by measuring the abundance of genes that are regulated by prox1 and her6. E.g. (b) future experiments should challenge the specificity of the MO reagents by testing to see if the same result is attained with disparate MO oligos, by phenocopy with CRISPR, performing the work in mutants (I assume rescuing the knockdown by replacing the target gene is not feasible by electroporation, but that would be ideal).
      6. The claim that Prox1 is in PR (Figure 4 title) is not convincing. Does the scRNA-Seq confirm this, and why not invoke this data to clarify more concretely? Figure 4A shows a lot of green prox1 signal, but that is very inconsistent with what is shown in Figure 4G, where no prox1 signal is observed in the PR. On page 12, which relates to this Figure, the authors instead say that Prox1 is detected in PR after injury (a big difference compared to title of Fig4!). Fig4I' shows some signal in the area of the PR, but the overlap of the signals is not convincing and it looks to mostly be adjacent to the zpr1 signal; maybe it is Muller glia or some other cone type, or rod cells. If it is Muller glia or rods, then the interpretation needs to be adjusted. Regardless, it is unclear if this is in LWS cones, which is presumably what regenerates after LWS cone ablation(?)
      7. Figures showing prox1 or Hes1 IHC (Fig 2, 4, 6, 7 & Supps) - how many replicates were evaluated (how many individual fish were assessed) to determine that these IHCs are representative.
      8. Some of the data, i.e. some photomicrographs of IHC, are used repeatedly in separate Figures. I cannot find a comment in the manuscript acknowledging this. Panel F is identical in Figures 3 and 5, and panel 7E is identical to Supp panel S5E. My opinion here is mixed: I think re-using these Figures is marginally ok if it is explicitly and repeatedly described (e.g. in Methods, Results, and Fig Legends), but I also think that if the authors have replicated the experiments sufficiently, then they will surely have some other micrographs to use. My opinion is tipped into grumpy and worried about good data integrity, because in both cases the lines that indicate retinal layers are drawn in different places between the replicated panels; that could happen out of sloppy-ness or instead could be a ploy to help hide the Figure recycling. I prefer to assume the authors are of good intent and have made an error (indeed the panels are all meant to represent the same control treatments) but I would not want the manuscript published without explicitly rectifying this issue. Minimally the replicate micrographs should be explicitly acknowledged. My search for other duplicated panels was not exhaustive.

      Minor points:

      • a) Page numbers and line numbers would make it less work to prepare a constructive critique of this paper. Similarly, the Figures need Figure numbers.
      • b) On the histograms, does each dot represent an individual fish? (i.e. an independent biological replicate).
      • c) It would be lovely to learn that left vs. right eyes were used as internal controls in each case, and then the authors could plot the difference between control & treatment within each individual. Perhaps this would allow normalizations or more powerful statistical tests, and then the PCNA data would be more aligned with the conclusions, for example.
      • d) Figure 5: expected to see quantification of PH3 here, akin to Figure 3.
      • e) P. 6 secondary antibodies probably did not come from ZIRC
      • f) More should be done to acknowledge past papers examining Her6, Hes1 and Prox1 in vertebrate retina.
      • g) I do not see how the final section of the manuscript (beginning with "Insulinoma" to the end of the Discussion is relevant to the paper. A very odd ending to this manuscript. Some sentences (especially beginning the section with a topic sentence) would be need to be added if this writing is to remain.
      • h) The final two sentences of the Abstract were interesting - these ideas are unfortunately not Discussed again later in the manuscript.
      • i) What is the source of the transgenic zebrafish line Tg(lws2:nfsb-mCherry) ? Is it maybe from Wang...Yan 2020 PLOS BIOL (PMID: 32168317)? If yes, it would be ideal to provide an allele number. If no, construction of this line should be described.
      • j) Bottom page 4 says "Two transgenic lines used were crossed" but only one line is mentioned.
      • k) Then on page 7, the text says "Zebrafish line Tg(her4.1:dRFP/gfap:GFP/lws2:nfsb-mCherry) for red cone ablation, ..." which muddies the waters even further.
      • l) When the antibody zpr1 is described, it is mentioned as a "zinc finger" (many instances throughout). This is incorrect, and the words "zinc finger" can be removed.
      • m) It would be useful to state in Methods, and at first occurrence in figure legends, that the antibody ZPR1 labels double cones (the red & green cones), and these make up about half of the cone photoreceptor population. (i.e. not all cones are evaluated in this work).
      • n) Figure 2 desperately needs a panel describing methodological timeline, similar to Fig 1D. It is really hard to figure what happened when (e.g. when did ablation occur? When was the MO delivered?). This also should be described more explicitly in the Methods, which seem quite vague on this point: Electroporated fish went straight into MTZ?
      • o) Throughout the authors refer to injury, e.g. hpi = hours post injury. I don't think this represents the methods very well at all, because they have ablated the cells, not injured them. Injured cells don't regenerate (because they are not dead). This miswording contributes to confusion interpreting the Figures, which are not decipherable as stand-alone items.
      • p) There is a really weird yellow dotted line that spans between and ACROSS adjacent panels in Figure 2. It covers the white line separating panels F' & G', and then again in F" and G".
      • q) Fig 2, it is evident that Hes1 protein is not eliminated so you cannot claim it is "not expressed". It is perhaps reduced in abundance, but signal is still obviously present.
      • r) Title of Figure 6 needs to rewritten: LLPS may be occurring, but until you manipulate both LLPS and Prox1 together, you cannot claim that they act through one another.
      • s) Figure 7 title needs to be rewritten: PR are not quantified here.
      • t) Figure 6: I am deeply incredulous that applying any chemical to zebrafish for only two minutes can alter cell differentiation, except perhaps via toxicity. Perhaps examples of similar impacts can be provided from the literature to make it seem more credible that the mechanism here is LLPS in retinal cells.

      The following minor comments are all captured under the notion that the Figure Legends all need to be re-written by a senior colleague. Figures+legends should be interpretable as stand-alone items. All these Figures fail this minimal standard. Below are some issues, but really I'd suggest starting with a blank slate.<br /> - u) Figure 1 must mention Drosophila. So very very confusing to read this believing it is about zebrafish.<br /> - v) Figure 1 what is "deadpan"?<br /> - w) Fig 2 title, how do you know these progenitors are MG-derived?<br /> - x) Fig 2, define abbreviation MG<br /> - y) Fig 2 title, Hes1 is less abundant, but that might be from alternative mechanisms other than "reduced expression" (e.g. altered PTMs, increased clearance, LLPS, etc)<br /> - z) Fig 3 legend is a jumble of oddity. At least three distinct signals are supposedly labelled in pink(?). separately, What about the mCherry - is it also in pink?<br /> - aa) Most Figures: we know they are micrographs, so you don't need to lead the Description saying "micrographs of...". Instead, describe the logic of the experiment and the overall interpretations.<br /> - bb) All Figures: it is really odd to list the data (averages & variances, including implausible significant digits on each) for every treatment - that is what the histograms are meant to convey.<br /> - cc) Figure 4 should send the reader to the Supplemental so they know that the no-primary control experiment is available.<br /> - dd) Fig 6B legend - explain what the chemicals are meant to do (e.g. "block LLPS").<br /> - ee) Fig 6 define "2m" = 2 minutes?<br /> - ff) Several more abbreviations are not defined: hpi, ONL, etc...

      Significance

      The manuscript by Veen and colleagues assesses two transcription factors, and makes the novel conclusion that they regulate each other in a manner that is required for photoreceptor regeneration in zebrafish. The work is potentially exciting, because similar findings from zebrafish have found traction in translation to mammals, where regeneration of photoreceptors has surprising promise to treat blindness.

      Together the technical feat and intriguing conclusions combine, in my opinion, to make this paper worthy of serious consideration for publication. I would hate to see it not be made available for public consumption. Its' merits are strong, but some shortcomings in communication and interpretation nevertheless should be addressed

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The authors interrogate the roles of prox1a and her6 in red/green cone photoreceptor regeneration in zebrafish. Using scRNAseq, they find evidence that her6 is expressed in MG and suggest it is downregulated in Müller glia-derived progenitor cells during retinal regeneration. Further, they show that knockdown of her6 leads to an increase in the rate of cone PR regeneration and suggest that this is due to increased proliferation of retinal progenitors. The authors then demonstrate that prox1a is expressed in differentiated PRs and that knockdown inhibits PR regeneration. An exploration of the role of Liquid-Liquid Phase<br /> Separation (LLPS) in prox1a signaling is provided. Finally, the authors show that her6 knockdown leads to increased prox1a expression and that prox1a knockdown leads to loss of her6 expression, suggesting both factors impact expression of the other to regulate the kinetics of PR regeneration in the zebrafish retina.

      Major comments:

      1. As presented, the "downregulation" of her6 in MG-derived progenitors is not convincing due to a discrepancy between the single cell data and antibody staining. For "downregulation" to be the case, MG and/or progenitor cells would need to be expressing her6 and then lose it over time during regeneration. The single cell data are consistent with that showing expression of her6 in quiescent and proliferating MG, but the antibody staining is not. In addition, regarding the single cell data, the colors used to discriminate early PRs and PRs are nearly identical. The authors need to make clear which clusters correspond to MG-derived progenitor cells using clear labeling. Regarding antibody labeling, prior to cone PR ablation, the expression of Her6 (ie Hes1 staining) appears to be localized to interneurons and RGCs, not MG - yet the single cell data suggest this is not the case. Either the single cell data or the antibody labeling may be correct, but not both. The authors should provide a figure showing co-labeling of Her6/Hes1 and a MG marker such as GS or GFAP. In the absence of that result, the antibody data is most consistent with her6 expression either not being expressed in MG and MG-derived progenitor cells or expressed in only a subset of progenitors - both of which conflict with the single cell data.
      2. The her6 MO results are not convincing with respect to data interpretation. Knockdown of her6 results in more cone PRs at 72 hpi and more progenitor proliferation at the same time point (as assessed by pH3 immunostaining). For an increase in progenitor proliferation to explain the increase in cone PRs the observation would need to precede the increase in cones, not be coincident with it. Alternative hypotheses need to be explored, for instance, whether her6 downregulation alters cell fate choices in progenitor cells. The precocious increase in prox1 expression at 48 hpi (Figure 6A-E) would be consistent with that idea, leading either to precocious cone differentiation or a stronger bias toward the red/green cone PR fate.
      3. The connection to Liquid-liquid Phase Separation (LLPS) is the weakest component of the study given the following issues:
      4. a. Prox1 staining as punctate and/or liquid-like assembly associated is not convincingly demonstrated, this would require much higher magnification, quantification, and co-localization with factors known to aggregate in liquid-like assemblies.
      5. b. The reagents used to modulate LLPS are not specific to Prox1 and will alter all LLPS-associated signaling events.
      6. c. What assay was used to set "effective and consistent" outcomes at a concentration of 5% 1,6-HD anda treatment time of 2 minutes? Was toxicity or any other assay performed to assess the specificity of 1,6-HD effects in vivo at this concentration?
      7. d. Shouldn't the regenerated cone cells be expressing the lws2:nfsb-mCherry transgene? This is especially troubling given that the lws2:nfsb-mCherry transgene is evident at the periphery in both conditions whereas the zpr1antibody (i.e., Arr3a expression) appears to differentially label more central areas of the retina.
      8. e. Controls are needed to demonstrate that the expression of other transcription factors is normal following 1,6-HD treatment.
      9. f. Controls are needed to show that zpr1 staining / Arr3a expression is not selectively altered by 1,6-HD treatment, eg are other markers of red/cones similarly altered?
      10. Statistical methods are not provided for the Dros portion of the study. Please indicate which statistical tests were used and what corrections performed for multiple comparisons.
      11. A control is need to show that the antibody against mammalian Hes1 labels Her6 in zebrafish.

      Minor Comments:

      1. Please provide alleles for all transgenic resources used as this will help to ensure others are able to replicate these findings and/or use equivalent resources for their own research.
      2. "Zebrafish injury model" section states that two transgenic lines were used to create a PR ablation line but only one line is listed? Please clarify. Also the larval ablation model should be included in the Methods.
      3. Montgomery et al ablated rods not cones. As cells exhibit differential sensitivity to cell ablation methods - including rods and cones - it would be preferable if a reference for NTR/Mtz-mediated cone cell ablation was cited.
      4. Figure S2: Since fish between 10-12 months were used, there is no need to mention the ablation results with the younger fish as it is unrelated to the study.
      5. 24 hpi as first observation of MG-derived progenitors (Fig. S3D-D') is very weak, data is not convincing. Please update the figure or revise the manuscript. Figure 2 is much better, simply referencing Figure 2E' would suffice.
      6. Edit needed: "They began proliferating at 48hpi, as indicated by clusters of PCNA+ cells across the inner nuclear cell layer (INL; Figure S3E-E'), also observed by at 72 and 96 hpi (Figure S3F-F' and G-G' EE', outlined).
      7. her6 has been previously implicated in retinal regeneration previously and references to these studies should be included in the intro and/or discussion. See: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8643038/<br /> https://bmcdevbiol.biomedcentral.com/articles/10.1186/1471-213X-6-36<br /> https://www.jneurosci.org/content/34/43/14403
      8. Please confirm her6 MO-based downregulation with a more quantitative method.
      9. "DamID" should be defined at the first instance (first paragraph of Results) as DNA adenine methyltransferase Identification.
      10. zpr-1 is an antibody not a protein and should not be capitalized (per "Zpr1+ cells").
      11. According to ZFIN, prox1 is now prox1a, the authors use both. It would be helpful to stay consistent and use the most recent nomenclature to refer to prox1a.

      Referees cross-commenting

      Reviewer #2 / Major concern #1: Unclear how one assesses the effects of gene knockdown on regeneration in the absence of cell ablation? The reviewer should clarify what "impacts" they would like quantified (e.g., developmental effects, etc) . For instance, assessing effects of gene knockdown on PR number developmentally (with egg injections of morpholino and/or sgRNAs for Crispants) would help to account for potential gene knockdown effects on progenitor differentiation (i.e., causing a fate bias toward red cones) or protection (e.g., absence of normal levels of cell death/TUNEL).

      Reviewer #2 / Major concern #8: Repeated micrographs: In my view this should not be done at all. Please use different examples of control data between comparisons of her6 and prox1a knockdowns - even if these experiments were al performed in parallel there should be additional control samples from each assay and across a minimum of three biological repeats.

      Reviewer #3, Paragraph 2 ("The authors state that the loss of Her6..."): Pulse-chase experiments demonstrating an increase in the number of newly generated red cones - by virtue of co-labeling with pulse marker and Lws2 transgene - would help to address this concern and clarify the degree of bias exhibited in the red cone ablation paradigm (an issue discussed by all reviewers and which the authors are familiar with, eg, DOI: 10.1186/s13064-017-0089-y)

      Significance

      This work is significant in interrogating the function of two classic factors associated with regulation of neurogenesis and neuronal differentiation in Drosophila in the context of cone photoreceptor regeneration in zebrafish. My expertise lies in the latter paradigm and I have restricted my evaluation to that portion of the study. The novelty of the study is diminished somewhat by recent reports of the role of Notch signaling in retinal regeneration in zebrafish - thus, it would follow that a major signaling component of the Notch pathway, Hes1/Her6, would likely be involved as well. Indeed, expression changes for her6 during regeneration have been previously reported (see refs above). However, the present study does add a functional characterization which is a significant advance. The advent of stimulation of retinal regenerative capacity in mice by Tom Reh and colleagues adds intrigue to the study of retinal regeneration in zebrafish as the insights generated are being applied in a way that suggests possible relevance to human disease. Thus defining conditions that lead to accelerated retinal regeneration is of widespread interest. However, several issues raised in the detailed review above diminish my enthusiasm for the study overall.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      General Statements:

      We want to thank the reviewers for their time in assessing our study, their positive feedback and their constructive comments that we address here. We have carefully assessed each reviewers’ comments and address them point-by-point below. We appreciate that the reviewers consider our study to be relevant and advance the field in better understanding mitochondrial stress responses.

      There is a consensus as to why we have inhibited rather than depleted PHGDH via genetic means. PHGDH knockout is developmentally lethal at embryonal day 13.5, and therefore whole-body knockout crossings were not an option (Yoshida et al. JBC 2004). Furthermore, we and colleagues have shown that mitochondrial disease induces a complex systemic response including e.g., metabokines FGF21 and GDF15, secreted by the affected muscle and heart and modifying metabolism in the whole organism, indicating that tissue-specific knockouts are not optimal to resolve mechanisms in pathophysiology. Further, potential serine supplementation from other tissues could mask the effects on the muscle. Next, the slowly progressive phenotype of the mitochondrial myopathy mouse, fully manifesting close to 2 years of age, make double-transgenic strategies resource-intensive. Therefore, a PHGDH inhibitor, the specificity of which we carefully explore, was the approach of choice.

      Serine rich diet: We did consider a serine-rich diet. However, our evidence indicates that exogenous serine is not sufficient to rescue the phenotype in cultured cells. This suggests that the enzymatic intracellular localization of de novo serine synthesis is of crucial importance.

      Off-target effects: We agree and are aware that using a small-molecule molecule for pharmacological inhibition bears risks of off-target effect, as Arlt et al. 2021 reported for NCT-503 neuroblastoma cells lines. In agreement with the reviewers about the relevance of our results, the observation that we do not observe any meaningful alterations in WT muscle, even at the advanced age where metabolic muscle fitness is already challenged, whilst the myopathy phenotype worsens in myopathic mice support an on-target effect of NCT-503.

      Therefore, we had carefully considered the suggested experiments during the initial study and decided that PHGDH inhibitor was the best choice to answer our questions about importance of de novo serine biosynthesis.

      Reviewer #1 (Evidence, reproducibility and clarity):

      In this manuscript the authors describe interesting results regarding amino acid metabolism under conditions of mitochondrial stress. The authors used a selective PHGDH inhibitor (compound NCT503), and document that de novo serine synthesis is essential to sustain phospholipid biosynthesis, redox homeostasis, mitochondrial function, and mitochondrial protein synthesis in Deletor mice and in cell culture under mitochondrial stress. Interestingly, serine supplementation does not rescue those metabolic alterations, indicating a specific mitochondrial stress-dependent mechanism of serine utilization by the cells.<br /> In addition, the authors attempted to explore the role of serine in phospholipid biosynthesis under in vivo and ex vivo mitochondrial stress, and this is the weakest part of the manuscript. The specific reduction of mitochondrial PE using the PHGDH is interesting, and it can provide some clues into how mitochondrial membranes are synthetized under mitochondrial stress, but additional experimental approaches should be incorporated to generate a more robust body of evidence.

      In summary, the manuscript should be improved by using additional experimental approaches. In addition, genetic intervention through PHGDH gain or loss of function can help to elucidate the molecular mechanisms.

      We thank the reviewer for this proposition. As explained above in detail, knockout of PHGDH in mice is lethal in embryogenesis. Secondly, the cell culture studies show that in a mitochondrial disease background, cell-intrinsic de novo serine biosynthesis becomes essential. Therefore, the phenotype of a conditional knockout in skeletal muscle is likely to be drastic and does not reflect the situation of an adult-onset disease. Thirdly, if the gain- and loss of mutant double transgenics would live, the Deletor mice are an actual slowly progressing disease model, which manifests the phenotype at around two years. Therefore, this experiment takes three years, is not feasible and was considered to be of little informativeness. We carefully explored the specificity of PHGDH inhibition by NCT503 and found it to serve best the questions asked.

      The authors could also incorporate metabolomic studies using C13 serine or C13 glucose supplemented culture medium to differentiate carbons that come from extracellular serine or from de novo synthesis.

      We thank reviewer #1 for her/his comments. The exogenous serine supplementation shows minor rescue of the phenotype in cultured cells but decreases somewhat the mitochondrial integrated stress response markers in serine-containing medium, suggesting some amelioration of the PHGDH inhibition.

      We have now incorporated new data of D3-serine flux in cells to the manuscript (p.14, FigS3G, p.33). These data indicate that some serine uptake occurs by the cells and that is not significantly affected by mitochondrial translation inhibition (actinonin), even if the combination of PHGDH plus actinonin is not viable.

      Manuscript Figure S3G. D3-serine uptake in C2C12 cells with and without actinonin. Normal non-labelled serine was used as a negative control for D3-serine contamination. D3-serine amounts were measured in culture media and in cells; biological replicates (n=3). In media, fold change (FC) was calculated relative to the sample with normal serine media without actinonin. In cells, FC was determined against cells in D3-serine without actinonin. No traces of D3 label were detected in normal serine samples. ACT = actinonin.

      Additional questions: Is PHDGH subcellular localization modulated under mitochondrial stress conditions?

      This is an interesting question. The insufficient resolution in muscle sections did not give a conclusive answer. We have, however, performed new immunofluorescence experiments in cells to investigate this potential mechanism and used a newly generated PHGDHKO cell line as a negative control (Rev Fig.1). The conclusions have been added to the manuscript (page 14, FigS4E,F, p.34). In essence, no altered localization of PHGDH in cells is observed – the localization appears to be cytoplasmic. The increasing PHGDH amount in increasing actinonin concentration is apparent, however.

      Revision Figure 1. Immunofluorescent staining of HEK293 and C2C12 cells. WT and PHGDHKO HEK293 cells were used as controls for the PHGDH antibody. (Hoechst staining of nucleus, blue; anti-PHGDH, green; mitochondrial outer membrane protein TOM20, red. EtOH = ethanol; ACT = actinonin; INH = PHGDH inhibitor.

      Is the extracellular serine uptake impaired under mitochondrial stress?

      As explained above, we have now incorporated data of D3-labeled serine uptake in cells to the manuscript, quantifying the uptake from the media and the levels in the cells. Mitochondrial translation inhibition by actinonin does not affect uptake, indicating that the uptake per se is not impaired. However, the de novo synthesis being essential in metabolic stress strongly points to the intracellular site to be important.

      While the extracellular serine can only little compensate for de novo synthesis, our new data, qPCR analysis on muscle of all mouse groups to quantify serine tRNA levels (MTTS1) indicates the levels to be increased, suggesting insufficient charging of the tRNA (MTTL1 as negative control; Rev Fig. 2). In addition, the presumed mitochondrial serine transporter SFXN1 is upregulated on protein level (p.11, Fig S2H, p.32). These data suggest that cell-intrinsic serine synthesis supports mitochondrial translation in metabolic stress situations.

      Revision Figure 2. RNA expression of mitochondrial tRNAs for leucine (MTTL1) and serine (MTTS1) in skeletal muscles of wild type (WT) and Deletor (DEL) mice; RT-qPCR. WT VEH n=6, DEL VEH n=5, WT INH n=7, DEL INH n=8. VEH = vehicle; INH = PHGDH inhibitor; FC = fold change.

      ATF4 is a transcription factor that regulates amino acid transport. In this connection, is ATF4-dependent serine transporters modulated under mitochondrial stress or under PHGDH treatment?

      As explained above, SFXN1 transporter was upregulated in protein level. In postmitotic skeletal muscle, the responses are under ATF5, as shown in Forsström, Jackson et al. Cell Metab 2019.

      Regarding the alteration in redox homeostasis, mitochondrial function and mitochondrial protein synthesis. Is the alteration of phospholipid synthesis upstream of all of those mitochondrial alterations?

      The authors are unclear of what the reviewer means by “all those mitochondrial alterations”. The disease in the Deletor mice is caused by dominant patient-homologous mutation of mitochondrial DNA helicase Twinkle, and in the cell culture model we block mitochondrial protein synthesis with actinonin. Therefore, the primary defect in both mice and cells is intramitochondrial, in mtDNA replication and protein synthesis, and the stress responses are a consequence of the primary mitochondrial dysfunction. The consequent secondary stagewise mitochondrial integrated stress response, ISRmt, affects both mitochondria and rest of the cell, with effects in metabolism and nuclear genome transcription. We have pioneered the discovery of ISRmt in mice and humans with mitochondrial defects/diseases in several studies (e.g., Cell Metab 2016, 2017, 2019, 2020). This response includes a remarkable remodeling of one-carbon metabolism, with major changes in methyl cycle, transsulfuration and nucleotide synthesis of the whole cell. PS synthesis is dependent of methyl groups deriving from the one-carbon cycle -driven methyl cycle. Therefore, the original mitochondrial replisome dysfunction causes a stagewise, progressive disease process, which is upstream of all the other responses. Phospholipid synthesis alteration, however, has high potential to modify mitochondrial membranes that can aggravate disease during its progression.

      The temporal metabolomics of cultured cells did show PE accumulation at later time points than on mitochondrial translation or other crucial cellular metabolites, suggesting its alterations to be a consequence rather than upstream. Indeed, further studies are needed to dig deeper into the dynamics of phospholipid synthesis in mitochondrial dysfunction.

      Additionally, in my opinion the results should be reorganized, because in the current format the manuscript is fragmented, and several panels lose the symmetry.

      The authors are unclear what the reviewer means by the panels losing symmetry. Without suggestions it is hard to make changes, but we have carefully reviewed the clarity of the presentation.

      Major concerns.

      Figure 1

      The authors should incorporate the Deletor mice amino acid levels in muscle. How does the PHGDH inhibitor treatment modulate the other non-essential amino acids?

      We have quantified all 11 non-essential amino acids from Deletor muscle by targeted metabolomics in combination or individually and added the new graphs (p.10, Figure S2D,E, p.32).

      Manuscript Figure S2D. Total non-essential amino acid quantification (NEAAs) from targeted metabolomics of skeletal muscles of WT and DEL mice. WT VEH n=6, DEL VEH n=5, WT INH n=7, DEL INH n=8. VEH = vehicle; INH = PHGDH inhibitor. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.

      Manuscript Figure S2E. Individual NEAAs from targeted metabolomics of skeletal muscles of WT and DEL mice. WT VEH n=6, DEL VEH n=5, WT INH n=7, DEL INH n=8. VEH = vehicle; INH = PHGDH inhibitor. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.2. The authors should incorporate the data of WT + vehicle and wt + NCT503 mice in figures 1C, 1D, 1F and 1G, in order to compare properly the effects of PHGDH inhibitorThe authors should incorporate the data of WT + vehicle and wt + NCT503 mice in figures 1C, 1D, 1F and 1G, in order to compare properly the effects of PHGDH inhibitor.The authors should incorporate the data of WT + vehicle and wt + NCT503 mice in figures 1C, 1D, 1F and 1G, in order to compare properly the effects of PHGDH inhibitor.

      The authors should incorporate the data of WT + vehicle and wt + NCT503 mice in figures 1C, 1D, 1F and 1G, in order to compare properly the effects of PHGDH inhibitor.

      We agree with the reviewer`s notion to depict all groups. No COX- fibres exist in our vehicle or inhibitor-treated WT mice and we have added this data into the manuscript in p.31, commented on in p.6, Figure S1B, also below).

      Manuscript Figure S1B. Histochemical analysis of combined cytochrome-c-oxidase (COX) and succinate dehydrogenase (SDH) activity in muscles of treated WT mice. (Brown fibres indicate high COX activity, translucent – low COX activity). Lower panel shows immunohistochemical detection of the mTORC1 downstream target - phosphorylated ribosomal S6 (p-S6). INH = PHDGH inhibitor.

      Figure 1H. Are there any effect of PHGDH in the mtDNA of WT mice? The authors might incorporate this information, to show properly that mitochondrial stress led to dependence of serine to sustain muscle homeostasis.

      In addition to the mtDNA deletion analysis, we have assessed mtDNA copy number via qPCR (p.27, Figure S1D). No mtDNA deletions exist in WTs and their mtDNA copy number raised slightly. These new data are included in p. 6 and Figure S1D, p.31.

      Manuscript Figure S1D. Mitochondrial DNA copy number analysis in muscles of WT and DEL mice. Measured with qPCR (n=5-8/group). VEH = vehicle; INH = PHGDH inhibitor. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.

      Figure 2.<br /> Interestingly the authors observe a decrease in total mitochondrial lipids content, and an increase in mitochondrial PE content in Deletor mice compared to WT mice. These results suggest an alteration in the phospholipids flux between mitochondria and endoplasmic reticulum in this model of mitochondrial disease. Moreover, PHGDH treatment appears to be able to rescue this alteration. Some question related this issue: What is the expression of genes involved in the balance PC, PE, PS? Are the PSS1, PSS2, PSD and PEMT expression altered?

      Previous Deletor muscle studies cohorts showed non-altered PEMT in diseased mice of similar age nor was PEMT and PSD significantly altered RNAseq data from patients in contrast to PHGDH (Forsstrom et al., 2019; Rev Fig.3). 20-months old Deletor do not show any alteration in PEMT (qPCR quantification below) when analysed from total muscle. Whether these are changed in single fibers (mosaic manifestation of the disease) we cannot exclude.

      Revision Figure 3. Left: RNA expression of PEMT in skeletal muscles of 20-months-old WT and DEL mice. Measured with qPCR; n=9. Right: Gene expression of PEMT, PSD, and PHGDH enzymes in muscles of mitochondrial myopathy patients. Measured with RNA-Seq; n=8 in control; n=4 in patients. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.

      Regarding the phospholipid synthesis. Is mitochondria or endoplasmic reticulum ultrastructure altered in Deletor mice muscle? The authors should explain the possible mechanisms.

      We have extensively characterized the pathology in Deletor muscle in publications previously (Tyynismaa et al. PNAS 2005; Tyynismaa Hum Mol Genet 2010 for morphology, especially, but also as a part of the physiology studies Nikkanen et al. Cell Metab 2016; Khan et al. Cell Metab 2017; Forsström, Jackson et al. Cell Metab 2019 and Mito et al. Cell Metab 2022). The morphological changes in mitochondria are quite extensive, and these are comparable to those found in patients with similar mutations: enlarged mitochondria with distorted and few cristae, various inclusions. We presume the reviewer means sarcoplasmic reticulum in skeletal muscle. The extent of the muscle pathology in vivo suggests that ER structure is changed as everything else is: the diseased muscle fibers are full of abnormal mitochondria in the Deletors, with only few traces of myofibers or fibrils. These fibers become more prevalent after PHGDH inhibition. Furthermore, the mice – WT and Deletors – show age-induced prevalence of non-pathology-related accumulation of sacroplasmic aggregates (so called tubular aggregates) as a known feature of C57Bl6 mice.

      New Figure S1 C, p.31 and below (Rev Fig.4): Ultrastructure of Deletor muscle shows enlarged mitochondria both inside the fibers (Fig S1C left panel, arrows) and subsarcolemmally, further aggravated by PHGDH inhibition. Tubular aggregates, as shown in the inhibitor treated Deletor in the Figure S1C seen in the light-microscopic image on the right (arrows), are part of the mouse substrain characteristics, not disease associated. These changes are also, as white aggregates inside the fibers in all genotypes and treatment groups We now added the light and electron microscopic image analysis to Figure S1 C. We now added the electron microscopic images to the manuscript as S1C (commented on p.6), indicating the aggravated phenotype of PHGDH inhibitor.

      Revision Figure 4. Left: Panel from the Manuscript Fig. S1C. Representative images of transmission electron microscopy (TEM) in skeletal muscles of WT and DEL mice. Black arrows – enlarged mitochondria. Right: Representative images from light microscopy (LM) of muscles of the same groups as in Left. Black arrows – tubular aggregates. VEH = vehicle; INH = PHGDH inhibitor.

      We have also performed analysis of mitochondrial ultrastructure in cells (see below) showing specific lipid accumulation. As mentioned above the alterations in PE levels are detected metabolically at later time points and after substantial loss of mitochondrial translation.

      We added this new data as Figure S3E, p.33, commented on p.6.

      Manuscript Figure S3E. Representative images of TEM analysis of 12h-treated C2C12 cells. The cells were incubated in media with or without serine and treated with either actinonin, PHGDH inhibitor or a combination of both. White arrow – myelinosome-like membranous lipid aggregates; M = mitochondria. INH = PHGDH inhibitor; ACT = actinonin; Ser = serine.

      Supplementary figure 3D<br /> Based on the metabolomic studies, the authors propose a time-dependent decrease in PSAT1 and phosphoserine in cells under mitochondrial stress (Figure S3D). To elucidate the direct role of PHGDH, the authors should analyze the phosphoserine and different phospholipid (described in figure 2E) in presence of PHGDH inhibitor. This will help to understand the link between the endogenous serine synthesis and mitochondrial PE accumulation.

      The temporal metabolomics show a time-dependent decrease of the metabolite phosphoserine (not PSAT1). Here, we show the PE and PC dynamics at 6 and 24 hours. These data have now been added to the manuscript, figure S3I, p.33, commented on page 14.

      Manuscript Figure S3I. Normalised PC and PE pools in C2C12 cells measured with untargeted metabolomics after treatments with actinonin, PHGDH inhibitor, or a combination of two for 6 and 24 hours. n=6-11/group; ACT = actinonin; INH = PHGDH inhibitor.

      Figure 3H shows a decrease in phosphoserine in the presence of PHGDH inhibitor but this figure is asymmetric compared to figure 3I. Can the authors use another experimental approach to detect the specific mitochondria phospholipid levels (used in Figure 2 for instance)?

      Figure 3H shows a decrease in phosphoserine in the presence of mitochondrial dysfunction induced through actinonin alone. Figure 3I shows a further decrease in phosphoserine when actinonin-treated cells are treated with the PHGDH inhibitor (phosphoserine is marked now also in our genetic model of mtDNA depletion, Figure 3I). The data are from untargeted metabolomics, parallel analysed samples, and therefore are comparable for the levels.

      We have now grouped the time-wise dynamics of the annotated phospholipids from the untargeted metabolomics decreasing at a late stage of the temporal treatment, suggesting that the consequences on of mitochondrial dysfunction by translation inhibition clearly precede phospholipid alterations in cells. (Figure below, also added to the manuscript as Figure S3D, p.33, and commented in the text in p. 13)

      Manuscript Figure S3D. Heatmap of selected top significantly altered metabolites in primary human myoblasts temporally treated with actinonin; untargeted metabolomics (n=5-6, run in technical duplicates). ACT = actinonin.

      The authors should incorporate mitochondrial PE analysis in figure 3 to link the cellular studies described in this figure with the studies done in Deletor mice muscle.

      Figure 3 I-K. The authors suggest an alteration in glutathione redox state and a further increase in mitochondrial superoxide production in cells treated with the PHGDH inhibition under mitochondrial stress. What are the total glutathione levels under these conditions? Could GSH regeneration improve the mitochondrial function and mitochondrial protein synthesis? Is extracellular serine able to rescue the reduced glutathione levels?

      We have previously shown in vivo (Nikkanen et al. Cell Metab 2016), in Deletors, that in the skeletal muscle and the heart glucose carbons show flux via serine to glutathione, without changes in steady-state levels of glutathione, indicating high usage. In our targeted metabolomics assay from muscle, the steady-state glutathione amount was below the limit of quantitation. The levels of glutathione oxidized vs reduced are dynamic, however. Our untargeted set shows a trend towards an increase. The GSSG/GSH data (Rev Fig.5 Right) was included already in the original manuscript, as Figure S2C, and the time-wise dynamics is here shown for the reviewer (Rev Fig.5 Left).

      Revision Figure 5. Left: Ratio between oxidized (GSSG) and reduced (GSH) glutathione temporally measured in primary human myoblasts with untargeted metabolomics; n=10-16/group. Right: Ratio between glutathione forms in muscles of WT and DEL mice. Measured by targeted metabolomics; WT VEH n=6, DEL VEH n=5, WT INH n=7, DEL INH n=8; VEH = vehicle; INH = inhibitor. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.

      Minor concerns. Figure 3B,C does not show the statistical analysis so please incorporate this information.<br /> Include quantification of figure 3 E and supplementary figure S3E.

      We have added this information to both figures.

      Figure S3E. Improve flow cytometry histogram, the cell population data values cannot be observed.

      We have improved the resolution.

      Some methods and primers included in the material and methods section are not used in the manuscript.

      We have carefully edited the materials and methods sections for any unnecessary data.

      Reviewer #1 (Significance):

      In this manuscript the authors describe interesting results regarding amino acid metabolism under conditions of mitochondrial stress. The authors used a selective PHGDH inhibitor (compound NCT503), and document that de novo serine synthesis is essential to sustain phospholipid biosynthesis, redox homeostasis, mitochondrial function, and mitochondrial protein synthesis in Deletor mice and in cell culture under mitochondrial stress. Interestingly, serine supplementation does not rescue those metabolic alterations, indicating a specific mitochondrial stress-dependent mechanism of serine utilization by the cells.<br /> This data will be relevant to better understand the connection between alterations in mitochondrial function and amino acid metabolism in cells, and in organisms.

      We thank the reviewer #1 for the constructive comments and acknowledgement of interesting results and significance.

      Reviewer #2 (Evidence, reproducibility and clarity):

      Experiments reported in this manuscript indicate that NCT-530- an inhibitor of the de novo serine biosynthetic enzyme PHGDH- worsens mitochondrial pathology.<br /> Systemic administration of NCT-503 decreased serine levels only in Deletor mice- ubiquitously expressing a homologous dominant patient mutation in mitochondrial twinkle helicase.<br /> NCT-503 treatment induced a further increase of the mitochondrial integrated stress response in Deletor mice. Moreover, the metabolic profile and lipid balance was further modified by NCT-503 administration to Deletor mice. The relevance of NCT-503 treatment was finally evaluated in cellular systems exposed with different treatments inducing mitochondrial insults.

      COMMENTS:

      NCT-530 specificity should be confirmed by reducing PHGDH levels by either siRNA or even better by CRISPR-Cas9-mediated gene deletion.

      Firstly, we find clear results in Deletor mice but no pathology in WT mice treated with NCT-530. We interpret the reviewer to mean our cellular model, because in vivo siRNA or CRISPR-Cas9 approach is not feasible in mice that manifest the disease at 2 years of age. The compound is inhibiting the activity of PHGDH. The specificity has been described in the paper of Pacoult et al. (2016) previously, and as we find decreased serine and response of increased PHGDH transcript, the results are well consistent to what has previously been described. However, to respond to this reviewer, we have now added new data on a PHGDHKO in HEK293 cells (Figure S4E,F,p34 and below, commented on page 14).

      Manuscript Figure S4F. Quantification of population doublings of WT and PHGDHKO cells treated with actinonin, PHDGH inhibitor or a combination of both. Immunofluorescence images are presented in Rev Fig 1. The data is presented as average values of three independent experiments; VEH = vehicle; INH = inhibitor; ACT = actinonin; KO = knockout; EtOH = ethanol. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001; **** p ≤0.0001.

      If the serine biosynthetic pathway is causally relevant to worsen the mitochondrial pathology, supplementing Deletor mice with a serine-rich diet or intraperitoneal injection of serine is expected to improve pathology.

      This is an exciting suggestion which we did consider. However, based on our cell experiments, we show that in the context of mitochondrial disease, the de novo serine synthesis becomes essential for cellular viability, and this cannot be compensated by extracellular serine supplementation alone. This suggests that the intracellular localization of serine synthesis is essentially important, which is an interesting finding and warrants further investigation, not in the scope of this paper.

      Reviewer #2 (Significance):

      Limited significance in the field.

      Reviewer #3 (Evidence, reproducibility and clarity):

      This study concludes that de novo serine biosynthesis fueled by PHGDH activity is an adaptive mechanism counteracting defects in mitochondrial function observed in mitochondrial myopathies, while being dispensable for mitochondrial function of healthy muscle. By using a mouse model of mitochondrial myopathies, as well as cells treated with different mitochondrial poisons, authors show that de novo serine biosynthesis is specifically needed to preserve phospholipid synthesis, some degree of mitochondrial function, and mitigate mitochondrial ROS production. These conclusions are drawn mostly from the data obtained from experiments treating cells and mutant mice with NCT-503, an inhibitor of PHGDH. The main limitation is that the approach does not allow us to discern whether the phenotypes observed are explained by on-target and muscle autonomous actions of NCT-503. The list of major concerns are as follows:

      We thank reviewer #3 for her/his comments.

      1) The authors do not cite the study by Vandekeere et al. Cell Metabolism 2018 that define the KO of PHGDH in endothelial cells. This study demonstrates that serine derived from PHGDH is required to synthesize heme to preserve mitochondrial function in endothelial cells. In addition, they demonstrate that the absence of PHGDH increases mitochondrial ROS and decreases electron transport chain function. These previous studies can indicate that the worsening of the muscle phenotype in the mice treated with NCT-503 might be driven by its actions in endothelial cells, and not in muscle. In addition, it raises the question on why NCT-503 has no effect on muscle of 24-month-old mice, which have a decline in metabolic fitness.

      This is an interesting comment, and we indeed have now included the missing reference. Firstly, we find it interesting as well that NCT-503 has no significant health-related effect in WT background in the tissues that we analysed but shows harmful effects upon mitochondrial dysfunction. Our aged WT mice, even at the age of 24 months, show no signs of respiratory chain deficiency in skeletal muscle and this is consistent with numerous other studies on old mice. Therefore, the metabolic fitness decline that the reviewer mentions does not make PHGDH induction essential in normal aging.

      Secondly, we are aware of the Vandekeere et al. study on endothelial cells. Our mouse is a constitutive transgenic mouse, and therefore isolated changes in single tissues as in the endothelial KO mouse, because of metabolite signaling between cell types, is hard to compare with ours. In our mice, expressing a dominant patient mutation in the mitochondrial replicative helicase Twinkle, PHGDH induction in the skeletal muscle is a key component of the mitochondrial integrated stress response (ISRmt) as we described in e.g., in Tyynismaa et al. 2010 and Forsström, Jackson et al. Cell Metab 2019. Similar findings have been reported by Kuhl et al. ELife 2017 and other groups. We have also shown that PHGDH expression is dependent on prior induction of FGF21 in the skeletal muscle (Cell Metab 2019). We cannot fully exclude a contribution of endothelial cells in the Deletor phenotype, but the upregulation of PHGDH is robust exactly in the Deletor muscle, and endothelial cells show no phenotype in ultrastructural analysis of these mice. Therefore, our strong view is that in order to study the effect of PHGDH induction caused by primary mitochondrial disease in the skeletal muscle, the use of an inhibitor is the first choice.

      Hence, we find that the Vandekeere et al. study supports our findings in that increasing PHGDH could represent an adaptive response to support electron transport chain function and decreasing mitochondrial ROS in a tissue where PHGDH is induced.

      In this respect, we would also like to emphasize that a 1-month treatment of old mice, as in our study, differs from a life-long tissue-specific knockout, which is not a natural disease presentation nor an avenue to understand whether the opposite – increasing PHGDH activity – could represent a viable treatment option.

      2) No experiments with PHGDH knockdown are performed in vitro (or ideally in vivo using muscle electroporation if possible) to confirm the specificity of NCT-503. This is validation is key in muscle, as the on-target actions of NCT-503 were mostly shown in different cancers with low and high PGHDH expression (Pacold et al). Therefore, whether there are no off-target effects of NCT-503 in muscle is still unknown and should be defined.

      Firstly, we find effects in serine levels and also response to PHGDH expression, and effects on ISRmt. As argued, full-body genetic ablation is associated with lethality in early embryogenesis and is not an option. Muscle-specific PHGDH-KO was considered, but with a late-manifesting mouse is a several-year experiment and therefore was not considered to be in the scope of this article. In an addition to the arguments, we raised above, muscle electroporation or intramuscular AAV infection would represent the only option, but with limited spreading in adult aged mice (our own and colleagues’ experience), and in a mosaic disease would offer low information.

      We have however, now added data on a PHGDHKO HEK293 cell line with and without pharmacologically inducing mitochondrial dysfunction, p.14, Fig S4E,F.

      3) The data showing that exogenous serine supplementation cannot override the effects of NCT-503 treatment on mitochondria could also be compatible with an off-target effect of NCT-503 in models of mitochondrial dysfunction (see point 2). If the experiments suggested in point number 2 demonstrate on-target action of NCT-503, authors should then decrease the expression of the mitochondrial transporter of serine (SFXN1) to demonstrate that specific intracellular pools of serine are needed to mitigate mitochondrial dysfunction. If the authors' conclusion is conclusive, knock-down of SFXN1 should be highly toxic in in vitro and in vivo models of mitochondrial myopathies, while having barely any effect in controls (similarly to serine deprivation in vitro being almost harmless).

      Thank you for the comment. To our knowledge and based on our own experience elsewhere, the role of SFXN1 as the only serine transporter is still somewhat unclear (Kory et al, Science 2018; see also below). Therefore, the relevant metabolomic serine-dependent changes, PHGDH response and effects on the relevant stress response to our opinion are strong evidence of on-target-effects.

      4) The authors list SFXN1 in the antibodies used in the paper, but I could not find any data. Are the protein levels of SFXN1 changed in mice with mitochondrial myopathies? Do they strongly correlate with PHGDH expression?

      We actually had probed SFXN1 ab in the muscle but because of the extent of the data in the paper, had decided to omit the data – but accidentally left it in the methods. We do see an increase in the abundance of SFXN1 in treated Deletors. However, as also explained above, although SFXN1 has been described as a serine transporter, it is not fully characterized, also transports other amino acids, and has some redundancy with other SFXN family members requiring multiple KDs to get the required effect (Kory et al., Science 2018).

      These data are now included to Figure S2H (p.32 and below) and commented in page 11.

      Manuscript Figure S2H. Evaluation of SFXN1 protein expression in muscles of WT and DEL mice with Western Blotting. Left: image of the SFXN1 bands and the total protein lanes. Right: quantification of the band intensities. n=5/group; VEH = vehicle; INH = inhibitor. Significance levels: n.s. = p > 0.05; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤0.001.

      4) Serine tracing experiments would be required to conclude that serine is needed for phospholipid synthesis. Otherwise, the defects observed can just be downstream of mitochondrial dysfunction and ISRmt activation.

      Thank you for the point. Our study aims to characterize the role of PHGDH in skeletal muscle, in a mitochondrial disease. In vivo tracing experiments would be out of the scope for this study. We have modified our conclusions in respect to this in page 11.

      5) Authors use isolated mitochondria from muscle to determine whether OPA1 processing is changed in mice with mitochondrial myopathy and treated with NCT-503. The blots show higher total OPA1 content per mitochondria in the group with the greatest mitochondrial dysfunction, depolarization, and ROS production (myopathy + NCT-503). These data strongly suggest that dysfunctional mitochondrial from dysfunctional fibers do not survive the isolation procedure, showing just OPA1 content of resilient mitochondria surviving isolation. Indeed, heme depletion (as expected from PHGDH inhibition Vadekeere et al. Cell Metabolism 2018) and OPA1 processing catalyzed by OMA1 activation by ROS and depolarization can both activate the mitochondria ISR, via HRI. Therefore, authors should analyze OPA1 processing in total lysates to include mitochondria from dysfunctional fibers. Maybe increased OMA1 activity as a result of increased mitochondrial ROS and depolarization could explain the exacerbation of the mitochondrial ISR induced by NCT-503 treatment.

      The notion that stress-induced OPA1 processing present in mitochondrial myopathy is a valid one, which we did ask in a previous study in the Deletor mouse (Forsstrom et al., Cell Metabolism 2019). Surprisingly, we did not detect any significant levels of OPA1 processing in the Deletors, in the total cell lysates in that paper, nor in a previous paper of mitochondrial myopathy treated with Atkins diet (Ahola et al. EMBO Mol Med, 2016). The differential centrifugation protocol is unlikely to induce selection bias at the high centrifugation forces used (10000xg). We have previously described the increase in stress-related proteins in mitochondria-enriched fractions (Forsstrom et al., Cell Metabolism, 2019) and Rev Fig.6, below from the current study.

      Revision Figure 6. Immunoblot analysis of mitochondria-enriched fractions from skeletal muscles of all treatment groups from this study. n=5/group; VEH = vehicle; INH = inhibitor.

      Reviewer #3 (Significance):

      This study is significant, as it aims to understand the pathways that mediate adaptation to mitochondrial myopathies and such knowledge is necessary to find novel therapeutic targets. It could be of high interest to basic researchers studying metabolism and mitochondrial regulation, as well as to clinicians treating mitochondrial diseases.

      We appreciate the reviewer noting its importance and emphasizing the significance of this pathway for its clinical relevance.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This study concludes that de novo serine biosynthesis fueled by PHGDH activity is an adaptive mechanism counteracting defects in mitochondrial function observed in mitochondrial myopathies, while being dispensable for mitochondrial function of healthy muscle. By using a mouse model of mitochondrial myopathies, as well as cells treated with different mitochondrial poisons, authors show that de novo serine biosynthesis is specifically needed to preserve phospholipid synthesis, some degree of mitochondrial function, and mitigate mitochondrial ROS production. These conclusions are drawn mostly from the data obtained from experiments treating cells and mutant mice with NCT-503, an inhibitor of PHGDH. The main limitation is that the approach does not allow us to discern whether the phenotypes observed are explained by on-target and muscle autonomous actions of NCT-503. The list of major concerns are as follows:

      1. The authors do not cite the study by Vadekeere et al. Cell Metabolism 2018 that define the KO of PHGDH in endothelial cells. This study demonstrates that serine derived from PHGDH is required to synthesize heme to preserve mitochondrial function in endothelial cells. In addition, they demonstrate that the absence of PHGDH increases mitochondrial ROS and decreases electron transport chain function. These previous studies can indicate that the worsening of the muscle phenotype in the mice treated with NCT-503 might be driven by its actions in endothelial cells, and not in muscle. In addition, it raises the question on why NCT-503 has no effect on muscle of 24-month-old mice, which have a decline in metabolic fitness.
      2. No experiments with PHGDH knockdown are performed in vitro (or ideally in vivo using muscle electroporation if possible) to confirm the specificity of NCT-503. This is validation is key in muscle, as the on-target actions of NCT-503 were mostly shown in different cancers with low and high PGHDH expression (Pacold et al). Therefore, whether there are no off-target effects of NCT-503 in muscle is still unknown and should be defined.
      3. The data showing that exogenous serine supplementation cannot override the effects of NCT-503 treatment on mitochondria could also be compatible with an off-target effect of NCT-503 in models of mitochondrial dysfunction (see point 2). If the experiments suggested in point number 2 demonstrate on-target action of NCT-502, authors should then decrease the expression of the mitochondrial transporter of serine (SFXN1) to demonstrate that specific intracellular pools of serine are needed to mitigate mitochondrial dysfunction. If the authors' conclusion is conclusion, knock-down of SFXN1 should be highly toxic in in vitro and in vivo models of mitochondrial myopathies, while having barely any effect in controls (similarly to serine deprivation in vitro being almost harmless).
      4. The authors list SFXN1 in the antibodies used in the paper, but I could not find any data. Are the protein levels of SFXN1 changed in mice with mitochondrial myopathies? Do they strongly correlate with PHGDH expression?
      5. Serine tracing experiments would be required to conclude that serine is needed for phospholipid synthesis. Otherwise, the defects observed can just be downstream of mitochondrial dysfunction and ISRmt activation.
      6. Authors use isolated mitochondria from muscle to determine whether OPA1 processing is changed in mice with mitochondrial myopathy and treated with NCT-503. The blots show higher total OPA1 content per mitochondria in the group with the greatest mitochondrial dysfunction, depolarization, and ROS production (myopathy + NCT-503). These data strongly suggest that dysfunctional mitochondrial from dysfunctional fibers do not survive the isolation procedure, showing just OPA1 content of resilient mitochondria surviving isolation. Indeed, heme depletion (as expected from PHGDH inhibition Vadekeere et al. Cell Metabolism 2018) and OPA1 processing catalyzed by OMA1 activation by ROS and depolarization can both activate the mitochondria ISR, via HRI. Therefore, authors should analyze OPA1 processing in total lysates to include mitochondria from dysfunctional fibers. Maybe increased OMA1 activity as a result of increased mitochondrial ROS and depolarization could explain the exacerbation of the mitochondrial ISR induced by NCT-503 treatment.

      Significance

      This study is significant, as it aims to understand the pathways that mediate adaptation to mitochondrial myopathies and such knowledge is necessary to find novel therapeutic targets. It could be of high interest to basic researchers studying metabolism and mitochondrial regulation, as well as to clinicians treating mitochondrial diseases.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Experiments reported in this manuscript indicate that NCT-530- an inhibitor of the de novo serine biosynthetic enzyme PHGDH- worsens mitochondrial pathology.

      Systemic administration of NCT-503 decreased serine levels only in Deletor mice- ubiquitously expressing a homologous dominant patient mutation in mitochondrial twinkle helicase.

      NCT-503 treatment induced a further increase of the mitochondrial integrated stress response in Deletor mice. Moreover, the metabolic profile and lipid balance was further modified by NCT-503 administration to Deletor mice. The relevance of NCT-503 treatment was finally evaluated in cellular systems exposed with different treatments inducing mitochondrial insults.

      Comments:

      1. NCT-530 specificity should be confirmed by reducing PHGDH levels by either siRNA or even better by CRISPR-Cas9-mediated gene deletion.
      2. If the serine biosynthetic pathway is causally relevant to worsen the mitochondrial pathology, supplementing Deletor mice with a serine-rich diet or intraperitoneal injection of serine is expected to improve pathology.

      Significance

      Limited significance in the field.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript the authors describe interesting results regarding amino acid metabolism under conditions of mitochondrial stress. The authors used a selective PHGDH inhibitor (compound NCT503), and document that de novo serine synthesis is essential to sustain phospholipid biosynthesis, redox homeostasis, mitochondrial function, and mitochondrial protein synthesis in Deletor mice and in cell culture under mitochondrial stress. Interestingly, serine supplementation does not rescue those metabolic alterations, indicating a specific mitochondrial stress-dependent mechanism of serine utilization by the cells.<br /> In addition, the authors attempted to explore the role of serine in phospholipid biosynthesis under in vivo and ex vivo mitochondrial stress, and this is the weakest part of the manuscript. The specific reduction of mitochondrial PE using the PHGDH is interesting, and it can provide some clues into how mitochondrial membranes are synthetized under mitochondrial stress, but additional experimental approaches should be incorporated to generate a more robust body of evidence.<br /> In summary, the manuscript should be improved by using additional experimental approaches. In addition, genetic intervention through PHGDH gain or loss of function can help to elucidate the molecular mechanisms. The authors could also incorporate metabolomic studies using C13 serine or C13 glucose supplemented culture medium in order to differentiate carbons that come from extracellular serine or from de novo synthesis.

      Additional questions:

      Is PHDG subcellular localization modulated under mitochondrial stress conditions?

      Is the extracellular serine uptake impaired under mitochondrial stress?

      ATF4 is a transcription factor that regulates amino acid transport. In this connection, is ATF4-dependent serine transporters modulated under mitochondrial stress or under PHGDH treatment?

      Regarding the alteration in redox homeostasis, mitochondrial function and mitochondrial protein synthesis. Is the alteration of phospholipid synthesis upstream of all of those mitochondrial alterations?

      Additionally, in my opinion the results should be reorganized, because in the current format the manuscript is fragmented, and several panels lose the symmetry.

      Major concerns.

      Figure 1<br /> 1. The authors should incorporate the Deletor mice amino acid levels in muscle. How does the PHGDH inhibitor treatment modulate the other non-essential amino acids?<br /> 2. The authors should incorporate the data of WT + vehicle and wt + NCT503 mice in figures 1C, 1D, 1F and 1G, in order to compare properly the effects of PHGDH inhibitor<br /> 3. Figure 1D is mislabeled<br /> 4. Figure 1H. Are there any effect of PHGDH in the mtDNA of WT mice?

      The author might incorporate this information, to show properly that mitochondrial stress led to dependence of serine to sustain muscle homeostasis

      Figure 2

      Interestingly the authors observe a decrease in total mitochondrial lipids content, and an increase in mitochondrial PE content in Deletor mice compared to WT mice. These results suggest an alteration in the phospholipids flux between mitochondria and endoplasmic reticulum in this model of mitochondrial disease. Moreover, PHGDH treatment appears to be able to rescue this alteration. Some question related this issue:<br /> What is the expression of genes involved in the balance PC, PE, PS?, Are the PSS1, PSS2, PSD and PEMT expression altered?<br /> Regarding the phospholipid synthesis. Is mitochondria or endoplasmic reticulum ultrastructure altered in Deletor mice muscle?<br /> The authors should explain the possible mechanisms.

      Figure 3

      Based on the metabolomic studies, the authors propose a time-dependent decrease in PSTA1 and phosphoserine in cells under mitochondrial stress (Figure 3D). To elucidated the direct role of PHGDH, the authors should analyze the phosphoserine and different phospholipid (described in figure 2E) in presence of PHGDH inhibitor. This will help to understand the link between the endogenous serine synthesis and mitochondrial PE accumulation.<br /> Figure 3H shows a decrease in phosphoserine in the presence of PHGDH inhibitor but this figure is asymmetric compared to figure 3I. Can the authors use another experimental approach to detect the specific mitochondria phospholipid levels (used in Figure 2 for instance)?<br /> The authors should incorporate mitochondrial PE analysis in figure 3 to link the cellular studies described in this figure with the studies done in Deletor mice muscle.<br /> Figure 3 I-K. The authors suggest an alteration in glutathione redox state and a further increase in mitochondrial superoxide production in cells treated with the PHGDH inhibition under mitochondrial stress. What are the total glutathione levels under these conditions? Could GSH regeneration improves the mitochondrial function and mitochondrial protein synthesis? Is extracellular serine able to rescue the reduced glutathione levels?

      Minor concerns.

      Figure 3B,C does not show the statistical analysis so please incorporate this information.

      Include quantification of figure 3 E and supplementary figure S3E.

      figure S3E. Improve flow cytometry histogram, the cell population data values cannot be observed.

      Some methods and primers included in the material and methods section are no used in the manuscript.

      Significance

      In this manuscript the authors describe interesting results regarding amino acid metabolism under conditions of mitochondrial stress. The authors used a selective PHGDH inhibitor (compound NCT503), and document that de novo serine synthesis is essential to sustain phospholipid biosynthesis, redox homeostasis, mitochondrial function, and mitochondrial protein synthesis in Deletor mice and in cell culture under mitochondrial stress. Interestingly, serine supplementation does not rescue those metabolic alterations, indicating a specific mitochondrial stress-dependent mechanism of serine utilization by the cells.

      This data will be relevant to better understand the connection between alterations in mitochondrial function and amino acid metabolism in cells, and in organisms.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1:

      Major comments:

      1. In figure 4 and throughout the text they refer to AVP neurons as being "directly" inhibited by glucose but they do not show this. They do show membrane depolarization in response to decreased glucose form 2.5 to 0.1 mM; however this could easily be an indirect effect. To demonstrate that they directly sense glucose, it is necessary to block presynaptic input (generally done with the sodium channel blocker tetrodotoxin). In addition, the example recordings are not very good. The neurons seem to just decrease action potential frequency throughout the recording, despite the membrane depolarization. In the methods section, they state that cell resistance was measured but they do not report it. Looking at the traces, it appears that resistance does not change in response to decreased glucose which further supports a presynaptic action. In order to characterize these neurons as directly glucose sensing, they must use a blocker of presynaptic activity such as tetrodotoxin and the resistance values should be reported. They should also choose better representative traces.

      Answer: By “directly inhibited” we do not refer to a cell-autonomous effect but to a direct glucose responsiveness. Our cFOS experiments (Fig 3) and preexisting in vivo fiber photometry data (Kim et al., PMID: 34787082; Mandelblat-Cerf et al., PMID: 27989461) reported activation of AVP neurons in conditions of hypoglycemia. We further wanted to verify that the activation was triggered directly by the decreased glucose levels and not by accompanying systemic signals (for example insulin levels, stress response, etc). Furthermore, we aimed at identifying if inactivation of Tmem117 in AVP neurons affects their glucose responsiveness (at the circuit level). Therefore, we decided to take into account the synaptic inputs. Of course, this approach provides information at the circuit level (that we consider essential for CRR characterization) but is also accompanied with highly variable firing patterns. We focused our analysis on the membrane potential, as an indicator of cell excitability state that based on our previous experience was proven to be consistently affected in glucose sensing neurons regardless of cell-type, inputs or topology (Strembitska et al., PMID: 36180454; Kessler et al., PMID: 34622169; Quenneville et al., PMID: 32839348; Quenneville et al., PMID: 32839348; Labouèbe et al., PMID: 29218531; Steinbusch et al., PMID: 27422385; Labouèbe et al., PMID: 27322418; Lamy et al., PMID: 24606905). We used membrane resistance as an indicator of our patch-clamp quality. As specified in the Materials and Methods section (pages 33, lines 702-704), neurons with an access resistance >25 MΩ or changing by >20% during the recording were excluded from the analysis.

      We understand that the term “directly affected” has created some confusion since it could be interpreted as cell-autonomous effect. Therefore, we have exchanged the term as follows:

      • Results section (page 14, line 281): “To determine whether AVP neurons were directly sensitive to hypoglycemia and whether Tmem117 would modify this sensitivity” was converted to “To determine whether AVP neurons were sensitive to the decreased glucose availability and whether Tmem117 would modify this sensitivity”
      • Discussion section (page 27, lines 548-553): “Thus, AVP neurons can directly respond to hypoglycemia. Interestingly, a recent study reported that hypoglycemia can also activate AVP neurons indirectly, through afferent connections arising from GI neurons of the basolateral medulla (Kim et al., 2021). Thus, AVP neurons are part of a brainstem-hypothalamus neuronal circuit where hypoglycemia can be sensed by neurons located at multiple sites to activate the secretion of AVP leading to increased secretion of GCG.” was converted to “Thus, AVP neurons can respond to decreased glucose levels. Interestingly, a recent study reported that hypoglycemia can also activate AVP neurons through afferent connections arising from GI neurons of the basolateral medulla (Kim et al., 2021). Thus, AVP neurons are part of a brainstem-hypothalamus neuronal circuit where hypoglycemia can be sensed by neurons located at multiple sites to activate the secretion of AVP leading to increased secretion of GCG.”

      Regarding the membrane resistance measurements, 6 out of 7 AVPTM117KO GI cells and 6 out of 9 AVPTM117WT GI cells show a decrease in conditions of low glucose suggesting a cell autonomous effect, at least in a subpopulation of AVP GI neurons. We realized, based on the reviewer’s comment, that not including these data can lead to misinterpretation of the results, therefore we included the membrane resistance measurements in figure 4 and added the corresponding explanation in the Results section (page 15, lines 295-298).

      Regarding the representative traces, those included in the figure clearly show the increase in membrane potential that was consistent in all our GI cells. Choosing a representative trace for firing patterns is unrealistic given the high variability observed without the use of synaptic blockers.

      1. The relationship between the AVP/Tmem117 knockout and glucagon secretion is also not very convincing - especially in terms of the data showing that the effect seen at 1-week reverses by 3 weeks post knockdown in males when the neurons have died. First, the effect is very slight to begin with. Second, and more of a concern, the over secretion is still evident at the later time point, it just did not reach significance. This could have been due to the difference in sample size. Sample size in the early timepoint is 15-16 and in the late time point is reported as 8-9 (almost half the size), and in fact when I try to count data points, it really looks like the WT sample size is only 5. To make the conclusion that the effect disappears at the later time it is necessary to increase sample size so that the studies are equivalent. This is very important because these data are what is supporting the hypothesis that Tmem117 in AVP neurons regulates (inhibits) glucagon secretion. It is also concerning that the increased glucagon secretion in the knockout did not translate into differences in the depth of hypoglycemia raising concerns about physiological relevance.

      Answer: The sample size required based on our power calculations for these traits (plasma glucagon and copeptin) in male mice is 8 animals per group. Figure 2 consists of data merged from two individual experiments, both of which showed a significant effect. Figure 6 is the 3rd replication of our phenotypic observations with the addition of a later timepoint measurement. The number of animals included is 9 AVPTM117WT and 8 AVPTM117KO. Only for copeptin levels (panel F), as stated in the figure legend, the n is 8 mice per group, since for one of the AVPTM117WT mice the baseline levels of copeptin were undetectable by ELISA. Counting the datapoints in a 2D graph can cause misinterpretation since similar values can be depicted as overlapping points. We had decided to present in Fig 6 only the later timepoint that corresponds to the IF results reporting AVP cell death. We now realize based on the reviewer’s comment that this can cause misinterpretation of the phenotypic outcome, therefore we have exchanged graphs E-G (containing 2 timepoints) for the corresponding graphs that contain all 3 timepoints. We believe that with this addition the concern will be addressed since with the same sample size there is a significant increase in glucagon and copeptin secretion in AVPTM117KO mice at the early timepoint that is no longer evident at the later timepoint.

      Regarding the concern of effect size, we acknowledge the fact that we are reporting a small effect. But the CRR is controlled by a highly complex network of hypoglycemia activated neurons, which are located in different brain regions and act in an integrated manner to induce glucagon secretion through autonomic control, the HPA axis, and the secretion of AVP (reviewed in Steinbush et al., PMID: 26163755; Thorens, PMID: 34989155). Therefore, in this highly redundant and robust system, suppressing only one hypoglycemia sensing node, cannot be expected to have major consequence on the glucagon secretion. Nevertheless, we provide solid evidence that inactivation of Tmem117 in AVP neurons leads to a slight upregulation of AVP secretion that is accompanied by a subsequent increase in the glucose-stimulating hormone glucagon. To further highlight this observation, we added in figure 6 the correlation analysis between glucagon and copeptin levels of each tested sample that is reporting a significant positive correlation in both genotypes.

      Regarding the concern for physiological relevance, we would like to clarify that in this model we have not followed the reestablishment of normoglycemia over time. The timepoint of blood collection and glycemic measurement was selected based on our previous experience. We have performed multiple times full insulin tolerance tests in various mouse models, and we selected here (and in other papers: Picard et al., PMID: 35339728; Strembitska et al., PMID: 36180454) the one-hour time point because this is always the nadir of the glycemic curves, where CRR has the strongest effect in stimulating the secretion of CRR hormones. Glycemia at this time point depends on the insulin sensitivity of the animal. Thus, finding similar glycemia at 60 minutes after insulin injection indicates similar insulin sensitivity in AVPTM117WT and AVPTM117KO mice, further supporting that the increased glucagon secretion is directly correlated to the increased AVP secretion.

      1. It is also curious that the females in proestrus were similar to males but that females in other stages showed no effect. If, as mentioned in the discussion, estradiol was involved one would expect that males would be more similar to females in stages with low estradiol. The sex difference should be discussed more fully since it does seem to be one of the strong conclusions in the study

      Answer: We acknowledge that the discussion of the sex-specific phenotype was minimal in the initial version of our manuscript. We consider this finding very important for the general understanding of sex-differences in CRR, therefore we have included it in our main figures. But given that our observations remain in the phenotypic level our intention was to keep the discussion minimal and not add a lot of speculations that would not be supported by experimental data. We have performed all our further mechanistic analysis only in male mice and therefore we are not able to comment about this sex specific effect with evidence on the underlying mechanism. Of course, we have our literature-based explanation/hypothesis for the observed phenotype and given that this point was raised by all 3 reviewers, we have expanded this section of the discussion (pages 26, lines 520-542).

      1. The discussion needs to be adjusted in line with the findings.

      Answer: Several adjustments both in the Results and Discussion sessions have been incorporated based on the reviewers’ comments. Details on the adjustments for each point raised can be found in the corresponding answer.

      Minor comments:

      The BXD mice should be defined and the reason for their use explained

      Answer: We did not include further information in the first place because all the details and rational for the use of BXD mice were included in the original publication of this genetic screen (Picard et al., PMID: 35339728). We have now added further details on the origin of the BXD mouse lines accompanied with the corresponding reference (page 4, lines 83-85).

      The abbreviation cQTL needs to be defined at first use in the text of the results

      Answer: We added the abbreviation (page 5, line 102).

      Reviewer #2:

      Minor comments:

      1. Page 5, line 111: Fig1 shows Tmem117 expression in the hypothalamus. Tmem117 expression in AVP neurons in the PVN and SON are highlighted, however, AVP is not only expressed in these areas in the hypothalamus and in extra-hypothalamic areas. Was Tmem117 also expressed in AVP neurons beyond these areas?

      Answer: Based on our immunofluorescent detection Tmem117 is only observed in AVP neurons of the PVN and SON. This pattern (Fig 1A), the percentage of AVP-Tmem117 co-positive cells in these two areas (Fig 1H, I) and the presence of strong positive staining in the neurohypophysis (Fig 1B) points towards specific expression in magnocellular neurosecretory AVP cells. We do not observe staining in other AVP positive neurons. An example can be found in Fig 1A where Tmem117 staining is localized at the PVN and SON, but not at the Suprachiasmatic nucleus.

      1. Page 10, line 219: Fig2 shows CRR responses after conditional Tmem117 ko in AVP neurons. A sex-dependent difference was observed in the increased CRR after Tmem117 inactivation. A similar pattern between males and females during pro-estrus in copeptin and glucagon was observed. Was AVP expression and AVP neuron response to hypoglycemia also analyzed in both sexes, and in the case of females, were the results analyzed during the pro-estrus phase?

      Answer: Unfortunately, a detailed analysis of the mechanistic underpins of the estrus phase-dependent phenotype in female mice would exceed the spectrum of this initial characterization. We do believe that this finding is of great importance for the general understanding of sex-differences in CRR, therefore we have included it in our main figures. But our observations remain at the phenotypic level. We have performed all our further mechanistic analysis only in male mice. Of course, we have our literature-based explanation/hypothesis for the observed phenotype and given that this point was raised by all 3 reviewers, we have expanded this section of the discussion (pages 26, lines 520-542).

      1. Many of the experiments performed after Fig 3 (glucose responsiveness of AVP neurons, ER stress and ROS production, Ca2+ imaging) are mainly analyzed in the SON, but not the PVN. What is the rationale for analyzing only the SON in some experiments? Analyzing the PVN is of relevance due to its known role in CRR triggering.

      Answer: The reason for focusing our single-cell level analysis only in SON is its homogeneous population of AVP-Tmem117 double positive cells (Fig 1I). In the PVN about 10% of AVP neurons are negative for Tmem117 (Fig 1H). Therefore, we would be unable to distinguish between the cells with Tmem117 inactivation and those that did not express it at the first place. We agree with the reviewer that PVN is of great relevance for CRR induction, and this is why for all our in vivo phenotyping experiments we aimed at targeting both areas. Our AVPTM117KO mouse model is generated by injection of the AAV6-AVP-icre virus in the posterior pituitary and is targeting both regions (Fig S2E). This model was used for all our phenotypic analyses (Fig 2, 6) and for the fiber photometry recordings (Fig 5H-M). The Ca2+ signal we obtain is a collective output of AVP magnocellular terminals in the posterior pituitary deriving from both PVN and SON. But when it comes to the analysis of responses at the single-cell level, not having the ability to identify the subpopulation of Tmem117 negative cells could have a big impact on the results and their interpretation.

      1. Page 16, line 346: Again here, only BIP expression in AVP neurons is shown in the SON. I would be interested in looking at expression in AVP neurons in the PVN. Same goes for activation of these neurons (measured by Ca2+) after insulin administration.

      Answer: As mentioned above, we did not quantify these single-cell events in AVP neurons of the PVN due to the inability of effectively distinguishing between cells with Tmem117 inactivation and those that do not express Tmem117. But based on our supporting data (activation of PVN AVP cells in Fig 3 and decreased number of AVP PVN cells upon Tmem117 inactivation in Fig 6) we believe that the effect of Tmem117 inactivation is comparable between the Tmem117-positive AVP cells of both areas.

      1. What would be the role of Tmem117 in CRR triggering after hypoglycemia? Would its expression change during hypoglycemic conditions versus normoglycemia? Would that be different in models of pathology, like diabetes? Speculation of its physiological role in the discussion might be of help to visualize its role beyond inactivation.

      Answer: We focused our discussion strictly on the acquired results, but we agree with the reviewer than including speculations regarding the physiological role of Tmem117 would enhance the communication of our results. We have incorporated some extra points focusing on the possible role of Tmem117 expression in physiological conditions and pathological states in the Discussion section (pages 27-28, lines 562-571). Furthermore, we have included some extra data from microdissected PVN and SON tissue reporting downregulation of Tmem117 in the SON as a physiological response to insulin-induced hypoglycemia (Fig 3G-I).

      Reviewer #3:

      Major comments:

      1) The in vivo calcium data is not convincing (e.g. Figure 5j). Why is the activity not similar to that normally seen from populations of neurons (and in particular AVP neurons) in vivo - bursting/spikes. This is just a background increase in calcium... not an increase in activity?

      Answer: Our aim with the fiber photometry experiments was not to detect the activity of AVP neurons but to evaluate the Ca2+ fluctuations in AVP neuronal terminals, directly at the site of AVP exocytosis. The activity of AVP neurons in conditions of hypoglycemia has been previously detected with similar techniques at the level of cell bodies in the SON (Kim et al., PMID: 34787082; Mandelblat-Cerf et al., PMID: 27989461) and was further supported by our cFOS and ephys experiments (Fig 3, 4). These experiments showed that inactivation of Tmem117 did not affect the activation of AVP neurons in conditions of hypoglycemia. But our phenotypic characterization revealed higher secretion of AVP (Fig 2) and our in vitro (Fig S3) and in vivo (Fig 5A-G) data demonstrated increased ER stress and ROS in AVPTM117KO cells. Therefore, we wanted to assess if this increased stress is associated with increased Ca2+ at the level of neuronal terminals which would enhance AVP exocytosis. The acquired signal is a collective output of AVP magnocellular neurons from PVN and SON and although it is not resembling the pattern observed from cell body recordings, we believe it provides important information for the output of this circuit in conditions of hypoglycemia. Our results do not only report that Tmem117 inactivation is accompanied by an increase in intracellular Ca2+ at the level of nerve terminals/exocytosis, but further demonstrate (for the first time to our knowledge) that the activity reported in conditions of hypoglycemia is linked, as expected, to an increase in local Ca2+ levels at the posterior pituitary. All the essential controls for normalization and interpretation have been taken into account as mentioned in the methods section (page 31, lines 655-668). GCaMP7 signal recordings are corrected for artifacts and photobleaching. The isosbestic channel is subtracted to correct for non-GCaMP7 related signal artifacts and then at a second stage (during the DF/F0 normalization) the traces are corrected for photobleaching by the running average algorithm. Furthermore, 60min recordings of mice injected with saline are used as control for determining the increased signal after insulin injection. We have now added a clarification on the origin of the recorded signal in the Results section (page 18, line 368).

      2) Why would this response be oestrus cycle dependent? This is given very little thought in the manuscript.

      Answer: We acknowledge that the sex-specific phenotype observed was not thoroughly discussed in the initial version of our manuscript. We included the data in a main figure since we consider them as an important piece of information supporting the crucial role of sex hormones in the regulation of CRR. On the other hand, since our observations remain in the phenotypic level, we thought it would be better to keep the discussion on the topic short and not include various literature-based hypothesis that would not be supported by experimental data. We have performed all our further mechanistic analysis only in male mice and therefore we are not able to comment about this sex specific effect with evidence on the underlying mechanism. We have now realized based on the reviewers’ comments that further discussion on the topic is needed, therefore we have expanded this section of the Discussion (page 26, lines 520-542).

      Minor comments:

      1) How does the regulation make sense in the context of AVPs normal role in whole body physiology?

      Answer: We focused our discussion strictly on the acquired results, but it has become evident based on the reviewers’ comments that a discussion of the broad picture regarding the role of AVP and Tmem117 in physiological and pathological conditions would strengthen the interpretation of our results. We have now incorporated some extra points focusing on the possible role of Tmem117 expression in physiological conditions and pathological states in the Discussion section (pages 27-28, lines 562-571).

      2) What do the authors think about the role of AVP in islets, some authors suggest it actually has the opposite effect.

      Answer: The literature on the role of AVP on pancreatic islets shows indeed some controversies. A couple of studies suggest an action on beta cells and insulin secretion without any effect on glucagon secretion. On the other hand, the evidence on the stimulation of glucagon secretion is supported by numerous studies over the years and has been convincingly demonstrated with various ex vivo and in vivo models. Our study, in line with these findings, verifies the increased AVP secretion in conditions of hypoglycemia and reports a positive correlation between the levels of circulating copeptin and glucagon (Fig 6H).

      3) Why have the authors left the recent study by Kim, Rorsman and colleagues et al. 2022 (eLife) to the discussion? This manuscript is an important piece in this field and should be introduced in the introduction.

      Answer: We have now added the AVP induced glucagon secretion, accompanied by the supporting references (including the reference mentioned by the reviewer) as integral part of the CRR in our Introduction section (pages 3-4, lines 68-71).

      4) The intro should also mention that islets also can intrinsically regulate glucagon release.

      Answer: We focused our introduction exclusively to the brain triggered glucagon secretion, but in accordance with the reviewer’s comment we have now incorporated the intra-islet regulation and supporting literature in the Introduction (page3, line 55).

      5) Has tmem117 shown up in any human screens of hypogylcaemia risk? Do tmem117 variants show in any osmoregulation or insipidus risk?

      Answer: Not to our knowledge.

      6) Please clarify what N= is? What is a statistical unit in each case in the graphs. It is not clear when it is a mouse, cell or experiment. This should be justified in each case.

      Answer: We have now justified the corresponding values in all figure legends.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Glucagon secretion counters hypogylcaemia, and this is in part regulated by the CNS.

      The authors investigated the role of hypothalamic Tmem117, which was previously identified in a genetic screen as a regulator of the counter-regulatory response to hypoglycaemia. They show that Tmem117 is expressed in vasopressin neurons and that inactivation of Tmem117 in AVP neurons increases hypoglycemia-induced vasopressin secretion leading to higher glucagon secretion. They show this is oestrus cycle phase-dependent.

      The manuscript is generally well written and the results of good quality. The findings are important.

      I have some comments:

      Major:

      1. The in vivo calcium data is not convincing (e.g. Figure 5j). Why is the activity not similar to that normally seen from populations of neurons (and in particular AVP neurons) in vivo - bursting/spikes. This is just a background increase in calcium... not an increase in activity?
      2. Why would this response be oestrus cycle dependent? This is given very little thought in the manuscript.

      Minor:

      1. How does the regulation make sense in the context of AVPs normal role in whole body physiology?
      2. What do the authors think about the role of AVP in islets, some authors suggest it actually has the opposite effect.
      3. Why have the authors left the recent study by Kim, Rorsman and colleagues et al. 2022 (eLife) to the discussion? This manuscript is an important piece in this field and should be introduced in the introduction.
      4. The intro should also mention that islets also can intrinsically regulate glucagon release.
      5. Has tmem117 shown up in any human screens of hypogylcaemia risk? Do tmem117 variants show in any osmoregulation or insipidus risk?
      6. Please clarify what N= is? What is a statistical unit in each case in the graphs. It is not clear when it is a mouse, cell or experiment. This should be justified in each case.

      Significance

      This is important, but some of the in vivo calcium data is weak. The manuscript is also riddled with self-citations and doesn't really put the results into a broader context. In addition, the finding is in a sense piggybacking off a recent revelation in the field (AVP neuron importance) using a technique that is available to the authors (Tmem117 manipulation) rather than trying to address the hypothesis/question with THE BEST approach to answer the question. The question feels like: "how can we use our mouse model to probe this AVP neuron hypothesis ourselves". Strange. The finding that the results are only relevant during a particular phase of the oestrus cycle feels a bit random and lacks adequate explanation. I still like the manuscript very much, the experiments are very technically challenging, the results are very interest, the data (mostly) of excellent quality, and the relevance to the field highly important, but I feel there is still room for improvement (unlikely more experiments, definitely some thinking and rewritting).

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The present study led by Gaspari, et al shows a new role for Tmem117 as a major regulator in the CRR. The authors used a variety of techniques to demonstrate that Tmem117 innactivation modulates hypoglycemia-induced responses by regulating AVP action in the hypothalamus. I found the rationale of the study interesting, the results seem to support the author's claims and conclusions seem to be proper. However there are some minor issues that needs to addressed:

      1. Page 5, line 111: Fig1 shows Tmem117 expression in the hypothalamus. Tmem117 expression in AVP neurons in the PVN and SON are highlighted, however, AVP is not only expressed in these areas in the hypothalamus and in extra-hypothalamic areas. Was Tmem117 also expressed in AVP neurons beyond these areas?
      2. Page 10, line 219: Fig2 shows CRR responses after conditional Tmem117 ko in AVP neurons. A sex-dependent difference was observed in the increased CRR after Tmem117 inactivation. A similar pattern between males and females during pro-estrus in co-peptin and glucagon was observed. Was AVP expression and AVP neuron response to hypoglycemia also analyzed in both sexes, and in the case of females, were the results analyzed during the pro-estrus phase?
      3. Many of the experiments performed after Fig 3 (glucose responsiveness of AVP neurons, ER stress and ROS production, Ca2+ imaging) are mainly analyzed in the SON, but not the PVN. What is the rationale for analyzing only the SON in some experiments? Analyzing the PVN is of relevance due to its known role in CRR triggering.
      4. Page 16, line 346: Again here, only BIP expression in AVP neurons is shown in the SON. I would be interested in looking at expression in AVP neurons in the PVN. Same goes for activation of these neurons (measured by Ca2+) after insulin administration.
      5. What would be the role of Tmem117 in CRR triggering after hypoglycemia? Would its expression change during hypoglycemic conditions versus normoglycemia? Would that be different in models of pathology, like diabetes? Speculation of its physiological role in the discussion might be of help to visualize its role beyond inactivation.

      Significance

      The study of Gaspari, et al proposes a new player in the hypoglycemia-induced CRR, specially affecting AVP modulation of CRR. The results and conclusions are of relevance to the field, as the mechanisms mediating hypoglycemia-induced CRR and how these are affected during pathology are not completely understood. The study is relevant in the metabolic field and for a neuroendocrinology public.

      Field of expertise: Neuroendocrinology, hypoglycemia, diabetes.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this study the authors convincingly demonstrate that the hypothalamic protein Tmem117 protects against elevated ROS and cell death in AVP neurons, and that knocking out Tmem117 in these neurons leads to cell death. However, the major thrust of this paper was to demonstrate that Tmem117, in AVP neurons plays a role in hypoglycemia counter regulation (per the title). The data supporting this hypothesis are much less convincing.

      Major comments

      There are 2 major findings of this study that are problematic (#1 and 2 below). Further experiments are needed to support their conclusions.

      1. In figure 4 and throughout the text they refer to AVP neurons as being "directly" inhibited by glucose but they do not show this. They do show membrane depolarization in response to decreased glucose form 2.5 to 0.1 mM; however this could easily be an indirect effect. To demonstrate that they directly sense glucose, it is necessary to block presynaptic input (generally done with the sodium channel blocker tetrodotoxin). In addition, the example recordings are not very good. The neurons seem to just decrease action potential frequency throughout the recording, despite the membrane depolarization. In the methods section, they state that cell resistance was measured but they do not report it. Looking at the traces, it appears that resistance does not change in response to decreased glucose which further supports a presynaptic action. In order to characterize these neurons as directly glucose sensing, they must use a blocker of presynaptic activity such as tetrodotoxin and the resistance values should be reported. They should also choose better representative traces.
      2. The relationship between the AVP/Tmem117 knockout and glucagon secretion is also not very convincing - especially in terms of the data showing that the effect seen at 1-week reverses by 3 weeks post knockdown in males when the neurons have died. First, the effect is very slight to begin with. Second, and more of a concern, the over secretion is still evident at the later time point, it just did not reach significance. This could have been due to the difference in sample size. Sample size in the early timepoint is 15-16 and in the late time point is reported as 8-9 (almost half the size), and in fact when I try to count data points, it really looks like the WT sample size is only 5. To make the conclusion that the effect disappears at the later time it is necessary to increase sample size so that the studies are equivalent. This is very important because these data are what is supporting the hypothesis that Tmem117 in AVP neurons regulates (inhibits) glucagon secretion. It is also concerning that the increased glucagon secretion in the knockout did not translate into differences in the depth of hypoglycemia raising concerns about physiological relevance.
      3. It is also curious that the females in proestrus were similar to males but that females in other stages showed no effect. If, as mentioned in the discussion, estradiol was involved one would expect that males would be more similar to females in stages with low estradiol. The sex difference should be discussed more fully since it does seem to be one of the strong conclusions in the study
      4. The discussion needs to be adjusted in line with the findings.

      Minor comments:

      The BXD mice should be defined and the reason for their use explained<br /> The abbreviation cQTL needs to be defined at first use in the text of the results

      Significance

      The observation that Tmem117 is protective against ROS and cell death is interesting. However, the other conclusions are not supported by the data which decreases the overall significance of the study

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Thank you for the rapid and favorable reviews of our manuscript entitled “Long-Read Genome Assembly and Gene Model Annotations for the Rodent Malaria Parasite Plasmodium yoelii 17XNL.” We particularly appreciated that both reviewers had substantial, detailed expertise with the sequencing and assembly of Plasmodium genomes, and valued their questions and suggestions to ensure high rigor of our work. We have addressed all of the reviewers’ comments in the revised manuscript, and have provided a point-by-point response to each below.

      Response to Reviewers

      Note: Point-by-point responses are provided in italics below each reviewer comment below. Line numbers referenced in our responses refer to their final line position in the Track Changes version of the manuscript.


      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The manuscript entitled "Long-Read Genome Assembly and Gene Model annotation for the Rodent Malaria Parasite P. yoelii 17XNL" is a well-written manuscript providing updates and important observations about the genome assembly and annotation of this specific non-lethal isolate. The group overall did a great job showing how the application of newer technologies such as long-read DNA and direct RNA sequencing to generate top-quality genomes to be used as a reference for the community. Here are some comments about the work presented:

      Response: Thank you for your positive feedback and suggestions on how to clarify these findings. We have improved the revised manuscript based on your feedback and suggestions below.

      Major comments: - The authors added several result information across the methods section. Making the text repetitive, since the same is also presented in the results section. Please revise the method section to remove results from this section.

      Response: We agree and have streamlined both the Results and Methods sections to remove redundancy in these descriptions.

      • Some methods are also redundant in the Result section. For example, in line 141-142, the group describe which DNA extraction kit they used (again this is correctly mentioned in the methods section).

      Response*: We agree and have removed minutiae such as these from the Results section. These details remain in the Methods section to ensure reproducibility. *

      • Besides important, the group added several information about method comparison between base call accuracy and sequencing methods. I agree that having this information in the supplemental material is great, but I would be careful to not focus too much on those, since most of the observations are already well-known by the community and focus more in the biological relevance of what is being generated with the newly updated genome.

      Response: The advances in base calling algorithms do make substantial improvements to the Nanopore reads. We have only included a short description of this in the main manuscript and feel this is an appropriate amount of context for the typical reader. Those that love these details and want to dig further can find this content in our supplemental information.

      • The group did a great job generating two versions of the genome, and an updated gene annotation set using long-read sequencing. But the major question is, how about alternative splicing? They mention the use of it (line 350) but I don't see any result about how many alternative transcripts were observed, and if they were differentially detected in different life stages of the sets used for the RNA sequencing. This is a very important result to be added since one of the key pieces of information that long-read RNA sequencing brings for Genome annotation.

      Response: We have now expanded this description in the manuscript to note that 866 genes are predicted to have multiple transcript isoforms (Lines 240-241). Moreover, we have now generated a Supplemental Table 4 that lists these isoforms in the revised manuscript. As we have not conducted further validation of this large number of transcript isoforms, we have left the description at this level.

      • Same observation as above for potential long ncRNAs.

      Response: We agree that lncRNAs are a fascinating aspect of the biology of the parasite, but a proper analysis of this class of RNA is far outside of the scope of this current study. Automatic identification approaches with Nanopore data will likely yield high numbers of false positives, which require manual curation for rigorous annotation. We hope others can use these data to accelerate such studies as well.

      • From what I understand the Hifi run was able to generate a gapless genome assembly and the ONT run did not. What was the final coverage for each? From my experience with P. falciparum genomes, ONT even with the rapid kit was able to generate chromosomal level assemblies if the coverage was >100x (but again, this is not a rule). Add those valuable observations about the depth so the reader can check if other variables in the comparison should be made.

      Response: This is a particularly interesting aspect of not only our datasets, but of other Plasmodium genomes as well. This issue occurs at least in part due to the presence of many repeated elements in the subtelomeric regions. It is important to note that these repeated elements do not resolve into a single haplotype in an assembly due to conflicting information, not due to lack of coverage. For instance, regions may differ by only a few nucleotides that each have significant read support. We are particularly interested in a recent preprint that concludes that P. falciparum harbors extrachromosomal plasmids with these var sequences present (doi.org/10.1101/2023.02.02.526885). *If this observation is supported via peer review, this interpretation could also begin to explain our results with P. yoelii 17XNL as well. *

      • Also be sure that the structural comparisons between the genomes are not the ones used after running ragtag.py. If so, there is a high chance of structural bias in the scaffolded contigs.

      Response: We apologize for the confusion. We did not use ragtag for the PacBio assembly, and all structural and variant comparisons were done using the PacBio assembly. However, we did use ragtag for the Nanopore assembly that is included in this study as an additional resource to our community. These data were not used for variant calling though.

      • How Prokka differed from Braker2 for the Mitochondria/API annotation? This needs to be very well described since prokka is made for prokaryotic organisms and not for eukaryotic ones. And Braker2 uses a custom build dataset for training, which I believe contains known information about MIT/API for Plasmodium species.

      Response: We first applied Braker2 to the organellar genomes and identified only 6 genes in the apicoplast genome and only 2 genes in the mitochondrial genome. Due to their prokaryotic origin, we then tested if Prokka could alleviate this issue. To do so, we applied Prokka to the 17X reference genome and found that it detected all of its annotated organellar genes. Therefore, we also applied Prokka to our Py17XNL genome to annotate the genes found on the apicoplast and mitochondrial genomes. As a final validation check, the gene annotations on these two organellar genomes are effectively identical between 17X and 17XNL. This is consistent with the sequencing results and assemblies that show that the apicoplast genome is identical and the mitochondrial genome differs in a single, notable deletion in 17XNL.

      • Figure 5B, what is the peak observed in the mitochondria? What genes? Repeats?

      Response: What appears to be an inward pointed trough actually reflects the deletion of bases in 17XNL compared to the 17X assembly. We have clarified this in the manuscript on Lines 296-297 and in the legend of Figure 5.

      Minor comments: - For Oxford nanopore sequencing using the ligation kit, did the group check for potential chimeric reads generated by the protocol?

      Response*: We did. We used the adapter trimming software, Porechop, to identify and bin chimeric reads that were eliminated from the dataset. This method is described in the Makefile associated with the manuscript. *

      • Check if all species are italicized (for example, line 187 P. yoelii is not)

      Response: We have italicized this instance of P. yoelii and have reviewed the document to search for any other words that should be italicized.

      • In methods add the parameters for minimap2 for the direct RNA alignment

      Response*: We would encourage readers to view our MakeFile that has all of the commands and parameters used for the bioinformatic work reported here. *

      • For variant calling, I would use a minimum of 10x coverage to make a variant call instead of 5x. Besides looking well reproducible between all checks, I would be careful mainly with the single bp deletions with a such low threshold.

      Response: Read counts for the called variants were generally greater than 20. Moreover, we took these validations a step further and manually curated these variants using the data from multiple sequencing platforms used in this study to ensure high rigor in making these variant calls. We have further clarified this in the revised manuscript.

      • In some parts of the methods, the authors mentioned slight modifications in some protocols (for example, lines 443 and 454), besides well described in the text, could you highlight what were the modifications in the text? This will facilitate many other researchers to understand why those modifications were needed.

      Response: We have clarified these modifications in the revised manuscript. In short, these modifications consisted of: 1) For the HMW gDNA prep kit, an agitation speed of 1500 rpm was used as opposed to the recommended 2000 rpm due to limitations of our instruments. 2) A slow end over end mixing by hand was preferred over using a vertical rotating mixer as yield was consistently greater with this change. 3) For the RNeasy kit, the lysate was passed through a 20-gauge needle for homogenization of the sample. Instead of an on-column DNaseI treatment, the RNA was treated with DNaseI off of the column to promote complete DNA digestion. 4) A second elution from the RNeasy column was performed in order to improve yield.

      • As mentioned in the major, the data analysis method section needs rework to remove results from the text.

      Response: We have revised the manuscript accordingly.

      • The group mentioned that small contigs not mapping to Py17X were discarded. What are those? Repeats? Contamination?

      Response: These contigs were of mouse origin, as P. yoelii was grown in Swiss webster mice in this work. We have clarified this in the revised manuscript on Lines 183-184.

      Reviewer #1 (Significance (Required)):

      This work generated a strong method and resource for a better genome assessment of P. yoelii for the community. As I mentioned in my comments, some more details about the findings such as alternative splicing and lncRNAs may strengthen them even more the publication. I know that comparative analysis between Py17X and XNL is not in the scope here, but more information about it, such as a synteny plot would be great for the community to understand that they can rely on this new reference genome. I've been working with eukaryotic and prokaryotic genomes for more than a decade and I have a lot of experience with all the methods presented. I believe that potentially the depth generated for the ONT data may be one of the factors for not reaching the chromosomal level of this isolate, since HiFI was. The group did a great job on the method description, and I believe that the community will be very happy to incorporate this genome as one of the references for this organism.

      Response: We are thrilled that you value the data and the rigor of our approaches. We also believed that a direct comparison between 17X and 17XNL strains is critical. Because of this, we provided details of this comparison in Figures 5 and 6, as well as in supplemental files. Because our colleagues often use these strains interchangeably, it is important for our community to know what differences are present between the parental 17X and the cloned 17XNL line. While substantial identity exists between the 17X and 17XNL strains, there are many variants between them, including many that affect genes that are known to have essential functions for the parasite. For this reason and more, we believe the true 17XNL genome assembly will be a preferred reference once it is fully integrated into PlasmoDB.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The paper has three distinct parts, 1. Assembly of the P. yoelii yoelii 17XNL 2 Annotation of the genome and adding UTR regions 3. Comparing the sequence of 17XNL with 17X .

      Assembly: The authors present a novel assembly for the P. yoelii yoelii 17XNL genome. They used two different approaches, comparing Oxford Nanopore (ONT) long reads + Illumina DNA with PacBio Hifi. None of the approaches generated a telomer to telomer assembly so sequences from the 17X reference was used to fill in the mssing sequence.

      Response: Please also see the comment from Reviewer 1 and our response. The presence of many repeated elements in the subtelomeric regions leads to the challenges noted here about a telomere-to-telomere assembly, as well. The presence of these elements means that the sequences do not resolve into a single haplotype in an assembly due to conflicting information, not due to lack of coverage. Because of this, we have chosen to harmonize the selected haplotype at these subtelomeric regions with that of 17X, while still acknowledging and providing the complex data associated with the subtelomeric regions.

      Annotation Next, they generated long reads (ONT)and Illumina RNA-Seq to improve the annotation. Although, their annotation is not better than the current P. yoelii 17X reference genome in PlasmoDB, they could predict the UTR regions and alternative splice sites due to the 3' capturing approach and long reads. Having the UTR annotated and potentially having alternative splice sides is useful for the field.

      Response: We agree that the additional gene model annotations for both UTRs and alternative transcript isoforms is a valuable resource to our community. We are working with PlasmoDB currently to make these data readily accessible.

      17XNL - 17X comparison The author compared the 17XNL with the 17X reference. Both genomes were done with Pacbio, and it should be noted that P. yoelii has a GC content of probably ~23% with several homopolymer tracks. Further, the 17XNL genotype was obtained from a 17X culture, so the genomes are expected to be very similar as the author noted in the introduction. The authors found ~2000 differences; some are in genes, but many are indels, which very well could be sequencing errors. Finally, the authors claim that this genome could become relevant for the community as new reference to perform analysis. As their genome is so similar to 17X and they have to show that their annotation is at least as good as the current 17X reference genome (manual curated) and the difference are not due to sequence error in 17X or 17XNL.

      Response: As we describe below, we have taken multiple steps to inspect the quality of the 17X genome assembly (it is very robust), to call variants between strains, and to validate them using our data across multiple sequencing platforms and via manual curation. Because of this, we view these as true variants between the 17X and 17XNL genomes

      Major comments Overall I struggle to see the need for a "NEW" P. yoelii reference. It would be good to state how similar these genomes are - they are basically identical. As the 17XNL is curated manually, it would have made more sense to me to start from that one and then generate the UTR annotation and include splice sides. This could be easily loaded into an alternative Web-apollo track and then merged to the current annotation to be useful to the community.

      Response*: We chose to generate a new reference assembly for 17XNL because the current one is from 2002, remains in >5000 contigs, has gene identifiers that do not align with other current Plasmodium gene models (e.g., PY00204 vs. PY17X_0502200), and historically has had problematic gene models attributed to individual genes. This clean start ensures that users can know the provenance of the underlying data that created the genome assembly and gene models. *

      I wonder if many of the differences the authors found between 17X and the 17XNL reference are true. The authors are correct that some differences between 17X and 17XNL are true. I could not find any evidence of genome polishing with tools like Pilon or ICORN to correct sequencing errors, I wonder if these differences are sequencing errors.

      Response: The PacBio-based assembly received no error correction or polishing. It should be noted that all variants that were called automatically were also manually verified using data from multiple sequencing platforms generated in this study. Moreover, for coding sequences, we imposed a threshold that 80% of all reads at the variant’s location needed to support the variant in order to be considered true. Through these strict thresholds, we eliminated many potential variants that only had support from one sequencing platform. We highlight several variants that were confirmed through multiple datasets in Table 2.

      Did the authors look into the reads of the NCBI - GCA_900002385.2 - assembly? Maybe they could use the underlying Illumina reads if theirs don't have enough coverage. Also, the differences between 17X and 17XNL could be that the reference is wrong. How many pseudo genes did they obtain? Are there more or less than in the current reference?

      To confirm the calls, could you also map the 17XNL reads against the 17X reference and see if they are still true. As the same time, map the 17X illumina reads to see if the reference is correct at this state. When looking at the alignments, it can be seen that many different are in low complexity/repetitive regions.

      Response: We analyzed both their raw and assembled data to compare them with our results, and we determined that the 17X data and assembly were robust and that these difference likely reflect true variance between the strains. The 17X reference has 57 pseudogenes that are annotated as pir, fam-a/c, or others. Overall, there were 1057 pir genes annotated in the 17X genome, whereas we annotated 1048 for our Py17XNL genome. There were 302 fam-a/b genes annotated in the 17X genome, whereas we annotated 301 for our Py17XNL genome. As noted above, we confirmed variant calls using data from multiple sequencing platforms in this study as well as through manual curation.

      The authors sequence their genome with a HiFi Pacbio run and also ONG + DNASeq... but why did they not get 16 chomromes out? For example the current P. yoelii reference was assembled directly into far less pieces than theirs [P. chabaudi assembles into 16 pieces]. Could it be a different read depth or is it the fragment length? Could the authors please comment on that. Also, if there were contigs, why did they fill the sequence with 17X sequence, rather than keeping gaps? So in the end, their sequence is a hybrid, of 17X and 17XNL, right?

      Response: Please see our responses above to both Reviewer 1 and 2 regarding the heterogeneity of the subtelomeric regions that indicate that a single haplotype is not readily called. This is not due to insufficient read depth, but rather we believe it reflects something fascinating about Plasmodium genomes in these regions. A recent preprint (doi.org/10.1101/2023.02.02.526885) provides one possible interpretation for this observation.

      Why do you think you had less coverage of CCS read around the telomer ends? Do you think it is a systematic issue of the PacBio Hifi? Did you see any evidence of Illumina or ONT reads - or could it be that while culturing the telomer ends dropped off?

      Response: See our response above about the challenging nature of the subtelomeric regions of Plasmodium genomes. As above, this is not an issue of coverage per se, but rather of heterogeneous related sequences that are not readily resolved into a single haplotype. In order to minimize the risk of sequencing a genome of a mixture of heterogeneous parasites, we sequenced “Pass 0” parasites received directly from BEI Resources to ensure this genome reflects the established P. yoelii 17XNL clone.

      I realised that the authors used a lot of primary tools. I wonder why they chose that path, as there are several tools to do automatic finishing for long read assemblies: Assemblosis, ARAMIS, MpGAP or ILRA. Especially the last one focuses on Plasmodium genomes. Please comment.

      Response: We initially started our bioinformatic analyses using established tools such as these. Specifically, we first tried Companion and ILRA, but the results were not superior to those we achieved with the workflow we describe in this manuscript, which also provided greater parameter control.

      Also, for the annotation, could it not be better to transfer the manually curated genome annotation with LIFT off or RATT? All these tools are widely used in the generation of reference genomes in the parasitology field. I annotated their sequence with Companion, and although their gene models are good and some of the Companion calls might need improvement, overall, the Companion results look more exact to me.

      Response: Companion was the original tool we used for the generation of gene models. While we found that for a pre-package software platform it performed excellently, we found it to be insufficiently customizable and the results were not sufficiently accurate from our assessment. Additionally, lifting over information always raises the risk of imposing a different perspective on what is truly present. We believe that a high quality, de novo assembly is always preferable, and therefore chose this workflow.

      The code is very well organised, and it was easy to follow. Are you planning to put it on a GitHub repository?

      Response: We appreciate this recognition. We believe clear reporting of the bioinformatics work is critical for rigor and reproducibility. Yes, all of this will also be provided in GitHub to benefit the wider community.

      For the annotation in the attachment, there were two files. I had a look at them and they were quite different. As 17X and this genome are basically identical (Response: The two gff files represent either a Nanopore only or hybrid Nanopore+Illumina-based model. The latter produced a more comprehensive annotation of gene models, which is what we have proceeded with. However, we provided both in case end users find value in the Nanopore only annotation which has a 3’ bias due to the mechanism of how sequencing occurs via this approach.

      We have found meaningful variations in genome sequence that potentially impact biological function (see Discussion). Therefore, we maintain that these genomes are not basically identical and are useful to the malaria research community for these reasons and more.

      It is excellent that the genome is submitted to NCBI. Why are there 18k proteins? Are these the alternative spliced forms?

      Response*: We are not certain how this interpretation might have arisen, as we only have reported 7047 potential transcript isoforms to NCBI based upon our data. *

      Minor The current Py 17X genome in PlasmoDB is a Pacbio assembly (https://plasmodb.org/plasmo/app/record/dataset/TMPTX_pyoeyoelii17X), but not part of the 2014 paper. It was submitted later to NCBI than the paper the authors cite. Also, the current P. berghei Pacbio genome is from Fougère et al. PLoS Pathog 2016;12(11):e1005917.

      Response: We have now made a detailed note about the Py17X PacBio dataset in our revised manuscript on Lines 186-187. Mentions of the current P. berghei genome assembly had already cited the Foug’ere et al. publication.

      I tried to open the supplemental tables, but they were all in pdf rather than excel and split over several pages. Two had missing information, e.g. UTR per gene. From the name of the tables, I had an idea of what they should contain, but for a re-submission, it would be good to have them in the correct format.

      Response: We agree that provision of the PDFs of the supplemental files is not the ideal way to review these analyses. The complete data was also provided in the Excel files provided to Review Commons. We will ensure that the affiliate journal receives the Excel files for completion’s sake.

      To me, the beginning of the results reads a bit like an introduction (the part which sequencing technology to use)

      Response: We agree, and as noted to Reviewer 1 above, we have streamlined this section of the revised manuscript.

      Could you add to the tables: Sequence Coverage of the three technology, how many contigs you had before ordering the contigs and the number of pseudogenes in the annotation?

      Response: This information is now provided in Supplemental Table 3 in the revised manuscript.

      I struggle with the section header line 229-230 that the new sequence is more complete as it is a hybrid assembly with 17X. Alternatively, please explain how the consensus was built.

      Response: We agree and have revised this section header for accuracy.

      The authors correctly state that ONG is great, lines 333ff, but why does it not generate telomer-to-telomer chromosomes in this case? Please discusss.

      Response: Please see our response to this above for remarks made by both Reviewer 1 and 2. We have also added clarifying text in our revised manuscript discussing why this may have occurred.

      Reviewer #2 (Significance (Required)):

      General assessment As mentioned above, I struggle to see this as a strong leap for the malaria community to use this genome, as it is so similar to the current 17X genome, which is manually curated in plasmodb. Response: We agree that it is important to know how similar the genomes of 17X and the cloned 17XNL strain are. It is perhaps even more important to know what the key differences are as well. In this study, we have asked and answered these questions, and identified 2000+ variants between the strains. We have manually curated several of the variants that impact the expression of essential/important genes, and found that biologically meaningful differences exist (see Discussion). Finally, we have also provided additional information on the gene models of 17XNL, including an experimental definition of UTRs and transcript isoforms. Together, we hold that these data will not only match those currently available for 17X, but will exceed them. We are currently working with PlasmoDB to make these data readily accessible to our community.

      Advance The authors should make the comparison of ONT and PacBio HiFi clearer and discuss why the technologies still don't generate telomer-to-telomer sequences. From the biological side, none of the found differences were related to the different phenotype between 17X and 17XNL.

      Response: We have provided these comparisons and all related data to the reader in this manuscript, as well as through public depositories. Please see above for our responses as to why a true telomere-to-telomere assembly is challenging with Plasmodium parasites, and for a recent preprint that might provide an explanation for this. Finally, the phenotypic differences between 17X and 17XNL are variable, which might reflect differences in individual parasite stocks as has been historically seen in the spontaneous development of lethality in multiple laboratories. While we do not find any particular genetic difference correlates with a specific phenotype, these data using the cloned 17XNL parasite available from BEI provides a robust reference with a defined parasite stock.

      Audience: I do agree that adding the UTR sequence will be useful for those working with P. yoelii as a model, or who want to do comparative UTR analysis across species.

      Response: We agree that this additional gene model information will be valuable. We are working with PlasmoDB to make this information readily available and are already integrating it into our ongoing studies.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The paper has three distinct parts,

      1. Assembly of the P. yoelii yoelii 17XNL 2 Annotation of the genome and adding UTR regions
      2. Comparing the sequence of 17XNL with 17X .

      Assembly: The authors present a novel assembly for the P. yoelii yoelii 17XNL genome. They used two different approaches, comparing Oxford Nanopore (ONT) long reads + Illumina DNA with PacBio Hifi. None of the approaches generated a telomer to telomer assembly so sequences from the 17X reference was used to fill in the mssing sequence.

      Annotation Next, they generated long reads (ONT)and Illumina RNA-Seq to improve the annotation. Although, their annotation is not better than the current P. yoelii 17X reference genome in PlasmoDB, they could predict the UTR regions and alternative splice sites due to the 3' capturing approach and long reads. Having the UTR annotated and potentially having alternative splice sides is useful for the field.

      17XNL - 17X comparison The author compared the 17XNL with the 17X reference. Both genomes were done with Pacbio, and it should be noted that P. yoelii has a GC content of probably ~23% with several homopolymer tracks. Further, the 17XNL genotype was obtained from a 17X culture, so the genomes are expected to be very similar as the author noted in the introduction. The authors found ~2000 differences; some are in genes, but many are indels, which very well could be sequencing errors.

      Finally, the authors claim that this genome could become relevant for the community as new reference to perform analysis. As their genome is so similar to 17X and they have to show that their annotation is at least as good as the current 17X reference genome (manual curated) and the difference are not due to sequence error in 17X or 17XNL.

      Major comments

      Overall I struggle to see the need for a "NEW" P. yoelii reference. It would be good to state how similar these genomes are - they are basically identical. As the 17XNL is curated manually, it would have made more sense to me to start from that one and then generate the UTR annotation and include splice sides. This could be easily loaded into an alternative Web-apollo track and then merged to the current annotation to be useful to the community.

      I wonder if many of the differences the authors found between 17X and the 17XNL reference are true. The authors are correct that some differences between 17X and 17XNL are true. I could not find any evidence of genome polishing with tools like Pilon or ICORN to correct sequencing errors, I wonder if these differences are sequencing errors. Did the authors look into the reads of the NCBI - GCA_900002385.2 - assembly? Maybe they could use the underlying Illumina reads if theirs don't have enough coverage. Also, the differences between 17X and 17XNL could be that the reference is wrong. How many pseudo genes did they obtain? Are there more or less than in the current reference?

      To confirm the calls, could you also map the 17XNL reads against the 17X reference and see if they are still true. As the same time, map the 17X illumina reads to see if the reference is correct at this state. When looking at the alignments, it can be seen that many different are in low complexity/repetitive regions. The authors sequence their genome with a HiFi Pacbio run and also ONG + DNASeq... but why did they not get 16 chomromes out? For example the current P. yoelii reference was assembled directly into far less pieces than theirs [P. chabaudi assembles into 16 pieces]. Could it be a different read depth or is it the fragment length? Could the authors please comment on that. Also, if there were contigs, why did they fill the sequence with 17X sequence, rather than keeping gaps? So in the end, their sequence is a hybrid, of 17X and 17XNL, right?

      Why do you think you had less coverage of CCS read around the telomer ends? Do you think it is a systematic issue of the PacBio Hifi? Did you see any evidence of Illumina or ONT reads - or could it be that while culturing the telomer ends dropped off?

      I realised that the authors used a lot of primary tools. I wonder why they chose that path, as there are several tools to do automatic finishing for long read assemblies: Assemblosis, ARAMIS, MpGAP or ILRA. Especially the last one focuses on Plasmodium genomes. Please comment.

      Also, for the annotation, could it not be better to transfer the manually curated genome annotation with LIFT off or RATT? All these tools are widely used in the generation of reference genomes in the parasitology field. I annotated their sequence with Companion, and although their gene models are good and some of the Companion calls might need improvement, overall, the Companion results look more exact to me. The code is very well organised, and it was easy to follow. Are you planning to put it on a GitHub repository? For the annotation in the attachment, there were two files. I had a look at them and they were quite different.

      As 17X and this genome are basically identical (<2k variants), would it not be better to transfer the genes from the 17X genome and then add the UTR (see comment before)? The 17X is manually curated. Table 1 and figure 4 show that it is far better. I doubt that the community would use this genome, if the annotation is not lifted over.

      There are two gff files in the supplemental. Which one is better? It is excellent that the genome is submitted to NCBI. Why are there 18k proteins? Are these the alternative spliced forms?

      Minor

      The current Py 17X genome in PlasmoDB is a Pacbio assembly (https://plasmodb.org/plasmo/app/record/dataset/TMPTX_pyoeyoelii17X), but not part of the 2014 paper. It was submitted later to NCBI than the paper the authors cite. Also, the current P. berghei Pacbio genome is from Fougère et al. PLoS Pathog 2016;12(11):e1005917. I tried to open the supplemental tables, but they were all in pdf rather than excel and split over several pages. Two had missing information, e.g. UTR per gene. From the name of the tables, I had an idea of what they should contain, but for a re-submission, it would be good to have them in the correct format. To me, the beginning of the results reads a bit like an introduction (the part which sequencing technology to use) Could you add to the tables: Sequence Coverage of the three technology, how many contigs you had before ordering the contigs and the number of pseudogenes in the annotation? I struggle with the section header line 229-230 that the new sequence is more complete as it is a hybrid assembly with 17X. Alternatively, please explain how the consensus was built. The authors correctly state that ONG is great, lines 333ff, but why does it not generate telomer-to-telomer chromosomes in this case? Please discusss.

      Significance

      General assessment As mentioned above, I struggle to see this as a strong leap for the malaria community to use this genome, as it is so similar to the current 17X genome, which is manually curated in plasmodb.

      Advance The authors should make the comparison of ONT and PacBio HiFi clearer and discuss why the technologies still don't generate telomer-to-telomer sequences. From the biological side, none of the found differences were related to the different phenotype between 17X and 17XNL.

      Audience: I do agree that adding the UTR sequence will be useful for those working with P. yoelii as a model, or who want to do comparative UTR analysis across species.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript entitled "Long-Read Genome Assembly and Gene Model annotation for the Rodent Malaria Parasite P. yoelii 17XNL" is a well-written manuscript providing updates and important observations about the genome assembly and annotation of this specific non-lethal isolate. The group overall did a great job showing how the application of newer technologies such as long-read DNA and direct RNA sequencing to generate top-quality genomes to be used as a reference for the community. Here are some comments about the work presented:

      Major comments:

      • The authors added several result information across the methods section. Making the text repetitive, since the same is also presented in the results section. Please revise the method section to remove results from this section.
      • Some methods are also redundant in the Result section. For example, in line 141-142, the group describe which DNA extraction kit they used (again this is correctly mentioned in the methods section).
      • Besides important, the group added several information about method comparison between base call accuracy and sequencing methods. I agree that having this information in the supplemental material is great, but I would be careful to not focus too much on those, since most of the observations are already well-known by the community and focus more in the biological relevance of what is being generated with the newly updated genome.
      • The group did a great job generating two versions of the genome, and an updated gene annotation set using long-read sequencing. But the major question is, how about alternative splicing? They mention the use of it (line 350) but I don't see any result about how many alternative transcripts were observed, and if they were differentially detected in different life stages of the sets used for the RNA sequencing. This is a very important result to be added since one of the key pieces of information that long-read RNA sequencing brings for Genome annotation.
      • Same observation as above for potential long ncRNAs.
      • From what I understand the Hifi run was able to generate a gapless genome assembly and the ONT run did not. What was the final coverage for each? From my experience with P. falciparum genomes, ONT even with the rapid kit was able to generate chromosomal level assemblies if the coverage was >100x (but again, this is not a rule). Add those valuable observations about the depth so the reader can check if other variables in the comparison should be made.
      • Also be sure that the structural comparisons between the genomes are not the ones used after running ragtag.py. If so, there is a high chance of structural bias in the scaffolded contigs.
      • How Prokka differed from Braker2 for the Mitochondria/API annotation? This needs to be very well described since prokka is made for prokaryotic organisms and not for eukaryotic ones. And Braker2 uses a custom build dataset for training, which I believe contains known information about MIT/API for Plasmodium species.
      • Figure 5B, what is the peak observed in the mitochondria? What genes? Repeats?

      Minor comments:

      • For Oxford nanopore sequencing using the ligation kit, did the group check for potential chimeric reads generated by the protocol?
      • Check if all species are italicized (for example, line 187 P. yoelii is not)
      • In methods add the parameters for minimap2 for the direct RNA alignment
      • For variant calling, I would use a minimum of 10x coverage to make a variant call instead of 5x. Besides looking well reproducible between all checks, I would be careful mainly with the single bp deletions with a such low threshold.
      • In some parts of the methods, the authors mentioned slight modifications in some protocols (for example, lines 443 and 454), besides well described in the text, could you highlight what were the modifications in the text? This will facilitate many other researchers to understand why those modifications were needed.
      • As mentioned in the major, the data analysis method section needs rework to remove results from the text.
      • The group mentioned that small contigs not mapping to Py17X were discarded. What are those? Repeats? Contamination?

      Significance

      This work generated a strong method and resource for a better genome assessment of P. yoelii for the community. As I mentioned in my comments, some more details about the findings such as alternative splicing and lncRNAs may strengthen them even more the publication. I know that comparative analysis between Py17X and XNL is not in the scope here, but more information about it, such as a synteny plot would be great for the community to understand that they can rely on this new reference genome.

      I've been working with eukaryotic and prokaryotic genomes for more than a decade and I have a lot of experience with all the methods presented. I believe that potentially the depth generated for the ONT data may be one of the factors for not reaching the chromosomal level of this isolate, since HiFI was. The group did a great job on the method description, and I believe that the community will be very happy to incorporate this genome as one of the references for this organism.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Banerji and colleagues measure DUX4 and target gene expression over a time course in doxycycline-inducible myoblasts to estimate kinetic parameters and rates underlying the transition of non-expressing cells through DUX4-expressing cells to cell death. They then use these parameters to model the rate of appearance of DUX4+ cells, DUX4 target gene expression, etc. in cells from FSHD patients, and derive a model that predicts that over 100 days around one fourth of cells die while less than 1% of cells express DUX4 or its target genes at any given time. This is somewhat similar to what is seen in FSHD patients, where DUX4 expression is infrequent in cultured cells, while patients eventually have substantial muscle loss. The experiments are well-designed and explained clearly.

      We thank the reviewer for their kind comments on our manuscript and for acknowledging the similarity between our model simulation and both cell biological and clinical features of FSHD.

      Reviewer #1 (Significance (Required)):

      The primary significance of this study is that the field has a sense that the damage seen in patient muscle is not congruent with the low expression of DUX4 in patients, and the model showing many cells dying with only a few cells expressing DUX4 at any given time suggests that overall damage can be greater than that observed in any particular snapshot.

      However, it is important not to conflate low frequencies of DUX4+ nuclei in cultured myoblasts with "DUX4 being difficult to detect" as in p 12, Discussion. DUX4 is difficult to detect, indeed basically not detected, in muscle biopsy specimens, but in cells in vitro, DUX4 is fairly easy to detect, albeit in quite low numbers of cells. Since the study evaluates cells in vitro, it is important to make clear that the situation in vivo is qualitatively different from that seen in vitro, namely DUX4 not being detected, and the authors should clarify this importance difference.

      We appreciate this important point that DUX4 detection is extremely challenging in FSHD patient muscle biopsies, compared to in vitro cell culture of FSHD myoblasts and myotubes, a topic we considered at length in our recent review (Banerji and Zammit 2021, https://doi.org/10.15252/emmm.202013695).

      Detection of DUX4 mRNA in muscle biopsies is highly variable requiring nested RT-qPCR, and protein detection is even less robust, though this has been achieved via western blot in less affected FSHD muscle (Tassin et al., 2013, DOI: 10.1111/j.1582-4934.2012.01647.x) and using a proximity ligation assay (Beermann et al. 2022, doi: 10.1186/s13104-022-06054-8). DUX4 target gene expression is detected in inflamed FSHD muscle but less robustly in non-inflamed muscle, indicating the recent presence of DUX4 protein, and also implying that a systemic component may activate DUX4 expression in vivo.

      Conversely in cell culture of FSHD muscle cells, DUX4 mRNA is typically found in 0.5-3.8% of myonuclei (van den Heuvel et al., 2019, https://doi.org/10.1093/hmg/ddy400) and protein in around 1/1000 myonuclei (Snider et al., 2010, https://doi.org/10.1371/journal.pgen.1001181). Arguably these levels are still very low and DUX4 is still ‘difficult to detect’ in vitro, for example DUX4 expression is never seen above the limit of detection in bulk RNA-seq of FSHD patient cultured myoblasts. However, we fully appreciate that DUX4 is ‘easier to detect’ in vitro versus in vivo.

      Regardless, anti-DUX4 therapy is currently the most heavily funded approach to FSHD treatment, and all anti-DUX4 therapies currently under consideration were first investigated in the myoblast in vitro setting. Thus, the aim of our model is to provide an additional level of in silico screening for anti-DUX4 therapy, before progressing to in vitro investigation.

      Full consideration of DUX4 expression in vivo (while an exciting prospect), would require significantly more data than is currently available (relating to inflammation, vascularity and other systemic factors) and a highly complex model which is beyond the remit of this investigation.

      We will clarify in the manuscript that our model applies in vitro, highlighting differences with in vivo and emphasising that the model is limited for understanding DUX4 expression in FSHD muscle biopsies.

      We will also change the title to emphasise this point to: ‘In silico FSHD muscle cell culture for modelling DUX4 dynamics and predicting the impact of therapy’.

      A second reason for caution in extrapolating correlates from the in vitro model to the disease process in muscle tissue is that in vivo there is a continual source of replacement cells, as the authors have shown in a previous study. Have the authors attempted to model a situation in which new cells are provided into the system at some rate, related to the amount of death occurring at different times? Although the authors mention that the static cell number is a limitation of the model, it would be valuable to revisit or explore this idea in the Discussion section, if only to provide the reader with a more pragmatic perspective.

      We are focused specifically on modelling the in vitro differentiated myogenic cell setting to provide an in silico pre-screening tool for assessing anti-DUX4 therapy, rather than attempting to model the full pathology in vivo, which given data limitations, is beyond the scope of our study. As the reviewer notes, we highlight this limitation relating to proliferation when we introduce the model in the results stating: ‘Cells are assumed not to proliferate over the evolution of the model. We restrict applications to differentiating cells which have exited the cell cycle.’

      As the reviewer likely appreciates, DUX4 expression in proliferating cells differs significantly from differentiated cells. The single nuclear and single cell RNA-seq data we employ to derive the parameters underlying DUX4 and DUX4 target transcription rates are from non-proliferating myocytes differentiated for 3 days. Hence it is not appropriate to include proliferation in this model, as the transcription rates we use will not be accurate for proliferating cells.

      Introducing proliferation will also require us to estimate the proliferation rate of FSHD myoblasts, and how it is impacted by DUX4 expression, as well as how DUX4/target transcription rates change as the proliferating cells differentiate. Though this is an interesting application there is not sufficient data available to produce this wider scale model at present.

      We thus restrict application of our model to the non-proliferating differentiated setting, which can be easily accessed in vitro to screen anti-DUX4 therapy.

      We appreciate the observation that in vivo, there will be addition of new cells during muscle regeneration, and will include this in discussion in the updated manuscript. We will also expand on our discussion of what data would be required to include proliferation in our model in the revised manuscript.

      The second part of the paper models presence of DUX4 in nuclei based on diffusion from expressing to non-expressing nuclei, and characterizes this as the activity of "an infectious agent, able to spread from one nucleus to another by adapting epidemiological compartment models". The relationship to an infection process is probably not the ideal way to characterize this process, because an infection implies the setting up of new sites of production of the agent, DUX4, where what is really happening is that DUX4 diffusing into these other nuclei isn't leading to more DUX4 production, it is just diffusing into nearby nuclei and accumulating there. Unless I am misunderstanding, the authors are simply showing that a larger number of nuclei will be positive in a system in which cells are fusion products having many nuclei than in a system in which all nuclei are isolated within their own cells.

      The term ‘infectious agent’ is only an analogy and implies some preconceptions. The reviewer interprets our infectious agent model as: ‘an infection implies the setting up of new sites of production of the agent, DUX4, where what is really happening is that DUX4 diffusing into these other nuclei isn't leading to more DUX4 production, it is just diffusing into nearby nuclei and accumulating there. Our bespoke model is not based on a direct mapping of e.g., viral infection to our setting. In our case, the ‘infectious agent’ DUX4 causes harm but does not replicate. DUX4 protein is a transcription factor and thus activates the expression of target genes (not including DUX4). In our model, DUX4 can be seen as the ‘infectious agent’, and expression of DUX4 target genes can be seen as the ‘infection’, which leads to cell death. DUX4 can either stay in the ‘infected’ cell until it dies or diffuse to another cell to spread the ‘infection’.

      The reviewer interprets the results of our model as ‘simply showing that a larger number of nuclei will be [DUX4] positive in a system in which cells are fusion products having many nuclei than in a system in which all nuclei are isolated within their own cells’.

      In fact, we make several observations: firstly we compare single cell RNA-seq of unfused myocytes to single nuclear RNA-seq of fused muti-nucleated myotubes and find that the latter has a greater proportion of cells expressing DUX4 target genes (i.e. more infection). The proportion of DUX4 positive cells (i.e. the amount of infectious agent produced) is similar in the two settings. We posit that this difference in DUX4 target gene positive cells (infection) may be due to DUX4 protein diffusing between cells in the myotube syncytium and activating the targets in neighbouring nuclei (i.e., greater mobility of the infectious agent/loss of quarantine). Note that there are many other possibilities, such as fusion causing an increase in DUX4 transcription/mRNA stability etc.

      We find that by introducing a DUX4 protein diffusion term (loss of quarantine) into our model we can completely explain the difference between DUX4 target gene expression (infection) in real data of unfused versus fused myonuclei, despite identical levels of DUX4 (infectious agent). This is a novel finding providing evidence for DUX4 protein diffusion in syncytial myonuclei, which represents an often overlooked therapeutic target/consideration in FSHD. We also provide the first explicit quantification of this diffusion rate via our model as well as a framework for investigators to understand how modifying this parameter can impact DUX4 induced myotoxicity.

      We will better define our ‘infectious agent’ analogy and clarify our interpretation in the updated manuscript.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      An in silico FSHD muscle fibre for modelling DUX4 dynamics

      Summary

      This paper studies and mathematically models the stochastic process of presence or absence of DUX4 expression in individual myocytes in FSHD, which underlies the very small proportion of individual cells which do express DUX4. The paper is valuable in providing a mathematical basis for modelling this, and hence a basis by which to study the effects of other factors or potential therapeutic interventions which may influence the overall proportion of cells which do express.

      We thank the reviewer for the kind comments on our manuscript and recognition of its value to design/screening of potential therapeutics for FSHD.

      To understand the paper fully, requires a familiarity with mathematical and statistical reasoning which will be beyond many potential readers, including this reviewer, but I hope that the following specific comments may still be helpful.

      We appreciate the reviewer’s candour regarding their understanding of the more advanced mathematical aspects the paper. Interdisciplinary work such as ours may introduce concepts which are unfamiliar to some readers.

      As the reviewer will appreciate, understanding a complex process like DUX4 expression requires new and more sophisticated approaches, having largely eluded the conventional approaches to date. The main mathematical tools employed in our work derive from the well-established stochastic gene expression and epidemiological compartment models. We have endeavoured to make the mathematics self-contained to facilitate understanding and will edit to further improve accessibility.

      Major Comments

      1. A potential major concern is that the modelling seems to be based largely on combined data from 27 DUX-4 positive myocytes out of 5133 myocytes from 4 FSHD patients described by Van Den Heuvel et al, 2019 (ref 17), but with 2 being FSHD1 and 2 FSHD2, and without the 2 patients within each FSHD type being matched for D4Z4 fragment length (RU = 'residual units'), which can be expected to be a major influencing factor on the threshold for expression in any one myocyte upon which the stochastic process acts. Thus, one can expect lower RU number to show a greater proportion of expressing cells within FSHD1, and to some extent similarly within FSHD2 (although in FSHD2, different SMCHD1 mutations will also have different 'strengths'). The 4 patients were : 2x FSHD1 (3RU ; 6RU); 2x FSHD2 (12RU ; 18 RU). In the paper of Den Heuvel et al it is evident that the DUX4-positive cell count differs between these 4 cell lines very much as might be anticipated from their D4Z4 RU number. Thus (Figure 2 in that paper) patient 1.1 (3RU) has 12 positive cells, whereas patient 1.2 (6RU) has only 2 positive cells. Patient 2.1 (SMCHD1 exon 37 mutation, and 12 RU) has 11 positive cells, whereas Patient 2.2 (SMCHD1 exon 10 mutation, and 18 RU) has only 2 positive cells. Therefore, if the validity and accuracy of the modelling here would be affected by genetic heterogeneity, the authors should present their calculations and analyses based only on the 2 patients who account for 23/27 of the positive cells, and furthermore, that the calculations and modelling are performed and presented for those 2 patients separately.

      The reviewer raises the important point that 2/5 of the parameters of our model were derived from the single cell RNA-seq data set of van den Heuvel et al., which comprises 4 FSHD patients of various genotype. The reviewer remarks that the number of DUX4 positive cells reported for each patient in the van den Heuvel data, differs according to genotype, in line with the known inverse association between DUX4 expression and D4Z4 short allele length. Figure 2E in van den Heuvel et al., to which the reviewer refers, does not present absolute DUX4+ cell counts, but rather ‘DUX4 affected’ cell counts, based on the expression of 67 DUX4 target genes. The numbers in that figure thus differ from ours. We caution that the number of ‘DUX4 affected’ cell counts must be normalised by the total number of cells assayed per patient, to obtain a ‘DUX4 affected’ proportion for each patient. However, we appreciate the reviewers point.

      A concern is raised that we have pooled all 4 FSHD patients to derive our parameter estimates, essentially averaging over genotypes. The two parameters we derived from this data are ‘the average DUX4 transcription rate, and ‘the average DUX4 target gene transcription rate.

      The average DUX4 target gene transcription rate was derived from consideration of DUX4 target gene expression in the 27 FSHD cells already expressing DUX4 mRNA. Since the capacity of DUX4 to activate its target genes is not known to depend on genotype, we feel it is appropriate to pool the patients to estimate this parameter.

      For the average DUX4 transcription rate however, we do appreciate the reviewer’s concern that patient genotype may impact the estimate. The reason for pooling all patients is partly statistical. As there are so few cells expressing DUX4 in each patient, the gradient descent algorithm we employed to estimate the 3 rate parameters for the promoter switching model of DUX4, may fail to converge for every patient separately. By pooling patients, we obtained an estimate that may not be true for an individual but represented the ‘average’ transcription rate of DUX4 in these 4 FSHD patients, hence our careful use of wording when defining the average DUX4 transcription rate parameter.

      Our in silico model of DUX4 expression is proposed as a pre- in vitro screening tool to guide anti-DUX4 therapy for the general population, not a digital twin of a single FSHD patient, and so an average DUX4 transcription rate derived from pooling available data is optimal.

      This average measure is not irrelevant in light of genetic variation and in fact may be more informative for anti-DUX4 therapeutics intended for a general population, but less informative for genotype stratified therapeutic design. Genotypic stratification by D4Z4 repeat length was not performed in recent FSHD clinical trials for anti-DUX4 therapy (e.g., losmapimod: NCT04003974), which recruited patients with all pathogenic D4Z4 repeat lengths, motivating an average over genotype design in the first instance.

      We will elaborate in detail on the reasons for patient pooling throughout the manuscript.

      We will attempt the analysis the reviewer suggests i.e. ‘the authors should present their calculations and analyses based only on the 2 patients who account for 23/27 of the positive cells…separately’. However, this is conditional on algorithm convergence given the smaller number of cells, and we must caveat that in doing so we will have eliminated 2 patients purely on the basis of low DUX4 expression and so will over-estimate the average DUX4 transcription rate for FSHD patients in general.

      In order to be of value for assessing potential interventions more widely in FSHD, the authors would then need, in further publications, to extend their analysis similarly to genetically homogeneous myocyte sets with other RU number.

      We agree with the reviewer that for genotypically stratified therapeutic design, based on D4Z4 short allele length, personalised or genotype specific estimates of the DUX4 transcription rate should be calculated. However, as the reviewer clearly appreciates, developing such FSHD digital twins, though exciting, would require a much larger library of single cell RNA-seq datasets describing FSHD patients of various genotypes than is currently available.

      We will explore this in an updated discussion.

      Specific points.

      Introduction 4th paragraph: - 'Single cell and single nuclear transcriptomic studies find only 0.5-3.8% of in vitro differentiated FSHD myonuclei express DUX4 transcript16,17. Immunolabelling studies only detect DUX4 protein in between 0.1-5% of FSHD myonuclei18,19.' The authors should comment whether there is any evidence from the data in these references, or from other publications, regarding differences in these proportions by FSHD diagnosis (I or II) or by D4Z4 residual number?.

      We will expand discussion in the updated manuscript of the result (explained by the reviewer) that the number of DUX4 affected cells found in the single cell RNA-seq dataset of van den Heuvel may correlate with genotype. We will contrast this with the observation that immortalised isogenic FSHD myoblast clones isolated from a single FSHD patient can also have a very wide range of DUX4 expression (e.g., Krom et al., doi: 10.1016/j.ajpath.2012.07.007). This will highlight the mix of poorly understood genetic and epigenetic factors impacting DUX4 expression and further motivate an average model in the first instance.

      Introduction 5th paragraph: - Importantly, a recent phase 2b clinical trial of the DUX4 inhibitor losmapimod failed to reach its primary endpoint of reduced DUX4 target gene expression in patient muscle, despite improvement in functional outcomes23. Please state here whether or not there was any evidence that DUX4 expression itself was reduced in this trial. It would help if the authors could also add here an interpretive comment as to whether this indicates that the current presumed target genes for DUX4 are not in fact the ones important for FSHD, or whether their expression might be retained from compensatory upregulation by other upstream regulators. The authors should expand briefly also in the introduction on the evidence for toxicity of target gene expression.

      We are very happy to include a discussion of these points, which we explore in considerable detail in our recent review of DUX4 in FSHD (Banerji and Zammit 2021, https://doi.org/10.15252/emmm.202013695). Briefly, the losmapimod trial did not publish data showing they measured DUX4, as Reviewer #1 pointed out DUX4 is highly difficult to detect in patient muscle biopsies and dynamic change following anti-DUX4 therapy has certainly never been observed. Expression of four DUX4 target genes was intended as a surrogate measure of DUX4 activity, reasons for its lack of change in this trial is very much a topic of open debate, which we will outline in an updated manuscript.

      Results 2nd paragraph: - We first describe the compartment model. FSHD single myocytes can express DUX4 and therefore DUX4 target genes; DUX4 target gene expression leads to cell death19,27,28. Please indicate whether the evidence in these studies is independent of DUX4. Ie. Is there independent evidence that it is definitely the target gene expression, rather than DUX4 expression per se, that leads to cell death, especially if losmapimod improves function by inhibiting DUX4, but has no impact on these target genes.

      This is an important point raised by the reviewer and one that we have rigorously investigated (Knopp et al., 2016, https://doi.org/10.1242/jcs.180372).

      The c-terminus of DUX4 is a potent transcriptional activator and is required for DUX4 target gene activation, while an inverted centromeric D4Z4 repeat unit encodes a version of DUX4 lacking the c-terminus, named DUX4c. We constructed a library of DUX4 expression constructs encoding: DUX4, DUX4c, tMALDUX4 (DUX4 with the c-terminus removed), DUX4-VP16 (DUX4 with the c-terminus replaced by the VP16 transactivation domain) and DUX4-ERD (DUX4 with the c-terminus replaced by the engrailed repressor domain). In a series of experiments outlined in Knopp et al., we clearly demonstrated that only DUX4 and DUX4-VP16 could activate DUX4 targets in C2C12 murine myoblasts and that only these constructs could induce apoptosis. Our prior work provides this clear link between DUX4 target gene expression and cell death. We will include discussion of this point in the updated manuscript.

      Results 2nd paragraph Item 4 : - 𝑅(𝑡) - a resigned state where the cell expresses no DUX4 mRNA but does express DUX4 target mRNA (DUX4 -ve/Target gene +ve: i.e. a historically DUX4 mRNA expressing cell) Since the mRNA is from the target genes, why should it be produced only in response to DUX4 expression ? ie. Please indicate the evidence to say that these must be 'historically DUX4 mRNA expressing cells', rather than target gene expression in response to other factors, or even autonomously.

      The reviewer raises the point that the 8 DUX4 target genes we investigate may be expressed in a DUX4 independent manner, making DUX4 target gene +ve, DUX4 -ve cells, potentially not historic DUX4 expressing cells. We selected these 8 genes as they are confirmed DUX4 targets by ChIP-seq and have been identified as upregulated by DUX4 in every transcriptomic analysis of DUX4 over-expressing human myoblasts (Banerji and Zammit 2021, https://doi.org/10.15252/emmm.202013695). We provide further evidence for these genes indicating historic DUX4 in these cells: first, we never find a single transcript for any of these 8 target genes in 1914 single myocytes and 77 single nuclei from control individuals, suggesting that their expression requires an FSHD genotype (and thus likely DUX4 expression). Second, our investigation of these genes in the single cell RNA-seq data set of van den Heuvel demonstrated that in the presence of DUX4, expression of all 8 genes significantly increase (Figure 3D), indicating activation by DUX4.

      While this is evidence that the 8 targets are specific to DUX4, we accept that it is not 100% conclusive and these genes may also be induced by some other factor related to the FSHD genotype. We will thus highlight this possibility of other modes of expression in the discussion.

      Results - Estimating the kinetics of DUX4 mRNA - 2nd paragraph: - DUX4 expression was induced with 250 ng/ml doxycycline for 7 hours .... Might some of the laboratory detail here be better placed in the 'Methods' section ?

      We will move some methodological detail to the methods as suggested.

      Results - Estimating the kinetics of DUX4 mRNA - 4th paragraph: - '...from 4 FSHD patients (2 FSHD1 and 2 FSHD2).' Please give additional information about these patients - ie. Age, sex, severity (or age-onset), and genetic results - perhaps best done as a Table in this paper rather than only by reference back to the Van den Heuvel et al. paper (see main comment 1 above).

      We will provide this information in a table as the reviewer suggests.

      Results - Estimating kinetics of DUX4 target activation - 2nd paragraph: - '8 DUX4 target genes......expression was restricted to FSHD cells/nuclei and never observed in controls.' So are these genes normally only expressed in the zygote , rather than post-birth (except perhaps the testis)? The authors should comment on this.

      The 8 DUX4 target genes are not well characterised in terms of their expression pattern in other tissues. We are confident that in our data sets they are not expressed in healthy myocytes and myotubes, but it is difficult to expand confidently on other tissues due to lack of data. We will include comment on what is known about their expression pattern during zygotic genome activation and in testicular tissue, but this cannot be an exhaustive description of their expression. For example, DUX4 has been detected in keratinocytes, osteoblasts and lymphocytes, but the target genes have not been characterised in such settings. We still have much to learn about the expression of these genes outside of the muscle setting.

      Results - Estimating kinetics of DUX4 target activation - 4nd paragraph: - In the presence of DUX4 mRNA the proportion of time the promoters of the 8 DUX4 target genes remained in the active state,....significantly increased. It would be interesting to know if any of these temporal dynamic descriptors of DUX4 target promoters differ consistently between sample II-2 and II-1 and in the same direction between I-2 and I-1. ie. Might the same factors (eg. D4Z4 copy number) which may affect presence/absence of DUX4 also affect other cellular measures of DUX 4 ?

      The reviewer raises an interesting point about genetic modifiers of DUX4 transcriptional activation. As discussed in response to point 1, the DUX4 target gene transcription rate is derived from the 27 cells expressing DUX4. As there are so few cells expressing DUX4 in each patient (sometimes We will attempt analysis of the two patients which provide the majority of DUX4 positive cells separately, as the reviewer requested in point 1. If successful, we will investigate whether the derived DUX4 target gene expression parameters differ between these two patients as the reviewer suggests. While this limited data will not permit anything definitive about impact of D4Z4 repeat length on DUX4 target gene expression, it may highlight the existence of inter-individual differences in such parameters.

      Results - Compartment model simulation - 4th paragraph: - '...so that after 10 days 26.3% of cells had died.' The authors need to give data here also for controls. Ie. What proportion of cells die after 10 days in controls ?

      As mentioned in the introduction of our model, we only model DUX4 dependent cell death. As control cells do not express DUX4 they cannot experience cell death by this mechanism. The reviewer can therefore interpret this result as excess death due to DUX4, i.e., the 26.3% of FSHD cells die which would not have died in control cells. We will clarify this point in an updated manuscript.

      Discussion - 1st paragraph: - ' However, DUX4 expression in FSHD muscle demonstrates a complex dynamic with DUX4 mRNA, protein and target gene accumulation all difficult to detect2,21. Understanding this complex dynamic is essential to the construction of optimal therapy' So, it presumably follows that comparison by known genetic or demographic modifiers of disease severity (such as D4Z4 copy number) could be of fundamental importance in interpreting this dynamic and hence the results of clinical trials) (see Main point 1, and point 7).

      This point appears to generally be a reiteration of the reviewer’s initial concerns on genotypic variation in the van den Heuvel et al., data set. We have addressed these concerns in response to points 1, 2 and 9.

      Discussion - 6th paragraph: - 'Our model predicts

      We will update the manuscript to amend to ‘DUX4 target gene mRNA positive’. The reviewer again raises the concern of genotypic variability, we will of course discuss this and perform additional analysis as detailed above (points 1, 2, 9 and 11).

      Minor comments

      Methods - scRNAseq and snRNAseq data - 2nd paragraph: - '..2 sperate patients...' Typo. to correct.

      We thank the reviewer and will address this typo.

      Methods - Hypothetical scenarios for raising 𝑬[𝒎] under the promoter-switching model- 1st paragraph: - '...constant in the second...' needs punctuation.

      We thank the reviewer and will address this typo.

      Methods - Cellular Automaton Model - 3rd paragraph: - '...according the non-syncytial...' Typo : '...according to...'

      We thank the reviewer and will address this typo.

      Methods - Genetic algorithms - 3rd paragraph: - '...elitism of 5%, mutation probability 0.1, crossover probability 0.8,...' Should these parameters be given in the same format to avoid any confusion - ie. all as probability, or all as percentages ?

      We thank the reviewer and will change all parameters and probabilities.

      Reviewer #2 (Significance (Required)):

      Please see comments in the 'Evidence, reproducibility and clarity' box above.

      This paper is valuable in providing a mathematical basis for modelling the stochastic process of presence or absence of DUX4 expression in individual myocytes in FSHD (facioscapulohumeral muscular dystrophy), and hence a basis by which to study the effects of other factors or potential therapeutic interventions which may influence the overall proportion of muscle cells which do express DUX4, and hence succumb to its toxicity.

      This is a specialist field and the nature of presentation of the mathematical modelling in the paper will restrict accessibility to only a very few researchers in this field.

      We appreciate that introducing concepts from different fields such as mathematics can present a challenge to some readers. However, new methods and interdisciplinary science are essential to understand complex disorders and this is even more so in complex rare diseases such as FSHD, where diversity in expertise is important. ‘Stochastic’ has been used to describe DUX4’s expression pattern for many years and is commonly used in many FSHD papers and conferences. We have introduced concepts from the well established field of ‘stochastic gene expression’ to understand DUX4 expression in FSHD. The methods are different from conventional approaches used in FSHD, but are arguably the most natural framework in which to understand DUX4.

      We have provided user-friendly programs that can be used to estimate the effects on DUX4 parameters of multiple variables to make the paper useful, even if some of the more advanced mathematics is challenging. We will also further edit to increase accessibility.

      There appears to be a possible major problem in the way that the paper has combined data from patients with different genetic forms of FSHD, and different likely genetic severities. It would seem better to analyse the data separately for each of these to allow a more homogenous platform on which to construct a model.

      That we pooled data from 4 FSHD patients, to derive estimates of 2 of the 5 parameters of our model is the major (non-editorial) comment about our study, and is raised in various versions in points 1, 2, 9, 11 and 12 of reviewer 2’s response. We have explained above that the reason for pooling is partly statistical, due to dataset size limitation. Considering each patient separately may prevent convergence of a gradient descent algorithm for parameter estimation. We again emphasise that pooling 4 FSHD patients, while less personalised, does not make our estimate of the average DUX4 transcription rate in FSHD patients invalid. It is simply an average level across our 4 patients, perhaps higher than for some patients but lower than for others.

      As commented, we will repeat the analysis separately for the 2 patients who have larger numbers of DUX4 positive cells and report the findings, with the caveat that these estimates will, by definition, be over-estimates of the true value of the average DUX4 transcription rate for the FSHD population.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      An in silico FSHD muscle fibre for modelling DUX4 dynamics

      Summary

      This paper studies and mathematically models the stochastic process of presence or absence of DUX4 expression in individual myocytes in FSHD, which underlies the very small proportion of individual cells which do express DUX4. The paper is valuable in providing a mathematical basis for modelling this, and hence a basis by which to study the effects of other factors or potential therapeutic interventions which may influence the overall proportion of cells which do express. To understand the paper fully, requires a familiarity with mathematical and statistical reasoning which will be beyond many potential readers, including this reviewer, but I hope that the following specific comments may still be helpful.

      Major Comments

      1. A potential major concern is that the modelling seems to be based largely on combined data from 27 DUX-4 positive myocytes out of 5133 myocytes from 4 FSHD patients described by Van Den Heuvel et al, 2019 (ref 17), but with 2 being FSHD1 and 2 FSHD2, and without the 2 patients within each FSHD type being matched for D4Z4 fragment length (RU = 'residual units'), which can be expected to be a major influencing factor on the threshold for expression in any one myocyte upon which the stochastic process acts. Thus, one can expect lower RU number to show a greater proportion of expressing cells within FSHD1, and to some extent similarly within FSHD2 (although in FSHD2, different SMCHD1 mutations will also have different 'strengths'). The 4 patients were : 2x FSHD1 (3RU ; 6RU); 2x FSHD2 (12RU ; 18 RU). In the paper of Den Heuvel et al it is evident that the DUX4-positive cell count differs between these 4 cell lines very much as might be anticipated from their D4Z4 RU number. Thus (Figure 2 in that paper) patient 1.1 (3RU) has 12 positive cells, whereas patient 1.2 (6RU) has only 2 positive cells. Patient 2.1 (SMCHD1 exon 37 mutation, and 12 RU) has 11 positive cells, whereas Patient 2.2 (SMCHD1 exon 10 mutation, and 18 RU) has only 2 positive cells. Therefore, if the validity and accuracy of the modelling here would be affected by genetic heterogeneity, the authors should present their calculations and analyses based only on the 2 patients who account for 23/27 of the positive cells, and furthermore, that the calculations and modelling are performed and presented for those 2 patients separately. In order to be of value for assessing potential interventions more widely in FSHD, the authors would then need, in further publications, to extend their analysis similarly to genetically homogeneous myocyte sets with other RU number.

      Specific points.

      1. Introduction 4th paragraph: - 'Single cell and single nuclear transcriptomic studies find only 0.5-3.8% of in vitro differentiated FSHD myonuclei express DUX4 transcript16,17. Immunolabelling studies only detect DUX4 protein in between 0.1-5% of FSHD myonuclei18,19.' The authors should comment whether there is any evidence from the data in these references, or from other publications, regarding differences in these proportions by FSHD diagnosis (I or II) or by D4Z4 residual number?.
      2. Introduction 5th paragraph: - Importantly, a recent phase 2b clinical trial of the DUX4 inhibitor losmapimod failed to reach its primary endpoint of reduced DUX4 target gene expression in patient muscle, despite improvement in functional outcomes23. Please state here whether or not there was any evidence that DUX4 expression itself was reduced in this trial. It would help if the authors could also add here an interpretive comment as to whether this indicates that the current presumed target genes for DUX4 are not in fact the ones important for FSHD, or whether their expression might be retained from compensatory upregulation by other upstream regulators. The authors should expand briefly also in the introduction on the evidence for toxicity of target gene expression.
      3. Results 2nd paragraph: - We first describe the compartment model. FSHD single myocytes can express DUX4 and therefore DUX4 target genes; DUX4 target gene expression leads to cell death19,27,28. Please indicate whether the evidence in these studies is independent of DUX4. Ie. Is there independent evidence that it is definitely the target gene expression, rather than DUX4 expression per se, that leads to cell death, especially if losmapimod improves function by inhibiting DUX4, but has no impact on these target genes.
      4. Results 2nd paragraph Item 4 : - 𝑅(𝑡) - a resigned state where the cell expresses no DUX4 mRNA but does express DUX4 target mRNA (DUX4 -ve/Target gene +ve: i.e. a historically DUX4 mRNA expressing cell) Since the mRNA is from the target genes, why should it be produced only in response to DUX4 expression ? ie. Please indicate the evidence to say that these must be 'historically DUX4 mRNA expressing cells', rather than target gene expression in response to other factors, or even autonomously.
      5. Results - Estimating the kinetics of DUX4 mRNA - 2nd paragraph: - DUX4 expression was induced with 250 ng/ml doxycycline for 7 hours .... Might some of the laboratory detail here be better placed in the 'Methods' section ?
      6. Results - Estimating the kinetics of DUX4 mRNA - 4th paragraph: - '...from 4 FSHD patients (2 FSHD1 and 2 FSHD2).' Please give additional information about these patients - ie. Age, sex, severity (or age-onset), and genetic results - perhaps best done as a Table in this paper rather than only by reference back to the Van den Heuvel et al. paper (see main comment 1 above).
      7. Results - Estimating kinetics of DUX4 target activation - 2nd paragraph: - '8 DUX4 target genes......expression was restricted to FSHD cells/nuclei and never observed in controls.' So are these genes normally only expressed in the zygote , rather than post-birth (except perhaps the testis)? The authors should comment on this.
      8. Results - Estimating kinetics of DUX4 target activation - 4nd paragraph: - In the presence of DUX4 mRNA the proportion of time the promoters of the 8 DUX4 target genes remained in the active state,....significantly increased. It would be interesting to know if any of these temporal dynamic descriptors of DUX4 target promoters differ consistently between sample II-2 and II-1 and in the same direction between I-2 and I-1. ie. Might the same factors (eg. D4Z4 copy number) which may affect presence/absence of DUX4 also affect other cellular measures of DUX 4 ?
      9. Results - Compartment model simulation - 4th paragraph: - '...so that after 10 days 26.3% of cells had died.' The authors need to give data here also for controls. Ie. What proportion of cells die after 10 days in controls ?
      10. Discussion - 1st paragraph: - ' However, DUX4 expression in FSHD muscle demonstrates a complex dynamic with DUX4 mRNA, protein and target gene accumulation all difficult to detect2,21. Understanding this complex dynamic is essential to the construction of optimal therapy' So, it presumably follows that comparison by known genetic or demographic modifiers of disease severity (such as D4Z4 copy number) could be of fundamental importance in interpreting this dynamic and hence the results of clinical trials) (see Main point 1, and point 7).
      11. Discussion - 6th paragraph: - 'Our model predicts <2.9% of single FSHD myocytes will be DUX4 target gene positive at any given time...' Should this be: '...DUX4 target gene-mRNA positive' . Also, does this 2.9%-figure differ between individual patients, and therefore might generally differ between FSHD1 and 2, and between different D4Z4 genetic categories ?; as this will matter for different individual patients.

      Minor comments

      1. Methods - scRNAseq and snRNAseq data - 2nd paragraph: - '..2 sperate patients...' Typo. to correct.
      2. Methods - Hypothetical scenarios for raising 𝑬[𝒎] under the promoter-switching model- 1st paragraph: - '...constant in the second...' needs punctuation.
      3. Methods - Cellular Automaton Model - 3rd paragraph: - '...according the non-syncytial...' Typo : '...according to...'
      4. Methods - Genetic algorithms - 3rd paragraph: - '...elitism of 5%, mutation probability 0.1, crossover probability 0.8,...' Should these parameters be given in the same format to avoid any confusion - ie. all as probability, or all as percentages ?

      Significance

      Please see comments in the 'Evidence, reproducibility and clarity' box above.

      This paper is valuable in providing a mathematical basis for modelling the stochastic process of presence or absence of DUX4 expression in individual myocytes in FSHD (facioscapulohumeral muscular dystrophy), and hence a basis by which to study the effects of other factors or potential therapeutic interventions which may influence the overall proportion of muscle cells which do express DUX4, and hence succumb to its toxicity.

      This is a specialist field and the nature of presentation of the mathematical modelling in the paper will restrict accessibility to only a very few researchers in this field. There appears to be a possible major problem in the way that the paper has combined data from patients with different genetic forms of FSHD, and different likely genetic severities. It would seem better to analyse the data separately for each of these to allow a more homogenous platform on which to construct a model.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Banerji and colleagues measure DUX4 and target gene expression over a time course in doxycycline-inducible myoblasts to estimate kinetic parameters and rates underlying the transition of non-expressing cells through DUX4-expressing cells to cell death. They then use these parameters to model the rate of appearance of DUX4+ cells, DUX4 target gene expression, etc. in cells from FSHD patients, and derive a model that predicts that over 100 days around one fourth of cells die while less than 1% of cells express DUX4 or its target genes at any given time. This is somewhat similar to what is seen in FSHD patients, where DUX4 expression is infrequent in cultured cells, while patients eventually have substantial muscle loss. The experiments are well-designed and explained clearly.

      Significance

      The primary significance of this study is that the field has a sense that the damage seen in patient muscle is not congruent with the low expression of DUX4 in patients, and the model showing many cells dying with only a few cells expressing DUX4 at any given time suggests that overall damage can be greater than that observed in any particular snapshot.

      However, it is important not to conflate low frequencies of DUX4+ nuclei in cultured myoblasts with "DUX4 being difficult to detect" as in p 12, Discussion. DUX4 is difficult to detect, indeed basically not detected, in muscle biopsy specimens, but in cells in vitro, DUX4 is fairly easy to detect, albeit in quite low numbers of cells. Since the study evaluates cells in vitro, it is important to make clear that the situation in vivo is qualitatively different from that seen in vitro, namely DUX4 not being detected, and the authors should clarify this importance difference.

      A second reason for caution in extrapolating correlates from the in vitro model to the disease process in muscle tissue is that in vivo there is a continual source of replacement cells, as the authors have shown in a previous study. Have the authors attempted to model a situation in which new cells are provided into the system at some rate, related to the amount of death occurring at different times? Although the authors mention that the static cell number is a limitation of the model, it would be valuable to revisit or explore this idea in the Discussion section, if only to provide the reader with a more pragmatic perspective.

      The second part of the paper models presence of DUX4 in nuclei based on diffusion from expressing to non-expressing nuclei, and characterizes this as the activity of "an infectious agent, able to spread from one nucleus to another by adapting epidemiological compartment models". The relationship to an infection process is probably not the ideal way to characterize this process, because an infection implies the setting up of new sites of production of the agent, DUX4, where what is really happening is that DUX4 diffusing into these other nuclei isn't leading to more DUX4 production, it is just diffusing into nearby nuclei and accumulating there. Unless I am misunderstanding, the authors are simply showing that a larger number of nuclei will be positive in a system in which cells are fusion products having many nuclei than in a system in which all nuclei are isolated within their own cells.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In the manuscript "Compaction of Drosophila histoblasts in a crowded epidermis is driven by buckling of their apical junctions", Rigato et al. study the behaviour of histoblasts during the third larval stage of Drosophila. Histoblasts are the progenitor cells of the adult abdominal epidermis. They are produced in the embryo and lie between the larval epithelial cells (LECs) in the larva before abdominal morphogenesis takes place during metamorphosis. The authors use this system to explore the role of forces during epithelial development.

      The authors show that histoblasts undergo a dramatic change in morphology between 90 and 115 h AEL (after egg laying), with adherens junctions changing from a straight to a highly folded appearance. They also show that, during this time, histoblast volume is increasing. Furthermore, both junctional actin and junctional myosin II levels decrease over time. Interestingly, reduction of contractility (Rok-RNAi) and increase of contractility (overexpression of Rok constitutively active) in both histoblasts or LECs has no significant effect on histoblast behaviour.

      The authors hypothesise that growth of histoblasts and LECs lead to a compression of the histoblasts, which causes the buckling of the histoblast junctions. To test this hypothesis, they perform three experiments and show that (1) overexpression of a dominant negative form of insulin receptor in LECs leads to a non-autonomous effect on histoblast cell size, (2) overexpression of a dominant negative Rab11 in histoblasts interferes with histoblast buckling, and (3) overexpression of String in histoblasts induces histoblast division and reduces histoblasts buckling.

      Major comments

      As mentioned in the significance box below, a major weakness of the manuscript is that the presented data does not sufficiently support the hypothesis that histoblasts are compressed by the LECs: Firstly, the manuscript does not provide evidence that the LECs expand and compress the histoblasts. Such an analysis needs to be included.

      Secondly, the authors present two pieces of evidence to support their hypothesis, which are not very convincing:

      1. In line 147ff, the authors imply that their experiments in Fig. S3D (Rok alterations in LECs) support a 'mechanical tug of war'. However, the authors point out that their analysis is not statistically significant, so their data does not actually support their hypothesis.
      2. The authors show that overexpression of a dominant negative form of insulin receptor results in a non-autonomous increase in apical histoblast cell area. Here, I wonder to which extent the change in histoblast cell size might be due to a change in histoblast cell number per nest rather than a change in LEC pressure. Furthermore, they state that junctions are straighter, however, it would be good to see a statistical analysis here. Importantly, the conclusion of the experiment is not very convincing as it has not been shown that LECs are smaller, or grow slower, or exert less pressure on the histoblasts due to the performed genetic manipulation. So, the reason for the observed histoblast phenotype is unclear. This needs to be explored further.

      Thirdly, there are a few observations, which further challenge the author's hypothesis:

      1. Buckling appears to happen in the plane of the tissue, but should it not happen orthogonal to it, as shown in the scheme in Fig. 2J, if LEC compression was the cause of buckling?
      2. In Fig. 1D, one can see buckling at interfaces between histoblasts and LECs - does this not suggest that histoblasts push against LECs (and that in that area LECs are not pushing against histoblasts)? I think this observation is very interesting and a more detailed analysis of this phenomenon at histoblast-LEC junctions could be included in the manuscript.

      Based on the above point, there are various sections of the manuscript that need to be adjusted in my opinion, for example:

      • Line 190ff. 'Combined, these perturbation experiments provide strong evidence that junctional buckling of the histoblasts is the result of a imbalance between the addition of junctional material in the histoblasts and mechanical constraints from the overcrowding of the epidermis.' - There is not sufficient evidence for this statement with respect to overcrowding. The presented data does however show convincingly that junctional remodelling is needed for buckling.
      • Line 201 ff. 'This experiments confirms that junctional buckling is a result of the combined overcrowding and absence of divisions.' - The presented experiments do not provide sufficient evidence for this statement. The presented data does however show convincingly that inducing cell division leads to less buckling. I wonder whether this result is counterintuitive with respect to the authors' compression hypothesis, as if increased compression from LECs would lead to buckling would then not also increased pushing by neighbouring histoblast lead to buckling?
      • Line 235 ff. 'We investigated the formation of histoblast junctional folding and found that it is a non-autonomous transition originated by the competition for space of the two cell populations.' - This needs to be rephrased are there is not sufficient evidence for this hypothesis.

      Further major comments

      Line 56: More details about which histoblasts were imaged would help the reader understanding the experiments better. - Which abdominal segment was imaged? - The authors state that they have imaged the "dorsal posterior nest, which has the largest number of cells (15-17)" - is this correct? In later stages, the anterior dorsal nest is larger than the posterior dorsal nest. - Do the different abdominal segments have different histoblast numbers/ histoblast nest sizes? - I think that it would be helpful to show the behaviour of the ventral nest - the authors' hypothesis suggests that all histoblasts behave similarly and the buckling should be observed in all nests.

      In the figures, the authors do not clearly present the statistics done. Here, giving the p-values in the graphs would be very helpful. There are instances where it is not sufficiently clear whether the authors present a significant finding or merely a non-significant tendency (e.g. in Fig. 6).

      Fig. 4CD. I do not agree with the authors' interpretation that Sqh::GFP is lost from the junctions. The figure shows that levels are reduced. Also, in line 157, it might be better to use 'reduction of junctional myosin' rather than 'loss of junctional myosin'.

      With a few exceptions, the authors do not show the fluorescent marker used in their experiments to report where and how strong the Gal4 is expressed, which they use to drive their RNAi or dominant negative constructs. For example, in Fig. 5, they say that they have co-expressed a cytosolic GFP, but they do not show it. To have this kind of information would be very useful when interpreting the data.

      In line 171 and in other places the authors talk about 'plastic remodelling'. It would be helpful if the authors could explain in more detail what they mean by this.

      Minor comments

      In my opinion, the paragraph about the 'Qualitative model of junctional buckling' would be better placed in the discussion.

      Fig. 6. Why was the insulin receptor experiment done in white pupa and not in wandering L3 larvae? This makes comparison of data more difficult.

      I wonder when are histoblasts stopping to show the buckling? I assume that it must be before the beginning of abdominal morphogenesis, as at the beginning of LEC replacement, the junctions are straight again?

      What is the morphology of histoblasts in late L1- and late L2-stage larvae? Potentially there might also be crowding during those stages?

      Significance

      The observations by Rigato et al. are very interesting. They present a novel model system that enables the study of the interaction of two epithelial cell types, which do not divide. The fact that the presented data suggests that neither histoblasts nor LECs are under tension, makes this an extremely interesting novel system to explore the forces involved. The presented results provide some interesting insights into histoblast biology. However, a major weakness of the manuscript is that the proposed hypothesis of histoblast compression by larval epithelial cells is not sufficiently supported by the results. So apart from the very interesting observations, the manuscript lacks insight into the mechanistical basis of junctional buckling.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript by Rigato and colleagues uses live imaging of Drosophila larvae to describe the transition of histoblasts from a configuration where junctions are straight to a configuration where junctions are folded. The emergence of folded junctions is concomitant with a decreasing apical area, an increasing cell height and decreasing junctional Myosin. Expression of Rab11-DN (reducing apical junctional trafficking) or Cdc25 (inducing proliferation) in histoblasts abolishes the emergence of folded junctions. Expression of InRdn (impairing insulin receptor pathway) in surrounding larval epidermal cells (LEC) is claimed to also reduce folding (but see comment below). Finally, laser ablation of folded junctions reveals little or no relaxation, indicating that these junctions are not under tension. The authors propose a model in which growth mediated cellular crowding generates mechanical constrain on histoblasts which, in conjunction with decreased junctional Myosin II, leads to the buckling of junctions.

      • The authors convincingly show that histoblast junctions buckle/fold during late larval stages. They also convincingly show that junctional folding requires Rab11 and is counteracted by cell proliferation. The conclusion that folded junctions are not under tension is less well supported. Ablation of folded junction results in little/no relaxation (Fig. 5), however, the positive control (late pupal histoblasts) did not show obvious relaxation either (in absence of quantification).
      • The key conclusion that growth mediated crowding drives junctional folding is not well supported. The authors claim that InRdn expression in LECs leads to straight junctions of histoblast, but that is not obvious from Fig. 6F. Additional experiments will be required to further test the role of growth mediated crowding in junctional folding. For example, the authors should further attempt to modulate growth of LECs and/or test whether overgrowth of larvae to increase epidermal surface (e.g. lgl mutants) would influence junctional folding. These experiments will likely require several months.
      • Moreover, the authors provide a 'qualitative model' (Fig. 7). The paper would be strengthened by providing a model based simulation (best based on quantitative data derived from experiment (e.g. growth rates of histoblasts, LECs, etc.) of the transition of straight to folded junctions. This simulation would test whether the authors' hypothesized mechanism is feasible. This work will likely require several months.
      • Statistical analysis to reveal significances between datasets is missing throughout the manuscript. The number of biological replicates (i.e. larvae) for each experiment are not provided. The authors should provide statistical analysis.
      • Fig. 3/S3. The authors observe a correlation between junctional folding and a decrease in F-actin and Myosin on junctions. However, changes in Rok activity do not alter junctional folding. It is therefore unclear whether the decrease of F-actin and Myosin is a cause or consequence of junctional folding. The authors should tune down their conclusion that junctions 'soften' through a loss of cytoskeletal components.
      • Fig. 5. The laser ablation experiments require a quantitative analysis.
      • Fig. 6. A control image (Cad;mKate without perturbation) is missing.
      • Fig. 7. The junctional buckling model is a hypothesis by the authors to explain their observation; it is not data and therefore should be removed from the 'results' section of the manuscript.

      Significance

      The manuscript describes an interesting behaviour of cells to change their junctional morphology from straight to folded during development. Previous work has mainly described epithelia as networks of cell junctions under tension. This work advances our understanding by providing evidence that epithelia can also be in a configuration that is not based on tension. The authors provide evidence that this cell configuration requires the absence of cell proliferation and trafficking of junctional material. However, beyond this, the mechanisms that drive epithelia into this configuration remain somewhat unclear. The manuscript would therefore likely target a specialist audience

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This study used metabolomic, lipidomic and proteomic approaches to analyze the metabolic changes induced by the p.S59L CHCHD10 mutation in mice. Altered metabolism in plasma and heart of Chchd10S59L/+ mice was seen compared to their wild type littermate. In plasma, levels of phospholipids were decreased while those of carnitine derivatives and most of amino acids were increased. In cardiac tissue, Chchd10S59L/+ mice showed a decreased Oxidative Phosphorylation (OXPHOS) and -oxidation proteins levels as well as tricarboxylic acid cycle (TCA) intermediates and carnitine pathway metabolism. In parallel, lipidomics analysis revealed changes in the lipidome, including triglycerides, cardiolipin and phospholipids. Consistent with this energetic deficiency in cardiac tissue, the authors show that L-acetylcarnitine supplementation improved the mitochondrial network length in IPS-derived cardiomyocytes from a patient carrying the CHCHD10S59L/+ mutation. It is concluded that L-acetylcarnitine may restore mitochondrial function in CHCHD10-related disease, due to the reduction in energy deficit that could be compensated by carnitine metabolic pathways.

      General Comments:

      The authors had already generated knock-in (KI) mice (Chchd10S59L/+) that developed cardiomyopathy associated with morphological abnormalities of mitochondria, severe oxidative phosphorylation (OXPHOS) deficiency and multiple defects of respiratory chain (RC) complexes activity in several tissues in the late stage. Other authors have seen similar results (see reference 5) As a result, the insights provided by this further metabolomic, lipidomic and proteomic analysis are not that novel. The data is very descriptive and often the authors misinterpret the meaning of the results. Addionally the alterations in either metabolites or proteins have in their mutant CHCHD10S59L/+ mice are often not accurately represented.

      The administration of acetylcarnitine to reverse the metabolic defects in iPSC cardiomyoctytes derived from a from a patient carrying the CHCHD10S59L/+ mutation is interesting, although the authors did not determine if similar benefits of acetylcarnitine were seen in the CHCHD10S59L/+ mice. They msy also misinterprete the role of acetylcarnitine in the mitochondria.

      Specific Comments:

      1. The authors point out that in vitro and in vivo studies have shown that CHCHD10 mutants cause disease by a toxic gain-of-function mechanism rather than by loss of function. It would be helpful to better define what the effects of the CHCHD10S59L/+ mutation represent.
      2. An aim of this study is to understand how mitochondria dysfunction associated with CHCHD10 mutations triggers altered global metabolism. This aim has not really be accomplished in this study.
      3. Figure 3C: The authors put FABP3 in the ß-oxidation pathwayt. This is incorrect. The figure also does not highlight the ketothiolase (ACAT1)? It is also not clear why CPT1 and CPT2 are place together. There is a carnitine translocase situation in between these enzymes. It should also be pointed out that CACT also has role in long chain acylcarnitine translocation.
      4. The main direction of CrAT in heart mitochondria is the conversion of acetyl CoA to acetylcarnitine. This is not recognized by the authors, and has important implications on interpreting acetylcarnitine therapy.
      5. Figure 3C: Why is just palmitate and linoeate shown as fatty acids?
      6. The authors state that "In cells, long-chain fatty acids dependent on esterification with L-carnitine to form acetyl-carnitine for transport from the cytoplasm to the mitochondrial matrix for oxidation and energy production." This sentence should be re-written and broken down into clearer statements.
      7. The authors state that "In lipid biosynthesis pathway, protein levels of long-chain- fatty-acid-CoA ligase 1 (Acsl1; as well as mRNA expression) and mitochondrial short-chain specific acyl-CoA dehydrogenase (Acads) in the hearts of symptomatic Chchd10S59L/+ mice were significantly lower than those of age-matched wild-type mice (with adjusted p < 0.05) (Fig. 3A-B). Please clarify and re-write this sentence. ACSl1 is primarily producing acyl CoA for CPT1. ACADs is involved in ß-oxidation of short chain fatty acids. Not lipid biosynthesis.
      8. The authors state that "With respect to the lipid oxidation, protein levels of carnitine-O-Acetyltransferase (Crat; as well as mRNA expression)...". Crat is not involved in fatty acid oxidation.
      9. It is stated that "Interestingly, a significant decrease in fatty acid biosynthesis intermediates, such as malonate and ethyl-malonate, was also observed in the hearts of symptomatic Chchd10S59L/+ mice (Fig. 3C). I do no not see this data. Where is this?
      10. Figure 3G.; Data is incomplete
      11. The authors state that: Altogether, those results suggest that CHCHD10S59L mutation induces branched-chain amino acids catabolic defects and increased non-essential amino acids synthesis which may contribute to the elevated levels of amino acids metabolites observed in plasma and heart of Chchd10S59L/+ mice (Fig.1D, Fig. 3D)." It should be recognized that the heart is a small contributor to plasma amino acid changes.
      12. The IPSC-derived cardiomyocytes seem to involve one single patient.
      13. The authors state that "As highlighted by our study, Chchd10S59L/+ mice displayed markedly elevated levels of cholesteryl esters, some glycerophospholipids and reduced concentrations of triglycerides species in heart at the symptomatic stage. Changes in cholesteryl ester metabolism were not reflected in changes in plasma total cholesterol pools (Table 1). In other words, it appears that cholesterol synthesis is upregulated but does not result in accumulation of free cholesterol." It should be recognized that the heart is not really involved in the synthesis of cholesterol.
      14. The authors state that "Increased plasma concentrations of acylcarnitines (which formed from carnitine and acyl-CoAs) are suggested as a marker of metabolism disorders related to cardiovascular diseases [43, 44]. Based on our data and the literature, we suggested that targeting carnitine metabolism pathway could counterbalance the metabolic disturbances, ameliorate mitochondrial functions, and therefore delay CHCHD10-related disease progression." This statement is not supported by data. There are also inaccuracies with the discussion of metabolism.

      Significance

      The authors had already generated knock-in (KI) mice (Chchd10S59L/+) that developed cardiomyopathy associated with morphological abnormalities of mitochondria, severe oxidative phosphorylation (OXPHOS) deficiency and multiple defects of respiratory chain (RC) complexes activity. Other authors have seen similar results (see reference 5) As a result, the insights provided by this further metabolomic, lipidomic and proteomic analysis are not that novel. The data is very descriptive and often the authors misinterpret the meaning of the results. They often misrepresent the significance of the observed alterations in metabolites and proteins in their mutant CHCHD10S59L/+ mice.

      The administration of acetylcarnitine to reverse the metabolic defects in iPSC cardiomyoctytes derived from a from a patient carrying the CHCHD10S59L/+ mutation is interesting, although the authors did not determine if similar benefits of acetylcarnitine were seen in the CHCHD10S59L/+ mice.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This manuscript by Madji Hounoum et al presents a study of the metabolic changes associated with the p.S59L CHCHD10 mutation that underlies a toxic gain-of-function in a number of disease phenotypes, including ALS and mitochondrial myopathy. The authors have used a multi-omics approach in their mouse model to demonstrate significant decreases in proteins required for oxidative phosphorylation (OXPHOS) and -oxidation, as well as metabolites involved in the Kreb's cycle and carnitine metabolism, along with significant changes in lipid profiles. The authors also provide evidence that L-acetylcarnitine appears to ameliorate mitochondrial function.

      Major comments:

      The manuscript is, in general, well-written and 1. The conclusions drawn are mostly justified on the basis of the data presented (see comment 2). 2. The authors have used a multi-omics approach, which is very powerful in allowing a cell-(or organism-) wide analysis of multiple systems. However, the key drawback for the proteomics approach is that low abundance proteins, such as the OXPHOS proteins, are often not accurately assessed. In this regard, it seems critical that the authors provide further evidence for the changes suggested by the heatmaps - or justify that the technical approach they have taken can account for low abundance. Western blotting would fit the bill nicely - there are antibodies available to many of the OXPHOS complex subunits. 3. There is a very rich and deep literature, particularly from the '80s and '90s, regarding the metabolic disturbances identified in mitochondrial disease patients, both for OXPHOS and fatty acid oxidation defects, that should be cited. In addition, the literature delineating the mitochondrial 'cofactor cocktail' should at least be mentioned.

      Minor comments:

      1. Some attention to grammar would help clarify the meaning for the reader. Some sentences are incomplete.
      2. The authors are encouraged to check their references, as a number are incomplete.
      3. Adding the scale to the scale bar for the MitoTracker Red confocal images would be handy. The right-most micrographs of the S59L/+ cells (Fig 4C) are not nearly as convincing as the middle pair of micrographs - and detract from the message. In addition, it would be nice to have the authors comment on the very intense staining of the mitochondria in the S59L/+ cardiomyocytes in panel A of Figure 4.
      4. The final paragraph of the Discussion is not as impactful as it could be. Specifically, referencing the mitochondrial disease literature would aloow a more fulsome discussion as to the mechanism underlying the action of ALCAR i.e. is the anti-oxidant function most important? Or is it simply it's action as a metabolite?

      Significance

      This study is an important contribution to the literature examining neurodegenerative diseases, such as ALS, that remain poorly understood. While the advance seems incremental, especially in light of the many studies in recent years that have document mitochondrial dysfunction in the mutant mice, the ALCAR treatment is novel and worthy of dissemination. The audience that this manuscript would interest would span from neurologists and other clinicians, such as medical geneticists, to basic biomedical researchers in both academic and industry.

      Reviewer area of expertise: mitochondrial function in health and disease; insufficient expertise to evaluate the details of the 'omics' methodologies.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      In the manuscript titled "Multiomics study of CHCHD10 S59L -related disease reveals energy metabolism downregulation: OXPHOS and beta-oxidation deficiencies associated with lipids alterations," Hounoum et al. performed metabolomics, lipidomics, and proteomics analyses of symptomatic and presymptomatic CHCHD10 S59L murine hearts. The results are largely descriptive. Levels of carnitine acyltransferases and carnitine palmitoyltransferase 2 are lower in S59L hearts. Many proteins of lipid biosynthesis and beta-oxidation pathways are also reduced. Authors concluded that utilization of fatty acids for energy production is deficient in the mutants. They treated CHCHD10 S59L iPS-derived cardiomyocytes with acetyl-L-carnitine and observed a rescue of mitochondrial length and cristae organization in vitro. This paper contains a few grammatical, structural, and organizational issues. The paper confirms several findings recently published by Sayles et al. (Cell Reports, 2022) while providing some additional information through lipidomics analysis in the hearts and metabolomics analysis in the plasma. Overall, it is largely descriptive apart from an experiment in the figure 3 in which the authors use iPSC-derived cardiomyocytes to show partial rescue of a mitochondrial morphology defect following acetyl-L-carnitine supplementation. However, these data seem preliminary and the correlation between the iPSC and mouse model is not established. Overall, these data are likely to be of interest to the immediate field but lack novelty for a general audience.

      Major comments

      1. In Figure 3, authors treated CHCHD10 S59L iPSC-derived cardiomyocytes with acetyl-L-carnitine for 72 hours and observed a rescue of mitochondrial length and cristae organization. However, it is not established that the defect in mitochondrial length is important to the pathology in the mouse heart. A rescue of the mitochondrial functional defects would have greater relevance. Thus, the relevance of rescuing this phenotype is not clear. It is not clear a priori whether increasing acetyl-L-carnitine levels would be protective. While certainly there is evidence for downregulation of fatty acid beta-oxidation as well as carnitine-related metabolites, if this a compensatory response to an OXPHOS defect, increasing acetyl-L-carnitine levels could make the cardiomyopathy worse. Supporting this alternative interpretation, levels of carnitine derivatives are already higher in mutant plasma. Thus, it is important to demonstrate this rigorously and in the most appropriate model. For instance, showing rescue of cardiomyopathy in the in vivo mouse model would be stronger than showing rescue of a minor defect in mitochondrial morphology in iPSC derived cardiomyocytes. Additionally, the EM images provided in the paper are in low magnification, and cristae structures are not clear. Quantifications of the cristae defects are not provided. Authors also do not provide any information regarding how they quantify mitochondrial length. Mitochondria is a 3D structure. The length of mitochondria on a 2D transmission EM image may not represent the true length of the mitochondria.

      Minor comments

      1. Title. Recommend changing "lipids alterations" to "lipid alterations."
      2. Page 7, line 13, 14, and 23. Some characters appear as squares.
      3. Page 12, line 8. Recommend changing "After 72 treated with Acetyl-L-carnitine" to "After treated with acetyl-L-carnitine for 72 hours."
      4. Page 14. It is unclear what the significance of the electrolyte measurements is. A brief discussion of the implications should be added.
      5. Page 15, last sentence. Consider rephrasing the sentence "Very interestingly, most of the amino acids detected in the plasma were increased in CHCHD10 S59L/+ mice at both stages, as well as carnitine, O-acetyl-L-carnitine and deoxycarnitine increased at symptomatic stage."
      6. Page 16, line 10. "Longitudinal proteomics" implies that the pre-symptomatic and symptomatic heart samples came from the same subjects. If this is not the case, I would recommend deleting the word "longitudinal."
      7. Page 17, line 14. Authors show changes in levels of proteins and metabolites in beta-oxidation, but there is no evidence presented to show that beta-oxidation is impaired in CHCHD10 S59L/+ hearts.
      8. Page 17, line 19. Please indicate where Cyb5r1 levels are shown.
      9. Page 18, line 15. Please indicate where Acss1 levels are shown.
      10. Page 18, line 10. Abbreviation Plaa has already been spelled out in line 2.
      11. Page 18, line 10, it is stated here that Plaa levels are lower in the CHCHD10 S59L KO mice but 3 sentences earlier and on the figure they are higher. Please resolve this discrepancy.
      12. Page 18, line 18. Recommend changing "lipids alterations" to "lipid alterations."
      13. Are enzymes involved in amino acid metabolism (PHGDH, PSAT1, and ASNS) upregulated in your proteomics analysis?
      14. Page 20, line 6. Recommend changing "Catabolic enzymes are mainly located in the mitochondrial matrix such as the branched-chain alpha-keto dehydrogenase complex (Bckdha, Bckdhb) and branched-chain-amino-acid aminotransferase (Bcat2)" to "Catabolic enzymes, such as the branched-chain alpha-keto dehydrogenase complex (Bckdha, Bckdhb) and branched-chain-amino-acid aminotransferase (Bcat2), are mainly located in the mitochondrial matrix."
      15. Page 20, line 12. The authors interpret the increase in non-essential amino acid synthesis as a consequence of the changes in branch-chain amino acids. An alternative interpretation is that this is a consequence of the mitochondrial integrated stress response, which has been demonstrated to be upregulated in symptomatic CHCHCD10 S59L hearts. Specifically, expression of proline synthesis, serine metabolism, and asparagine synthesis enzymes is increased in a manner that depends on the OMA1-DELE1-eIF2alpha signaling axis. This alternative explanation for these results should be discussed and the relevant studies cited (PMID: 35700042 and 32338760).
      16. Page 22, line 12. An alternative explanation for lower creatinine levels is decreased body weight in the CHCHD10 S59L mice. This should be discussed in addition to noting changes in creatinine in ALS. Additionally, it seems more likely that these changes in the CHCHD10 S59L mouse relate more to the myopathy/cardiomyopathy in this model than motor neuron disease, which is not a prominent feature in the model.
      17. Page 23, line 10. Recommend showing Uchl1 levels in Results and/or Figures.
      18. Page 23, line 15. Myh6 levels are unchanged or decreased not increased in cardiomyopathy.
      19. Page 24, line 17. Recommend changing "mitochondrial dysfunctional" to "mitochondrial dysfunction."
      20. Page 27, line 10. Recommend changing "ameliorate mitochondrial function" to "ameliorate mitochondrial dysfunction."
      21. Page 31, line 22. Formatting error.
      22. Figure and Figure legend 3D. Recommend changing "not regulated" and "not modulated" to "unchanged" or "not significantly different."
      23. Figure 4C and 4D. Please provide images of higher magnification to clearly show mitochondrial network and cristae. Please provide quantification for 4C.

      Significance

      This paper contains a few grammatical, structural, and organizational issues. The paper confirms several findings recently published by Sayles et al. (Cell Reports, 2022) while providing some additional information through lipidomics analysis in the hearts and metabolomics analysis in the plasma. Overall, it is largely descriptive apart from an experiment in the figure 3 in which the authors use iPSC-derived cardiomyocytes to show partial rescue of a mitochondrial morphology defect following acetyl-L-carnitine supplementation. However, these data seem preliminary and the correlation between the iPSC and mouse model is not established. Overall, these data are likely to be of interest to the immediate field but lack novelty for a general audience.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      The study "Mesenchymal stem cell models reveal critical role of Myc as early molecular event in osteosarcomagenesis" by Akkawi et al shows that BM-MSCs are a foundational tool for study of osteosarcoma. And authors identified Myc and its targets as early molecular events in osteosarcoma formation, using BM-MSCs knocked out of both p53 and Wwox. Although the quality and validity of the data presented in this manuscript are not in question, this reviewer has doubts about the novelty of the findings in this current version of manuscript. It does not clearly indicate what is different from previous findings.

      Response: We thank the reviewer for the kind words regarding our manuscript. Our study revealed that combined deletion of WWOX and p53, two known tumor suppressors in OS, results in early transformation of BM-MSCs that mediates upregulation of Myc. We believe that this notion is original and has not been described before. In addition, we provide evidence that this genetic manipulation has an advantage over p53 deletion alone. More details are provided below.

      1. It has already been reported that p53-/- BM-MSCs are the cells of origin in osteosarcoma development (ref. 21).

      Response: We agree with the reviewer about this notion/fact and we indeed cited this reference. It should be noted that in this study the cell of origin of osteosarcoma was proposed to be BM-MSCs-derived osteogenic progenitors when p53 and Rb are co-deleted. Interestingly, this study did not show whether p53-/- BM-MSCs-derived osteogenic progenitors are able to form osteosarcoma or any other type of sarcomas. In our model BM-MSCs p53-KO alone were not able to develop osteosarcoma tumors as well, even when injected intratibially. Moreover, we showed that co-deletion of Wwox and p53 in BM-MSCs-derived osteogenic progenitors have the ability to form OS at earlier stages at the time point when deletion of p53 alone is still not enough to induce osteosarcomagenesis. Based on our findings and those in the literature, we believe that this combined genetic perturbation is critical for initiation of OS.

      1. Indispensability of Myc in osteosarcomagenesis was revealed (PMID: 12098700).

      Response: It is well known that Myc is a potent oncogene and overexpressed in osteosarcoma (ref. 12, 13, 28 and ref. 29) as well as in many other human malignancies. The referred study (PMID: 12098700; ref 32) which expressed Myc in lymphocytes based their analysis of Myc contribution at the tumor stage (at the time of tumor detection). Our study, on the contrary, shows that upregulation of Myc is an early event in osteogenic-committed BM-MSCs deficient for Wwox and p53 in tumor-free mice. This notion indicates that combined deletion of two important tumor suppressors, WWOX and p53, promotes osteosarcoma through early changes in Myc levels. Our data further show that p53 deletion alone is dispensable for this change to happen at early stages further highlighting the significance of our findings. The referred paper was cited and discussed in the discussion section (ref 32).

      Our data further shed light on WWOX as a key determinant of Myc function placing it as an upstream regulator. To further proof this, we propose in our revision plan to knockout WWOX in yBM SKO cells and/or restore WWOX in yBM DKO cells and determine consequences on Myc levels and activity as well as on tumorigenesis. In addition, we shall perform a ChIP-seq assay for Myc in yBM DKO and compare it to yBM SKO cells to show whether WWOX deletion is indeed results in enhanced chromatin accessibility of Myc.

      1. Osteosarcoma formation of p53flox-OsxCre mice was rescued by Myc-depletion and BM-MSCs from p53flox-OsxCre was shown to upregulate Myc (PMID: 34803166).

      Response: This is a very relevant new study that we regrettably missed to cite so we are grateful for the reviewer to bring this up. In our revised version, we will be citing this important reference and discussing it (ref 33). Although this article shows that p53 deficiency promotes osteosarcomagenesis mediated through oncogenic Myc, which we also showed in our study (figure 6C, D), but the authors did not validate the tumorigenic ability of these cells at this earlier stage of osteosarcomagenesis. The later was showed in our study by injecting yBM-MSCs deficient for p53 intratibially into immunocompromised mice and showed that they lack tumorigenic ability although they display a mild upregulation of Myc (figure S5). On the other hand, co-deletion of Wwox and p53 at this earlier stage resulted in even higher levels of Myc and inducing osteosarcomagenesis at this earlier stage. Therefore, our study provides unforeseen effect of genetic perturbation that promotes OS initiation.

      First of all, the authors need to cite the above papers and compare their findings with them to better clarify the value of their findings.

      Response: Thank you for this comment, we will cite and discuss these valuable studies in our revised version.

      The only one clear finding would be that Wwox functions as a tumor suppressor by repressing Myc function in the absence of p53, but unfortunately, no data have been presented on the mechanism Some additional analysis would be needed to mention it

      Response: As addressed above, our revision plan will include:

      1. Depleting WWOX in yBM SKO and/or restoring WWOX in yBM DKO cells to further prove the tumor suppressor function of WWOX.
      2. Performing ChIP-seq assay for Myc in yBM DKO and compare it to yBM SKO cells to show whether WWOX deletion is indeed results in enhanced chromatin accessibility of Myc.

      In the first place, Myc is upregulated in the absence of both p53 and Wwox, compared in only p53-null situation? Western blotting would be better to show it

      Response: In our revised version we will add a western blotting showing the upregulation of Myc in DKO (WWOX, p53) compared to SKO (p53) yBM cells; This is already added in new Figure 5S C.

      1. In Figure 1D, should separate each panel so that it is clearly visible. What is the blue-colored fluorescence, DAPI? If so, why don't tdTomato positive cells overlap with blue (Figs, 1D, 2C, 4C, 4E?

      Response: In our revised version we added more precise images in all Figures indicating the overlap between DAPI (blue) and tdTomato (Red).

      1. Why was MCM7 chosen among the Myc targets (S Figure 3)? What is the rationale for this?

      Response: Thank you for this important notion. MCM7 is part of the MCMs protein family, that plays and essential role as a helicase and organizing center in DNA replication initiation. Moreover, several studies show the upregulation of MCM7 in several types of cancers among which is osteosarcoma, as cited in our manuscript (Ref. 14, 15, 16). MCM7 is also a direct target of Myc and has been shown to be a druggable target, by SVA as has been presented in Fig 7. Altogether, these facts and observations made us exploring its significance in our mode. In our revision plan, we will also explore other Myc targets through performing ChIP-seq on DKO cells.

      In Figure 5 legend, what does "yBM cells (1.5, 4-months) (n=6)" mean? yBM cells (1.5-months) (n=3) and yBM cells (4-months) (n=3)?

      Response: Thank you for this notion. yBM, at age of 1.5 months or 4-months were collected from tumor free mice and analyzed. In our revised paper, we updated and clarified this in the Figure 5 legend.

      1. In Figure 7B, is there a correlation between MCM7 and Myc protein expression levels?

      Response: Thank you for this comment. In our revised version we added a western blot analysis showing the upregulation of both Myc and MCM7 in yBM-DKO compared to SKO cells; new Figure S5 C. (did the mean 7B upper panne, if so, we have to add this in the updated version).

      Also, do MCM7 and Myc immunopositivites overlap in Figure 7G?

      Response: In our revised version we will perform Myc IHC on same tumor sections. In the meanwhile, we added a western blot analysis showing the inhibitory effect of Simvastatin on both MCM7 and Myc in vitro (new Fig 7B, lower panel, re-blotted for Myc).

      In S Figure 4C, what is 'PC'? What sample was loaded?

      Response: PC refers to positive control for p53 that was used which was in this case HEPG2 cells treated with Nutlin to stabilize p53. p53 antibody used in this plot (IC12-Cell signaling) detects both human and mouse p53. A note was added to Figure legend.

      1. In S Figure 2A, what does 'US' (BM-US) mean? In S Figure 4F, what does 'US' and 'S' (Direct US and Direct S) mean?

      Response: Thank you for this notion. We apologize for not clearly defined these symbols. In our revised version we added clarifications in the legends of these figures. The symbols are as follow: US: unstained BM-control, S: stained BM, Direct: directly collected BM and checked with FACS before culturing.

      1. Overall, this manuscript, there are too many symbols and it is cumbersome. Ex, in S Figure 3, yBM_DKO, Tum_DKO, DKOT, DKO-BMT, etc. All figures should be consistent with the same notation.

      Response: We apologize for this in consistency in using too many symbols. In our revised version we will provide a table with all the symbols that should be consistent all over the manuscript

      Reviewer #1 (Significance):

      Although the quality and validity of the data presented in this manuscript are not in question, this reviewer has doubts about the novelty of the findings in this current version of manuscript. It does not clearly indicate what is different from previous findings, such as;

      1. It has already been reported that p53-/- BM-MSCs are the cells of origin in osteosarcoma development (ref.21).
      2. Indispensability of Myc in osteosarcomagenesis was revealed (PMID: 12098700).
      3. Osteosarcoma formation of p53flox-OsxCre mice was rescued by Myc-depletion and BM-MSCs from p53flox-OsxCre was shown to upregulate Myc (PMID: 34803166).

      First of all, the authors need to cite the above papers and compare their findings with them to better clarify the value of their findings.

      Response: Thank you for your valuable comments, and as we mentioned these important studies were and will be cited and discussed properly in our revised version.

      The only one clear finding would be that Wwox functions as a tumor suppressor by repressing Myc function in the absence of p53, but unfortunately, no data have been presented on the mechanism.

      Response: As stated in our response above, we argue that our observations showing very early transformation of BM-MSCs in combined genetic perturbation of WWOX and p53 is novel. In our revision plan we propose to perform additional ex vivo experiments to prove this notion by performing WWOX deletion in SKO-yBM cells and WWOX restoration in DKO-yBM cells and test consequences on Myc levels/activity and tumorigenicity. To further shed light on the mechanistic outcome of WWOX action in this context, we shall perform Myc ChIP and ChIP seq assays in yBM DKO and compare it to yBM SKO cells to show whether WWOX deletion is indeed results in enhanced chromatin accessibility of Myc [follow up of Fig-I shown above]. These experiments should further strengthen our findings.

      Reviewer #2 (Evidence, reproducibility and clarity):

      In current study, the authors established a mouse model with tdTomato expression under the OSX-controlled double deletions of Wwox and Trp53. Such mouse strain gives a great platform to study the OS development and therapeutic potential. Experiments are clear and convincing. Results are well presented.

      Response: We thank the reviewer for the kind words regarding our manuscript and acknowledging its clarity and validity.

      To better improve this study, few minor suggestions regarding the data are as following:

      1. Some of the legends on figures are too small to read, or in low quality. please change these labels.

      Response: We thank the reviewer for this notion. We apologize for the low quality and inconvenience. In our revised version, we shall provide an improved resolution of legends.

      1. For Figure 7C and D, from 7C, the control WT BM showed clear resistance to the SVA treatment, but in 7D, there is almost no cells in the WT BM group. Data of this group might be missed?

      Response: Thank you for this comment. Cre+WT BM cells (shown in 7D) were unable to form colonies as shown previously in figures 2B and 4B. Fig 7C refers to sensitivity to SVA using MTT assay.

      1. For figure 7G, the difference among MCM7 IHC staining of two groups didn't show as much as the statistical analysis in the right panel. Authors may consider using MCM7 western blot to check its levels after SVA treat.

      Response: Thank you for this notion. We updated the Figure showing a more representative image (new Figure 7G).

      Reviewer #2 (Significance):

      This study uses a transgenic mouse model with tdTomato expressed in combination of loss of p53 and Wwox under the OSX lineage to study early initiation of OS. They found only DKO bone marrow cells can form OS in a subsequent orthotopic mouse model, but not the p53 single KO cells. After compare the RNA-seq from these different cell population, they identified the Myc pathway is the key player to promote OS development, especially the MCM7. Moreover, they tested SVA in treating these BM cells and reveal a therapeutic potential. This animal model is a good platform to study OS, especially at the early stage. Most results are clear and convincing. With the identification of Myc pathway, they further tested the SVA effects on treating these DKO BM. This is an important study and provided meaningful information to the OS, even broad cancer research community.

      Response: We thank the reviewer for his/her supporting comments, and acknowledging the importance of our study.

      However, the significance, or novelty of this work is not sufficient. For instance, SKO BM won't form tumor in the IT injection assays compare to the DKO BM groups, therefore, the involvement of Wwox during the OS tumorigenesis is clear. However, authors didn't explore any potential mechanisms of Wwox function or related signaling behind this observation

      Response: We thank the reviewer for this very important comment. As mentioned previously, response to reviewer 1, our results indicate that combined deletion of two important known tumor suppressors, WWOX and p53, promotes osteosarcoma through early changes in Myc levels. Our data further show that p53 deletion alone is dispensable for this change to happen at early stages further highlighting the significance of our findings. In our revision plan we will do knockout of WWOX in yBM SKO and restore WWOX in yBM DKO cells. In addition, we are currently working to perform ChIP assay for Myc in yBM DKO and compare it to yBM SKO cells to show whether WWOX deletion is indeed results in enhanced chromatin accessibility of Myc.

      And the RNA-seq analysis mostly focus on c-Myc pathway and its downstream targets. Given the well-known relationship of p53, c-myc even RB in the OS, it will be more interesting and attractive to see a clear mechanism of Wwox in this context.

      Response: We thank the reviewer for this suggestion. Indeed, combined deletion of WWOX and p53 resulted in alteration of key cellular pathways involved in OS development. Due to the capacity of the work, we focused here on this important notion showing very early upregulation of Myc in BM-MSCs isolated from DKO cells, but not from SKO cells. Future work can expand use of this model to address relationship with other key pathways and genes.

      Second, since authors took effort to generate this Tomato-DKO mice, it could be clearer if they isolate tdTomato positive cells instead of a mixture of BM, culture them, differentiate them, and perform more assays using these cells. In this way, it will give better clean background for all assays, and may be able to find novel effectors during this OS progression process.

      Response: Thank you for this important suggestion. BM-MSCs cells collected directly from the mouse (Tom+, Sca1+, CD45-) represents a very small and minute population and was used to be cultured for enrichment as was done in previous studies (ref. 33 and 34). So direct collecting this small population and injecting directly to immunocompromised mice is not feasible. Moreover, further validation of the cultured cells used in our study confirmed their mesenchymal identity. We however, propose to try performing in vitro tumorigenic assays on these sorted cells. In our revision plan we suggest performing colony formation assays and soft agar assays to address tumorigenicity of these cells.

      Third, within the text, authors tried to use OB differentiation and some other assays to discuss the OS origin cells, MSC or OB; but didn't get a preferred conclusion. It could be possible to better understand this process with the single cell RNA-seq using these BM from different mice or at different ages

      Response: Thank you for this important point. According to our results we can conclude that BM-MSCs committed to the osteoblast lineage are supposed to be the cell of origin for OS and will be clearly emphasized in our revised version. Preforming a single cell RNA-seq is beyond the scope of this study and can be explored in future studies.

      In general, this is a clean, straightforward study, and they established a very useful model to study OS. But the mechanisms merit is somewhere short

      Response: Thank you for the kind words, as proposed previously our plan to further investigate the mechanism of WWOX regulatory effect on Myc will be addressed using the in vitro assays of WWOX deletion/restoration to SKO/DKO-yBM cells respectively. Moreover, ChIP-seq assay for Myc in yBM DKO and compare it to yBM SKO cells to show whether WWOX deletion is indeed results in enhanced chromatin accessibility of Myc.

      Reviewer #3 (Evidence, reproducibility and clarity):

      Summary: The work describes analysis of an Osx1-Cre p53fl/fl Wwoxfl/fl mouse model compared to an Osx1-Cre p53fl/fl model. The authors have assessed the osteosarcoma inducing potential of cells within the bone marrow by including a tdTom reporter of Cre expression. They conclude that bone marrow mesenchymal cells can give rise to osteosarcoma when transplanted. Based on transcriptomics they contend that upregulation of Myc is important and its target MCM7 can be targeted with simvastatin.

      Major comments: -

      Are the key conclusions convincing?

      The authors can generate tumors in immunocompromised mice upon injecting cells derived from bone marrow flushed. This is not surprising given the data available now about expression of Osx1-Cre

      Response: Thank you for this notion. In our study we showed that yBM cells harboring the deletion of two known important tumor suppressor genes WWOX and p53 collected from tumor free mice are tumorigenic compared to SKO p53 at this earlier stage. This is a novel notion that has not been presented previously. In our revised version, we propose to further study the mechanism of WWOX action on Myc accessibility.

      The analysis of MSCs lacks detail and needs significant more improvement and assessment by FACS using the well-defined criteria for mesenchymal cells that have been developed

      Response: Thank you for this comment. In our revised version we will add another marker (CD11b), in addition to the used markers (CD45/Sca-1 and CD29) which are all well known to define MSCs as mentioned in Ref. 21, 33, 34.

      It is not clear to me from the available information if the authors have used bone marrow cells that were flushed and immediately transplanted or if all cells transplanted have been placed in culture first, adherent cells expanded in culture media favoring survival and proliferation of non-hematopoietic cells and then transplanted- this is important to clarify explicitly as it is important to the significance of the study. If these cells are all used after culture, then the novelty of these studies are questionable as it was demonstrated previously that similar types of cells give rise to OS when transplanted (PMID: 18697945).

      Response: Thank you for this important point. In the referred reference (PMID: 18697945, ref 34) authors used p53/Rb Cre- stromal cells that were cultured in vitro then infected with Ad-Cre and then injected subcutaneously in immunocompromised mice. In our study, we provide evidence that genetically manipulated young BM-MSCs (for Wwox/p53) are tumorigenic when injected intratibially, a more relevant niche for these cells, and this involved upregulation of Myc. In our revised version, we shall provide more mechanistic insights on the functional relationship of WWOX and Myc. Using BM-MSCs cells that are directly collected from the mouse (Tom+, Sca1+, CD45-) is not feasible due to very low percentage of cells which has been also previously reported by many groups (Ref 34). In our revision plan, we also propose to try performing in vitro tumorigenic assays on sorted cells.

      Moreover, in our study we validated that the deletion of p53 alone at this earlier stage is not enough to induce osteosarcomagenesis (which was not shown previously) suggesting additional hits are required for OS formation. Importantly, co-deletion of Wwox and p53 using the same Cre line resulted in the upregulation/higher levels of Myc that promotes osteosarcomagenesis at this earlier stage.

      • Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      I think overall the authors are appropriately cautious in interpretation. The points raised above regarding the nature of the cells would need clarification and then the claims reassessed however.

      Response: Thank you for this acknowledgment. According to our results we can conclude that BM-MSCs committed to the osteoblast lineage could be the cell of origin for OS and this will be clearly emphasized in the discussion of our revised version.

      Claims re "metastatic potential" should be significantly reconsidered - the authors present (motility assays) which should be referred to as motility assays. The injection of cells intravenously is a lodgment assay of cells in the venous circulation and does not equate to the process a cancer cell must undergo and survive to metastasis from a primary tumor in an immune competent environment. The claims around these assays should be significantly reconsidered.

      Response: Thank you for this important comment. In our revision plan we will check the lungs of IT injected mice for the presence of lung metastatic nodules (tdTomato positive cells in the lungs).

      • Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      It is not explained or justified what the control cohort in Fig 7F is significantly smaller than the treated cohort. This will affect the statistical analysis and interpretation. There is no statement regarding blinding/randomization (or not) in the in vivo simvastatin experiment - this needs to be added.

      Response: In our revised version we clarified in the materials and methods section clearly the randomization of the mice selection for each group and number of mice in each group.

      The authors should include discussion that these are relatively long latency OS models compared to p53/pRb compound mutants and contrast with previous data from these models where in vitro cultured cells did give rise to OS in vivo after Cre treatment.

      Response: Thank you for this suggestion. In our revised paper, we will include the latency of OS in our model and compare them to p53/Rb, and emphasize that our model tested the tumorigenic ability of SKO yBM cells and showed that they are unable to form osteosarcoma tumors at this early stage compared to DKO yBM cells.

      • Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      If a patient could to be treated based on these data, then the extra experiments to provide a robust preclinical dataset should be provided otherwise significant caution should be stated.

      Response: Our study provides a proof-of-concept showing that our model can be used to screen for drugs that could inhibit OS development. The inhibitory potential of SVA affecting the progression of OS for clinical assessment would certainly need further investigation that goes beyond the scope of this paper.

      • Are the data and the methods presented in such a way that they can be reproduced?

      See comments regarding cells used for injection and blinding. Need to more clearly describe the cells being injected and what was done to them from isolation to injection.

      Response: Thank you for this comment. In our revised version we will add clearly in the materials and methods section the protocol of cell isolation and injection, randomization of the mice selection for each group and number of mice in each group.

      • Are the experiments adequately replicated and statistical analysis adequate? Unclear if appropriate experiment completed in Fig 7F as no justification of different sample sizes is provided nor a statement reblinding/randomization.

      Response: Thank you for this point. In our revised version we will add clearly in the materials and methods section the randomization of the mice selection for each group and number of mice in each group.

      Minor comments:

      • Specific experimental issues that are easily addressable.

      The Osx1-Cre expresses a Cre:GFP fusion - the authors should correlate the GFP and tomato signal.

      Response: We thank the reviewer for this point. We shall perform validation analysis in our revised plan.

      Fig 2A- if 50% of the bone marrow is tdTom positive this is not evident in the image in Fig 1D. Quantify the images in Fig 1D. The tumor images in Fig 2C appear to have only sporadic tdTom positive cells - the authors should explain this further.

      Response: Thank you for this notion, Figure 2A represents BM collected from a tumor bearing mouse which has a higher percentage of tomato positive BM cells compared to tumor free mouse (Fig 1D). Fig 2C is updated

      Need statistics added to all GSEA plots.

      Response: Thank you for this comment, statistics will be added in our revised version.

      4C is very different than 2C - 4C is more consistent with the levels of tomato stated

      Response: Thank you for this notion, the images were updated in our revised version

      • Are prior studies referenced appropriately?

      This seems appropriate

      Response: Thank you for this comment.

      • Are the text and figures clear and accurate?

      Figures are not ideal and could be improved in terms of >clarity and text size

      Response: We apologize for the low quality. In our revised version, we shall provide an improved resolution and accuracy.

      Several sections of text are either contradictory or questionably accurate:

      page 3: Molecular studies of OS are significantly hindered by its genetic complexity and chromosomal instability, which precludes the identification of a single recurrent event associated with OS. Contrasts with the following text: Page 18 - p53 has been extensively shown to play a central role in OS development in both human and mouse models. The data from sequencing of human OS and mouse models and canine data all point to p53 loss as being a central event in OS.

      Response: We apologize for this inaccurate statement. In our revised paper, we revised this statement to reflect the common event of p53 deletion in OS and its significance in osteosarcomagenesis.

      Page 18: High genetic heterogeneity and chromosomal instability limit the early diagnosis of OS and lead to lung metastases and a worse prognosis. I don't understand this statement given that intratumor characteristics are not a determinant of early diagnosis - the patient being aware they have an issue and the clinical follow up determine the rate of diagnosis (and access to healthcare).

      Response: We shall revise this statement to reflect the genetic heterogeneity of OS tumors.

      Page 21: Consistent with their roles as tumor suppressor genes, the combined deletion of WWOX and p53 in Osx1-positive progenitor cells resulted in their transformation and growth advantage. Didn't the authors reach this conclusion from their previous work published in 2016? –

      Response: Thank you for this notion. In our previous paper, we provided evidence that WWOX and p53 loss contributes to more aggressive OS tumor formation. In the current study, we provide evidence about early events contributes to osteosarcomagenesis using our Wwox/p53 model.

      Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      improve figure clarity and text sizes

      Response: We thank the reviewer for this notion; in our revised version, we shall provide an improved resolution, accuracy and clarity.

      Reviewer #3 (Significance):

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      I think this is largely an incremental study which largely confirms previous studies.

      Response: Although our results are consistent with some previously noted observations, we clearly provide unforeseen evidence that links Wwox/p53 in early osteosarcomagenesis and suggest that p53 deletion alone is not enough at this stage; other hits are required as in Wwox/p53 or Rb/p53. The mechanism of how DKO cells (Wwox/p53) results in Myc upregulation is also novel and will be further tested in our revised submission.

      • Place the work in the context of the existing literature (provide references, where appropriate).

      The study is a modest advance over the existing literature.

      Response: We believe that with our revision plan, our paper will provide a significant advancement in the research in osteosarcomagenesis.

      • State what audience might be interested in and influenced by the reported findings.

      This would be relevant to basic sarcoma researchers.

      • Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Generated multiple murine models of OS and characterized and applied them for biological understanding and preclinical studies.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary: The work describes analysis of an Osx1-Cre p53fl/fl Wwoxfl/fl mouse model compared to an Osx1-Cre p53fl/fl model. The authors have assessed the osteosarcoma inducing potential of cells within the bone marrow by including a tdTom reporter of Cre expression. The conclude that bone marrow mesenchymal cells can give rise to osteosarcoma when transplanted. Based on transcriptomics they contend that upregulation of Myc is important and its target MCM7 can be targeted with simvastatin.

      Major comments:

      • Are the key conclusions convincing?

      The authors can generate tumors in immunocompromised mice upon injecting cells derived from bone marrow flushed. This is not surprising given the data available now about expression of Osx1-Cre. The analysis of MSCs lacks detail and needs significant more improvement and assessment by FACS using the well-defined criteria for mesenchymal cells that have been developed.

      It is not clear to me from the available information if the authors have used bone marrow cells that were flushed and immediately transplanted or if all cells transplanted have been placed in culture first, adherent cells expanded in culture media favouring survival and proliferation of non-hematopoietic cells and then transplanted - this is important to clarify explicitly as it is important to the significance of the study. If these cells are all used after culture then the novelty of these studies are questionable as it was demonstrated previously that similar types of cells give rise to OS when transplanted (PMID: 18697945).<br /> - Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      I think overall the authors are appropriately cautious in interpretation. The points raised above regarding the nature of the cells would need clarification and then the claims reassessed however.

      Claims re "metastatic potential" should be significantly reconsidered - the authors present motility assays which should be referred to as motility assays. The injection of cells intravenously is a lodgement assay of cells in the venous circulation and does not equate to the process a cancer cell must undergo and survive to metastasise from a primary tumour in an immune competent environment. The claims around these assays should be significantly reconsidered.<br /> - Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      It is not explained or justified what the control cohort in Fig 7F is significantly smaller than the treated cohort. This will affect the statistical analysis and interpretation. There is no statement regarding blinding/randomisation (or not) in the in vivo simvastatin experiment - this needs to be added.

      The authors should include discussion that these are relatively long latency OS models compared to p53/pRb compound mutants and contrast with previous data from these models where in vitro cultured cells did give rise to OS in vivo after Cre treatment.<br /> - Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      If a patient could to be treated based on these data then the extra experiments to provide a robust preclinical dataset should be provided otherwise significant caution should be stated.<br /> - Are the data and the methods presented in such a way that they can be reproduced?

      See comments regarding cells used for injection and blinding.

      Need to more clearly describe the cells being injected and what was done to them from isolation to injection.<br /> - Are the experiments adequately replicated and statistical analysis adequate?

      Unclear if appropriate experiment completed in Fig 7F as no justification of different sample sizes is provided nor a statement re blinding/randomisation.

      Minor comments:

      • Specific experimental issues that are easily addressable.

      The Osx1-Cre expresses a Cre:GFP fusion - the authors should correlate the GFP and tomato signal.

      Fig 2A- if 50% of the bone marrow is tdTom positive this is not evident in the image in Fig 1D. Quantify the images in Fig 1D.

      The tumor images in Fig 2C appear to have only sporadic tdTom positive cells - the authors should explain this further.

      Need statistics added to all GSEA plots

      Panel 4C is very different than 2C - 4C is more consistent with the levels of tomato stated<br /> - Are prior studies referenced appropriately?

      This seems appropriate<br /> - Are the text and figures clear and accurate?

      Figures are not ideal and could be improved in terms of clarity and text sizes

      Several sections of text are either contradictory or questionably accurate:<br /> page 3: Molecular studies of OS are significantly hindered by its genetic complexity and chromosomal instability, which precludes the identification of a single recurrent event associated with OS.<br /> Contrasts with the following text:<br /> Page 18 - p53 has been extensively shown to play a central role in OS development in both human and mouse models.

      The data from sequencing of human OS and mouse models and canine data all point to p53 loss as being a central event in OS.

      Page 18: High genetic heterogeneity and chromosomal instability limit the early diagnosis of<br /> OS and lead to lung metastases and a worse prognosis.<br /> I don't understand this statement given that intratumor characteristics are not a determinant of early diagnosis - the patient being aware they have an issue and the clinical follow up determine the rate of diagnosis (and access to healthcare).

      Page 21: Consistent with their roles as tumor suppressor genes, the combined deletion of<br /> WWOX and p53 in Osx1-positive progenitor cells resulted in their transformation<br /> and growth advantage.

      Didn't the authors reach this conclusion from their previous work published in 2016?<br /> - Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      improve figure clarity and text sizes

      Significance

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      I think this is largely an incremental study which largely confirms previous studies.<br /> - Place the work in the context of the existing literature (provide references, where appropriate).

      The study is a modest advance over the existing literature.<br /> - State what audience might be interested in and influenced by the reported findings.

      This would be relevant to basic sarcoma researchers.<br /> - Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Generated multiple murine models of OS and characterized and applied them for biological understanding and preclinical studies.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In current study, the authors established a mouse model with tdTomato expression under the OSX-controlled double deletions of Wwox and Trp53. Such mouse strain gives a great platform to study the OS development and therapeutic potential. Experiments are clear and convincing. Results are well presented.

      To better improve this study, few minor suggestions regarding the data are as following,

      1. Some of the legends on figures are too small to read, or in low quality. please change these labels.
      2. For Figure 7C and D, from 7C, The control WT BM showed clear resistance to the SVA treatment, but in 7D, there is almost no cells in the WT BM group. Data of this group might be missed?
      3. For figure 7G, the difference among MCM7 IHC staining of two groups didn't show as much as the statistic analysis in the right panel. Authors may consider using MCM7 western blot to check its levels after SVA treat.

      Significance

      This study use a transgenic mouse model with tdTomato expressed in combination of loss of p53 and Wwox under the OSX lineage to study early initiation of OS. They found only DKO bone marrow cells can form OS in a subsequent orthotopic mouse model, but not the p53 single KO cells. After compare the RNA-seq from these different cell population, they identified the Myc pathway is the key player to promote OS development, especially the MCM7. Moreover, they tested SVA in treating these BM cells and reveal a therapeutic potential.

      This animal model is a good platform to study OS, especially at the early stage. Most results are clear and convincing. With the identification of Myc pathway, they further tested the SVA effects on treating these DKO BM. This is an important study and provided meaningful information to the OS, even broad cancer research community. However, the significance, or novelty of this work is not sufficient.

      For instance, SKO BM won't form tumor in the IT injection assays compare to the DKO BM groups, therefore, the involvement of Wwox during the OS tumorigenesis is clear. However, authors didn't explore any potential mechanisms of Wwox function or related signaling behind this observation. And the RNA-seq analysis mostly focus on c-Myc pathway and its downstream targets. Given the well known relationship of p53, c-myc even RB in the OS, it will be more interesting and attractive to see a clear mechanisms of Wwox in this context.

      Second, since authors took effort to generate this Tomato-DKO mice, it could be more clear if they isolate tdTomato positive cells instead of a mixture of BM, culture them, differentiate them, and perform more assays using these cells. In this way, it will give better clean background for all assays, and may be able to find novel effectors during this OS progression process.

      Third, within the text, authors tried to use OB differentiation and some other assays to discuss the OS origin cells, MSC or OB; but didn't get a preferred conclusion. It could be possible to better understand this process with the single cell RNA-seq using these BM from different mice or at different ages.

      In general, this is a clean, straightforward study, and they established a very useful model to study OS. But the mechanisms merit is somewhere short.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The study "Mesenchymal stem cell models reveal critical role of Myc as early molecular event in osteosarcomagenesis" by Akkawi et al shows that BM-MSCs are a foundational tool for study of osteosarcoma. And authors identified Myc and its targets as early molecular events in osteosarcoma formation, using BM-MSCs knocked out of both p53 and Wwox. Although the quality and validity of the data presented in this manuscript are not in question, this reviewer has doubts about the novelty of the findings in this current version of manuscript. It does not clearly indicate what is different from previous findings, such as;

      1. It has already been reported that p53-/- BM-MSCs are the cells of origin in osteosarcoma development (ref.19).
      2. Indispensability of Myc in osteosarcomagenesis was revealed (PMID: 12098700).
      3. Osteosarcoma formation of p53flox-OsxCre mice was rescued by Myc-depletion and BM-MSCs from p53flox-OsxCre was shown to upregulate Myc (PMID: 34803166).<br /> First of all, the authors need to cite the above papers and compare their findings with them to better clarify the value of their findings.

      The only one clear finding would be that Wwox functions as a tumor suppressor by repressing Myc function in the absence of p53, but unfortunately, no data have been presented on the mechanism. Some additional analysis would be needed to mention it. In the first place, Myc is upregulated in the absence of both p53 and Wwox, compared in only p53-null situation? Western blotting would be better to show it.

      1. In Figure 1D, should separate each panel so that it is clearly visible. What is the blue-colored fluorescence, DAPI? If so, why don't tdTomoto positive cells overlap with blue (Figs, 1D, 2C, 4C, 4E?
      2. Why was MCM7 chosen among the Myc targets (S Figure 3)? What is the rationale for this?
      3. In Figure 5 legend, what does "yBM cells (1.5, 4-months)(n=6)" mean? yBM cells (1.5-months)(n=3) and yBM cells (4-months)(n=3)?
      4. In Figure 7B, is there a correlation between MCM7 and Myc protein expression levels? Also, do MCM7 and Myc immunopositivites overlap in Figure 7G?
      5. In S Figure 4C, what is 'PC'? What sample was loaded?
      6. In S Figure 2A, what does 'US' (BM-US) mean? In S Figure 4F, what does 'US' and 'S' (Direct US and Direct S) mean?
      7. Overall this manuscript, there are too many symbols and it is cumbersome. Ex, in S Figure 3, yBM_DKO, Tum_DKO, DKOT, DKO-BMT, etc. All figures should be consistent with the same notation.

      Significance

      Although the quality and validity of the data presented in this manuscript are not in question, this reviewer has doubts about the novelty of the findings in this current version of manuscript. It does not clearly indicate what is different from previous findings, such as;

      1. It has already been reported that p53-/- BM-MSCs are the cells of origin in osteosarcoma development (ref.19).
      2. Indispensability of Myc in osteosarcomagenesis was revealed (PMID: 12098700).
      3. Osteosarcoma formation of p53flox-OsxCre mice was rescued by Myc-depletion and BM-MSCs from p53flox-OsxCre was shown to upregulate Myc (PMID: 34803166).<br /> First of all, the authors need to cite the above papers and compare their findings with them to better clarify the value of their findings.<br /> The only one clear finding would be that Wwox functions as a tumor suppressor by repressing Myc function in the absence of p53, but unfortunately, no data have been presented on the mechanism.
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      Summary:<br /> Plasmodium sporozoites rely on gliding motility to invade the salivary glands of the mosquito vector where they reside until being inoculated into the vertebrate host. Once in the vertebrate host, sporozoites again have to glide to pass through liver cells and reach the final host cell before exo-erythrocytic replication occurs. In sporozoites, thrombospondin-related anonymous protein (TRAP) is the key adhesin, linking the molecular motor to the substrate. TRAP and TRAP-like proteins contain on the extracellular side an inserted (I) domain that is responsible for substrate binding. The I domain can be in an open or closed state which can be fixed by mutating specific amino acids. Braumann et al. then assessed the effect of these states on gliding motility and infection. Whilst no effect was seen for both mutants with closed or open states until the production of haemolymph sporozoites, the number of salivary gland sporozoites were highly reduced in both mutants. The closed mutant was not able to be transmitted from mosquitoes to mice whilst the open mutant is severely impacted in transmission. Gliding of both mutant is highly impaired. Some of these phenotypes could be reverse by adding a reducing agent.

      Major comments:<br /> This is an elegant study with exhaustive experiments to address the research questions. One of the things I wondered about is the effect of exchanging amino acids. As far as I understood, structural information of integrins from other organisms informed the authors about positions that should be mutated and about the impact (or loss of it) on the 3D structure of the domain. Would it not be useful to run a structure prediction programme such as Alphafold on all the mutants to at least confirm stability of the domain structure upon mutation in silico?_

      A: Thanks for this suggestion, we added the crystal structure models of P. falciparum and P. vivax as well as the Alphafold models of the open and closed state of P. berghei TRAP as new panels in Figure 1, added some corresponding text to the results, materials and methods, and the figure legend.

      Some of the concentrations of reducing agents tested are very high. Can the authors be sure that the parasites are not dead?

      A: We used sporozoites expressing GFP in the cytosol and did not see loss of fluorescence. While this does not rule out that the parasites are not alive anymore, it shows that the plasma membrane was not compromised. Importantly, when using the more moderate concentrations that rescued motility, wild type parasites were also moving, showing that the parasites were alive.

      Minor comments:<br /> -Please make sure that punctuation is correct (e.g. missing commas) and that there are no other typing errors.

      A: We carefully read and edited the manuscript again and hopefully corrected all those errors.

      • Line 50: This sentence may imply mechanical rupture of oocysts rather than active egress of the sporozoite. Please re-phrase.

      A: rephrased, it now reads “egress” instead of “burst”. (now line 53)

      • Line 82: Do you mean a complexed Mg2+ ion?

      A: Yes, this sentence was revised. (now line 99)

      • The introduction stops rather abruptly. Maybe a sentence of the significance of this study could be added.

      A: we added the following: “Our results suggest that active change between the open and closed conformation of the TRAP I domain is essential for sporozoite invasion of salivary glands and transmission from mosquitoes to mammals.” (line 122-125).

      • Line 361: 20 million parasites each? Please re-phrase to make it clearer.

      A: done, it now reads: “…into each of two naïve mice…”.(now line 517)

      • Line 363: Field of view needs to defined: What is the magnification used to observe exflagellation?

      A: done, it now reads: “as observed with a Zeiss Axiostar using a 100x objective lens – revealing 300-400 red blood cells per field of view) – now line 519-521.”

      • Materials and Methods: Please write out reagent names for the first time.

      A: done, e.g. “phosphate buffered saline” for PBS; line 540; Roswell Park Memorial Institute medium 1640 for RPMI; line 420; as well as for DTT and TCEP (lines 560, 561), BSA (line 565), etc

      Figures:<br /> - Figure 1A is very small. The label font of the whole figure 1 is often too small.

      A: We intentionally kept Figure 1A small as most readers will be familiar with the life cycle but increased font size as much as possible throughout the figure including Figure 1B, which we needed to shrink in the new design to accommodate the Alphafold structures.

      • Figure 1D: Please list the components in the figure legend, e.g. blue: substrate etc.

      A: done, now lines 722-725

      • Figure 3: The figure title should be changed as there is no complete failure of sporozoites with fixed I-domains to invade salivary glands.

      A: done, it now reads: “…show strong reduction in salivary gland invasion”, line 790-791

      • Figure 5: for clarity, it would be easier if Figure C would not be squeezed into the legends of A and B.

      A: We agree this is a tricky arrangement, but when composing the figure, we tried many different ways, which were all unsatisfactory too, leading to either too awkward an arrangement or too much white between the panels. We hence, despite anticipating this critique, decided on this arrangement and would hence like to keep it. However, we changed the color of the box around C so that it is marked more differently.

      Reviewer #1 (Significance):

      This study addresses in detail the mechanism of Plasmodium TRAP I domain in gliding motility and transmission. It builds on work from many years and groups including their own and contributes to deepen our understanding of TRAP-family proteins, gliding motility in Plasmodium sporozoites and maybe even in other Plasmodium stages or other Apicomplexan parasites.

      This work is of interest to researchers in the field of Plasmodium mosquito stages and transmission as well as scientist who work on apicomplexan gliding motility and transmission.

      I have previously worked on Plasmodium mosquito stages, but currently work on Toxoplasma_ gondii.

      A: Thank you for your appreciation of our study, the mechanistic insights it gives into gliding and transmission, and the helpful critique.

      Reviewer #2 (Evidence, reproducibility and clarity):

      This work seeks to investigate the effects on sporozoite motility of hypothesized conformational changes in TRAP's integrin domain. Previous structural studies suggested that the Integrin-like domain of TRAP assumes 'open' and 'closed' conformations induced by ligand binding. Here the authors hypothesize that TRAP's ability to dynamically switch between these states is crucial for sporozoite motility. The hypothesis is interesting and the authors elected to test it by 'fixing' TRAP in constitutively 'open' and 'closed' conformations by introducing Cys residues that are presumed to form disulphide bonds resulting in these states.

      Major Comments<br /> The approach is creative. The data that are presented are of high quality with adequate reproducibility. However, as written the manuscript does not provide a rationale for the specific substitutions they chose, how these substitutions are expected to lead to 'open' and 'closed' states, and how they mimic the natural route of TRAP transitioning between the 'open' and 'closed' conformations._

      A: We now add a more detailed rationale at the very start of the results section, which now reads: “We used closed and open structures of TRAP from P. falciparum and P. vivax, respectively (Song et al., 2012), to design cysteine mutations in P. berghei (Fig. 1E-J). The TRAP I domain of P. berghei is 42 and 48% identical in sequence to those of P. vivax and P. falciparum, respectively; lower identity was used for successful introduction of a disulfide into integrin αI domains (Shimaoka et al., 2001; Shimaoka et al., 2003). Between the open and closed TRAP I domain conformations, the I domain α7-helix pistons 9 Å relative to the neighboring β6-strand; therefore, disulfides introduced between these two structural elements can stabilize one state over the other, as previously pioneered in integrin I domains. β6-strand and α7-helix residues with Cβ atoms within 5 Å of one another in structures of the two states were chosen for mutation to cysteine (Fig. 1G&H). P. falciparum TRAP-Fc fusions with homologous cysteine mutations were well expressed in mammalian cells (Koksal et al,, 2013). Using the TRAP sequence alignment (Fig. 1F), homologous residues in P. berghei TRAP were mutated to cysteine to stabilize the closed conformation (Ser-210 and Phe-224 in the S210C/F224C mutation) and the open conformation (Ser-210 and Gln-216 in the S210C/Q216C mutation). AlphaFold (Mirdita et al 2022) predicted that the P. berghei TRAP I domains were well folded and assumed the desired conformations with formation of the mutationally introduced disulfide bonds (Fig. 1I&J). The I domain of P. berghei is 42 and 48% identical in sequence to those of P. vivax and P. falciparum in which the open and closed conformations are defined, assuring highly confident modeling (Song et al., 2012). Cysteines were substituted in positions that were sufficiently close in one conformation to form a disulfide but not in the alternative conformation..” lines 130-202 and also provided a detailed view of the structures in Figure 1.

      Furthermore, there is no biochemical, biophysical or modeling data demonstrating that the introduced mutations impact the folding/unfolding of TRAP's I domain in the manner hypothesized. Therefore, it is difficult to interpret subsequent phenotypic data from the two mutant lines. While mutant parasites display defects in gliding motility, these defects are unexpected, perhaps pointing to alternative explanations - such as aberrant inter- or intra-molecular disulphide bonding in TRAP's extracellular domain.

      A: The ability of such mutations to give biologically meaningful results has already been demonstrated in integrin I domains, where ligand-binding affinity was measured. We now describe the rationale in more detail, and demonstrate that the cysteines are recognized by Alphafold to yield well-folded domains that are stabilized in the desired conformations. These are presented as new panels in Figure 1.

      About 10% of mutant sporozoites assumed to be in a constitutively 'closed' conformation display gliding motility and they move faster that WT. Yet this mutant did not cause patency in mice when introduced either via mosquito bite or IV injection. In contrast, the mutant assumed to be in an 'open' conformation displayed no motility in vitro but was able to infect mice (albeit at a significantly reduced rate compared to controls). Presumably, these data suggest that the in vitro gliding motility assays used are insufficient for testing the effect of these mutations on motility that is relevant in vivo. The model is that TRAP's interaction with extracellular ligands stabilizes its 'open' position. This suggests that motility assays conducted with extracellular matrix eg Matrigel are a more appropriate test of motility.

      A: The reviewer raises interesting points. There are several types of sporozoite motility assays available, 2D on glass, 2D on ligands (e.g. Matrigel), 3D in polyacrylamide gels or Matrigel, and 3D in the skin. All of these have a number of advantages and disadvantages. 2D on glass is clearly the easiest, 3D in skin, clearly the most complex one. The advantage of the 2D on glass assay is that it reveals even tiny defects on motility that cannot be revealed in 3D assays as the enclosure of the parasite in a 3D matrix compensates for several defects, especially those in adhesion that are most relevant for our study here (see also e.g. Bane et al. Plos Path 2016, Ripp et al., EMBO Mol Med 2021). Hence, we believe that for understanding the role of adhesion in motility the 2D assay is highly valuable because it represents a minimal system. In contrast, the complex 3D environments, are closer to the natural situation but are less useful in our specific case. The fact that the mutants are severely limited in vivo (in the mosquito where they are blocked at the 2D surface of the salivary gland) suggests that the assays are highly relevant. We take this comment as a motivation to write a review/opinion like paper in the near future but feel it would distract if added here to e.g. the discussion.

      Experiments with DTT are difficult to interpret since there is once again no biochemical evidence that this treatment leads to a change in conformation of TRAP. DTT's effect on motility of the mutant could be non-specific. Overall, conclusions that are presented need to be supported by more data.

      A: We are aware of this and hence already discussed these potential shortcomings of our study in the discussion. Importantly: there is no known specific ligand to the TRAP I domain. Hence, we believe that biochemical tests would not justify the effort it would take to express the different domains.

      Reviewer #2 (Significance):

      Sporozoite motility is a prerequisite for infection by Plasmodium of the liver. A better mechanistic understanding of this process is significant for our understanding of the first step of malaria infection. TRAP is the major adhesin on the sporozoite surface and its loss abrogates sporozoite motility. The authors are to be commended for undertaking a challenging study.

      A: We thank the reviewer for appreciating our efforts, the advance provided, and for the constructive critique.

      Reviewer #3 (Evidence, reproducibility and clarity):

      This paper builds on previous structural studies from the Springer lab, which show that the I-domain of the malaria sporozoite surface protein TRAP can switch between two conformations ("open" and "closed"), similar to what happens with the I domain of integrins. In the current study the authors explore whether the open and closed conformations of TRAP are important for sporozoite migration and infectivity by generating parasites expressing each form locked in place using introduced disulfides. Locking TRAP into either form inhibits sporozoite gliding, invasion of the mosquito salivary glands and transmission from mosquito to mouse. The addition of low levels of a reducing agent can partially rescue these effects with the open form, which the authors suggest points to a requirement for TRAP to undergo a switch between its open and closed states to support these key processes in the parasite's life cycle.

      The paper is well written and the data and methods are clearly presented.

      Major Comments:

      Lines 109-115: The entire paper relies on the premise that the introduced disulfides lock the I domain of TRAP in either the open or closed conformation. In the absence of experimental proof that this is the case, it would be helpful to the reader to have more detail on how this can be confidently inferred from the previous work on integrins -- perhaps as a supplementary figure._

      A: We now added a statement on how the positions for the cysteines were selected and also a figure on structures and Alphafold prediction as also suggested by reviewers 1 and 2 as panels in Figure 1.

      The partial rescue of motility in the S210C/Q216C parasites by 50-100mM DTT is a VERY indirect approach to testing whether the conformational switch between the open and closed states is functionally important. The authors are appropriately reserved in their conclusions, but wildtype parasites are ultimately a better (less confounded) comparator; the authors may want to stress this more._

      A: Thanks for appreciating our efforts to navigate the limitations of our experimental system. We have changed our wording (e.g. replaced “fixed state” with “stabilized state” in the discussion) and added cautionary statements, which now read “While DTT clearly does not only act on TRAP, these data nevertheless suggest that…” (lines 353-354); “While not providing final proof, this phenotype indicates…” (lines 371); “…antibodies that stabilize… could contribute to stopping parasite migration” (line 415)

      The implications of the current results for the authors' previous stick-and-slip model of sporozoite motility should be discussed.

      A: We added a few sentences including two references on this in the discussion: “Sporozoites glide in a stick-slip fashion…” (lines 417-422)

      Minor Comments:

      The authors are experienced in the use reflection interference contrast microscopy to visualize attachment of the parasite to the substrate. Did they do any RICM on the mutants? Although not necessary for the paper, this would be a good way to support the interpretation of some of their results (eg, lines 185-190)._

      A: We indeed hoped that the mutants would allow us to exploit these techniques as this would give much insight into the mode of migration. However, all our previous work on RICM was done with salivary gland derived sporozoites, which are robustly gliding. In contrast, those derived from the hemolymph or oocysts do not glide very well. While we can quantitatively image them at low magnification (large field of view) settings, we have consistently failed to get sufficient data on most of our advanced assays that require single sporozoite imaging such as RICM, TIRFM, and laser tweezer experiments. This, unfortunately, is a real limitation of the system as most interesting mutants (see also e.g. recent paper by Yee et al., Plos Pathogens 2022) are not entering the salivary glands.

      Line 127: Figure 2A does not show "no growth difference to wild type mice"

      A: we split the sentence in two with Figure 2A now only referring to mosquito infections (now line 212)

      Line 154: "higher, but not significantly higher" - if the data don't meet the significance threshold being used, they cannot be called higher

      A: Yes, the thing here is that we always got more from the open mutant and hence could do experiments but indeed the stats showed it not to be significant. We changed the sentence to read “…was not significantly higher…” (line 242)

      Line 186: "showed nearly no floating parasites compared to the controls S210C and cFluo" - cFluo and S210C/Q216C show the same amount of floaters in Fig 5B. Also, S210C/Q216C HLS show similar levels of floaters to both controls in 2A.

      A: Thanks for spotting this mixup, we changed it to: “Interestingly, hemolymph sporozoites expressing the closed I domain (S210CF224C) showed more floating parasites suggesting reduced adhesion. Intriguingly, the few moving sporozoites of this mutant were also significantly faster than the corresponding controls.” (lines 296-299). We also pick up on this observation in the discussion in the new paragraph on stick-slip motility, lines 414-422) which links back to the Munter et al paper cited in line 303. This is in line with observations in mammalian cells where reduced ligand density also leads to less adhesion and faster migration.

      Fig S2 defines unproductive gliding to include waving, but Figs. 5 and S3 scores waving as a separate category

      A: We define it as unproductive motility, which we now changed into “unproductive movement” in the hope to be less misleading, clearly “lazy gliding” is motility while waving is no motility but some type of movement.

      Fig S3B and Fig 5D,E appear to be the same data presented twice

      A: Correct, we now state this explicitly in the figure legend to Figure S3B (lines 958-960) where they are reproduced together with the matching controls

      Line 304: "the inability of sporozoites with the TRAP I domain to migrate" (?)

      A: “conformationally stabilized” was missing and has now been included (line 453)

      Line 226: please explain what the + > ++++ qualitative descriptors signify in the tables and how they were scored

      A: Now added in the legends to the table, lines 885-887 and 892, respectively.

      Lines 282, 312: the authors should mention here the extensive work that has been done on efficacy of viral vaccines directed against a particular conformational state of the immunogen

      A: We were naturally tempted to do this but feel that this could hype the study more than is justified by our data.

      Fig 2B: The labels above the lanes are incomplete and therefore confusing; suggest sticking to the same nomenclature as in 2A

      A: Modified as suggested

      Typographical errors on lines: 58 (space missing), 80-81 (parentheses), 155 (Figure misspelled), 188 (expressing the closed (S210C/F224C)), 306 (comma after both)

      A: Thanks, these were corrected.

      CROSS-CONSULTATION COMMENTS<br /> Since all three reviewers questioned whether the introduced disulfides would have the assumed effects on I domain structure, the authors should provide a stronger rationale for this assumption or -- as suggested by reviewer 2 -- some actual data to support it. Reviewer 2's comment about the extracellular ligands available for the parasite to bind to in the gliding assay and whether this could influence the outcome (and relevance to what occurs in vivo) also deserves consideration.

      A: We have now added Alphafold predictions of the mutants (Figure 1) and also described better how we selected the mutations based on extensive work by the Springer lab (see newly added lines 130-202). We appreciate the idea of using extracellular ligands, however, all our previous assays (e.g. Klug et al. eLife 2020 and Perschmann et al., Nano Letter 2011) suggest that the parasites move on a large variety of surfaces at the same rate.

      Reviewer #3 (Significance):

      This is an elegant study that contributes important new information to our understanding of apicomplexan parasite motility and the function of the TRAP protein. The results will be of significant interest to those who study parasite motility, and likely also to those who study the role of integrins in cellular adhesion and signaling. The data nicely connect what was previously known about conformational changes in integrins with parasite adhesion to the substrate and motility.

      I have expertise in the area of parasite motility._

      A: We thank the reviewer for the constructive comments and appreciation of our work

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This paper builds on previous structural studies from the Springer lab, which show that the I-domain of the malaria sporozoite surface protein TRAP can switch between two conformations ("open" and "closed"), similar to what happens with the I domain of integrins. In the current study the authors explore whether the open and closed conformations of TRAP are important for sporozoite migration and infectivity by generating parasites expressing each form locked in place using introduced disulfides. Locking TRAP into either form inhibits sporozoite gliding, invasion of the mosquito salivary glands and transmission from mosquito to mouse. The addition of low levels of a reducing agent can partially rescue these effects with the open form, which the authors suggest points to a requirement for TRAP to undergo a switch between its open and closed states to support these key processes in the parasite's life cycle.

      The paper is well written and the data and methods are clearly presented.

      Major Comments:

      Lines 109-115: The entire paper relies on the premise that the introduced disulfides lock the I domain of TRAP in either the open or closed conformation. In the absence of experimental proof that this is the case, it would be helpful to the reader to have more detail on how this can be confidently inferred from the previous work on integrins -- perhaps as a supplementary figure.

      The partial rescue of motility in the S210C/Q216C parasites by 50-100mM DTT is a VERY indirect approach to testing whether the conformational switch between the open and closed states is functionally important. The authors are appropriately reserved in their conclusions, but wildtype parasites are ultimately a better (less confounded) comparator; the authors may want to stress this more.

      The implications of the current results for the authors' previous stick-and-slip model of sporozoite motility should be discussed.

      Minor Comments:

      The authors are experienced in the use reflection interference contrast microscopy to visualize attachment of the parasite to the substrate. Did they do any RICM on the mutants? Although not necessary for the paper, this would be a good way to support the interpretation of some of their results (eg, lines 185-190).

      Line 127: Figure 2A does not show "no growth difference to wild type mice"

      Line 154: "higher, but not significantly higher" - if the data don't meet the significance threshold being used, they cannot be called higher

      Line 186: "showed nearly no floating parasites compared to the controls S210C and cFluo" - cFluo and S210C/Q216C show the same amount of floaters in Fig 5B. Also, S210C/Q216C HLS show similar levels of floaters to both controls in 2A.

      Fig S2 defines unproductive gliding to include waving, but Figs. 5 and S3 scores waving as a separate category

      Fig S3B and Fig 5D,E appear to be the same data presented twice

      Line 304: "the inability of sporozoites with the TRAP I domain to migrate" (?)

      Line 226: please explain what the + > ++++ qualitative descriptors signify in the tables and how they were scored

      Lines 282, 312: the authors should mention here the extensive work that has been done on efficacy of viral vaccines directed against a particular conformational state of the immunogen

      Fig 2B: The labels above the lanes are incomplete and therefore confusing; suggest sticking to the same nomenclature as in 2A

      Typographical errors on lines: 58 (space missing), 80-81 (parentheses), 155 (Figure misspelled), 188 (expressing the closed (S210C/F224C)), 306 (comma after both)

      Referees cross-commenting

      Since all three reviewers questioned whether the introduced disulfides would have the assumed effects on I domain structure, the authors should provide a stronger rationale for this assumption or -- as suggested by reviewer 2 -- some actual data to support it. Reviewer 2's comment about the extracellular ligands available for the parasite to bind to in the gliding assay and whether this could influence the outcome (and relevance to what occurs in vivo) also deserves consideration.

      Significance

      This is an elegant study that contributes important new information to our understanding of apicomplexan parasite motility and the function of the TRAP protein. The results will be of significant interest to those who study parasite motility, and likely also to those who study the role of integrins in cellular adhesion and signaling. The data nicely connect what was previously known about conformational changes in integrins with parasite adhesion to the substrate and motility.

      I have expertise in the area of parasite motility.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This work seeks to investigate the effects on sporozoite motility of hypothesized conformational changes in TRAP's integrin domain. Previous structural studies suggested that the Integrin-like domain of TRAP assumes 'open' and 'closed' conformations induced by ligand binding. Here the authors hypothesize that TRAP's ability to dynamically switch between these states is crucial for sporozoite motility. The hypothesis is interesting and the authors elected to test it by 'fixing' TRAP in constitutively 'open' and 'closed' conformations by introducing Cys residues that are presumed to form disulphide bonds resulting in these states.

      Major Comments

      The approach is creative. The data that are presented are of high quality with adequate reproducibility. However, as written the manuscript does not provide a rationale for the specific substitutions they chose, how these substitutions are expected to lead to 'open' and 'closed' states, and how they mimic the natural route of TRAP transitioning between the 'open' and 'closed' conformations.

      Furthermore, there is no biochemical, biophysical or modeling data demonstrating that the introduced mutations impact the folding/unfolding of TRAP's I domain in the manner hypothesized. Therefore, it is difficult to interpret subsequent phenotypic data from the two mutant lines. While mutant parasites display defects in gliding motility, these defects are unexpected, perhaps pointing to alternative explanations - such as aberrant inter- or intra-molecular disulphide bonding in TRAP's extracellular domain.

      About 10% of mutant sporozoites assumed to be in a constitutively 'closed' conformation display gliding motility and they move faster that WT. Yet this mutant did not cause patency in mice when introduced either via mosquito bite or IV injection. In contrast, the mutant assumed to be in an 'open' conformation displayed no motility in vitro but was able to infect mice (albeit at significantly reduced compared to controls). Presumably these data suggest that the in vitro gliding motility assays used are insufficient for testing the effect of these mutations on motility that is relevant in vivo. The model is that TRAP's interaction with extracellular ligands stabilizes its 'open' position. This suggests that motility assays conducted with extracellular matrix eg Matrigel are a more appropriate test of motility.

      Experiments with DTT are difficult to interpret since there is once again no biochemical evidence that this treatment leads to a change in conformation of TRAP. DTT's effect on motility of the mutant could be non-specific. Overall, conclusions that are presented need to be supported by more data.

      Significance

      Sporozoite motility is a prerequisite for infection by Plasmodium of the liver. A better mechanistic understanding of this process is significant for our understanding of the first step of malaria infection. TRAP is the major adhesin on the sporozoite surface and its loss abrogates sporozoite motility. The authors are to be commended for undertaking a challenging study.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Plasmodium sporozoites rely on gliding motility to invade the salivary glands of the mosquito vector where they reside until being inoculated into the vertebrate host. Once in the vertebrate host, sporozoites again have to glide to pass through liver cells and reach the final host cell before exo-erythrocytic replication occurs. In sporozoites, thrombospondin-related anonymous protein (TRAP) is the key adhesin, linking the molecular motor to the substrate. TRAP and TRAP-like proteins contain on the extracellular side an inserted (I) domain that is responsible for substrate binding. The I domain can be in an open or closed state which can be fixed by mutating specific amino acids. Baumann et al. then assessed the effect of these states on gliding motility and infection. Whilst no effect was seen for both mutants with closed or open states until the production of haemolymph sporozoites, the number of salivary gland sporozoites were highly reduced in both mutants. The closed mutant was not able to be transmitted from mosquitoes to mice whilst the open mutant is severely impacted in transmission. Gliding of both mutant is highly impaired. Some of these phenotypes could be reverse by adding a reducing agent.

      Major comments:

      This is an elegant study with exhaustive experiments to address the research questions. One of the things I wondered about is the effect of exchanging amino acids. As far as I understood, structural information of integrins from other organisms informed the authors about positions that should be mutated and about the impact (or loss of it) on the 3D structure of the domain. Would it not be useful to run a structure prediction programme such as Alphafold on all the mutants to at least confirm stability of the domain structure upon mutation in silico?

      Some of the concentrations of reducing agents tested are very high. Can the authors be sure that the parasites are not dead?

      Minor comments:

      • Please make sure that punctuation is correct (e.g. missing commas) and that there are no other typing errors.
      • Line 50: This sentence may imply mechanical rupture of oocysts rather than active egress of the sporozoite. Please re-phrase.
      • Line 82: Do you mean a complexed Mg2+ ion?
      • The introduction stops rather abruptly. Maybe a sentence of the significance of this study could be added.
      • Line 361: 20 million parasites each? Please re-phrase to make it clearer.
      • Line 363: Field of view needs to defined: What is the magnification used to observe exflagellation?
      • Materials and Methods: Please write out reagent names for the first time.

      Figures:

      • Figure 1A is very small. The label font of the whole figure 1 is often too small.
      • Figure 1D: Please list the components in the figure legend, e.g. blue: substrate etc.
      • Figure 3: The figure title should be changed as there is no complete failure of sporozoites with fixed I-domains to invade salivary glands.
      • Figure 5: for clarity, it would be easier if Figure C would not be squeezed into the legends of A and B.

      Significance

      This study addresses in detail the mechanism of Plasmodium TRAP I domain in gliding motility and transmission. It builds on work from many years and groups including their own and contributes to deepen our understanding of TRAP-family proteins, gliding motility in Plasmodium sporozoites and maybe even in other Plasmodium stages or other Apicomplexan parasites.

      This work is of interest to researchers in the field of Plasmodium mosquito stages and transmission as well as scientist who work on apicomplexan gliding motility and transmission.

      I have previously worked on Plasmodium mosquito stages, but currently work on Toxoplasma gondii.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The Kim et al. paper titled "PRMT5 links lipid metabolism to contractile function of skeletal muscles" reports how the arginine methyltransferase PRMT5 affects lipid metabolism in myofibers by stabilizing the mSREBP1 protein and repressing the expression of the PNPLA2 gene. The genetic deletion of PRMT5 in muscle results in the loss of lipid droplets in myofibers and a loss in muscle strength. Additionally, there is a change in muscle fiber types, moving from an oxidative state to a more glycolytic one. While the authors present compelling data on PRMT5's role in muscle metabolism, there are some concerns on the mouse model used and the sequencing data.

      Major concerns:

      1. The mouse model used in this study is PRMT5fl/fl , Myl1cre in order to genetically delete PRMT5 in skeletal muscle. While there is no issue with the KO mice, the WT mice are PRMT5fl/fl , Myl1+ which is not an acceptable control. It is known that Cre itself can have a phenotype, and additionally Myl1 is very highly expressed. Thereby, there is a large amount of Cre in the KO mice, but none in the WT which may contribute to the differences seen between WT and KO mice. The appropriate WT control is PRMT5+/+ Myl1cre and the experiments would need to be repeated using this mouse genotype as the WT.

      2. We appreciated the comment and have analyzed many mice from the various control groups (WT, Myl1Cre, Prmt5f/f, and Myl1Cre/Prmt5f/+). Long story short, we have maintained and used Myl1Cre for multiple projects and in several previous publications (PMID: 25794679; PMID: 27644105), and never observed a phenotype of the Myl1Cre In the current study during the development of the Myl1Cre-Prmt5KO mouse model, we had to first breed Myl1Cre with Prmt5f/f to generate the Myl1Cre/Prmt5f/+ mice, and then breed Myl1Cre/Prmt5f/+ with Prmt5f/fmice to generate the Myl1Cre/Prmt5f/f mice. During the breeding we had generated many Myl1Cre/Prmt5f/+ mice (at least 10). We only observed phenotypes in the Myl1Cre/Prmt5f/f mice but not in the Myl1Cre/Prmt5f/+ (heterozygous KO) mice. In line with our observation, no phenotypes were described in the original report on the generation of the Myl1Cre mice by Steve J. Burden and his colleagues (Bothe, Genesis, 2000, PMID: 10686620). Also, in consistent to our choice of the floxed mice as control, Pereira et al (EMBO Molecular Medicine, 2020, PMC7005622 ) used the Ndufsf/+/Myl1Cre-/- or Ndufsf/f/Myl1Cre-/- as control for their Ndufs3f/f/Myl1Cre+/- KO mice.

      3. Given the situation, we trust that the reviewer will agree that the Prmt5f/f mice are appropriate controls and repeating all the experiments with a new control model will not only require years of work but also violate IACUC’s and NIH’s 3R policy in reducing unnecessary use of animals. We added a sentence to state that the Prmt5f/f are phenotypically identical to Myl1Cre/Prmt5f/+ mice in the revised manuscript.

      In the scRNA-Seq the authors claim that PRMT5 is not expressed in quiescent muscle stem cells. However, the data set that is used only has approximately 250 muscle stem cells, which would not provide much coverage. It would be necessary to validate this claim by using other data sets, such as Tabula Muris or publicly available bulk RNA-Seq.

      • As suggested, we queried Tabula Muris on Prmt5 expression in skeletal muscles based on scRNA-seq. The results showed that Prmt5 is expressed at very low levels in various mononuclear cell populations in the skeletal muscle. Specifically, only 8% of satellite cells had detectable levels of Prmt5, while 92% satellite cells had no detectable levels of Prmt5 (Table 1). We included the results in the revised Supplemental Table S1.

      The ChIP-Seq data shown was performed on 3T3-L1 cells and is not appropriate for a muscle paper. The ChIP-Seq must be performed on muscle cells in order to confirm their conclusion.

      • We trust that the reviewer understand that ChIP-seq only represents a discovery tool that needs to be experimentally validated. Although the ChIP-Seq data and identification of the PRMT5 binding peak at the Pnpla2 gene was based on 3T3-L1 cells, we have validated enrichment of PRMT5 on the potential binding region through ChIP-qPCR experiments. Repeating the ChIP-seq on muscle cells will not add additional support to the conclusion.

      The authors claim that loss of PRMT5 leads to a gradual loss of muscle fiber size but has no effect on myogenesis. The evidence to support that claim is shallow, being based solely on CSA and total number of myofibers, along with a loss of lean body mass. To confirm this statement, it would be best to quantify the CSA and # of myofibers in EDL and TA at P7 and P21. Further, a regeneration assay would also demonstrate if myogenesis is compromised or not.

      • Thank you for this suggestion. As Myl1Cre is only expressed in post-differentiation myocytes and myofibers (Bi et al, 2016, eLife, PMID: 27644105), we do not expect the Myl1Cre/Prmt5f/f to impact muscle development. Nevertheless, we now provide data on analysis of muscles at P7 and P21, as well postnatal muscle regeneration. The results are included in Supplementary Fig S2.

      The data presented shows that there is fiber type switch from oxidative to glycolytic, along with a decrease in muscle strength in the PRMT5 KO mice. This seems counterintuitive to what is known in the field as glycolytic fibers are viewed as being capable of generating more force than oxidative, while having less endurance. The authors should clarify this point and elaborate more on their conclusion that the loss of strength is due to an altered metabolism.

      • We agree with the reviewer that an increased abundance of glycolytic myofibers should increase muscle force under normal conditions. However, the increased glycolytic fibers in the Prmt5 mKO mice is associated with metabolic deficiencies. These fibers are atrophic (smaller than control fibers of the same myosin type), devoid of lipid droplets and had less force production. We added the following sentences to the discussion in this matter. Minor concerns:

      • The term myocyte is not the most accurate word for describing skeletal muscle. Myofibers would be best for fully differentiated muscle, myotubes for in vitro differentiation and myocytes should be reserved for differentiated cells that have not fused yet (1-2 nuclei/cell). I would recommend changing all mentions of myocyte to myofiber and changing "myocyte specific" with regards to the mouse models as "skeletal muscle specific"

      • Thank you for your suggestion. We updated the nomenclature accordingly.

      Figure 1 Panel F and G would be clearer if they were labelled as 2 months old mice

      We edited the Figure 1F, and 1G to include the mouse age. 3. Figure 2 Panel E, G and H the control line appears to be missing error bars

      Error bars were in the original panels, but the variation was very small, making it hard to visualize the error bars. 4. Figure 2 legend should specify that these mice are 2 months old for the sake of clarity

      We added mouse age to the Figure 2 legend. 5. Figure 3 Panel G and H are not informative and are misleading. The supplemental panels show that when normalized to body mass there is no difference in O2 consumption or CO2 production. These should be replaced with the supplemental panels

      We reformatted the figure as suggested.

      Figure 4 Panel E and F, are these separate experiments? The values do not match between the 2 panels. If these are separate it should be made more clear. a. Error bars appear to be missing in Panel E

      Error bars were included (as it was obvious after FCCP) but the error bars are small for the rest of the time points. b. As this is an experiment where the state of the cell is incredibly important (metabolism of myoblast is much different to myotube), the authors must demonstrate that there is no defect in in vitro differentiation by showing the fusion index assay for these cells and a representative image of the myotubes.

      The differentiation of the KO cells was normal as Myl1cre is only expressed after differentiation. we isolated myoblasts from WT and Prmt5MKO mice and differentiated for 3 days to stain MyoG and MF20 to measure fusion index. However, we did not see any change in fusion index from differentiated myotubes (Supplementary Fig. S4A)

      c.The authors should mention in the legend that these are 3 DM myotubes

      Figure legends are updated.

      1. Figure 5 Panel G, a qPCR to confirm the O/E of the PRMT5 and SREBP1a in the test samples would be necessary.

      We added the PRMT5 and SREBP1 O/E data (Supplementary Fig S5C, D). a. The double O/E cells are marked as significantly different, but it is unclear to which group they are significantly different to.

      We edited the figure to highlight the comparison. 8. Figure 7 Panel B, body weight would be more informative in g rather than percentage.

      We reformatted the figure as suggested.

      It would be interesting to test whether the KO of Pnpla2 also rescues the fiber type switch.

      We added Fiber type staining in dKO muscles. Based on quantification in Sol and EDL muscles, increased Type IIB (glycolytic myofibers) in Prmt5MKO mice was significantly decreased in Prmt5/Pnpla2MKO mice (Supplementary Fig S6D-F).

      Reviewer #1 (Significance (Required)):

      Overall the manuscript provides insight into the role of PRMT5 in regulating the metabolism of skeletal muscle. While the paper provides some interesting data, it is severely hampered by the improper WT controls lacking the cre alleles. In order for the data to be reliable, all of the WT samples will need to be replaced with PRMT5+/+ Myl1 cre mice. There are other papers looking at the role of PRMT5 in skeletal muscle, however these are more focused on muscle stem cells than the myofibers. Therefore this paper does fill in a gap with regards to the metabolic role of PRMT5 and how this can affect skeletal muscle function. This paper would most likely be of interest to a specialized audience, mostly those in the skeletal muscle field.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In the manuscript "PRMT5 links lipid metabolism to contractile function of skeletal muscles", Kim et al., describe the role for the arginine methyl transferase PRMT5 in maintaining skeletal muscle homeostasis. The authors showed that myocyte-specific deletion of PRTM5 results in the loss of muscle mass, reduced motor-performance, a fiber type switch from oxidative to glycolytic fibers along with reduced lipid content in the myofibers. The authors reasoned that absence of PRMT5 results in reduced methylation and stability of mSREBP1 and an increase in the expression of adipose triglyceride lipase (ATGL).

      Major Comments

      1. Experiments looking at the interaction between PRMT5 and mSREBP1a using overexpressed proteins are used to conclude that PRMT5 methylates SREBP1a. While the results are consistent with these conclusions, the finding remains correlative. Methylation assays using purified PRMT5 and SREBP1a would be required to make a definite conclusion that PRMT5 methylates SREBP1a. These should be performed. In the absence of such data, the authors would need to adjust their conclusions to say that in the presence of PRMT5, SREBP1a becomes methylated, and that it remains to be determined if this is directly mediated by PRMT5.

      [response] We thank the reviewer for this comment and wished we could perform in vitro methylation assay to address whether SREBP1a is directly methylated by PRMT5. However, our co-author (Dr. Changdeng Hu) who is an expert of PRMT5 biochemistry unfortunately died recently, hampering the validation of SREBP1 as PRMT5 substrate. We would also like to mention that several other studies have reported SREBP1 as substrate of PRMT5 in cancer cells (Liu et al, 2016, Cancer Research, https://doi.org/10.1158/0008-5472.CAN-15-1766 ).We cited and discussed the paper in the manuscript. Our new results using enzymatic inhibitor of PRMT5 (BLL3.3) further supports that PRMT5 mediates methylation of SREBP1 (Supplementary Fig. S5A).

      Stability studies in figure 5E have been performed in HEK293 cells using over-expressed proteins. While these results show that PRMT5 protects SREBP1a from degradation, the significance of this in muscle is less clear. Western blots of these proteins in C2C12 cells show that the over expression of PRMT5 does not stabilize SREBP1a (Flag) despite the appearance of increased methylation. To solidify the concept that PRMT5-dependent methylation of SREBP1 leads to its stabilization, cycloheximide experiments should be performed in myotubes generated in culture from the PRMT5mko mice. The stability of the endogenous SREBP1a gene could be monitored using antibodies.

      [response] We performed that study as suggested. Consistent with the notion that PRMT5 stabilizes SREBP1, we found extremely low levels of SREBP1 proteins (nearly undetectable) in Prmt5 KO myotubes, in contrast to the robust expression of SREBP1 in WT myotubes (Supplementary Fig. S5B). This extremely low levels of SREBP1 precludes us from examining degradation after cycloheximide treatment

      The measurement of methylation levels of SREBP1a are complicated by the fact that the protein levels are destabilized in the absence of PRMT5. The authors should use a PRMT5 inhibitor experiments in complement to these overexpression studies to measure the relative methylation of mSREBP1a (SMY10/mSREBP1).

      [response] We used PRMT5 inhibitor, BLL 3.3, to support that mSREBP1a methylation is mediated by PRMT5 (Supplementary Fig. S5A).

      Minor Comments 4. In figure 1H, there are more nuclei surrounding the myofibers. The authors should document the number of PAX7 cells per myofiber in the Control and Prmt5MKO mouse strains as it helps understand the additive effect of change in PAX7 cells during muscle atrophy.

      [response] We quantified the number of Pax7+ cells in muscles and myofibers of WT and KO mice (Supplementary S2D,E).

      In figure 5, the legend title mentioned ATGL. However the stability or methylation results of ATGL are not presented anywhere in the manuscript. Only in figure 6 did the authors show the differential expression of ATGL in the presence and absence of PRMT5. This title for Figure 5 should corrected.

      [response] Thanks for clarifying. We fixed title of Figure 5 in the manuscript.

      For better representation, the authors should consider moving the western blot panel (S3A) and lipid droplet staining data (S3E) to main figures and some of the data on force generation and body weights to supplementary. [response] We updated the figures as suggested.

      Reviewer #2 (Significance (Required)):

      This is an interesting manuscript that provides novel insight into the role for PRMT5 in muscle homeostasis. While previous studies have looked at the PRMT5 from a transcriptional standpoint during muscle differentiation, this work shows a role for PRMT5 in controlling the metabolic state of myofibers through transcriptional and potentially non-transcriptional mechanisms. Identification of the transcriptional regulation of Pnpla2 gene by PRMT5 is confirmed by mouse rescue experiments with the double KO mice. However the role for non-transcriptional control of SREBP1a stability through methylation by PRMT5 is not as clearly established. To strengthen this aspect of the manuscript, additional experiments are needed.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The lipid droplets represent an energy store and central hub of lipid metabolism in cells. In the skeletal muscle, abundant lipid droplets are present in myofibers (especially in oxidative Type 1 and IIA myofibers) and thought to play a role in supplying energy through fatty acid oxidation (FAO) to power muscle contraction. Increased abundance of lipid droplets in myofibers is associated with poor muscle function and insulin resistance in patients of type 2 diabetes. Paradoxically, myofibers of trained athletes also contain higher than normal levels of lipid droplets but with better contractile function and insulin sensitivity. The molecular mechanism underlying this "Athlete's Paradox" has been unclear, due to the lack of understanding of what controls biogenesis and metabolism of lipid droplets in the myofiber.

      In this manuscript, Kuang and colleague provide compelling evidence to support a key role of PRMT5 in maintaining lipid droplets in the myofiber. They generated a conditional knockout mouse model to disrupt the Prmt5 gene in the myofibers. This leads to an astonishing depletion of lipid droplets in myofibers. The Prmt5 null myofibers also exhibited poor contractile function and classical signs of atrophy. To determine if the depletion of lipid droplets drives muscle atrophy or if muscle atrophy drives depletion of lipid droplets, the authors introduced a secondary lesion (ATGL-KO) in the Prmt5 null myofibers that would preserve the lipid droplets by preventing ATGL-mediated lipolysis. This restored lipid droplet content and largely rescued muscle contractile function, demonstrating that depletion of lipid droplets drives muscle atrophy and impairs muscle contractile function. The authors also performed a series of biochemical and molecular biology assays to show that PRMT5 stabilizes SREBP1a through dimethylation, enhancing the activity of this master transcriptional regulator of de novo lipogenesis. PRMT5 also methylates H4R3, and the methylated H4R3 represses the transcription of Pnpla2 (ATGL - which controls lipolysis), therefore inhibiting degradation of lipid droplets. These results together illustrate the dual role of PRMT5 in promoting lipid biogenesis and inhibiting lipid droplet degradation.

      Reviewer #3 (Significance (Required)):

      Collectively, this study identify PRMT5 as a key regulator of lipid metabolism in the muscle and establish a causal relationship between lipid droplet and muscle contractile function, and point to scarce lipid droplets as a driver of muscle atrophy. PRMT5 has previously been reported to regulate early myogenesis but its role in post-fusion myofibers has never been reported, therefore the conceptual novelty of this study is high. There are couple of minor points authors should consider: 1) While muscle-specific Prmt5-KO mice show reduced muscle mass, it is not clear whether this is a developmental effect or muscle atrophy. Authors should measure a few markers of muscle atrophy such as Atrogin1 and MuRF1 and overall levels of ubiquitination. Alternatively, authors can also subject the mice to conditions of muscle atrophy such as starvation and measure how various markers of atrophy are affected.

      [response] Thank you for this suggestion. As the Myl1Cre is only expressed in post-differentiation myocytes and myotubes/myofibers, we did see any developmental defects during postnatal myogenesis (Supplementary Fig S2A-C). We also checked Atrogin-1 and MuRF1 in WT and KO muscle tissues based on your advice, but we did not find any significant difference (Supplementary Fig S1F). These two genes are muscle-specific E3 ubiquitin ligases involved in protein degradation by the ubiquitin proteasome pathway. This finding is consistent with the idea that there are multiple mechanisms that can lead to muscle atrophy, and our study clearly elaborates that dysregulation of lipid catabolism by PRMT5 is the main pathway associated with muscle wasting.

      2) Please show representative EcoMRI images for body composition analysis.

      [response] Thank you for your comments, but the EcoMRI equipment does not provide images of body composition. It only provides data of lean mass, fat mass and water in gram. We presented those data in the manuscript.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The lipid droplets represent an energy store and central hub of lipid metabolism in cells. In the skeletal muscle, abundant lipid droplets are present in myofibers (especially in oxidative Type 1 and IIA myofibers) and thought to play a role in supplying energy through fatty acid oxidation (FAO) to power muscle contraction. Increased abundance of lipid droplets in myofibers is associated with poor muscle function and insulin resistance in patients of type 2 diabetes. Paradoxically, myofibers of trained athletes also contain higher than normal levels of lipid droplets but with better contractile function and insulin sensitivity. The molecular mechanism underlying this "Athlete's Paradox" has been unclear, due to the lack of understanding of what controls biogenesis and metabolism of lipid droplets in the myofiber.

      In this manuscript, Kuang and colleague provide compelling evidence to support a key role of PRMT5 in maintaining lipid droplets in the myofiber. They generated a conditional knockout mouse model to disrupt the Prmt5 gene in the myofibers. This leads to an astonishing depletion of lipid droplets in myofibers. The Prmt5 null myofibers also exhibited poor contractile function and classical signs of atrophy. To determine if the depletion of lipid droplets drives muscle atrophy or if muscle atrophy drives depletion of lipid droplets, the authors introduced a secondary lesion (ATGL-KO) in the Prmt5 null myofibers that would preserve the lipid droplets by preventing ATGL-mediated lipolysis. This restored lipid droplet content and largely rescued muscle contractile function, demonstrating that depletion of lipid droplets drives muscle atrophy and impairs muscle contractile function. The authors also performed a series of biochemical and molecular biology assays to show that PRMT5 stabilizes SREBP1a through dimethylation, enhancing the activity of this master transcriptional regulator of de novo lipogenesis. PRMT5 also methylates H4R3, and the methylated H4R3 represses the transcription of Pnpla2 (ATGL - which controls lipolysis), therefore inhibiting degradation of lipid droplets. These results together illustrate the dual role of PRMT5 in promoting lipid biogenesis and inhibiting lipid droplet degradation.

      Significance

      Collectively, this study identify PRMT5 as a key regulator of lipid metabolism in the muscle and establish a causal relationship between lipid droplet and muscle contractile function, and point to scarce lipid droplets as a driver of muscle atrophy. PRMT5 has previously been reported to regulate early myogenesis but its role in post-fusion myofibers has never been reported, therefore the conceptual novelty of this study is high.

      There are couple of minor points authors should consider:

      1. While muscle-specific Prmt5-KO mice show reduced muscle mass, it is not clear whether this is a developmental effect or muscle atrophy. Authors should measure a few markers of muscle atrophy such as Atrogin1 and MuRF1 and overall levels of ubiquitination. Alternatively, authors can also subject the mice to conditions of muscle atrophy such as starvation and measure how various markers of atrophy are affected.
      2. Please show representative EcoMRI images for body composition analysis.
    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In the manuscript "PRMT5 links lipid metabolism to contractile function of skeletal muscles", Kim et al., describe the role for the arginine methyl transferase PRMT5 in maintaining skeletal muscle homeostasis. The authors showed that myocyte-specific deletion of PRTM5 results in the loss of muscle mass, reduced motor-performance, a fiber type switch from oxidative to glycolytic fibers along with reduced lipid content in the myofibers. The authors reasoned that absence of PRMT5 results in reduced methylation and stability of mSREBP1 and an increase in the expression of adipose triglyceride lipase (ATGL).

      Major Comments

      1. Experiments looking at the interaction between PRMT5 and mSREBP1a using overexpressed proteins are used to conclude that PRMT5 methylates SREBP1a. While the results are consistent with these conclusions, the finding remains correlative. Methylation assays using purified PRMT5 and SREBP1a would be required to make a definite conclusion that PRMT5 methylates SREBP1a. These should be performed. In the absence of such data, the authors would need to adjust their conclusions to say that in the presence of PRMT5, SREBP1a becomes methylated, and that it remains to be determined if this is directly mediated by PRMT5.
      2. Stability studies in figure 5E have been performed in HEK293 cells using over-expressed proteins. While these results show that PRMT5 protects SREBP1a from degradation, the significance of this in muscle is less clear. Western blots of these proteins in C2C12 cells show that the over expression of PRMT5 does not stabilize SREBP1a (Flag) despite the appearance of increased methylation. To solidify the concept that PRMT5-dependent methylation of SREBP1 leads to its stabilization, cycloheximide experiments should be performed in myotubes generated in culture from the PRMT5mko mice. The stability of the endogenous SREBP1a gene could be monitored using antibodies.
      3. The measurement of methylation levels of SREBP1a are complicated by the fact that the protein levels are destabilized in the absence of PRMT5. The authors should use a PRMT5 inhibitor experiments in complement to these overexpression studies to measure the relative methylation of mSREBP1a (SMY10/mSREBP1).

      Minor Comments

      1. In figure 1H, there are more nuclei surrounding the myofibers. The authors should document the number of PAX7 cells per myofiber in the Control and Prmt5MKO mouse strains as it helps understand the additive effect of change in PAX7 cells during muscle atrophy.
      2. In figure 5, the legend title mentioned ATGL. However the stability or methylation results of ATGL are not presented anywhere in the manuscript. Only in figure 6 did the authors show the differential expression of ATGL in the presence and absence of PRMT5. This title for Figure 5 should corrected.
      3. For better representation, the authors should consider moving the western blot panel (S3A) and lipid droplet staining data (S3E) to main figures and some of the data on force generation and body weights to supplementary.

      Significance

      This is an interesting manuscript that provides novel insight into the role for PRMT5 in muscle homeostasis. While previous studies have looked at the PRMT5 from a transcriptional standpoint during muscle differentiation, this work shows a role for PRMT5 in controlling the metabolic state of myofibers through transcriptional and potentially non-transcriptional mechanisms. Identification of the transcriptional regulation of Pnpla2 gene by PRMT5 is confirmed by mouse rescue experiments with the double KO mice. However the role for non-transcriptional control of SREBP1a stability through methylation by PRMT5 is not as clearly established. To strengthen this aspect of the manuscript, additional experiments are needed.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The Kim et al. paper titled "PRMT5 links lipid metabolism to contractile function of skeletal muscles" reports how the arginine methyltransferase PRMT5 affects lipid metabolism in myofibers by stabilizing the mSREBP1 protein and repressing the expression of the PNPLA2 gene. The genetic deletion of PRMT5 in muscle results in the loss of lipid droplets in myofibers and a loss in muscle strength. Additionally, there is a change in muscle fiber types, moving from an oxidative state to a more glycolytic one. While the authors present compelling data on PRMT5's role in muscle metabolism, there are some concerns on the mouse model used and the sequencing data.

      Major concerns:

      1. The mouse model used in this study is PRMT5fl/fl , Myl1cre in order to genetically delete PRMT5 in skeletal muscle. While there is no issue with the KO mice, the WT mice are PRMT5fl/fl , Myl1+ which is not an acceptable control. It is known that Cre itself can have a phenotype, and additionally Myl1 is very highly expressed. Thereby, there is a large amount of Cre in the KO mice, but none in the WT which may contribute to the differences seen between WT and KO mice. The appropriate WT control is PRMT5+/+ Myl1cre and the experiments would need to be repeated using this mouse genotype as the WT.
      2. In the scRNA-Seq the authors claim that PRMT5 is not expressed in quiescent muscle stem cells. However, the data set that is used only has approximately 250 muscle stem cells, which would not provide much coverage. It would be necessary to validate this claim by using other data sets, such as Tabula Muris or publicly available bulk RNA-Seq.
      3. The ChIP-Seq data shown was performed on 3T3-L1 cells and is not appropriate for a muscle paper. The ChIP-Seq must be performed on muscle cells in order to confirm their conclusion.
      4. The authors claim that loss of PRMT5 leads to a gradual loss of muscle fiber size but has no effect on myogenesis. The evidence to support that claim is shallow, being based solely on CSA and total number of myofibers, along with a loss of lean body mass. To confirm this statement, it would be best to quantify the CSA and # of myofibers in EDL and TA at P7 and P21. Further, a regeneration assay would also demonstrate if myogenesis is compromised or not.
      5. The data presented shows that there is fiber type switch from oxidative to glycolytic, along with a decrease in muscle strength in the PRMT5 KO mice. This seems counterintuitive to what is known in the field as glycolytic fibers are viewed as being capable of generating more force than oxidative, while having less endurance. The authors should clarify this point and elaborate more on their conclusion that the loss of strength is due to an altered metabolism.

      Minor concerns:

      1. The term myocyte is not the most accurate word for describing skeletal muscle. Myofibers would be best for fully differentiated muscle, myotubes for in vitro differentiation and myocytes should be reserved for differentiated cells that have not fused yet (1-2 nuclei/cell). I would recommend changing all mentions of myocyte to myofiber and changing "myocyte specific" with regards to the mouse models as "skeletal muscle specific"
      2. Figure 1 Panel F and G would be clearer if they were labelled as 2 months old mice
      3. Figure 2 Panel E, G and H the control line appears to be missing error bars
      4. Figure 2 legend should specify that these mice are 2 months old for the sake of clarity
      5. Figure 3 Panel G and H are not informative and are misleading. The supplemental panels show that when normalized to body mass there is no difference in O2 consumption or CO2 production. These should be replaced with the supplemental panels
      6. Figure 4 Panel E and F, are these separate experiments? The values do not match between the 2 panels. If these are separate it should be made more clear.
        • a. Error bars appear to be missing in Panel E
        • b. As this is an experiment where the state of the cell is incredibly important (metabolism of myoblast is much different to myotube), the authors must demonstrate that there is no defect in in vitro differentiation by showing the fusion index assay for these cells and a representative image of the myotubes.
        • c. The authors should mention in the legend that these are 3 DM myotubes
      7. Figure 5 Panel G, a qPCR to confirm the O/E of the PRMT5 and SREBP1a in the test samples would be necessary.
        • a. The double O/E cells are marked as significantly different, but it is unclear to which group they are significantly different to.
      8. Figure 7 Panel B, body weight would be more informative in g rather than percentage.
      9. It would be interesting to test whether the KO of Pnpla2 also rescues the fiber type switch.

      Significance

      Overall the manuscript provides insight into the role of PRMT5 in regulating the metabolism of skeletal muscle. While the paper provides some interesting data, it is severely hampered by the improper WT controls lacking the cre alleles. In order for the data to be reliable, all of the WT samples will need to be replaced with PRMT5+/+ Myl1 cre mice. There are other papers looking at the role of PRMT5 in skeletal muscle, however these are more focused on muscle stem cells than the myofibers. Therefore this paper does fill in a gap with regards to the metabolic role of PRMT5 and how this can affect skeletal muscle function. This paper would most likely be of interest to a specialized audience, mostly those in the skeletal muscle field.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements [optional]

      We thank the reviewers for their comments and very helpful suggestions to improve the manuscript. All the reviewers address that further confirmation of the causality of activity-induced AMPK activation and AMPK-induced mitochondrial fission and mitophagy regulating dendritic outgrowth in immature neurons would strengthen the significance of this study. We believe that this is the first study demonstrating that AMPK mediates activity-dependent dendritic outgrowth of immature neurons, and that regulation of mitophagy is critical for dendrite development.

      We can perform most of the experimentations and corrections requested by the reviewers. We have already made several revisions and are currently working on additional experiments. All experiments will be finished in several weeks and we expect to submit a full revision by the due date.

      2. Description of the planned revisions

      Insert here a point-by-point reply that explains what revisions, additional experimentations and analyses are planned to address the points raised by the referees.

      Reviewer #1-1.- MMP alone is not a good indicator of mitochondrial health. For instance, ATPase inhibitor causes increase in MMP and complex I inhibition diminish MMP and in both cases mitochondrial function is impaired. On the other hand, authors use increased flickering and mitochondrial ROS production as an indicator of enhanced respiration but they could also be used as indicators of mitochondrial dysfunction. Other assays, such as oxygen consumption, are needed to assess the mitochondrial function.

      *Related comments by Reviewer #2-C. In figure 6 it is unclear what is the significance of the TMRM "flickering" parameter quantified and the difference between the control and knockdown condition is small on average. *

      Increase in TMRM flickering and mitochondrial ROS production, which we used as indicators of enhanced mitochondrial respiration, can certainly also be caused by mitochondrial dysfunction. We think it difficult to adopt an oxygen consumption assay in our system, as the transfection efficiency in the primary hippocampal culture is low (~10%). Instead, we plan to assess the mitochondrial function in control and AMPK deficient cells by using an ATP FRET sensor targeted to mitochondria (Mito-ATeam, Imamura et al., PNAS, 2009; Yoshida et al., Methods Mol Biol 2017). Mito-ATeam will be transfected in neurons to compare mitochondrial ATP synthesis in control and AMPK deficient neurons.

      *Reviewer #1-2.- It would be interesting to show a better characterization of the mitophagy flux and to test whether pharmacological or genetic stimulation of mitophagy could revert the effect of AMPK KD on dendritic outgrowth, ultimately linking AMPK, mitophagy and dendritic outgrowth. The latter experiments may be challenging but not impossible, for example see (PMID: 27760312). *

      We understand that it is important to demonstrate more strongly the correlation of the AMPK-induced peripheral fission and subsequent mitophagy of fragmented mitochondria with dendritic outgrowth. We will attempt the suggested experiment to see if induction of autophagy could revert the dendritic hypoplasia by AMPK KD. However, because AMPK deficiency generates elongated mitochondria defective in fission rather than fragmented mitochondria that are failed to undergo mitophagy, we doubt that activating mitophagy will properly remove damaged mitochondria.

      In parallel to the above experiments, we currently analyze if inhibition of mitochondrial fission or mitophagy would phenocopy the hypoplastic dendrites of AMPK-deficient neurons, and if the activation of fission would rescue the phenotypes of AMPK KD, to strengthen the causality of AMPK-dependent fission, autophagy and dendrite outgrowth. So far we have observed that inhibition of mitochondrial fission by MFF knockdown or inhibition of autophagy by bafilomycin treatment strongly suppress dendrite outgrowth. MFF knockdown also leads to the elongation of mitochondria with decreased association of p62-puncta, strikingly reminiscent of AMPK-deficient neurons. Please see attached figures. Completed analyses will be included in the full revision.

      *Reviewer #1-4.- Results clearly indicate that AMPK enhances mitochondrial fission, and that AMPK is necessary for proper dendritic outgrowth. However, as indicated, the role of AMPK-dependent mitochondrial fission in promoting dendritic growth is not well demonstrated. A possible, and not very difficult experiment, would be the expression of non-phosphorylable MFF S155/172 mutant (perhaps is also needed to knock down the endogenous MFF). Use of this mutant would abolish AMPK-dependent mitochondrial fission while preserving its other functions. *

      Related comments by Reviewer #3-3. The authors could further confirm the claim by examining how mutations in Mff and ULK2 which cannot be phosphorylated by AMPK can rescue defects in mitochondrial fission and spine density.

      We will examine if the expression of non-phosphorylable MFF S155/172 mutant would cause defective autophagy and dendritic arbor growth similarly to AMPK KD neurons. In addition, we will test whether MFF S155/172 mutant would inhibit activity-induced mitochondrial fission to strengthen the link between activity-AMPK-MFF-autophagy axis and dendritic outgrowth.

      *Reviewer #1-Minor 2.- It is intriguing that as shown in Fig. 2A, rather than an increase in pAMPK/AMPK at DIV5 seems there is less phosphorylation despite FRET analysis indicate more AMPK activation. On the other hand, most of the blots in Fig. 6 seem to be overexposed. *

      The exposure time of WB in Fig. 2A was adjusted so that all lanes can be compared. We will fix the exposure time.

      Reviewer#2-A. Most of the evidence on the role of AMPKa2 relies on a shRNA-based strategy. The authors have performed this approach with the best practice, including selecting 2 shRNA plasmids for each gene, and performing a rescue experiment with shRNA -resistant cDNA. Yet, it is critical to provide stronger evidence with all the tools available to demonstrate the role of AMPKa2 in dendritic development. This is especially important because the effect reported by the authors is a transient effect: indeed, dendritic development appears abnormal in very young neurons (P5) but largely normal afterwards (P10). Hence one cannot discard a non specific effect on cell viability or sampling effect. The number of neurons counted is fairly low (about 30 neurons per condition) and it is not clear if they come from several independent cultures. It is known that plasmid preparation can impact cell viability and performing the experiment with only one batch of plasmid prep could explain why one plasmid would produce a short-lived effect on cell morphology. Two shRNA constructs are presented in figure S2A but only one is used for morphological experiments quantified in S2D-E with again a very low N number. The specific experiments I would recommend would be to increase the N: at least 25-30 neurons counted per culture, 3 independent cultures, and presenting the results of the two shRNA plasmids for both AMPKa1 and AMPKa2. Furthermore, the immunofluorescence validation of knockdown provided in figure S2B is not really convincing, a nuclear marker is lacking to determine where cells are (it seems that many cells are present in the image, maybe some of them with low AMPKa2 expression as well). A quantification should be provided as well as evidence for shRNA #1 and #2. *

      *

      We thank the reviewer for valuable suggestions to improve our manuscript. All the knockdown analyses were done from three independent experiments using different mouse litters and multiple batches of plasmid prep. N number was low because of a low transfection efficiency in the primary culture. We will repeat experiments and increase the sample number. We will also present results of the two shRNA constructs. We will redo the immunofluorescence for validation of shRNA knockdown and replace Extended Data Fig. 2B which was pointed out as not being clear.

      *Reviewer #2-C. The observation, in vivo, that dendritic development is normal at P10 is intriguing but this reconciles the observation of altered dendritic development with previous studies demonstrating that AMPK knockout has little effect on brain development, as well as previous studies (Mairet-Coello et al. Neuron 2013, Lee et al. Nat commun 2022) targeting AMPKa2 in the hippocampus of AD mouse models by in utero electroporation. This is a critical aspect of the paper and as stated in the discussion, the previous studies only looked at the end product (neuronal morphology appears normal after development) but not the process of neuronal development and maturation. The in vitro experiment offer the possibility to study dendritic development over time in the same population of neurons, either through selected time points, or through time lapse imaging. This would strengthen one of the most original aspect of this work. *

      We thank the reviewer for an important suggestion. We will analyze if dendritic morphology and mitochondria would recover in later stages in culture. However, the dendritic growth defects in AMPK KD neurons are apparently more severe in culture and our preliminary results have shown that dendritic growth defects and mitochondrial elongation persist until 10DIV. We anticipate that AMPK deficiency is complemented by certain compensation mechanisms in vivo that are not present in culture, such as chemical signals or synaptic inputs from correct afferents. We will confirm the recovery of dendritic outgrowth in vivo using an AMPK alpha2 knockout mouse. We will include the results in vivo and in vitro in the revised manuscript.

      * The authors use a FRET probe to witness AMPK activity, and this part raises a lot of questions. A lot of the signal matches the regularly spaced activity peaks suggesting that FRET response is a coincidence detector of calcium waves. Hence, is the FRET signal influenced by intracellular calcium concentration, or changes in pH? To address this question, the proper control would be to use a FRET biosensor with a mutated AMPK phosphorylation site and demonstrating the absence of response to calcium waves. *

      We think it unlikely that the FRET probe detects calcium concentration or pH change, as its kinetics and timing are different from calcium spikes. For confirmation, we will examine a FRET probe lacking phosphorylation sites to negate that calcium waves directly activate the FRET probe.

      * Also, the parameter used for quantification is a so-called "number of FRET peaks over 3 minutes" for which the biological significance is unknown. On average there are 1-2 such "peaks" in control conditions (figure 4). These peaks have low amplitude, sometimes around 0.05-0.1 of the YFP/CFP ratio, which is about what is expected even in AMPKa2 knockdown cells (figure S4C). Are there changes in the baseline of FRET signal? *

      We monitor FRET at 3-5 sec intervals and is set to 3 minutes due to gradual photobleaching. Although the event frequency is 0-4 times per 3 minutes observation, it is nearly absent in AMPK KD (1 small peak in 3 cells out of 40 cells) or activity deprivation, which we consider a significant difference. We have replaced Figure 4B, 4D, 4I, 4J andExtended Data Fig.4E. The basal FRET signal is lowered in AMPK KD cells, but also varies depending on the expression level of the probe. For comparision of the results shown in Figure 4 and Extended Data Fig.4, we have changed the y-axis to the normalized FRET signal {FRET/FRETbaseline} and jRGECO signals (DF/F0) in Fig. 4F, Extended Data Fig.4C, 4D.

      *

      *

      *Finally, given that calcium peaks and AMPK activity peaks overlap, one key observation is the continued presence of calcium peaks upon AMPKa2 knockdown in figure S4D. Yet, the scale for jRGECO1 intensity in figure S4D differs from the scale in figure 4, making it difficult to interpret. It seems that on average the delta (peak-baseline) is 2000 in wild-type cells (figure 4), compared to 500 in AMPKa2 knockdown cells, which suggests a strong reduction in calcium signal amplitude upon knockdown of AMPK. This should be clarified to demonstrate that the FRET probe peaks are really due to AMPK activity. Also, the effect of STO-609 should be added to this figure. *

      We think that the presence of calcium transients in AMPK KD cells supports our conclusion that AMPK is downstream of calcium signaling. The amplitude of calcium spikes was actually lowered in AMPK KD cells. We think it is due to the reduction of the cell size and complexity in KD cells. To negate that AMPK inhibition affects calcium influx, we will examine if acute inhibition by an AMPK inhibitor will suppress only FRET signals but not calcium waves. In addition, we will monitor calcium waves and FRET signals in neurons treated with STO-609 or AICAR. STO-609 and AICAR should decrease and increase FRET signals without affecting calcium influx.

      • Other comments by Reviewer #2*
      • Similarly, the number of events in figure 5F-G is really low. Is a difference between 0.02 in the control group and 0.01 in the knockdown group physiologically relevant?*

      Since p62 puncta contact only a small mitochondrial region, the overlap area of mitochondria with p62 in the total mitochondrial area is small. We will analyze the number of p62 puncta associated with mitochondria per unit dendritic area.

        • Lines 339-350, the authors discuss about a putative regulatory loop involving AMPK dephosphorylation. Since this part of the discussion is based on the FRET signal, the authors should consider if an alternative explanation could be the kinetics of the biosensor dephosphorylation.* We will revise Discussion to argue about alternative possibilities of dynamic oscillation of the FRET signal when we get data from the above experiments.

      *In terms of significance, I would have two major criticisms. The first is that it appears that many of the findings by the authors are redundant with observations of the roles of CAMKK2-AMPK-MFF-ULK1 in AD model mice, see for example the work by Polleux (Mairet-Coello et al. Neuron 2013, Lee et al., Nat commun 2022). As said above, my opinion is that the paper should put more emphasis on the transient effect of AMPK, which would be a novel observation and, as the authors rightfully discuss, a phenotype potentially overlooked in previous studies of AMPK KO mice. The second is that many points in the discussion seem to be over reached and are not entirely supported by the data. As an example lines 298-299 "leading to mitochondrial dysfunction with low respiratory activity" (not addressed in this manuscript), lines 312-313 "multiple signatures of mitochondrial dysfunction such as reduced delta-Psi-m and ROS production" (biological significance of these parameters?), lines 332-334 "AMPK phosphorylation dynamically oscillates in dendrites, depending on Ca2+ influx and CAMKK2 activity, while it is independent of LKB1" (the authors don't study AMPK phosphorylation, and the experimental data has many limitations that need addressing), etc. *

      We thank reviewer’s guidance. We think this is the first study showing AMPK function in dendritic arbor growth in immature neurons before synaptogenesis. We will rewrite the manuscript to emphasize that neuronal activity in immature neurons regulates dendrite formation via AMPK in a short time window during brain development. Discussion will be revised according to the data of the ongoing additional experiments.

      Reviewer#3-1. All these studies are done in invitro neuronal culture modal with transfection of ShRNAs to Knockdown AMPK. An alternative possibility is that authors could use an AMPK Conditional Knockout mouse models Conditional deletion of (AMPKα1/α2 (AMPKα1−/−; AMPKα2F/F; Emx1-Cre) derived neurons for this study.

      We showed the effect of AMPK knockdown in hippocampal neurons in culture and in vivo (Fig. 2). For validation, we also examined CRISPR interference (Extended data Fig.2). We will examine in vivo phenotypes in pyramidal neurons in AMPK alpha2 knockout mice to further validate our observation.

      Description of the revisions that have already been incorporated in the transferred manuscript

      Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. If no revisions have been carried out yet, please leave this section empty.

      *Reviewer #1-1.- Authors use mitochondrial membrane potential (MMP), MMP flickering and mitochondrial ROS production as indicators of mitochondrial function, but this is not convincing. To analyze MMP, authors use TMRM fluorescence normalized by mitochondria area. This is not correct, using this strategy would mean that a symmetric fission would instantly double MMP and fusion would half MMP. The analysis must be made by tracing ROIs of the same surface in different mitochondria and determining TMRM fluorescence in these ROIs. *

      We have reanalyzed TMRM fluorescence using the method indicated. As a result, TMRM fluorescence show a slight but significant decrease (p=0.0071) in AMPK KD cells. Extended Data Fig. 5C has been replaced accordingly. We thank the Reviewer for kind guidance!

      Reviewer #1-3.- The authors treat neurons with glutamate to support the view that synaptic activity activates AMPK and promotes mitochondrial fission. However, the concentration used (100 mM) may be excitotoxic. Synaptic activity can be induced by electric field stimulation, although this require equipment that may not be available in the authors' lab. Another alternative is network disinhibition with bicuculine or to use lower concentrations of glutamate. In any case, since neurons are immature and may respond differently from mature neurons, it would be worth to verify synaptic activity by analyzing Ca2+ transients.

      *Reviewer #1-Minor 3.- It is necessary more explanation about spontaneous Ca2+ transients in immature cultures. What percentage of neuros experience it? Is it synchronized? *

      *Related comments by Reviewer#2-D. It is well established and thus not surprising that AMPK activity increases in response to synaptic activity. It is more surprising to witness such an effect of activity in very immature neurons, where presumably synapses are sparse and not well developed. For example dendritic segments in Figure 1E and 3A don't have dendritic spines. Western-blot and/or immunofluorescence of synaptic markers with comparison to fully mature neurons would complete figure 1 and make the case whether the reported effects are marginal or a strong driver for dendritic development and AMPK regulation. *

      We thank the reviewers’ point that we failed to emphasize in the original manuscript.

      We focus on AMPK function during activity-dependent dendritic outgrowth in immature neurons before the onset of synaptogenesis. It has been shown that synaptogenesis occurs in dissociated hippocampal cultures between 7-12 DIV (eg, Renger et al., Neuron 2001) and that developing dendrites at 5 DIV are activated by ambient glutamate which is spontaneously released from nearby immature axon terminals and undergo spontaneous Ca2+ transients, and this non-synaptic activity is important for dendritic outgrowth (Andreae and Burrone, Cell Rep 2015). We have observed that Ca2+ transients in individual neurons are variable in frequency and magnitude and are not synchronized in consistent with previous studies. We have performed immunofluorescence with a synaptic marker PSD95 and confirmed that dendritic spines are not yet differentiated and PSD95 is sparsely distributed along the dendritic shaft in DIV5 hippocampal neurons. We describe the nature of Ca2+ transients in the Results more clearly and provide high magnified images and immunofluorescence with a synaptic marker PSD95 of the neurons at DIV5 and DIV13 as a new Fig. 1A. We believe that this is the first indication of AMPK function in non-synaptic neuronal activity during dendritogenesis.

      We have observed induction of mitochondrial fission in neurons treated with 1 µM glutamate. Extended Data Fig. 1E has been replaced accordingly. Since GABA is known to induce depolarization in immature neurons (Soriano et al., PNAS 2008), we would like to exclude bicuculine treatment from this analysis.

      *Reviewer #1-5.- The statistical analysis seems appropriate, but it is confusing that sometimes non-parametric and sometimes parametric tests are used. It is not indicated which test is used to determine normality since the methods section lacks a statistical analysis section.

      *

      We have revised Methods and have described statistical analysis in detail.

      *Reviewer #1-Minor 1.- Authors should double check the analysis shown in Fig. 1A. As it is shown, Ca2+ transients are 2-3% higher than basal, when the video shown in video 1 seem to indicate much more. *

      Thank you for pointing this out. In the original version, the percentile change was erroneously measured across the entire visual field, including areas without neurons. We have replaced Fig. 1B (original Fig. 1A) with reanalyzed data in the proximal region of the apical dendrite.

      *Reviewer #1-Minor 4.- It is interesting that AMPK KD in vivo impairs dendritic architecture at P5, however at P10 the defect seem to be somehow compensated. This result apparently detracts from the relevance of the findings, however last year was published a paper in which in an animal model of Huntington's disease dendritic architecture is delayed during the first week but normalizes thereafter. Despite later normalization in dendritic architecture, this early defect in maturation has effects in adulthood as pharmacological restoration of arborization during the neonatal period suppresses some phenotypes observed in adulthood (PMID: 36137051). I believe that discussing this paper would help the reader to recognize the potential relevance of the findings. *

      *Related comments by Reviewer #2: Nonetheless let aside the technical concern, if their findings hold true, this is an intriguing mechanism. There are interesting parallels to be made with observations of altered morphology and excitability of neurons in Huntington's disease model mice during the first postnatal week. These changes spontaneously reverts and are undetectable in the second week (Braz et al. Science 2022). Thus, precedent suggests that indeed dendritic development can take a slow course, and this study also suggests that this is important later since normalization of abnormal excitability during the first week in HTT mice prevents some of the phenotypes later in life. Here again, an interesting parallel could be made with the known role of AMPK in synaptic loss in AD models. *

      We thank the reviewers for the supportive comments. We will refer this paper and discuss about potential significance of the transient defects in early dendrite morphology in AMPK deficient neurons.

      *Reviewer#2-B. The Crispr method lacks validation which should be provided somehow. The drug-based experiment relies on compound C, a notoriously non specific AMPK inhibitor (see for example Bain et al. Biochem J 2007, or Vogt et al. Cell Signal 2011). Data obtained with Compound C is hard to interpret given the number of kinases that are affected by the drug and should be removed from the manuscript. *

      We have added immunofluorescence images for validation of AMPK deletion by CRISPRi (Extended Data Fig. 2F).

      We think the results of Compound C treatment support our conclusion in combination with KD and CRISPRi, but will delete the results in accordance with this comment.

      • Other comments by Reviewer#2*
      • Figure 5A-C relies on the quantification of fission events that appear very rare (0.4 event per 20 minutes). The difference between the two groups is between 0.1 and 0.2 events on average. Since this was quantified on a fairly low number of cells (N=14), it is hard to appreciate exactly how many events have been observed and the actual physiological relevance. Furthermore individual datapoints should be added to the figure to estimate variability.*

      The number of fission events was counted in mitochondria in a unit length of dendrite of similar diameter, and normalized by the number of mitochondria. The values were thus small as they represent average number of events in one mitochondrion in 20 minutes. We have replaced the Fig. 1K, 3F, 5B and 5C to show the number of fission events in mitochondria included in a unit length of dendrites of similar diameter. Individual data points have been included.

      Reviewer #3-4. Authors showed activity-dependent calcium signaling controls mitochondrial homeostasis and dendritic outgrowth via AMP-activated protein kinase (AMPK) in developing hippocampal neurons do the cortical mitochondria respond the same way as the hippocampal neurons?

      Thank you for the comment. As pyramidal neurons in the cerebral cortex and hippocampus are basically the same origin, it is likely that they share the same signaling. We use hippocampal neurons in this study to perform quantitative analysis of dendritic morphology in the same type of neurons. Primary cultures of cortical neurons contain multiple different cell types, making it difficult to analyze the same cell type.

      4. Description of analyses that authors prefer not to carry out

      Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

      *Reviewer #1: If activity is observed in only a portion of the neurons, taking advantage of the stablished long-term live imaging protocol in the authors' lab, it would be interesting to study in the same culture whether neurons that experience spontaneous activity develop more than those that do not. *

      We prefer not to carry out this analysis, as activity-dependent dendritic growth has already been well described in previous papers. It will take considerable time to observe the number of neurons for analysis of correlation between Ca2+ transients and dendrite morphology. We would like to focus our effort to demonstrate AMPK signaling during activity-dependent dendritic growth.

      Reviewer#3-2. Another technical issue here, most of the experiments are carried out on Neurobasal media, which has a lot of glucose plus substitution of glutamax might be not the perfect conditions for AMPK. Authors could not obtain evidence supporting the regulation of mitochondria biogenesis by PGC1α phosphorylation and expression. This surprise me, if you could reduce the glucose concentration if might change.

      We observed little or no changes in phosphorylation of PGC1alpha by enhancing or suppressing neuronal activity or AMPK activity. As mitochondrial biogenesis is very active in growing neurons, we surmise that PGC1alpha and mitochondrial biogenesis is regulated by multiple mechanisms during neuronal differentiation and AMPK activation/inhibition might not induce visible changes. We agree the reviewer that there is room to seek the conditions under which changes in PGC1alpha can be detected, but we do not see why Neurobasal plus glutamax is not suitable for this study. Multiple papers studying AMPK function in cultured neurons use similar culture media (Sample et al., Mol. Cell. Biol., 2015; Muraleedharan et al., Cell. Rep., 2020; Lee et al., Nat. Commun., 2022). We might see PGC1 phosphorylation by glucose deprivation, as it decreases glycolysis-derived ATP and thereby activates AMPK. Since we focus on AMPK activation by calcium signals, we are afraid that it would be difficult to distinguish AMPK activation by ATP deficiency or calcium signaling in glucose deficient condition. In addition, glucose deprivation would affect neuronal activity (which consumes large amount of ATP) and neuronal differentiation including dendritic outgrowth.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The manuscript by Hatsuda and colleagues builds on previous work from their group and others, to further investigate the activity-dependent dendritic arbor development and AMPK-dependent mitochondrial quality control. It recently been illustrated that over-activation of the CAMKK2-AMPK kinase dyad mediates synaptic loss through coordinated phosphorylation of MFF-dependent mitochondrial fission and ULK2-dependent mitophagy (Aβ42 oligomers trigger synaptic loss through CAMKK2-AMPK-dependent effectors coordinating mitochondrial fission and mitophagy). Though this is progress is modest, present study showed neuronal activity induces activation of two downstream effectors of AMPK, MFF and ULK1, which are the key regulators of mitochondrial fission and mitophagy.

      Major Concerns:

      1. All these studies are done in invitro neuronal culture modal with transfection of ShRNAs to Knockdown AMPK. An alternative possibility is that authors could use an AMPK Conditional Knockout mouse models Conditional deletion of (AMPKα1/α2 (AMPKα1−/−; AMPKα2F/F; Emx1-Cre) derived neurons for this study.
      2. Another technical issue here, most of the experiments are carried out on Neurobasal media, which has a lot of glucose plus substitution of glutamax might be not the perfect conditions for AMPK. Authors could not obtain evidence supporting the regulation of mitochondria biogenesis by PGC1α phosphorylation and expression. This surprise me, if you could reduce the glucose concentration if might change.
      3. The authors could further confirm the claim by examining how mutations in Mff and ULK2 which cannot be phosphorylated by AMPK can rescue defects in mitochondrial fission and spine density.
      4. Authors showed activity-dependent calcium signaling controls mitochondrial homeostasis and dendritic outgrowth via AMP-activated protein kinase (AMPK) in developing hippocampal neurons do the cortical mitochondria respond the same way as the hippocampal neurons?

      Significance

      It recently been illustrated that over-activation of the CAMKK2-AMPK kinase dyad mediates synaptic loss through coordinated phosphorylation of MFF-dependent mitochondrial fission and ULK2-dependent mitophagy (Aβ42 oligomers trigger synaptic loss through CAMKK2-AMPK-dependent effectors coordinating mitochondrial fission and mitophagy). Though this is progress is modest, present study showed neuronal activity induces activation of two downstream effectors of AMPK, MFF and ULK1, which are the key regulators of mitochondrial fission and mitophagy.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript 'Calcium signals tune AMPK activity and mitochondrial homeostasis in dendrites of developing neurons' by Hatsuda and collaborators aims at studying the interrelationship between neuronal activity, mitochondria dynamics (ie. fusion and fission mechanisms) and dendritic development. The authors provide evidence linking activity-dependent activation of a CAMKK2-AMPK pathway and the regulation of mitochondria fission and autophagy. Based on the literature, they focus on the roles of the mitochondria fission factor MFF and the autophagy regulator ULK1, both previously known targets of AMPK.

      This work parallels previous observations in the context of Alzheimer's disease and as such the discovery of a molecular link between CAMKK2-AMPK, MFF/ULK1 and the regulation of dendritic mitochondria is not surprising. The change of biological context raises interesting question although the relevance of these observations is not addressed in this manuscript.

      As a general comment, the work is well structured, reads easily. Iconography and figures organization are good. Major criticisms would concern the tools used to study AMPK and challenge some of the observations, as such I believe these are essential to address to validate the findings.

      Major comments

      • A. Most of the evidence on the role of AMPKa2 relies on a shRNA-based strategy. The authors have performed this approach with the best practice, including selecting 2 shRNA plasmids for each gene, and performing a rescue experiment with shRNA -resistant cDNA. Yet, it is critical to provide stronger evidence with all the tools available to demonstrate the role of AMPKa2 in dendritic development. This is especially important because the effect reported by the authors is a transient effect: indeed, dendritic development appears abnormal in very young neurons (P5) but largely normal afterwards (P10). Hence one cannot discard a non specific effect on cell viability or sampling effect. The number of neurons counted is fairly low (about 30 neurons per condition) and it is not clear if they come from several independent cultures. It is known that plasmid preparation can impact cell viability and performing the experiment with only one batch of plasmid prep could explain why one plasmid would produce a short-lived effect on cell morphology. Two shRNA constructs are presented in figure S2A but only one is used for morphological experiments quantified in S2D-E with again a very low N number. The specific experiments I would recommend would be to increase the N: at least 25-30 neurons counted per culture, 3 independent cultures, and presenting the results of the two shRNA plasmids for both AMPKa1 and AMPKa2. Furthermore, the immunofluorescence validation of knockdown provided in figure S2B is not really convincing, a nuclear marker is lacking to determine where cells are (it seems that many cells are present in the image, maybe some of them with low AMPKa2 expression as well). A quantification should be provided as well as evidence for shRNA #1 and #2.
      • B. To complete the shRNA-based experiments, the authors use a single cell Crispr approach, as well as a pharmacological approach. The Crispr method lacks validation which should be provided somehow. The drug-based experiment relies on compound C, a notoriously non specific AMPK inhibitor (see for example Bain et al. Biochem J 2007, or Vogt et al. Cell Signal 2011). Data obtained with Compound C is hard to interpret given the number of kinases that are affected by the drug and should be removed from the manuscript.
      • C. The observation, in vivo, that dendritic development is normal at P10 is intriguing but this reconciles the observation of altered dendritic development with previous studies demonstrating that AMPK knockout has little effect on brain development, as well as previous studies (Mairet-Coello et al. Neuron 2013, Lee et al. Nat commun 2022) targeting AMPKa2 in the hippocampus of AD mouse models by in utero electroporation. This is a critical aspect of the paper and as stated in the discussion, the previous studies only looked at the end product (neuronal morphology appears normal after development) but not the process of neuronal development and maturation. The in vitro experiment offer the possibility to study dendritic development over time in the same population of neurons, either through selected time points, or through time lapse imaging. This would strengthen one of the most original aspect of this work.
      • D. It is well established and thus not surprising that AMPK activity increases in response to synaptic activity. It is more surprising to witness such an effect of activity in very immature neurons, where presumably synapses are sparse and not well developed. For example dendritic segments in Figure 1E and 3A don't have dendritic spines. Western-blot and/or immunofluorescence of synaptic markers with comparison to fully mature neurons would complete figure 1 and make the case whether the reported effects are marginal or a strong driver for dendritic development and AMPK regulation. Furthermore the authors use a FRET probe to witness AMPK activity, and this part raises a lot of questions. A lot of the signal matches the regularly spaced activity peaks suggesting that FRET response is a coincidence detector of calcium waves. Hence, is the FRET signal influenced by intracellular calcium concentration, or changes in pH? To address this question, the proper control would be to use a FRET biosensor with a mutated AMPK phosphorylation site and demonstrating the absence of response to calcium waves. Also, the parameter used for quantification is a so-called "number of FRET peaks over 3 minutes" for which the biological significance is unknown. On average there are 1-2 such "peaks" in control conditions (figure 4). These peaks have low amplitude, sometimes around 0.05-0.1 of the YFP/CFP ratio, which is about what is expected even in AMPKa2 knockdown cells (figure S4C). Are there changes in the baseline of FRET signal? Finally, given that calcium peaks and AMPK activity peaks overlap, one key observation is the continued presence of calcium peaks upon AMPKa2 knockdown in figure S4D. Yet, the scale for jRGECO1 intensity in figure S4D differs from the scale in figure 4, making it difficult to interpret. It seems that on average the delta (peak-baseline) is 2000 in wild-type cells (figure 4), compared to 500 in AMPKa2 knockdown cells, which suggests a strong reduction in calcium signal amplitude upon knockdown of AMPK. This should be clarified to demonstrate that the FRET probe peaks are really due to AMPK activity. Also, the effect of STO-609 should be added to this figure.

      Other comments

      • A. Figure 5A-C relies on the quantification of fission events that appear very rare (0.4 event per 20 minutes). The difference between the two groups is between 0.1 and 0.2 events on average. Since this was quantified on a fairly low number of cells (N=14), it is hard to appreciate exactly how many events have been observed and the actual physiological relevance. Furthermore individual datapoints should be added to the figure to estimate variability.
      • B. Similarly, the number of events in figure 5F-G is really low. Is a difference between 0.02 in the control group and 0.01 in the knockdown group physiologically relevant?
      • C. In figure 6 it is unclear what is the significance of the TMRM "flickering" parameter quantified and the difference between the control and knockdown condition is small on average. Rather, the data presented in figure S5 would suggest that there is no difference in TMRM signal.
      • D. Lines 339-350, the authors discuss about a putative regulatory loop involving AMPK dephosphorylation. Since this part of the discussion is based on the FRET signal, the authors should consider if an alternative explanation could be the kinetics of the biosensor dephosphorylation.

      Significance

      The manuscript by Hatsuda and collaborator studies the roles of neuronal AMPK in the development of hippocampal neurons, specifically the authors describe a transient effect on dendritic development. To this reviewer's opinion, this is the major findings of this paper. Although the physiological implications of this finding are unknown, this is beyond the scope of this paper.

      Yet in terms of significance, I would have two major criticisms. The first is that it appears that many of the findings by the authors are redundant with observations of the roles of CAMKK2-AMPK-MFF-ULK1 in AD model mice, see for example the work by Polleux (Mairet-Coello et al. Neuron 2013, Lee et al., Nat commun 2022). As said above, my opinion is that the paper should put more emphasis on the transient effect of AMPK, which would be a novel observation and, as the authors rightfully discuss, a phenotype potentially overlooked in previous studies of AMPK KO mice. The second is that many points in the discussion seem to be over reached and are not entirely supported by the data. As an example lines 298-299 "leading to mitochondrial dysfunction with low respiratory activity" (not addressed in this manuscript), lines 312-313 "multiple signatures of mitochondrial dysfunction such as reduced delta-Psi-m and ROS production" (biological significance of these parameters?), lines 332-334 "AMPK phosphorylation dynamically oscillates in dendrites, depending on Ca2+ influx and CAMKK2 activity, while it is independent of LKB1" (the authors don't study AMPK phosphorylation, and the experimental data has many limitations that need addressing), etc.

      Nonetheless let aside the technical concern, if their findings hold true, this is an intriguing mechanism. There are interesting parallels to be made with observations of altered morphology and excitability of neurons in Huntington's disease model mice during the first postnatal week. These changes spontaneously reverts and are undetectable in the second week (Braz et al. Science 2022). Thus, precedent suggests that indeed dendritic development can take a slow course, and this study also suggests that this is important later since normalization of abnormal excitability during the first week in HTT mice prevents some of the phenotypes later in life. Here again, an interesting parallel could be made with the known role of AMPK in synaptic loss in AD models.

      Reviewer expertise: I have expertise in neuronal metabolism

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, Hatsuda et al study the role of synaptic activity-dependent Ca2+ signals in activating AMPK and regulating mitochondrial homeostasis and dendritic outgrowth in developing neurons. Using cultures of immature primary hippocampal neurons, the authors found that Ca2+ transients activate AMPK, which regulates mitochondrial fission and dendritic growth. AMPK KD and pharmacological manipulation of AMPK activity confirmed a role of AMPK in mitochondrial morphology that correlated with impaired mitophagy and mitochondrial function. These findings led the authors to conclude that activity-dependent activation of AMPK promotes mitochondrial fission, which facilitates removal of dysfunctional mitochondria and thus contributes to maintaining a healthy mitochondrial pool that is necessary in the intense energetic effort that requires dendritic outgrowth.

      Major comments:

      Meanwhile the activation of AMPK and its role in mitochondrial fission and dendritic outgrowth is in general well demonstrated, the conclusion that AMPK is necessary for proper dendritic outgrowth because by promoting asymmetric mitochondrial fission facilitates mitophagy of dysfunctional mitochondria and thus ensures adequate generation of energy for dendritic outgrowth still seems preliminary.

      1. Authors use mitochondrial membrane potential (MMP), MMP flickering and mitochondrial ROS production as indicators of mitochondrial function, but this is not convincing. To analyze MMP, authors use TMRM fluorescence normalized by mitochondria area. This is not correct, using this strategy would mean that a symmetric fission would instantly double MMP and fusion would half MMP. The analysis must be made by tracing ROIs of the same surface in different mitochondria and determining TMRM fluorescence in these ROIs. But even in the case that there were changes in MMP, that it does not seem to be the case, MMP alone is not a good indicator of mitochondrial health. For instance, ATPase inhibitor causes increase in MMP and complex I inhibition diminish MMP and in both cases mitochondrial function is impaired. On the other hand, authors use increased flickering and mitochondrial ROS production as an indicator of enhanced respiration but they could also be used as indicators of mitochondrial dysfunction. Other assays, such as oxygen consumption, are needed to assess the mitochondrial function.
      2. It would be interesting to show a better characterization of the mitophagy flux and to test whether pharmacological or genetic stimulation of mitophagy could revert the effect of AMPK KD on dendritic outgrowth, ultimately linking AMPK, mitophagy and dendritic outgrowth. The latter experiments may be challenging but not impossible, for example see (PMID: 27760312).
      3. The authors treat neurons with glutamate to support the view that synaptic activity activates AMPK and promotes mitochondrial fission. However, the concentration used (100 M) may be excitotoxic. Synaptic activity can be induced by electric field stimulation, although this require equipment that may not be available in the authors' lab. Another alternative is network disinhibition with bicuculine or to use lower concentrations of glutamate. In any case, since neurons are immature and may respond differently from mature neurons, it would be worth to verify synaptic activity by analyzing Ca2+ transients.
      4. Results clearly indicate that AMPK enhances mitochondrial fission, as previously reported, and that AMPK is necessary for proper dendritic outgrowth. However, as indicated, the role of AMPK-dependent mitochondrial fission in promoting dendritic growth is not well demonstrated. For example, AMPK could regulate dendritic outgrowth through its role on cytoskeletal dynamics. A possible, and not very difficult experiment, would be the expression of non-phosphorylable MFF S155/172 mutant (perhaps is also needed to knock down the endogenous MFF). Use of this mutant would abolish AMPK-dependent mitochondrial fission while preserving its other functions.
      5. The statistical analysis seems appropriate, but it is confusing that sometimes non-parametric and sometimes parametric tests are used. It is not indicated which test is used to determine normality since the methods section lacks a statistical analysis section.

      Minor comments:

      1. Authors should double check the analysis shown in Fig. 1A. As it is shown, Ca2+ transients are 2-3% higher than basal, when the video shown in video 1 seem to indicate much more.
      2. It is intriguing that as shown in Fig. 2A, rather than an increase in pAMPK/AMPK at DIV5 seems there is less phosphorylation despite FRET analysis indicate more AMPK activation. On the other hand, most of the blots in Fig. 6 seem to be overexposed.
      3. It is necessary more explanation about spontaneous Ca2+ transients in immature cultures. What percentage of neuros experience it? Is it synchronized? If activity is observed in only a portion of the neurons, taking advantage of the stablished long-term live imaging protocol in the authors' lab, it would be interesting to study in the same culture whether neurons that experience spontaneous activity develop more than those that do not.
      4. It is interesting that AMPK KD in vivo impairs dendritic architecture at P5, however at P10 the defect seem to be somehow compensated. This result apparently detracts from the relevance of the findings, however last year was published a paper in which in an animal model of Huntington's disease dendritic architecture is delayed during the first week but normalizes thereafter. Despite later normalization in dendritic architecture, this early defect in maturation has effects in adulthood as pharmacological restoration of arborization during the neonatal period suppresses some phenotypes observed in adulthood (PMID: 36137051). I believe that discussing this paper, and others with similar message (if they exist, I do not know), would help the reader to recognize the potential relevance of the findings.

      I believe that all the proposed experiments would strongly help to support the claims of the paper and are perfectly feasible during the time given for a revision and economically affordable.

      Significance

      As authors already cite in their work, several groups have shown that mitochondrial fission is necessary for proper dendritic growth. Here, the authors have proposed that synaptic activity in immature neurons induce mitochondrial fission via AMPK activation and subsequent MFF phosphorylation. Many of the findings here are confirmations of previous work, for instance activity-dependent activation of AMPK (PMID: 25698741, PMID: 27012879) and induction of mitochondrial fission by AMPK via MFF phosphorylation (PMID: 26816379). The novelty of the work is in studying these processes in immature neurons and how this affects dendritic growth, which is of interest for cellular neuroscientist, but I do not think it represents a conceptual breakthrough. A more detailed understanding of the mechanism proposed, i.e. mitochondrial fission facilities removal of dysfunctional mitochondria to maintain the high energy demands of growing dendrites, would greatly enhance the significance of the study.

      This reviewer specializes in neuronal cell biology, specifically the study of the mechanisms by which mitochondrial function regulates aspects of neuronal physiology, including neuritic outgrowth.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Point-by-point response to reviewer comments

      General statement

      Several studies have previously demonstrated functional links between the death receptors (DR) TRAIL-R1/2 and the Unfolded protein response (UPR). In this manuscript, we describe the previously unrecognized IRE1-dependent dual regulation of the expression of another DR, CD95, and CD95L-induced cell death. Our work therefore adds to the current knowledge on the functional links existing between UPR and DR signaling and provides novel mechanistic insights on a dual regulation involving both transcriptional and post-transcriptional control of the expression of CD95 mRNA expression by IRE1. To demonstrate this, we have used both genetic (overexpression of XBP1s or dominant-negative forms of IRE1) and pharmacologic (IRE1 RNase inhibitor) approaches and cellular models of glioblastoma (GB) and triple-negative breast cancer (TNBC). We show that IRE1 RNase activity promotes CD95 expression and CD95-mediated cell death via the transcription factor XBP1s whilst IRE1 RNase limits CD95 expression and cell death via its ability to cleave RNAs (through RIDD, for Regulated IRE1-dependent decay of RNAs, activity). Furthermore, we report that IRE1-mediated control of CD95 expression is active in vivo, using a model of CD95-mediated fulminant hepatitis in mice. Lastly, we correlate these results to the pathology by showing that CD95 expression is decreased in RIDD high or XBP1s low human GB and TNBC tumors.

      We thank the reviewers for their fair assessment of our manuscript and for their insightful comments. Below, we describe the experiments we plan to carry out to address the reviewers’ comments.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): Summary: Here the authors argue that IRE1 activation has opposite effects on Fas/CD95 expression/stability in a number of contexts, via either RIDD-dependent degradation of Fas mRNA or XBP-1-mediated induction of Fas expression, which led to either increased or decreased sensitivity to Fas-induced apoptosis in a number of settings. Major issues: The study is somewhat preliminary and inconclusive in that it is not clear why the RIDD function of XBP-1 appears to predominate in vitro in the cell lines examined, leading to modest increases in Fas expression levels (Figure 1) when IRE1 DN versus IRE1 WT constructs are overexpressed, which is at odds with the latter part of the paper which suggests that inhibition of RIDD led to reduced Fas expression levels. However, this could be due to supraphysiological levels of IRE1 being expressed under overexpression conditions, leading to confounding results. Similarly, when XBP-1s is overexpressed in vitro (Figure 5) the modest increases in CD95/Fas expression and sensitization to Fas-induced cell death may not be fully representative of what would be observed at physiological levels of XBP-1s activation. The in vivo results obtained using an IRE1 RNase inhibitor (MKC8866) contradict the earlier part of the study (as Fas levels decreased and there was protection from Fas-induced liver toxicity) and this could be due to a multitude of reasons. There is no doubt that impacting on IRE1 activity has interesting effects on CD95/Fas expression, which can be up- or -down-regulated, with consequences for cell death induced via engagement of the latter receptor, however, the manuscript does not offer a lot of clarity on which outcome is the predominant one in the context of engagement of the UPR. I have the following suggestions for improvement.

      We thank the reviewer for this overall positive assessment.

      1. The authors should induce ER stress using Thaps, Brefeldin A and Tunicamycin, and explore the effects of doing this on Fas expression levels in the context of silencing endogenous IRE1, XBP-1 and PERK.

      We do agree with this reviewer that the proposed experiments might further highlight which of the IRE1-dependent control of CD95 expression dominates upon ER stress induction. Therefore, we will perform the requested experiment in the various cell lines already used in the manuscript.

      We propose to evaluate the expression of CD95 (at the mRNA and total protein levels) under ER stress induction (by different ER stressors) upon knock-down of IRE1 or XBP1. Other DRs (TRAIL-R1 and 2) have been shown to be induced by PERK activation and it is also demonstrated that PERK and IRE1 signaling pathways coregulate each other. As such, we also propose to assess whether PERK could also control CD95 expression in this setting.

      1. The authors should explore the effects of silencing of IRE1, XBP-1 and PERK on constitutive Fas expression and the outcome of Fas/CD95-induced apoptosis in cells not experiencing an overt activation of the UPR (i.e. in the absence of Thaps, Brefeldin A or other UPR inducer).

      We thank the reviewer for their suggestion and will perform the requested experiments as proposed.

      1. The specificity of MKC8866 at the concentration used (30 uM) is unclear. What effect does MKCC have on sensitivity towards Fas-induced apoptosis, similar to the type of experimental set up presented in Figure 5A, 5B?

      Regarding the specificity of MKC8866, this drug has been optimized and refined from a family of IRE1-specific endoribonuclease inhibitors initially obtained from a chemical library screen [1-3]. This salicylaldehyde analog has already shown to be effective in multiple cancer models including breast [4, 5] and prostate [2] cancers. We have recently demonstrated its efficacy in a GB mouse model [6]. It is therefore a widely used IRE1 inhibitor, including in the dose range 10-30 mM used in this study (e.g [4, 5]). We therefore do not think it is in the scope of this manuscript to re-assess it specificity. However, we will aim at testing an additional IRE1 inhibitor to assess whether similar effects can be observed on CD95 expression in cells. To do so, we propose to use a novel IRE1 kinase inhibitor developed in the laboratory (DOI: 10.26434/chemrxiv-2022-2ld35 – Accepted iScience) and shown to efficiently blunt IRE1 activity in GB. As also suggested by the reviewer, we will assess whether the use of MKC-8866 can affect CD95L-induced cell death in cell lines.

      1. Similarly, what effects does MKC8866 (at 30 uM) have on key Fas pathway determinants, such as Fas, FLIPL, FLIPs, Caspase-8, FADD, RIPK1, A20, CYLD, cIAP-1, cIAP-2 and Bid? There are many points at which MKC8866 could influence the outcome of Fas receptor engagement beyond the receptor itself.

      In the present manuscript, we have shown that MKC-8866 reduces CD95 expression in mouse liver (IHC depicted in Figure 4B and S3B) in vivo and that, when used at 30 mM in vitro, it prevents the loss of CD95 expression induced by tunicamycin or thapsigargin in U87 cells (Fig 1C-F). We do agree with the reviewer that IRE1 may impact CD95-induced cell death beyond modulating CD95 expression, as also already discussed in the present manuscript. Therefore, and as suggested, we will assess whether MKC-8866, used at 30 mM, also impacts on the basal cellular expression of the various components of CD95 signaling mentioned by this reviewer.

      Minor issues:

      1. For the Fas mRNA cleavage experiments presented in Figure 2, there are no irrelevant control mRNAs to allow the reader to judge whether the effects presented are specific to Fas mRNA or are commonly observed for many mRNAs at these amounts of IRE1 (1 ug, 0.5 ug, which appear high).

      The expression of Fas mRNA was already normalized to GAPDH (which does not seem to vary upon incubation with IRE1). We nevertheless will test the expression of additional “irrelevant” RNAs as suggested by the reviewer.

      Reviewer #1 (Significance (Required)): General assessment: this is an interesting study, as there is little knowledge currently concerning how the UPR influences Fas expression or Fas-dependent outcomes. However, the impact of this work is limited by the overexpression approaches used, which could produce artifactual results, as well as the contradictory message of the study.

      Although we think that the message of the manuscript is indeed complex, the work presented herein does not rely exclusively on overexpression approaches as our genetic-based results are also comforted by the use of pharmacologic inhibitors of IRE1.

      Advance: the advance reported here is relatively modest and limited in scope due to the inconclusive nature of the data presented.

      Audience: this study will be of interests to specialists in the UPR and cell death communities.

      We thank the reviewer for acknowledging the overall novelty of our work. We do hope that the experiments proposed will address her/his remaining concerns.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The authors address here for the first time the connection between CD95, which is known as Fas, and ER stress. The role of another DR, TRAIL-R2 has been already reported, but this is the first study uncovering the link between Cd95 system and ER stress. The study is performed on the high level and supported by all necessary controls. They find the connection between IRE1 and CD95 and show that it might play a role in Cd95 signaling and attenuate CD95-mediated cell death.

      Further, the correlation between CD95 expression and IRE is found in tumors. Importantly the authors find out the connection between XBP1 and CD95 expression, which was not reported to date. Hence, it is a very important and highly essential piece of research.

      We thank the reviewer for these very positive comments and the acknowledging of the novelty and importance of our study.

      However, I would like to clarify the several issues:

      1: Figure 1. Tunicamycin obviously leads to deglycosylation of CD95, which is indicated by the appearance of 35 Kda band. This should be highlighted and commented.

      We agree, this will be commented on in the text.

      1. Figure 2c, d. The piece of mRNA structure, which is synthesized, might have the different secondary structure and might be not cleaved by IRE, accordingly. More detailed comments have to be provided in this regard.

      The model depicted in Figure 2B is a predicted computational secondary structure of CD95 mRNA. In the experiments performed in Figure 2A, C and D the mRNA was extracted from U87 cells prior to incubation with recombinant IRE1 and the resulting products analyzed using RT-qPCR with primers flanking different portions of the CD95 mRNA sequence. For Figures 2C and D, the primers used flank the two sites which were predicted to be cleaved by IRE1 based on previous work from our lab [7]. Even though we cannot exclude that additional sites can be targeted beyond these two, the fact that the amplification of CD95 sequence is reduced in samples pre-incubated with recombinant IRE1 strongly suggests that IRE1 is indeed able to cleave CD95 mRNA in these regions in vitro. We will modify the main text to further explain this point.

      1. Figure 3. Caspase-8-3 western blots show beautiful effects but did authors see some effects further downstream, eg on PARP1 cleavage? Was cell death (not viability) measured as well? Can you comment on this?

      This is absolutely right, we will test PARP-1 cleavage in this setting as suggested. Given the morphology of the cells we observed in the viability experiments, we would expect a similar trend using cell death assays. However, we do agree with the reviewer that this should be proven experimentally, so we will perform these experiments again using cell death assays as a read out.

      1. Did the authors looked at the DISC assembly? Did they detect some differences there?

      No, we did not. We would expect some difference given the impact we have observed on CD95 expression, caspase-8 activation and cell death of expressing dominant negative forms of IRE1, but this of course needs to be actually tested. We are in the process of optimizing CD95 DISC experiments in our lab and we therefore hope to be able to address this reviewer’s comment in a revised version of the manuscript.

      Reviewer #2 (Significance (Required)):

      This is an excellent study. The authors address here for the first time the connection between CD95, which is known as Fas, and ER stress. The role of another DR, TRAIL-R2 has been already reported, but this is the first study uncovering the link between Cd95 system and ER stress. The study is performed on the high level and supported by all necessary controls. This is an important advance for the death receptor field.

      Thank you again for these very positive comments and your insightful appreciation of our work.

      References

      1. Volkmann, K., Lucas, J. L., Vuga, D., Wang, X., Brumm, D., Stiles, C., Kriebel, D., Der-Sarkissian, A., Krishnan, K., Schweitzer, C., Liu, Z., Malyankar, U. M., Chiovitti, D., Canny, M., Durocher, D., Sicheri, F. & Patterson, J. B. (2011) Potent and selective inhibitors of the inositol-requiring enzyme 1 endoribonuclease, J Biol Chem. 286, 12743-55.
      2. Sheng, X., Nenseth, H. Z., Qu, S., Kuzu, O. F., Frahnow, T., Simon, L., Greene, S., Zeng, Q., Fazli, L., Rennie, P. S., Mills, I. G., Danielsen, H., Theis, F., Patterson, J. B., Jin, Y. & Saatcioglu, F. (2019) IRE1α-XBP1s pathway promotes prostate cancer by activating c-MYC signaling, Nat Commun. 10, 323.
      3. Langlais, T., Pelizzari-Raymundo, D., Mahdizadeh, S. J., Gouault, N., Carreaux, F., Chevet, E., Eriksson, L. A. & Guillory, X. (2021) Structural and molecular bases to IRE1 activity modulation, Biochem J. 478, 2953-2975.
      4. Logue, S. E., McGrath, E. P., Cleary, P., Greene, S., Mnich, K., Almanza, A., Chevet, E., Dwyer, R. M., Oommen, A., Legembre, P., Godey, F., Madden, E. C., Leuzzi, B., Obacz, J., Zeng, Q., Patterson, J. B., Jager, R., Gorman, A. M. & Samali, A. (2018) Inhibition of IRE1 RNase activity modulates the tumor cell secretome and enhances response to chemotherapy, Nat Commun. 9, 3267.
      5. Almanza, A., Mnich, K., Blomme, A., Robinson, C. M., Rodriguez-Blanco, G., Kierszniowska, S., McGrath, E. P., Le Gallo, M., Pilalis, E., Swinnen, J. V., Chatziioannou, A., Chevet, E., Gorman, A. M. & Samali, A. (2022) Regulated IRE1α-dependent decay (RIDD)-mediated reprograming of lipid metabolism in cancer, Nat Commun. 13, 2493.
      6. Le Reste, P. J., Pineau, R., Voutetakis, K., Samal, J., Jégou, G., Lhomond, S., Gorman, A. M., Samali, A., Patterson, J. B., Zeng, Q., Pandit, A., Aubry, M., Soriano, N., Etcheverry, A., Chatziioannou, A., Mosser, J., Avril, T. & Chevet, E. (2020) Local intracerebral Inhibition of IRE1 by MKC8866 sensitizes glioblastoma to irradiation/chemotherapy in vivo, 841296.
      7. Voutetakis, K. D., D.; Vlachavas, E-I., Leonidas, DD.; Chevet, E.; Chatzioannou, A. (In preparation) RNA sequence motif and structure in IRE1-mediated cleavage.
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The authors address here for the first time the connection between CD95, which is known as Fas, and ER stress. The role of another DR, TRAIL-R2 has been already reported, but this is the first study uncovering the link between Cd95 system and ER stress.The study is performed on the high level and supported by all necessary controls. They find the connection between IRE1 and CD95 and show that it might play a role in Cd95 signaling and attenuate CD95-mediated cell death.

      Further, the correlation between CD95 expression and IRE is found in tumors. Importantly the authors find out the connection between XBP1 and CD95 expression, which was not reported to date. Hence, it is a very important and highly essential piece of research.

      However, I would like to clarify the several issues:

      1: Figure 1. Tunicamycin obviously leads to deglycosylation of CD95, which is indicated by the appearance of 35 Kda band. This should be highlighted and commented. 2.Figure 2c, d. The piece of mRNA structure, which is synthesized, might have the different secondary structure and might be not cleaved by IRE, accordingly. More detailed comments have to be provided in this regard. 3. Figure 3. Caspase-8-3 western blots show beautiful effects but did authors see some effects further downstream, eg on PARP1 cleavage? Was cell death ( not viability) measured as well? Can you comment on this? 4. Did the authors looked at the DISC assembly? Did they detect some differences there?

      Significance

      This is an excellent study. The authors address here for the first time the connection between CD95, which is known as Fas, and ER stress. The role of another DR, TRAIL-R2 has been already reported, but this is the first study uncovering the link between Cd95 system and ER stress.The study is performed on the high level and supported by all necessary controls. This is an important advance for the death receptor field.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Here the authors argue that IRE1 activation has opposite effects on Fas/CD95 expression/stability in a number of contexts, via either RIDD-dependent degradation of Fas mRNA or XBP-1-mediated induction of Fas expression, which led to either increased or decreased sensitivity to Fas-induced apoptosis in a number of settings.

      Major issues:

      The study is somewhat preliminary and inconclusive in that it is not clear why the RIDD function of XBP-1 appears to predominate in vitro in the cell lines examined, leading to modest increases in Fas expression levels (Figure 1) when IRE1 DN versus IRE1 WT constructs are overexpressed, which is at odds with the latter part of the paper which suggests that inhibition of RIDD led to reduced Fas expression levels. However, this could be due to supraphysiological levels of IRE1 being expressed under overexpression conditions, leading to confounding results. Similarly, when XBP-1s is overexpressed in vitro (Figure 5) the modest increases in CD95/Fas expression and sensitization to Fas-induced cell death may not be fully representative of what would be observed at physiological levels of XBP-1s activation. The in vivo results obtained using an IRE1 RNase inhibitor (MKC8866) contradict the earlier part of the study (as Fas levels decreased and there was protection from Fas-induced liver toxicity) and this could be due to a multitude of reasons. There is no doubt that impacting on IRE1 activity has interesting effects on CD95/Fas expression, which can be up- or -down-regulated, with consequences for cell death induced via engagement of the latter receptor, however, the manuscript does not offer a lot of clarity on which outcome is the predominant one in the context of engagement of the UPR. I have the following suggestions for improvement.

      1. The authors should induce ER stress using Thaps, Brefeldin A and Tunicamycin, and explore the effects of doing this on Fas expression levels in the context of silencing endogenous IRE1, XBP-1 and PERK.
      2. The authors should explore the effects of silencing of IRE1, XBP-1 and PERK on constitutive Fas expression and the outcome of Fas/CD95-induced apoptosis in cells not experiencing an overt activation of the UPR (i.e. in the absence of Thaps, Brefeldin A or other UPR inducer).
      3. The specificity of MKC8866 at the concentration used (30 uM) is unclear. What effect does MKCC have on sensitivity towards Fas-induced apoptosis, similar to the type of experimental set up presented in Figure 5A, 5B?
      4. Similarly, what effects does MKC8866 (at 30 uM) have on key Fas pathway determinants, such as Fas, FLIPL, FLIPs, Caspase-8, FADD, RIPK1, A20, CYLD, cIAP-1, cIAP-2 and Bid? There are many points at which MKC8866 could influence the outcome of Fas receptor engagement beyond the receptor itself

      Minor issues:

      1. For the Fas mRNA cleavage experiments presented in Figure 2, there are no irrelevant control mRNAs to allow the reader to judge whether the effects presented are specific to Fas mRNA or are commonly observed for many mRNAs at these amounts of IRE1 (1 ug, 0.5 ug, which appear high).

      Significance

      General assessment: this is an interesting study, as there is little knowledge currently concerning how the UPR influences Fas expression or Fas-dependent outcomes. However, the impact of this work is limited by the overexpression approaches used, which could produce artifactual results, as well as the contradictory message of the study.

      Advance: the advance reported here is relatively modest and limited in scope due to the inconclusive nature of the data presented.

      Audience: this study will be of interests to specialists in the UPR and cell death communities.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Overview:

      This manuscript addresses the emerging nexus linking the machinery associated with clathrin endocytosis (clathrin-coated pits; CCPs), flat clathrin lattices (FCLs) and the recently discovered Reticular Adhesions (RAs). This is timely work, reflecting recent foci on the relationship between these structures and systems. Initially clearly identifying reductions in FCL and RA formation on fibronectin, the authors sought to clarify the mechanisms that suppress or prevent FCL / RA formation on this matrix. Knock-down of integrin avb5 (core RA component) suppressed both RA and FCL formation, suggesting a dependence of FCLs on this integrin. This was supported by acute avb5 inhibition via cilengitide (avb5 and avb3 inhibitor) which caused disassembly of existing RAs and FCLs.

      Notably, the inverse relationship also appears true, with suppression of core clathrin endocytic machinery (AP2 complex components) being sufficient to greatly deplete RA formation. Supporting this finding, overexpression of a dominant negative-acting protein fragment (AP180 c-terminal fragment) blocked both AP2 localisation to the plasma membrane and RA formation.

      To unmix this bi-directional dependence further, the authors used acute cilengitide treatment followed by washout and post-washout incubation to first deplete RAs (cillengitide) and then allow monitoring of en masse RA formation after cilengitide washout. This is an effective experiment, however, the analysis would benefit from greater depth, particularly relating to the order of events. Analysis of this aspect seems central to the thrust of the paper, and some statistical analysis of either static co-occurrence or dynamic ordering in large numbers of FCL / RA structures (i.e. hundreds) would be of value.

      The authors next focused on the observation that fibronectin suppressed both FCL and RA structures, by assessing the role of fibronectin-receptor integrin b1. Acute antibody mediated integrin b1 inhibition (mab13) and integrin b1 knock down both confirmed that in cells on fibronectin, suppression of integrin b1 is sufficient to permit massive upregulation of both FCL and RA formation. This is surprising and very interesting. It raises questions about the actual ECM requirements for avb5-mediated reticular adhesion formation. It would seem that fibronectin per se can support very efficient RA / FCL formation, but that normally concurrent integrin b1 activities would suppress this. Given this implication, it would be especially important to clarify the purity of FN ECM coating (as explored in questions 1-3 below) at the time of imaging. The discussion addresses a number of topics, and proposes a mechanistic model to explain the results presented. I don't find the mechanism very convincing, as the directionality of the dependence between FCLs and RAs is not clearly delineated by the experiments presented, in my opinion. That there is co-dependence is convincingly shown, but whether there is directionality, and what order of events underpins FCL then RA or RA then FCL formation, is unclear. Nonetheless, the evidence presented does generally support the idea of a shift in the way we consider the role of endocytic machinery in adhesion regulation, from a disassembly only related function to additional functions associated with adhesion formation and maintenance. Ideally, the mechanisms around this new assembly / maintenance function would be further delineated here, but regardless, this work does point in the direction of important new questions in this area. Further discussion about the potential role of this interdependent regulatory process in, for example, mitosis, seems unwarranted and should probably be removed.

      Questions:

      1. A technical question on the replating experiments onto specific matrix proteins; after coating surfaces with the purified ECM components or controls, what media were the cells replated in? Ideally this should be serum-free media, to ensure that the ECM components of FBS / FCS are not immediately added to the purified ECM components. This should be clarified in the methods.
      2. Related to above, I cannot see how long cells were plated onto the different ECM conditions. This would be relevant to know and should be clarified because cells will secrete ECM over time and thus the purity of the ECM components addressed is dependent on the length of time cells are incubated and imaged for after attachment.
      3. Similarly, it is noted that cells plated on 'glass' support RA formation. It should be clarified what ECM component is then actually responsible for cell adhesion and adhesion complex (RA, FA or other) formation
        • since this requires an ECM component of some type. Presumably, 'on glass' means whatever ECM is either derived from the media used during cell attachment / incubation (if that media contains serum, which is vitronectin rich), or whatever ECM is secreted by the cells themselves over the attachment / incubation period prior to imaging.
      4. In the cilengitide washout experiments, the evidence shown in figures seems to suggest that AP2-positive FCLs form in locations where avb5 (probably RAs) are already present, whereas avb5 positive structures do not form from AP2-only structures. Statistical analysis of this pattern (i.e. which protein is present first) would be valuable to address directionality. Notably, in Figure 3G, it appears that avb5 is present and increasing prior to the subsequent arrival of AP2.
        • a. I would suggest that the cilengitide experimental results(3E-G) be shown in a separate figure from the endocytosis inhibition results (3A-D).
      5. The integrin b1 inhibition and knock down results are clear and interesting. Clarifying the ECM components present during these experiments would be valuable to interpretation of the paper.

      Significance

      see above

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      Hakanpää and colleagues report on the relationship between flat clathrin lattices (FCLs) and reticular adhesions, with FCLs being preposed to nucleate reticular adhesions. Overall the experimental work is high quality and the data are generally well presented.

      Major comments:

      The Introduction is very brief and doesn't cover the information required to understand the paper. There are three cellular structures to be understood: focal adhesions, reticular adhesions and FCLs. The intro jumps straight into the FCLs (the paper is written from a FCL point of view) but there is no information about the other two structures really particularly the differences between them. Furthermore, there is nothing in the intro about cellular adhesion or why this is even worth studying. The authors should fully revise this Intro, there is much room for improvement!

      Fig 4D I could not understand this plot and the legend did not describe it properly. What are the units of FCL frequency? I guess it is FCLs per some distance (10µm?), the images need a scale bar. OK, I read the description in the methods and now I see it is the proportion of total CCSs that are FCLs; so frequency is the wrong term. The legend says that there were 32 videos and there are 32 points on the plot but what we need to know is: where n = 1 cell, what did the FCL frequency do over time? A line is drawn on the graph, no info on what the line is and the fit is poor (R2 < 0.5). The authors should take their series of data points from individual cells and fit curves to each and describe the summary statistics of the parameters of these fits OR average the data and fit to that, using the 1 SD of the data for weighting the fit. Probably more data is required to do any meaningful fitting here. To my eye it looks like FCL frequency goes from 0.3 to a plateau of 0.5 at 10 min and that more timepoints between 0 and 10 min would have been useful.

      Fig 3F/G is a nice expt. It looks as though the ITGB5 signal is already creeping up when the AP2 arrives. I agree that they accelerate together, but the prior accumulation of integrin is at odds with the conclusion that AP2/clathrin nucleates the adhesion. This experiment is missing two controls: what is the behaviour of ITGB5 in AP2 negative regions? What happens to both signals in the continued presence of cilengitide? These controls are needed to conclude that AP2 is nucleating the adhesion.

      Minor comments:

      Fig 6 - several typos - "adaptor proteins" "engagement" "containing"

      Significance

      Previously, endocytosis (clathrin-mediated) was thought to decrease cellular adhesion by removal of integrins. This paper suggests that the same machinery can be used to build adhesions. This is a surprising conclusion that will be of interest to many cell biologists; the topic of clathrin and adhesion is being actively explored by several labs either from the adhesion or the endocytosis sides. I have been following this topic from a distance and don't know the details of all the published papers, but this paper does seem to add something new over the recent work from Taraska, Sonnenberg, Montagnac, Strömblad.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, Hakanpää et al explored the connection between flat clathrin lattices and reticular adhesions and the regulatory mechanism underlying the formation of these two structures in the U2OS cells. The author provided evidence that the composition of the extracellular matrix plays critical roles in their formation and concluded that fibronectin and its receptor, β1 integrin, inhibit the assembly of FCLs and RAs. The author depleted several components of the clathrin mediated endocytosis machinery and could show that it blocked the formation of reticular adhesions.

      Major comments

      1. In Fig. 1, the author plated U2OS cells on surfaces coated with different ECM components and then measured the frequency of FCLs. How long were the cells allowed to attach to the surfaces before they were imaged? Were the cells serum-starved before seeding? Given the fact that cells attached well even on BSA-coated dishes, I guess the cells were allow to attach and spread for at least overnight. In this case, the ECM components (vitronectin is very abundant in the serum in a concentration of 200-400 ug/mL, fibronectin is another one) in the culture medium would coat the glass surface and this has profound effects on the adhesion status of the cells. Thus, more details of this experiment need to be included and more attention should be pay regarding the data interpretation. In Fig. 1C, it seems like the mere glass surface induced the most FCL formation. However, if the cells are grown on the glass overnight or for days, the major component of the surface would actually be vitronectin and fibronectin (maybe more) rather than glass, thus it is not accurate to say that 'VTN reduced FCL frequency to some extent compared to glass' (Line 67).
      2. Line 91-93. It is not accurate to claim that the reticular adhesions are the only type of cellular adhesion maintained during mitosis. In several studies, active integrin β1 are found along the retraction fibers (Dix et al, Dev Cell, 2018; Chen et al, NCB, 2022). The importance of αVβ5 integrin in the spatial memory during mitosis was only shown in the in vitro cell culture. In fact, mice lacking αVβ5 integrin or its ligand vitronectin are both viable and show no major defects during embryonic development (Zheng et al, PNAS, 1995; Huang et al, Mol Cell Biol, 2000), suggesting reticular adhesions are dispensable in cell division in vivo. I advise to change it into'RAs are composed of αVβ5 integrin and are maintained during mitosis in culture'.
      3. It has been shown that fibronectin and laminin coating inhibit formation of reticular adhesions (Lock et al, NCB, 2018, Fig. S7). This study should be cited in Fig. 1. I suggest to also include laminin in Fig. 1C to make the list of ECM components more complete.
      4. Fig. 5C, the fluorescent intensity of αVβ5 integrin is increased dramatically when integrin β1 was depleted compared to the control shRNA. Although the images were collected in the TIRF mode, it is important to measure αVβ5 and β1 integrin level by immunoblot to confirm the knockdown efficiency of β1 integrin and exclude the possibility that the increase of RA formation is not due to the compensation by upregulation of αVβ5.
      5. Antibody-blocking or depletion of β1 integrin both lead to accumulation of FCL and RA formation, indicating that the activation of β1 integrin is critical in the inhibition of FCL and RA. Activation of β1 integrin depends on talin and kindlin, which bind β5 integrin with a much lower affinity. Would depletion of talin or kindlin cause FCL and RA formation similar to inhibition of β1 integrin?

      Minor comments

      1. In most of the quantifications, only the number of the cells measured were mentioned in the legend. The number of replicate experiments is missing. It should be included in the legend as well.
      2. A recent study (https://doi.org/10.1242/jcs.259465) demonstrated the molecular mechanism underlying the localization of αVβ5 integrin in flat clathrin lattices. It should be mentioned in the introduction.

      Significance

      Although it is not novel that FCLs and RAs share same localization and might actually be the different parts of the same structure (Zuidema et al, JCS, 2022), the observation that inhibiting β1 integrin stimulates FCL and RA assembly is interesting as it indicates the counter-balance between the αVβ5 and α5β1 integrins. It is a pity that the author did not dig deeper into the mechanism underlying this interesting finding, which should greatly increase the impact of this study.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer 1:

      We would like to thank you for taking the time to review our manuscript. Your thoughtful and insightful comments have greatly improved the quality of our work. We appreciate your thoroughness in evaluating our study and providing valuable feedback.

      Your constructive criticism and suggestions have helped us identify areas that needed further clarification and improvement, and we are grateful for your efforts in guiding us towards a stronger manuscript.

      Thank you again for your time and expertise in reviewing our work. We hope that you find our revisions satisfactory and look forward to hearing your thoughts on the revised manuscript.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): *

      In this manuscript by Sharma and colleagues, the authors investigate the transcriptional regulation of the TAL1 isoforms - that derive from differential promoter usage and/or alternative splicing - and the contribution of TAL1 long and TAL1 short protein isoforms in normal haematopoietic development and disease.

      The study suggests that TAL1 transcript isoforms are fine-tuned regulated. By using CRISPR/Cas9 techniques, the authors show that the enhancer -8 (MuTE) and enhancer -60 differentially regulate the TAL1 isoforms. Whether the remaining enhancers at the TAL1 locus (see Zhou Y et al, Blood 2013) also differentially regulate TAL1 transcription remains to be elucidated.

      The authors found that TAL1 short isoform interacts strongly with T-cell specific transcription factors such as TCF3 and TCF12, as compared to TAL1 long isoform. TAL1 short shows an apoptotic transcription signature and it fails in rescuing cell growth as compared to TAL1 long in T-ALL. In addition, TAL1 short promotes erythropoiesis.

      Lastly, the authors suggest that altering TAL1 long and TAL1 short protein isoforms ratio could have a potential therapeutic application in disease, but further studies are needed. *

      We would like to thank you for your time and effort in reviewing our manuscript. Your constructive feedback and insightful comments have been immensely valuable in improving the quality of our work. Your expertise in the field has undoubtedly contributed to the credibility and accuracy of this research. In addition, your dedication and attention to detail have been instrumental in shaping the final version of the manuscript.

      * I have a number of comments: Figure 1 It was not mentioned that MOLT4 cells also have MuTE. Do Jurkat and MOLT4 share a similar profile in terms of TAL1 transcript isoforms? It would have been very interesting to see whether the TAL1 transcript isoforms are similar in SIL-TAL1+ cells (e.g RPMI-8402). In these cells, TAL1 activation results from a deletion that fuses the 5' non-coding region of SIL with TAL1. *

      Thank you for your comment. We apologize for the confusion regarding the MOLT4 cells in our analysis. We have now updated the manuscript to explicitly mention the presence of MuTE in MOLT4 cells (Line 127). Additionally, we agree that it would be interesting to investigate whether the TAL1 transcript isoforms are similar in SIL-TAL1+ cells, such as RPMI-8402. To address this point, we have included the CCRF-CEM cell line that harbors the SIL-TAL1 recombination in our analysis. We have updated the manuscript with these new findings (Fig. 1C&D and S1A&B). Thank you for bringing this to our attention.

      Figure 2 * It is not very clear how the expression of the short isoform delta exon 3 is quantified. Detailed information and a schematic of the primer location could be helpful. *

      Thank you for your comment. We apologize for any confusion regarding the quantification of the expression of the short isoform (delta exon 3). The detailed information and schematic of the primer location can be found in Supplementary Figure 2B. We have included the location of each primer used in real-time PCR analysis for the quantification of all TAL1 isoforms. We hope this additional information will address your concerns.

      * The results on Figure 2 derive from complex Cas9/CRISPR experiments. A schematic representation showing the location of the following elements is missing: CTCF sites, CTCF gRNA target region, dCas9-p300 gRNA target region and -60 enhancer. *

      We agree that providing a schematic representation of the Cas9/CRISPR experiments would be helpful for better understanding the data in Figure 2. We have now included a detailed schematic of the location of the CTCF sites, CTCF gRNA target region, dCas9-p300 gRNA target region and -60 enhancer in Supplementary Figure 2E. We believe this new figure will provide a clearer overview of the experiments performed and will aid in the interpretation of the results.

      * Are the levels of dCas9-p300 WT and dCas9-p300 MUT comparable in transfected HEK 293 cells? Were those possibly measured by qPCR or Western Blot? Why the authors chose to use 293T cells for the CTCF del as the enhancer usage around the locus must be so different from haematopoietic cells. *

      Thank you for your question. We have added Western Blot analysis to compare the levels of dCas9-p300 WT and dCas9-p300 MUT in transfected HEK293T cells, as suggested. The results are presented in Supp. Fig. S2H.

      Regarding the choice of HEK293T cells for the CTCF deletion experiment, we selected this cell line for its low expression of TAL1, which contributes to a high dynamic range when tethering p300 core to a closed chromatin region. We have added a clarification of our rationale for using HEK293T cells in the revised manuscript (Lines 177-8). Thank you for your valuable feedback.

      * Is CPT - camptothecin? A control gene that is sensitive to CPT treatment would ensure the inhibitor is working. *

      Thank you for your comment. Indeed, CPT stands for camptothecin, and this information is already included in the methods section. We have also added this information to the results section (Line 221) to make it clearer.

      Regarding the suggestion to use a control gene sensitive to CPT treatment, we agree that this could be a useful addition to our experimental design. To address this, we have quantified the amount of TAL1 transcript to an endogenous control which is not transcribed by RNA Polymerase II (RNAPII) (18s rRNA). As a positive control, we compared Cyclo A, our endogenous control, to 18s rRNA and observed a reduction (Supp. Fig. S2K). This allows us to confidently conclude that the inhibitor is working as intended.

      Thank you for bringing up this point, and we hope that our response addresses your concern.

      *

      In supplementary Figure 2D, the reduction in expression in Jurkat Del-12 is restricted to TSS2. There is no reduction in TAL1 TSS1 and TAL1 TSS4 (this is not clear from the result description section). As seen, these isoforms are upregulated and that could suggest a compensatory mechanism mediated by alternative promoter activation. The fact that Jurkat Del-12 express TAL1 from MSCV-TAL1 could also suggest that TSS1 and TSS4 are upregulated by TAL1 or indirectly, by other members of the TAL/LMO complex (see Sanda T et al, Cancer Cell 2012) *

      Certainly, we appreciate your feedback. Supplementary Figure 2D indeed shows that the MuTE enhancer has a differential effect on the promoters, and we have now included this in the text of the manuscript. Regarding the TAL1-long isoform, while MSCV-TAL1 in the Jurkat Del-12 cell line does give rise to this isoform, our results from Figure 3A did not find TAL1-long to have a differential effect on TAL1 promoters. It is important to note that the experiment conducted was an exogenous construct in HEK293T cells, which has its limitations. Thus, the speculation that TAL1-long drives the result in supplementary Figure 2D is possible, and we have added this to the text. Thank you for bringing up this important point (Lines 167-9).

      Figure 3 * A. Are the levels of TAL1 short cDNA and TAL1 long cDNA comparable in the co-transfection luciferase experiments? The overexpression of the isoforms does not reflect the endogenous expression levels in cell lines where one of the isoforms is more predominantly expressed (e.g Jurkat cells express low levels of TAL1 short). *

      Thank you for your comment. To address your concern, we have added real time (Supp. Fig. S3A) as well as Western blot in a new figure (Supp. Fig. S3B) to show that the levels of TAL1-short and TAL1-long cDNA are comparable in the co-transfection luciferase experiments. Additionally, we observed a very low amount of endogenous TAL1 isoforms in the cell line (Supp. Fig. S3A&B), which was below detection using these methods. This suggests that the effect of the endogenous TAL1 in this cell line is low. We appreciate your feedback, and we hope this additional information addresses your concern.

      * Figure 4 Are the levels of flag-TAL1 long and flag-TAL1 short comparable? The levels of expression could explain the low intensity signal for TAL1 long. *

      Thank you for your insightful comment. Indeed, the issue of isoform quantification is critical in understanding the functional differences between TAL1-short and TAL1-long. To address this concern, we performed careful quantification of the isoforms and made sure that the amount was equal or slightly in favor of TAL1-long before conducting the experiments in this manuscript. We have also added a Western blot in Supp. Fig. S3A and real time in Supp. Fig. S3B showing the similar amount of the two isoforms. Furthermore, in Figure 4A, we provided the amount of each isoform in the input section, showing a higher amount of TAL1-long. This strengthens our result, which shows that TAL1-short binds stronger to TCF-3 and 12. Protein levels for ChIP-seq experiment (Fig. 4B-H) is now in Supp. Fig. S4B. We thank you for bringing up this important point, and we hope that our additional data and clarifications have addressed your concern

      *Is there any reason for not performing a depletion of endogenous TAL1 prior to the ChIP seq flag experiment? *

      Thank you for your comment. In our experience, infecting Jurkat cells with shRNA or an expressing vector systems can induce some cellular stress, and we did not want to add additional stress to the cells by depleting endogenous TAL1. Since we immunoprecipitated using a Flag-tagged protein, we did not see a need to deplete the endogenous TAL1 protein. However, in our RNA-seq experiment, depletion of endogenous TAL1 was critical, and we have added this additional step in this experiment.

      * Could the authors speculate about MAF motif enrichment in both isoforms and not in TAL1-total? *

      Thank you for bringing up this interesting point. It is worth noting that while all ChIP-seq experiments were performed in Jurkat cells, not all of them were conducted by us. In particular, ChIP-seq of TAL1 total was performed by Sanda et al., 2012, using an endogenous antibody against both isoforms, whereas we conducted ChIP-seq for TAL1-short and TAL1-long using a FLAG tag antibody in cells expressing each of the isoforms. Therefore, the different conditions of these experiments may have contributed to the observed MAF motif enrichment in both isoforms and not in TAL1-total. While we cannot provide a definitive explanation, we speculate that the overexpression of the isoforms or the presence of the FLAG tag may have facilitated the detection of the MAF motif. We have added this discussion to the manuscript to acknowledge and address this interesting observation (Lines: 307-8).

      1. Sanda et al., Core transcriptional regulatory circuit controlled by the TAL1 complex in human T cell acute lymphoblastic leukemia. Cancer Cell 22, 209-221 (2012).

        * Do TAL1 long and TAL1 short recognise the same DNA motif? *

      This is indeed a very interesting question but a difficult one to answer since TAL1 does not bind to the DNA alone but in a complex. In this situation, the ChIP-seq de-novo binding results suggest motifs that could be recognized by TAL1 or any of its complex partners. Using previous data, TAL1’s binding motif is CAGNTG (Hsu et al., 1994), while this motif was not identified in our analysis of the TAL1-total or FLAG-TAL1-long ChIP-seq results, we did, however, identify this sequence in FLAG-TAL1-short ChIP-seq results (p value=1e-93). We predict that this discrepancy is due to the complex nature of transcription factors binding and the fact that the ChIP-seq results were not all done in the same way. We have now added this to the discussion (Lines: 419-25).

      1. L. Hsu et al., Preferred sequences for DNA recognition by the TAL1 helix-loop-helix proteins. Mol Cell Biol 14, 1256-1265 (1994).

      * Figure 6 In A and B, are the levels of flag-TAL1 long and flag-TAL1 short in transduced K562 comparable? In C and D, are the TAL1 levels reduced at the protein level?*

      Thank you for your question. To answer your question, we added Western Blot analysis to show the comparable levels of flag-TAL1-long and flag-TAL1-short in transduced K562 cells (Supp. Fig. S6C). In Figure 6C and D, we also added Western Blot analysis to show the reduction in TAL1 protein levels upon shRNA-mediated knockdown(Supp. Fig. S6B).

      * Minor points: Figure 1 A. Include a scale bar *

      To address this, we included coordinates of the components of the gene marked in the figure.

      * C. Loading control such as GAPDH is missing in the Western Blot. Are CUTLL cells the same as CUTTL-1? *

      We added loading controls as requested now supplementary Fig. 1C, S2C, S3A, S4B, S6B&C. Yes, CUTLL is the same as CUTLL-1 we have now fixed this in the text (Line 120).

      D. Adjust scale of the CHIP seq tracks in K562 cells in order to see the peak summit. *Include genome build *

      Thank you for your comment. We have adjusted the scale of the ChIP-seq tracks in K562 cells as suggested to improve the visualization of the peak summit. However, one of the peaks still had a much higher signal and the summit is still missing from this particular peak. To address this, we have added a new figure in the supp. Fig. S1C materials where we adjusted the peak to show the summit. Please note that in this track, the chromatin structure at the enhancers is missing, and therefore, we did not include it in the main figure. Thank you for bringing this to our attention.

      We have added a genome build hg19 to the figure legend.

      * In supplementary Figure 1B, the symbol scheme is not clear *

      Thank you for this note, we have replaced the figure and added text to make it clearer.

      * Figure 2 A & C. Remove 'amount' from the Y axis. Is the total mRNA amount calculated as % of the reference genes? It could be specified on the y axis or figure legend. *

      We have removed the word "amount" from the Y axis as requested. Total mRNA amount is normalized relative to the reference genes (∆∆Cq) by Bio-Rad's CFX Maestro software (version 2.3) according to the formula:

      where:

      • RQ = Relative Quantity of a sample
      • Ref = Reference target in a run that includes one or more reference targets in each sample
      • GOI = Gene of interest (one target)

      * In supplementary Figure 2C, a loading control is missing.*

      We have added alpha-tubulin to this figure.

      * Figures 4, 5 and 6 Size of the figures should be increased. *

      We have increased the figure size as suggested. *

      Reviewer #1 (Significance (Required)): The study from Sharma and colleagues is novel and it extends the knowledge on TAL1 regulation and the role of TAL1 in development and disease. Although the study suggests that there is a correlation between enhancers, chromatin mark deposition at exons and regulation of alternative splicing, the mechanistic link is not fully elucidated.*

      To further elucidate the mechanistic link between the MuTE enhancer, broad H3K4me3 modification spanning 7.5 Kbp from TAL1 promoter 1 to promoter 5 (as shown in Fig. 1D), and alternative splicing, we conducted experiments where we manipulated KMT2B, a component of the SET1/COMPASS complexes responsible for methylating H3K4. Our findings indicate that silencing KMT2B in Jurkat cells led to a significant 30% increase in TAL1-∆Ex3 (Fig. 2H and Supp. Fig. S2I&J). These results contribute to a more comprehensive understanding of the molecular mechanisms underlying TAL1 alternative splicing regulation.

      The findings on TAL1 short protein are interesting but the data on TAL1 long lacks some refinement so then robust conclusions can be drawn. * The experimental data lacks a few controls. The text is clear and prior studies could be better referenced. *

      We have made an effort to better reference out manuscript.

      * As TAL1 is a very crucial transcription factor oncogene in T-ALL, the study is important as it addresses a very relevant question in the field that is the regulation of the transcription of TAL1 and the functional relevance of both TAL1 short and TAL1 long isoforms. *

      Reviewer 2: *

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: Sharma et al. thoroughly characterized the regulation of TAL1 by mapping the use of its five promoters and enhancers, which together transcribe five transcripts, coding for two protein isoforms. For that purpose the authors used few cell lines: Jurkat as a T-ALL cell line, chronic myeloid leukemia (CML) cell line K562 and HEK293T with low TAL1 expression, as well as CutLL and MOLT4. They profiled the chromatin marks H3K27ac and H3K4me3 at the TAL1 locus, and show that when a the -8 enhancer is compromised tha chromatin marks change, and not only the expression level of TAL1 is reduced, the level of exon 3 skipping is increased. When the -60 enhancr was activated, TAL1 expression increased, and exon 3 skipping was reduced. Those findings indicate that in tal1, transcription and alternative splicing are co-regulated, independent of RNAPII. The authors also show that as an autoregulator, TAL1-short has a preference to TSS1-3 of TAL1, which is not shared by TAL1-long, and that each of the 5' UTR affect Tal1 expression differently. TAL1-short binds E-proteins more strongly than TAL1-long, binds many more sites than TAL1-long and stronger, and each isoform has unique set of targets. Finally, the authors set to identify the different functions of the TAL1 isoforms, and showed that Tal1-short slows cell growth and leads to TAL1-short but not TAL1-long leads to exhaustion of hematopoietic stem cells and promotes differentiation into erythroids. This paper used for the first time TAL1 isoform specific ChIP-seq, which enable accurate definition of isoform-specific targets in Jurkat cells. They demonstrated an interaction between choice of TSS and alternative splicing, and isoform specific functions. Given the clinical importance of TAL1 and the meticulous work performed to characterize its isoform specific regulation and function, I find this manuscript of interest, and only have minor suggestions to improve readability. *

      Thank you for taking the time to carefully review our manuscript on the regulation and function of TAL1 isoforms. We appreciate your positive feedback on our comprehensive characterization of TAL1 regulation using chromatin profiling and isoform-specific ChIP-seq. We are glad that you found our findings on the co-regulation of transcription and alternative splicing, as well as the isoform-specific functions of TAL1, to be of interest.

      We also appreciate your suggestions to improve the readability of the manuscript and have made the necessary revisions accordingly. Your feedback has been invaluable in strengthening the quality of our work, and we are grateful for your contribution to the scientific community.

      * Minor comments: Add explicitly the motivation for choosing the cell line in each part. *

      We have added motivation (Lines: 157-8, 177-8, 192-194, 235-6 text that was on the previous version: 192-194, 379-80).

      * Figure 1 - Consider marking the promoter numbers and the enhancers names in the same names as in text (-8,-60 etc.), to make it easier for the readers to understand which enhancers is being discussed. *

      This in a very important point. We have added the numbering to Figure 1D and Supp. Fig. S2A, B & E.

      *P5, P18 - ProtParam is only a prediction tool, and does not supply an experimental measurement, as may be assumed from text. Please rephrase accordingly. *

      The words “prediction tool” were added in the indicated paragraphs (Lines 115 and 427).

      * Figure 2B/D - y axis label unclear, not explained in text. In accordance, unclear if the change is in the amount of RNA, or the ratio between the long and short variants. *

      Thank you for this comment. We greatly appreciate your feedback and suggestions. To make our calculations, which are the norm in the splicing field, clearer, we have now added text to Figure 4 and provided more detailed explanations in lines 670-73. We hope that these modifications will improve the clarity and comprehensiveness of our manuscript.

      *Consider removing the bars and increasing the dots, to make the graphs cleaner. *

      We removed the bars throughout the manuscript for a cleaner look.

      * P8 - The term '5C' may require more explanation, depending on target audience. *

      We have added text to explain the technique (Lines 179-81).

      * Figure 3 - the trend is that TAL1-short promotes transcription from all five TSSs. However, only in TSS1-3 is the difference significant, but the difference between the long and short forms is not significant. It is unclear if "The mean of three independent experiments done with three replicates" means overall there are three replicates per condition or nine. Please rephrase to clarify. *

      Thank you for your comment. To clarify, we want to state that each biological experiment was done in three technical replicates, resulting in a total of nine replicates for each condition. We apologize for any confusion and have now rephrased to: The mean was calculated from three independent biological experiments, each performed with three technical replicates (Lines: 696 and 699).

      *Fig 4 A - it seems that many of the sites bound by Tal1 total are not bind by either Tal1-short or Tal1-long. Indeed very little overlap between Tal1-short and Tal-1-total is seen in Fig 4I as well. It seems Tal1-long has very few peaks. Consider adding a discussion of possible reasons. *

      We agree that these findings are noteworthy and warrant further discussion. We added text to the discussion section to explore potential reasons for these observations (Lines 416-25).

      * Fig 4c - it is hard to distinguish the different lines. Consider a more clear visualization. Also, some text is in a font size too small to read. *

      We have changed the format of the figure and took out the input data from the main figure to help the visualization. The input data appear in the Supp. Fig. S4C.

      * Fig 4 D-H - will be useful to see the numbers, not just the % divided by %. *

      A table with the specific numbers can be found in Supp Figure 4F-J.

      * Fig 4 legend - 'I&L' possibly means 'I-L'. P14 - refer to where the results of the 'validation using real-time PCR' are shown. P16 - symbol replaced by an empty rectangle 20 􀀀M *

      Thank you for these valuable comments, we have fixed/added these in the manuscript.

      * Figure 6D - Y axis value seem strange (fold change relative to day 0 should be 1 at day 0). Consider different Y axis label for C and D to clarify. *

      Thank you for this comment, we have changed the y-axis to: Fold-change relative to day 1.

      * P18 - It is unclear which "two isoforms with posttranslational modifications which affected the migration rate of the protein (Fig. 1C)" were shown. Only two isoforms are mentioned throughout the paper. *

      We have added text to clarify we are referring to TAL1-short and long (Lines 409-10).

      *

      P18 - "Our ChIP-seq results suggest that the isoforms bind at the same location (Fig. 4B)." - in 4B it seems most of TAL1-short bound positions are not bound by TAL1 long. Please clarify. *

      * Worth mentioning that the Total TAL1 is taken from Jurkat cells but from a different experiment. * We have changed the statement and added the text referring to the experiments done independently (Lines 422-3).

      *

      Reviewer #2 (Significance (Required)): This paper used for the first time TAL1 isoform specific ChIP-seq, which enable accurate definition of isoform-specific targets in Jurkat cells. They demonstrated an interaction between choice of TSS and alternative splicing, and isoform specific functions. Given the clinical importance of TAL1 and the meticulous work performed to characterize its isoform specific regulation and function, I find this manuscript of interest, and only have minor suggestions to improve readability. *

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      Sharma et al. thoroughly characterized the regulation of TAL1 by mapping the use of its five promoters and enhancers, which together transcribe five transcripts, coding for two protein isoforms. For that purpose the authors used few cell lines: Jurkat as a T-ALL cell line, chronic myeloid leukemia (CML) cell line K562 and HEK293T with low TAL1 expression, as well as CutLL and MOLT4.

      They profiled the chromatin marks H3K27ac and H3K4me3 at the TAL1 locus, and show that when a the -8 enhancer is compromised tha chromatin marks change, and not only the expression level of TAL1 is reduced, the level of exon 3 skipping is increased. When the -60 enhancr was activated, TAL1 expression increased, and exon 3 skipping was reduced. Those findings indicate that in tal1, transcription and alternative splicing are co-regulated, independent of RNAPII. The authors also show that as an autoregulator, TAL1-short has a preference to TSS1-3 of TAL1, which is not shared by TAL1-long, and that each of the 5' UTR affect Tal1 expression differently. TAL1-short binds E-proteins more strongly than TAL1-long, binds many more sites than TAL1-long and stronger, and each isoform has unique set of targets.

      Finally, the authors set to identify the different functions of the TAL1 isoforms, and showed that Tal1-short slows cell growth and leads to TAL1-short but not TAL1-long leads to exhaustion of hematopoietic stem cells and promotes differentiation into erythroids.

      This paper used for the first time TAL1 isoform specific ChIP-seq, which enable accurate definition of isoform-specific targets in Jurkat cells. They demonstrated an interaction between choice of TSS and alternative splicing, and isoform specific functions. Given the clinical importance of TAL1 and the meticulous work performed to characterize its isoform specific regulation and function, I find this manuscript of interest, and only have minor suggestions to improve readability.

      Minor comments:

      Add explicitly the motivation for choosing the cell line in each part.

      Figure 1 - Consider marking the promoter numbers and the enhancers names in the same names as in text (-8,-60 etc.), to make it easier for the readers to understand which enhancers is being discussed.

      P5, P18 - ProtParam is only a prediction tool, and does not supply an experimental measurement, as may be assumed from text. Please rephrase accordingly.

      Figure 2B/D - y axis label unclear, not explained in text. In accordance, unclear if the change is in the amount of RNA, or the ratio between the long and short variants. Consider removing the bars and increasing the dots, to make the graphs cleaner.

      P8 - The term '5C' may require more explanation, depending on target audience.

      Figure 3 - the trend is that TAL1-short promotes transcription from all five TSSs. However, only in TSS1-3 is the difference significant, but the difference between the long and short forms is not significant. It is unclear if "The mean of three independent experiments done with three replicates" means overall there are three replicates per condition or nine. Please rephrase to clarify.

      Fig 4 A - it seems that many of the sites bound by Tal1 total are not bind by either Tal1-short or Tal1-long. Indeed very little overlap between Tal1-short and Tal-1-total is seen in Fig 4I as well. It seems Tal1-long has very few peaks. Consider adding a discussion of possible reasons.

      Fig 4c - it is hard to distinguish the different lines. Consider a more clear visualization. Also, some text is in a font size too small to read.

      Fig 4 D-H - will be useful to see the numbers, not just the % divided by %.

      Fig 4 legend - 'I&L' possibly means 'I-L'.

      P14 - refer to where the results of the 'validation using real-time PCR' are shown.

      P16 - symbol replaced by an empty rectangle 20 􀀀M

      Figure 6D - Y axis value seem strange (fold change relative to day 0 should be 1 at day 0). Consider different Y axis label for C and D to clarify.

      P18 - It is unclear which "two isoforms with posttranslational modifications which affected the migration rate of the protein (Fig. 1C)" were shown. Only two isoforms are mentioned throughout the paper.

      P18 - "Our ChIP-seq results suggest that the isoforms bind at the same location (Fig. 4B)." - in 4B it seems most of TAL1-short bound positions are not bound by TAL1 long. Please clarify. Worth mentioning that the Total TAL1 is taken from Jurkat cells but from a different experiment.

      Significance

      This paper used for the first time TAL1 isoform specific ChIP-seq, which enable accurate definition of isoform-specific targets in Jurkat cells. They demonstrated an interaction between choice of TSS and alternative splicing, and isoform specific functions. Given the clinical importance of TAL1 and the meticulous work performed to characterize its isoform specific regulation and function, I find this manuscript of interest, and only have minor suggestions to improve readability.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript by Sharma and colleagues, the authors investigate the transcriptional regulation of the TAL1 isoforms - that derive from differential promoter usage and/or alternative splicing - and the contribution of TAL1 long and TAL1 short protein isoforms in normal haematopoietic development and disease.

      The study suggests that TAL1 transcript isoforms are fine-tuned regulated. By using CRISPR/Cas9 techniques, the authors show that the enhancer -8 (MuTE) and enhancer -60 differentially regulate the TAL1 isoforms. Whether the remaining enhancers at the TAL1 locus (see Zhou Y et al, Blood 2013) also differentially regulate TAL1 transcription remains to be elucidated.

      The authors found that TAL1 short isoform interacts strongly with T-cell specific transcription factors such as TCF3 and TCF12, as compared to TAL1 long isoform. TAL1 short shows an apoptotic transcription signature and it fails in rescuing cell growth as compared to TAL1 long in T-ALL. In addition, TAL1 short promotes erythropoiesis.

      Lastly, the authors suggest that altering TAL1 long and TAL1 short protein isoforms ratio could have a potential therapeutic application in disease, but further studies are needed.

      I have a number of comments:

      Figure 1

      It was not mentioned that MOLT4 cells also have MuTE. Do Jurkat and MOLT4 share a similar profile in terms of TAL1 transcript isoforms? It would have been very interesting to see whether the TAL1 transcript isoforms are similar in SIL-TAL1+ cells (e.g RPMI-8402). In these cells, TAL1 activation results from a deletion that fuses the 5' non-coding region of SIL with TAL1.

      Figure 2

      It is not very clear how the expression of the short isoform delta exon 3 is quantified. Detailed information and a schematic of the primer location could be helpful.

      The results on Figure 2 derive from complex Cas9/CRISPR experiments. A schematic representation showing the location of the following elements is missing: CTCF sites, CTCF gRNA target region, dCas9-p300 gRNA target region and -60 enhancer. Are the levels of dCas9-p300 WT and dCas9-p300 MUT comparable in transfected HEK 293 cells? Were those possibly measured by qPCR or Western Blot? Why the authors chose to use 293T cells for the CTCF del as the enhancer usage around the locus must be so different from haematopoietic cells.

      Is CPT - camptothecin? A control gene that is sensitive to CPT treatment would ensure the inhibitor is working.

      In supplementary Figure 2D, the reduction in expression in Jurkat Del-12 is restricted to TSS2. There is no reduction in TAL1 TSS1 and TAL1 TSS4 (this is not clear from the result description section). As seen, these isoforms are upregulated and that could suggest a compensatory mechanism mediated by alternative promoter activation. The fact that Jurkat Del-12 express TAL1 from MSCV-TAL1 could also suggest that TSS1 and TSS4 are upregulated by TAL1 or indirectly, by other members of the TAL/LMO complex (see Sanda T et al, Cancer Cell 2012)

      Figure 3

      A. Are the levels of TAL1 short cDNA and TAL1 long cDNA comparable in the co-transfection luciferase experiments? The overexpression of the isoforms does not reflect the endogenous expression levels in cell lines where one of the isoforms is more predominantly expressed (e.g Jurkat cells express low levels of TAL1 short).

      Figure 4

      Are the levels of flag-TAL1 long and flag-TAL1 short comparable? The levels of expression could explain the low intensity signal for TAL1 long. Is there any reason for not performing a depletion of endogenous TAL1 prior to the ChIP seq flag experiment? Could the authors speculate about MAF motif enrichment in both isoforms and not in TAL1-total? Do TAL1 long and TAL1 short recognise the same DNA motif?

      Figure 6

      In A and B, are the levels of flag-TAL1 long and flag-TAL1 short in transduced K562 comparable? In C and D, are the TAL1 levels reduced at the protein level?

      Minor points:

      Figure 1

      A. Include a scale bar C. Loading control such as GAPDH is missing in the Western Blot. Are CUTLL cells the same as CUTTL-1? D. Adjust scale of the CHIP seq tracks in K562 cells in order to see the peak summit. Include genome build In supplementary Figure 1B, the symbol scheme is not clear

      Figure 2

      A & C. Remove 'amount' from the Y axis. Is the total mRNA amount calculated as % of the reference genes? It could be specified on the y axis or figure legend.

      In supplementary Figure 2C, a loading control is missing.

      Figures 4, 5 and 6

      Size of the figures should be increased.

      Significance

      The study from Sharma and colleagues is novel and it extends the knowledge on TAL1 regulation and the role of TAL1 in development and disease. Although the study suggests that there is a correlation between enhancers, chromatin mark deposition at exons and regulation of alternative splicing, the mechanistic link is not fully elucidated. The findings on TAL1 short protein are interesting but the data on TAL1 long lacks some refinement so then robust conclusions can be drawn.

      The experimental data lacks a few controls. The text is clear and prior studies could be better referenced.

      As TAL1 is a very crucial transcription factor oncogene in T-ALL, the study is important as it addresses a very relevant question in the field that is the regulation of the transcription of TAL1 and the functional relevance of both TAL1 short and TAL1 long isoforms.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would like to thank the reviewers for their extensive review of our manuscript and constructive criticism. We have attempted to address the points raised in the reviewer's comments and have performed additional experiments and have edited the text of the manuscript to explain these points. Please see below, our point-by-point response to the reviewer’s comments. In the submitted revised manuscript, some figure numbers have changed from the prior reviewed version.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this MS, Mrj - a member of the JDP family of Hsp70 co-chaperones was identified as a regulator of the conversion of Orb2A (the Dm ortholog of CPEB) to its prion-like form.

      In drosophila, Mrj deletion does not cause any gross neurodevelopmental defect nor leads to detectable alterations in protein homeostasis. Loss of Mrj, however, does lead to altered Orb2 oligomerization. Consistent with a role of prion-like characteristics of Orb2 in memory consolidation, loss of Mrj results in a deficit in long-term memory.

      Aside from the fact that there are some unclarities related to the physicochemical properties of Orb2 and how Mrj affects this precisely, the finding that a chaperone could be important for memory is an interesting observation, albeit not entirely novel.

      In addition, there are several minor technical concerns and questions I have that I feel the authors should address, including a major one related to the actual approach used to demonstrate memory deficits upon loss of Mrj.

      Reviewer #1 (Significance (Required)):

      Figure 1 (plus related Supplemental figures): • There seem to be two isoforms of Mrj (like what has been found for human DNAJB6). I find it striking to see that only (preferentially?) the shorter isoform interacts with Orb2. For DNAJB6, the long isoform is mainly related to an NLS and the presumed substrate binding is identical for both isoforms. If this is true for Dm-Mrj too, the authors could actually use this to demonstrate the specificity of their IPs where Orb2 is exclusively non-nuclear?

      According to Flybase, Mrj has 8 predicted isoforms of which four are of 259 amino acids (PA, PB, PC, and PD), 3 are of 346 amino acids (PE, PG, and PH) and one is of 208 amino acids (PF) length (Supplementary data 1). We isolated RNA from flyheads and used this in RT-PCR experiments to check which Mrj isoforms express in the brain. Since both the 346 amino acid (1038 nucleotide long) and 259 amino acids (777 nucleotides long) form, which we refer to as the long and middle isoform, has the same N and C terminal sequences we used the same primer pair for this, but on RT-PCR the only amplicon we got corresponds to the 259 amino acid form. For the 208 amino acids (624 nucleotides long) form we designed a separate forward primer and attempted to amplify this using RT-PCR but were unable to detect this isoform also. This data is now presented in Supplemental Figure 4B. Since the only isoform detected from fly head cDNA corresponded to the 259 amino acid form, we think this is the predominant isoform of Mrj expressing in Drosophila and this is what is in our DnaJ library and what we have used in all our experiments here. This is also the same isoform described in previous papers on Drosophila Mrj (Fayazi et al, 2006; Li et al, 2016b). For this 259 amino acid Mrj isoform, we see its expression in both the nucleus and cytoplasm (Supplemental Figure 4C). As the long 346 AA fragment was undetectable in the brain, it was not feasible to address the reviewer’s point of using the long and short forms of Mrj for IP with Orb2. However, we have performed IP of human CPEB2 (hCPEB2) with the long and short isoforms of human DnaJB6 and have detected interaction of hCPEB2 with both the long and short isoforms of DnaJB6 (Supplemental Figure 6E).

      • I would be interested to know a bit more about the other 5 JDPs that are interactors with Orb2: are the human orthologs of those known? It is striking that these other 5 JDPs interact with Orb2 in Dm (in IPs) but have no impact on Sup35 prion behavior. Importantly, this does not imply they may not have impact on the prion-like behavior of other Dm substrates, including Dm-Orb2.

      We have performed BlastP analysis of CG4164, CG9828, CG7130, DroJ2, and Tpr2 protein sequences against Human proteins. Based on this we have listed the highest-ranking candidate identified here for each of these genes.

      Drosophila Gene

      Human gene

      Query cover

      Percent identity

      E value

      CG4164

      dnaJ homolog subfamily B member 11 isoform 1

      98 %

      62.96%

      2e-150

      CG9828

      dnaJ homolog subfamily A member 2

      92%

      39.41%

      3e-84

      CG7130

      dnaJ homolog subfamily B member 4 isoform d

      56%

      69.44%

      2e-30

      Tpr2

      dnaJ homolog subfamily C member 7 isoform 1

      93%

      46.22%

      6e-139

      DroJ2

      dnaJ homolog subfamily A member 4 isoform 2

      98%

      60.60%

      2e-169

      In the context of the chimeric Sup35-based assay where Orb2A’s Prion-like domain (PrD) is coupled with the C-terminal domain of Sup35, the only protein which could convert Orb2A PrD-Sup35 C from its non-prion state to prion state was Mrj. Within the limitations of this heterologous-system based assay, the other 5 DnaJ domain proteins as well as the Hsp70’s were unable to convert the Orb2A PrD from its non-prion to prion-like state. What these other 5 interacting JDP proteins are doing through their interaction with Orb2A and if they are even expressing in the Orb2 relevant neurons will need to be tested separately and will be the subject of our future studies.

      • The data in panels H, I indeed suggest that Mrj1 alters the (size of) the oligomers. It would be important to know what is the actual physicochemical change that is occurring here. The observed species are insoluble in 0.1 % TX100 but soluble in 0.1% SDS, which suggest they could be gels, but not real amyloids such as formed by the polyQ proteins that require much higher SDS concentrations (~2%) to be solubilized. This is relevant as Mrj1 reduces polyQ amyloidogenesis whereas is here is shown to enhance Orb2A oligomerization/gelidification. In the same context, it is striking to see that without Mrj the amount of Orb2A seems drastically reduced and I wonder whether this might be due to the fact that in the absence of Mrj a part of Orb2A is not recovered/solubilized due to its conversion for a gel to a solid/amyloid state? In other words: Mrj1 may not promote the prion state, but prevents that state to become an irreversible, non-functional amyloid?

      On the reviewer’s point to address what is the actual physicochemical change occurring here, we will need to develop methods to purify the Orb2 oligomers in significant quantities to examine and distinguish if they are of gel or real amyloid-like nature. Currently, within the limitations of our ongoing work, this has not been possible for us to do and we can attempt to address this in our future work. Cryo-EM derived structure of endogenous Orb2 oligomers purified from a fly head extract from 3 million fly heads, made in the TritonX-100 and NP-40 containing buffer, the same buffer as what we have used here for the first soluble fraction, showed these oligomers as amyloids (Hervas et al, 2020). If the oligomers extracted using 0.1% and 2% SDS are structurally and physicochemically different, within the limitations of our current work, had not been possible to address.

      The other point raised by the reviewer is, if in the absence of Mrj (in the context of Figure 4 of our previously submitted manuscript), a part of Orb2 is not solubilized due to us using a lower 0.1% SDS for extraction. To address this, we attempted to see how much of leftover Orb2 is remaining in the pellet after extraction with 0.1 % SDS. Towards this, according to the reviewers’ suggestion, we used a higher 2% SDS containing buffer to resuspend the leftover pellet after 0.1% SDS extraction, and post solubilisation ran all the fractions in SDD-AGE. We did this experiment with both wild-type and Mrj knockout fly heads. Under these different extractions, we first observed while there is more Orb2 in the soluble fraction (Triton X-100 extracted) of Mrj knockout, this amount is reduced in both the 0.1% SDS solubilized and 2% SDS solubilized fractions. So, even though there is leftover Orb2 after 0.1% SDS extraction, which can be extracted using 2% SDS, this amount is reduced in Mrj knockout. The other observation here is the Orb2 extracted using 2% SDS shows a longer smear in comparison to the 0.1% SDS extracted form suggesting a possibility of more and higher-sized oligomers present in this fraction. Since we do not have the exact physicochemical characterization of these oligomers detected with 0.1% and 2% SDS-containing buffer, we are not differentiating them by using the terms gels and real amyloids, but refer to them as 0.1% SDS soluble Orb2 oligomers and 2% SDS soluble Orb2 oligomers. Overall, our observations here suggest in absence of Mrj, both of these kinds of Orb2 oligomers are decreased and so Mrj is most likely promoting the formation of Orb2 oligomers. It is possible that the 0.1% SDS soluble Orb2 oligomers gradually accumulate and undergo a further transition to the 2% SDS soluble Orb2 oligomers, so if in absence of Mrj, the formation of the 0.1% SDS soluble Orb2 oligomers is decreased, the next step of formation of 2% SDS soluble Orb2 oligomers also be decreased. This data is now presented in Figure 5H, I and J).

      On the other possibility raised by the reviewer that Mrj can prevent the oligomeric state of Orb2 to become an irreversible non-functional amyloid, we think it is still possible for Mrj to do this but this could not be tested under the present conditions.

      • It may be good for clarity to refer to the human Mrj as DNAJB6 according to the HUGO nomenclature. Also, the first evidence for its oligomerization was by Hageman et al 2010.

      We have now changed mentions of human Mrj to DNAJB6. We apologize for missing the Hageman et al 2010 reference and have now cited this reference in the context of Mrj oligomerization.

      • It is striking to see that Mrj co-Ips with Hsp70AA, Hsp70-4 but not Hsp70Cb. The fact that interactions were detected without using crosslinking is also striking given the reported transient nature of J-domain-Hsp70 interactions Together, this may even suggest that Mrj-1 is recognized as a Hsp70 substrate (for Hsp70AA, Hsp70-4 but not Hsp70Cb) rather than as a co-chaperone. In fact, a variant of Mrj-1 with a mutation in the HPD motif should be used to exclude this option.

      In IP experiments we notice Mrj interacts with Hsp70Aa and Hsc70-4 but not with Hsc70-1 and Hsc70Cb. In our previously submitted manuscript, we realized we made a typo on the figure, where we referred to Hsp70Aa as Hsc70Aa. We have corrected this in the current revised manuscript. On the crosslinking point raised by the reviewer, we reviewed the published literature for studies of immunoprecipitation experiments which showed an interaction between DnaJB6 and Hsp70. We noted while one of the papers (Kakkar et al, 2016) report the use of a crosslinker in the experiment which showed an interaction between GFP-Hsp70 and V5-DnaJB6, in another two papers the interaction between endogenous Mrj and endogenous Hsp/c70 (Izawa et al, 2000) and Flag-Hsp70 and GFP-DnaJB6 (Bengoechea et al, 2020) could be detected without using any crosslinker. Our observations of detecting the interaction of Mrj with Hsp70Aa and Hsc70-4 in the absence of a crosslinker are thus similar to the observations reported by (Izawa et al, 2000; Bengoechea et al, 2020).

      On the point of if Mrj is a substrate for Hsp70aa and Hsc70-4 and not a co-chaperone, we feel in the context of this manuscript, since we are focussing on the role of Mrj in the regulation of oligomerization of Orb2 and in memory, the experiment with HPD motif mutant is probably not necessary here. However, if the reviewers suggest this experiment to be essential, we can attempt this experiment by making this HPD motif mutant.

      • The rest of these data reconfirm nicely that Mrj/DNAJB6 can suppress polyQ-Htt aggregation. Yet note that in this case the oligomers that enter the agarose gel are smaller, not bigger. This argues that Mrj is not an enhancer of oligomerization, but rather an inhibitor of the conversion of oligomers to a more amyloid like state.

      Figure 2 and Supplemental Figure 4 discuss the effect of Mrj on Htt aggregation. We have used 2 different Htt constructs here. For Figure 2I, we used only Exon1 of Htt with the poly Q repeats. Here in SDD-AGE, for the control lane, we see the Htt oligomers as a smear for the control. For Mrj, we see only a small band at the bottom which can be interpreted most likely as either a monomer or as small oligomers since we do not observe any smear here. However, for the 588 amino acid fragment of HttQ138 in the SDD-AGE we do not see a difference in the length of the smear but in the intensity of the smear of the Htt oligomers (Supplemental Figure 4E). Based on this we are suggesting in presence of Mrj, there are lesser Htt oligomers. On the point of Mrj is not an enhancer of oligomerization, but rather an inhibitor of the conversion of oligomers to a more amyloid-like state, our experiments with the Mrj knockout show reduced Orb2 oligomers (both for 0.1% and 2% SDS soluble forms), suggesting Mrj plays a role in the conversion of Orb2 to the oligomeric state. If Mrj inhibits the conversion of oligomers to a more amyloid-like state, this is possible but we couldn’t test this hypothesis here. However, for Htt amyloid aggregates, previous works done by other labs with DnaJB6 as well as our experiments with Mrj suggest this as a likely possibility.

      Figure 3: • The finding that knockout of DNAJB6 in mice is embryonic lethal is related to a problem with placental development and not embryonic development (Hunter et al, 1999; Watson et al, 2007, 2009, 2011) as well recognized by the authors. Therefore, the finding that deletion of Dm-Mrj has no developmental phenotype in Drosophila may not be that surprising.

      We agree with the reviewer’s point that DNAJB6 mutant mice have a problem with placental development. However, one of the papers cited here (Watson et al, 2009) suggests DNAJB6 also plays a crucial role in the development of the embryo independent of the placenta development defect. The mammalian DNAJB6 mutant embryos generated using the tetraploid complementation method show severe neural defects including exencephaly, defect in neural tube closure, reduced neural tube size, and thinner neuroepithelium. Due to these features seen in the mice knockout, and the lack of such developmental defects in the Drosophila knockout, we interpreted our findings in Drosophila as significantly different from the mammals.

      • It is a bit more surprising that Mrj knockout flies showed no aggregation phenotype or muscle phenotype, especially knowing that DNAJB6 mutations are linked to human diseases associated with aggregation (again well recognized by the authors). However, most of these diseases are late-onset and the phenotype may require stress to be revealed. So, while important to this MS in terms of not being a confounder for the memory test, I would like to ask the authors to add a note of caution that their data do not exclude that loss of Mrj activity still may cause a protein aggregation-related disease phenotype. Yet, I also do think that for the main message of this MS, it is not required to further test this experimentally.

      We agree with the reviewer and have added this suggestion in the discussion that loss of Mrj may still result in a protein aggregation-related disease phenotype, probably under a sensitized condition of certain stresses which is not tested in this manuscript.

      Figure 4:

      • IPs were done with Orb2A as bite and clearly pulled down substantial amounts of GFP-tagged Mrj. For interactions with Orb2B, a V5-tagged Mrj was use and only a minor fraction was pulled down. Why were two different Mrj constructs used for Arb2A and Orb2b?

      In the previously submitted manuscript, we have used HA-tagged Mrj (not V5) for checking the interaction with full-length Orb2B tagged with GFP. This was done with the goal of using the same Mrj-HA construct as that used in the initial Orb2A immunoprecipitation experiment. Since this has raised some concern as in the IPs to check for interaction between truncated Orb2A constructs (Orb2A325-GFP and Orb2AD162-GFP) and Mrj (Mrj-RFP), we used a different GFP and RFP tag combination. To address this, we have now added the same tag combinations for the IPs (Mrj-RFP with Orb2A-GFP and Orb2B-GFP). In these immunoprecipitation experiments where Mrj-RFP was pulled down using RFP Trap beads, we were able to detect positive interaction with GFP-tagged Orb2A and Orb2B. This data is now added in Figure 4F and 4I. We also have added the IP data for interaction between Mrj-HA and untagged Orb2B in Figure 4K, similar to the combination of initial experiment between Mrj-HA and untagged Orb2A.

      • In addition, I think it would be important what one would see when pulling on Mrj1, especially under non-denaturing conditions and what is the status of the Orb2 that is than found to be associated with Mrj (monomeric, oligomeric and what size).

      We have now performed IP from wild-type fly heads using anti Mrj antibody and ran the immunoprecipitate in SDS-PAGE and SDD-AGE followed by immunoblotting them with anti-Orb2 antibody. Our experiments suggest that immunoprecipitating endogenous Mrj brings down both the monomeric and oligomeric forms of Orb2. This data is now added in Figure 4L, M and N.

      • This also relates to my remark at figure 1 and the subsequent fractionation experiments they show here in which there is a slight (not very convincing) increase in the ratio of TX100-soluble and insoluble (0.1% SDS soluble) material. My question would be if there is a remaining fraction of 0.1% insoluble (2% soluble) Orb2 and how Mrj affects that? As stated before, this is (only) mechanistically relevant to understanding why there is less oligomers of Orb2 in terms of Mrj either promoting it or by preventing it to transfer from a gel to a solid state. The link to the memory data remains intriguing, irrespective of what is going on (but also on those data I do have several comments: see below).

      We have addressed this in response to the reviewer’s comments on Figure 1. We find in both wild type and Mrj knockout fly heads, there are Orb2 oligomers that can be detected using 0.1% SDS extraction and with further extraction with 2% SDS. The 2% SDS soluble Orb2 oligomers were previously insoluble during 0.1% SDS-based extraction. However, the amounts of both of these oligomers are reduced in Mrj knockout fly heads. Since we do not have the physicochemical characterization of both of these kinds of oligomers, we are not using the terms gel or solid state here but referring to these oligomers as 0.1% SDS soluble Orb2 oligomers and 2% SDS soluble Orb2 oligomers. We speculate that the 0.1% SDS soluble Orb2 oligomers over time transition to the 2% SDS soluble Orb2 oligomers. As in the absence of Mrj in the knockout flies, both the 0.1% SDS soluble and 2% SDS soluble Orb2 oligomers are decreased, this suggests Mrj is promoting the formation of Orb2 oligomers. On the reviewer’s point, if Mrj can prevent the transition from 0.1% SDS soluble to 2% SDS soluble Orb2 oligomers, we think it is possible for Mrj to both promote oligomerization of Orb2 as well as prevent it from forming bigger non-functional oligomers, but the second point is not tested here. The relevant data is now presented in Figure 5H, I and J.

      • I also find the sentence that "Mrj is probably regulating the oligomerization of endogenous Orb2 in the brain" somewhat an overstatement. I would rather prefer to say that the data show that Mrj1 affects the oligomeric behavior/status of Orb2.

      Based on the reviewer’s suggestion we have now changed the sentence to Mrj is probably regulating the oligomeric status of Orb2

      Figure 5:

      • To my knowledge, the Elav driver regulates expression in all neurons, but not in glial cells that comprise a significant part of the fly heads/brain. The complete absence of Mrj in the fly-heads when using this driver is therefore somewhat surprising. Or do we need to conclude from this that glial cells normally already lack Mrj expression?

      On driving Mrj RNAi with Elav Gal4, we did not detect any Mrj in the western. We attempted to address the glial contribution towards Mrj’s expression we used a Glia-specific driver Repo Gal4 line to drive the control and Mrj RNAi line and performed a western blot using fly head lysate with anti-Mrj antibody. In this experiment, we did not observe any difference in Mrj levels between the two sets. As the Mrj antibody raised by us works in western blots but not in immunostainings, we could not do a colocalization analysis with a glial marker. However, we used the Mrj knockout Gal4 line to drive NLS-GFP and performed immunostainings of these flies with a glial marker anti-Repo antibody. Here we see two kinds of cells in the brain, one which have GFP but no Repo and the other where both are present together. This suggest that while Glial cells have Mrj but probably majority of Mrj in the brain comes from the neurons. We also found a reference where it was shown that Elav protein as well as Elav Gal4 at earlier stages of development expresses in neuroblasts and in all Glia (Berger et al, 2007). So, another possibility is when we are driving Mrj RNAi using Elav Gal4, this knocks down Mrj in both the neurons as well as in the glia. This coupled with the catalytic nature of RNAi probably creates an effective knockdown of Mrj as seen in the western blot. This data is now added in Supplementary Figure 5G and H.

      • Why not use these lines also for the memory test for confirmation? I understand the concerns of putative confounding effects of a full knockdown (which were however not reported), but now data rely only on the mushroom body-specific knockdown for the 201Y Gal4 line, for which the knockdown efficiency is not provided. But even more so, here a temperature shift (22oC-30oC) was required to activate the expression of the siRNA. For the effects of this shift alone no controls were provided. The functional memory data are nice and consistent with the hypothesis, but can it be excluded that the temperature shift (rather than the Mrj) knockdown has caused the memory defects? I think it is crucial to include the proper controls or use a different knockdown approach that does not require temperature shifts or even use the knockout flies.

      We have now performed the memory experiments with Mrj knockout flies. Our experiments show at 16 and 24-hour time points Mrj knockout flies have significantly reduced memory in comparison to the control wildtype. This data is now added in Figure 6B.

      Figure 6:

      The finding of a co-IP between Rpl18 and Mrj (one-directional only) by no means suffices to conclude that Mrj may interact with nascent Orb2 chains here (which would be the relevant finding here). The fact that Mrj is a self-oligomerising protein (also in vitro, so irrespective of ribosomal associations!), and hence is found in all fractions in a sucrose gradient, also is not a very strong case for its specific interaction with polysomes. The finding that there is just more self-oligomerizing Orb2A co-sedimenting with polysomes in sucrose gradients neither is evidence for a direct effect of Mrj enhancing association of Orb2A with the translating ribosomes even though it would fit the hypothesis. So all in all, I think the data in this figure and non-conclusive and the related conclusions should be deleted.

      We have now performed the reverse co-IP between Rpl18-Flag and Mrj-HA using anti-HA antibody and could detect an interaction between the two. This data is now added in Supplementary Figure 6A.

      To address if Mrj is a self-oligomerizing protein that can migrate to heavier polysome fractions due to its size, we have loaded recombinant Mrj on an identical sucrose gradient as we use for polysome analysis. Post ultra-centrifugation we fractionated the gradients and checked if Mrj can be detected in the fraction numbers where polysomes are present. In this experiment, we could not detect recombinant Mrj in the heavier polysome fractions (data presented in Supplementary Figure 6B). Overall, our observations of Mrj-Rpl18 IPs, the presence of cellularly expressed Mrj in polysome fractions, and the absence of recombinant Mrj from these fractions, suggest a likelihood of Mrj’s association with the translating ribosomes.

      On the reviewer’s point of us concluding Mrj may interact with nascent Orb2 chains, we have not mentioned this possibility in the manuscript as we don’t have any evidence to suggest this. We have also added a sentence: This indicates that in presence of Mrj, the association of Orb2A with the translating ribosomes is enhanced, however, if this is a consequence of increased Orb2A oligomers due to Mrj or caused by interaction between polysome-associated Orb2A and Mrj will need to be tested in future.

      Based on these above-mentioned points, we hope we can keep the data and conclusions of this section.

      Overall, provided that proper controls/additional data can be provided for the key experiments of memory consolidation, I find this an intriguing study that would point towards a role of a molecular chaperone in controlling memory functions via regulating the oligomeric status of a prion-like protein and that is worthwhile publishing in a good journal.

      However, in terms of mechanistical interpretations, several points have to be reconsidered (see remarks on figure 1,4); this pertains especially to what is discussed on page 13. In addition, I'd like the authors to put their data into the perspective of the findings that in differentiated neurons DNAJB6 levels actually decline, not incline (Thiruvalluvan et al, 2020), which would be counterintuitive if these proteins are playing a role as suggested here in memory consolidation.

      We have addressed the comments on Figures 1 and 4 earlier. We have also added new memory experiment’s data with the Mrj knockout in Figure 6.

      We have attempted to put the observations with Drosophila Mrj in perspective to observations in Thiruvalluvan et al, on human DnaJB6 in the discussions as follows:

      Can our observation in Drosophila also be relevant for higher mammals? We tested this with human DnaJB6 and CPEB2. In mice CPEB2 knockout exhibited impaired hippocampus-dependent memory (Lu et al, 2017), so like Drosophila Orb2, its mammalian homolog CPEB2 is also a regulator of long-term memory. In immunoprecipitation assay we could detect an interaction between human CPEB2 and human DnaJB6, suggesting the feasibility for DnaJB6 to play a similar role to Drosophila Mrj in mammals. However, as the human DnaJB6 level was observed to undergo a reduction in transitioning from ES cells to neurons, (Thiruvalluvan et al, 2020) how this can be reconciled with its possible role in the regulation of memory. We speculate, such a reduction if is happening in the brain will occur in a highly regulatable manner to allow precise control over CPEB2 oligomerization only in specific neurons where it is needed and the reduced levels of DnaJB6 is probably sufficient to aid CPEB oligomerization Alternatively, there may be additional chaperones that may function in a stage-specific manner and be able to compensate for the decline in levels of DNAJB6.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: The manuscript describes the role of the Hsp40 family protein Mrj in the prion-like oligomerization of Orb2. The authors demonstrate that Mrj promotes the oligomerization of Orb2, while a loss in Mrj diminishes the extent of Orb2 oligomerization. They observe that while Mrj is not an essential gene, a loss in Mrj causes deficiencies in the consolidation of long-term memory. Further, they demonstrate that Mrj associates with polysomes and increases the association of Orb2 with polysomes.

      Major comments: None

      Minor comments:

      1. In the section describing the chaperone properties of Mrj in clearing Htt aggregates (Fig 2), the legend describes that "Mrj-HA constructs are more efficient in decreasing Htt aggregation compared to Mrj-RFP". It would be helpful to add Mrj-RFP to the quantification in Fig 2G to know exactly the difference in efficiency. Is there an explanation for why the 2 constructs behave differently?

      We have added the quantitation of Htt aggregates in presence of Mrj-RFP in the revised version (Data presented in Figure 2G). While the efficiency of Mrj-RFP to decrease Htt aggregates is significantly less in comparison to Mrj-HA, it is still significantly better in comparison to the control CG7133-HA construct. It is possible, due to the tagging of Mrj with a larger tag (RFP), this reduces its ability to decrease the Htt aggregates in comparison to the construct where Mrj is tagged with a much smaller HA tag.

      Figs A, B, C, G need to have quantification of the percentage of colocalization with details about the number of cells quantified for each experiment.

      We have now added the intensity profile images and colocalization quantitation (pearson’s coefficient) in the Supplemental Figure 5A and B. This quantitation is done from multiple ROI’s taken from at 4-6 cells.

      In Fig 6 B, C, F, G it would be helpful to label the 40S, 60S and 80S peaks in the A 254 trace.

      We have now labeled the 80S, and polysome peaks in the Figure 7B, C, F and G. We could not separate the 40S and 60S peaks in the A254 trace.

      It's interesting that Mrj has opposing functions with regard to aggregation when comparing huntingtin with Orb2. From the literature presented in the discussion, it appears as though chaperones including Mrj have an anti-aggregation role for prions. It would be helpful to have more discussion around why, in the case of Orb2, this is different. The discussion states that "The only Hsp40 chaperone which was found similar to Mrj in increasing Orb2's oligomerization is the yeast Jjj2 protein" - this point needs elaboration, as well as a reference.

      In the discussions section we have now added the following speculations on this:

      One question here is why Mrj behaves differently with Orb2 in comparison to other amyloids. Orb2 differs from other pathogenic amyloids in its extremely transient existence in the toxic intermediate form (Hervás et al, 2016). For the pathogenic amyloids, since they exist in the toxic intermediate form for longer, Mrj probably gets more time to act and prevent or delay them from forming larger aggregates. For Orb2, Mrj may help to quickly transition it from the toxic intermediate state, thereby helping this state to be transient instead of longer. An alternate possibility is post-transition from the toxic intermediate state, Mrj stabilizes these Orb2 oligomers and prevents them from forming larger aggregates. This can be through Mrj interacting with Orb2 oligomers and blocking its surface thereby preventing more Orb2 from assembling over it. Another difference between the Orb2 oligomeric amyloids and the pathogenic amyloids is in the nature of their amyloid core. For the pathogenic amyloids, this core is hydrophobic devoid of any water molecules, however for Orb2, the core is hydrophilic. This raises another possibility that if the Orb2 oligomers go beyond a certain critical size, Mrj can destabilize these larger Orb2 aggregates by targeting its hydrophilic core.

      On the Jjj2 point raised by the reviewer, we have added the (Li et al, 2016a) reference now and elaborated as:

      The only Hsp40 chaperone which was found similar to Mrj in increasing Orb2’s oligomerization is the yeast Jjj2 protein. In Jjj2 knockout yeast strain, Orb2A mainly exists in the non-prion state, whereas on Jjj2 overexpression the non-prion state could be converted to a prion-like state. In S2 cells coexpression of Jjj2 with Orb2A lead to an increase in Orb2 oligomerization (Li et al, 2016a). However, Jjj2 differs from Mrj, as when it is expressed in S2 cells, we do not detect it to be present in the polysome fractions.

      The Jjj2 polysome data is now presented in Supplementary Figure 6C.

      Reviewer #2 (Significance (Required)):

      General assessment:

      Overall, the work is clearly described and the manuscript is very well-written. The motivation behind the study and its importance are well-explained. I only have minor comments and suggestions to improve the clarity of the work. The study newly describes the interaction between the chaperone Mrj and the translation regulator Orb2. The experiments that the screen for proteins that interact with Orb2 and promote its oligomerization are very thorough. The experiments that delve into the role of Mrj in protein synthesis are a good start, and need to be explored further, but that is beyond the scope of this study.

      Advance: The study describes a new interaction between the chaperone Mrj and the translation regulator Orb2. The study is helpful in expanding our knowledge of prion regulators as well factors that affect memory acquisition and consolidation.

      Audience: This paper will be of most interest to basic researchers.

      My expertise is in Drosophila genetics and neuronal injury.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The manuscript submitted by Desai et al. identifies a chaperone of the Hsp40 family (Mrj) that binds Orb2 and modulates its oligomerization, which is critical for Orb2 function in learning and memory in Drosophila. Orb2 are proteins with prion-like properties whose oligomerization is critical for their function in the storage of memories. The main contribution of the article is the screen of Hsp40 and Hsp70-family proteins that bind Orb2. The authors show IP results for all the candidates tested, including those that bind Fig. 1) and those that don't (Supp Fig 3). There is also a figure devoted to examining the interaction of Mrj with polyglutamine models (Htt). They also generate a KO mutant that is viable and shows no gross defects or protein aggregation. Lastly, they show that the silencing of Mrj in the mushroom body gamma neurons results in weaker memories in a courtship paradigm. Although the data is consistent and generally supportive of the hypothesis, key details are missing in several areas, including controls. Additionally, the interpretation of some results leaves room for debate. Overall, this is an ambitious article that needs additional work before publication.

      Specific comments:

      1. General concern over the interpretation of IP experiments and colocalization. These experiments don't necessarily reflect direct interactions. They are consistent with direct interaction but not the only explanation for a positive IP or colocalization.

      This paper is centred on the interaction between Orb2A and Mrj, which we have detected using immunoprecipitation. The reviewer’s concern here is, this experiment is not able to distinguish if this can be a direct protein-protein interaction or if the two proteins are part of a complex.

      To address this concern we have used purified recombinant protein-based pulldowns. Our experiments with purified protein pulldowns (GST tagged Mrj from E.coli with Orb2A from E.coli or Orb2A-GFP from Sf9 cells) suggest Orb2A and Mrj can directly interact amongst themselves. This data is now presented in Figure 1J and K.

      The Huntingtin section has a few concerns. The IF doesn't show all controls and the quantification is not well done in terms of what is relevant. A major problem is the interpretation of Fig 2F. The idea is that Mrj prevents the aggregation of Htt, which is the opposite of what is observed with Orb2. The panel actually shows a large Htt aggregate instead of multiple small aggregates. This has been reported before in Drosophila and other systems with different polyQ models. Mrj and other Hsp40 and Hsp70 proteins modify Htt aggregation, but in an unexpected way. This affects the model shown in Fig. 6H. Lastly, Fig 2H and 2I show very different level of total Htt.

      In Figure 2F of the previously submitted manuscript, we have shown representative images of HttQ103-GFP cells coexpressing with a control DnaJ protein CG7133-HA and Mrj-HA. In Figure 2G we quantitated the number of cells showing aggregates within the population of doubly transfected cells. On the reviewer’s point of figure 2F showing large Htt aggregates instead of multiple small aggregates, we do not see a large Htt aggregate in presence of Mrj in this figure, the pattern looks diffused here and very different from the control CG7133 where the aggregates are seen. We have performed the same experiment with a different Htt construct (588 amino acids long fragment) tagged with RFP, and here also we notice in presence of Mrj, the aggregates are decreased and the expression pattern looks diffused (Supplementary Figure 4E, 4F).

      If the comment on large Htt aggregates in presence of Mrj is concerning figure 2E, here we show Mrj-RFP to colocalize with the Htt aggregates. Here, even though Mrj-RFP colocalizes with Htt aggregates, it rescues the Htt aggregation phenotype as in comparison to the control CG7133, the number of cells with Htt aggregates is still significantly less here. We have added this quantitation of rescue by Mrj-RFP in the revised manuscript now. The observation of colocalization of Mrj-RFP with Htt aggregates is similar to previous reports of chaperones rescuing Htt aggregation and yet showing colocalization with the aggregates. Both Hdj-2 and Hsc70 suppress Htt aggregation and yet were observed to colocalize with Htt aggregates in the cell line model as well as in nuclear inclusions in the brain (Jana et al, 2000). In a nematode model of Htt aggregation, DNJ-13 (DnaJB-1), HSP-1 (Hsc70), and HSP-11 (Apg-2) were shown to colocalize with Htt aggregates and yet decrease the Htt aggregation (Scior et al, 2018). Hsp70 was also found to colocalize with Htt aggregates in Hela cells (Kim et al, 2002).

      Regarding Figures 2H and 2I, while figure 2H is of an SDS-PAGE to show no difference in the levels of monomeric HttQ103 (marked with *) in presence of Mrj and the control CG7133, figure 2I is for the same samples ran in an SDD-AGE where reduced amount of Htt oligomers as seen with the absence of a smear in presence of Mrj. The apparent difference in Htt levels between 2H and 2I is due to the detection of Htt aggregates/oligomers in the SDD-AGE which are unable to enter the SDS-PAGE and hence undetected. In Supplementary Figure 4E, similar experiments were done with the longer Htt588 fragment and here we notice in the SDD-AGE reduced intensity of the smear made up of Htt oligomers, again suggesting a reduction in Htt aggregates. Thus our results are not in contradiction to previous studies where Mrj was found to rescue Htt aggregate-associated toxicity.

      Endogenous expression of Mrj using Gal4 line: where else is it expressed in the brain / head and in muscle. Fig 3G shows no muscle abnormalities but no evidence is shown for muscle expression. It is nice that Fig 3E and F show no abnormal aggregates in the Mrj mutant, but this would be maybe more interesting if flies were subjected to some form of stress.

      We have now added images of the brain and muscles to show the expression pattern of Mrj. Using Mrj Gal4 line and UAS- CD8GFP, we noticed enriched expression in the optic lobes, mushroom body, and olfactory lobes. We also noticed GFP expression in the larval muscles and neuromuscular junction synaptic boutons. This data is now presented in Supplementary Figure 5C, D, E and F.

      On the reviewer’s point of subjecting the Mrj KO flies to some form of stress, we have not performed this. We have added in the discussions a note of caution, that loss of Mrj may still result in a protein aggregation-related disease phenotype, probably under a sensitized condition of certain stresses which is not tested in this manuscript.

      Fig. 5B shows no Mrj detectable from head homogenates in flies silencing Mrj in neurons with Elav-Gal4. It would be nice if they could show that ONLY neurons express Mrj in the head. Also noted, Elav-Gal4 is a weak driver, so it is surprising that it can generate such robust loss of Mrj protein

      We have used an X chromosome Elav Gal4 driver to drive the UAS-Mrj RNAi line and here we could not detect Mrj in the western. To address the reviewer’s point on the glial contribution towards expression of Mrj, we used a Glial driver Repo Gal4 to drive Mrj RNAi. In this experiment, we did not detect any difference in Mrj levels between the control and the Mrj RNAi line (presented now in Supplementary Figure 5G). We also used the Mrj knockout Gal4 line to drive NLS-GFP and immunostained these using a glial marker anti-Repo antibody. Here, we were able to detect cells colabelled by GFP as well as Repo, suggesting Mrj is likely to be present in the glial cells (presented now in Supplementary Figure 5H). We also looked in the literature and found a reference where it was shown that Elav protein as well as Elav Gal4 at earlier stages of development expresses in neuroblasts and in all Glia (Berger et al, 2007). So, another possibility is when we are driving Mrj RNAi using Elav Gal4, this knocks down Mrj in both the neurons as well as in the glia.

      Fig 4-Colocalization of Orb2 with Mrj lacks controls. The quantification could describe other phenomena because the colocalization is robust but the numbers shown describe something else.

      We have now added the intensity profile and colocalization quantitation (pearson’s coefficient) in Supplemental Figure 5A and B. This quantitation is done from multiple ROI’s taken from 4-6 cells. Also, to suggest the interaction of Orb2 isoforms with Mrj, we are not depending on colocalization alone and have used immunoprecipitation experiments to support our observations.

      Fly behavior. The results shown for Mrj RNAi alleles is fine but it would be more robust if this was validated with the KO line AND rescued with Mrj overexpression.

      We have now performed memory assays with the Mrj knockout. Our experiments showed Mrj knockouts to show significantly decreased memory in comparison to wild-type flies at 16 and 24-hour time points (presented in Figure 6B). We have not been able to make an Mrj Knockout-UAS Mrj recombinant fly, most likely due to the closeness of the two with respect to their genomic location in second chromosome.

      Minor comments:

      Please, revise minor errors, there are several examples of words together without a space.

      We have identified the words without space and have corrected them now.

      Intro: describe the use of functional prions. Starting the paragraph with this sentence and then explaining what prion diseases are is a little confusing. Also "prion proteins" can be confusing because the term refers to PrP, the protein found in prions.

      We have now altered the introduction and have described functional prions.

      Results, second subtitle in page 5. This sentence is quite confusing using prion-like twice

      We have now changed the heading to “Drosophila Mrj converts Orb2A from non-prion to a prion-like state.”

      Page 6: "conversion from non-prion to prion-like form...". This can be presented differently. Prion-like properties are intrinsic, proteins don't change from non-prion to prion-like. They may be oligomeric or monomeric or highly aggregated but the prion-like property doesn't change

      We agree with the reviewer's point of Prion-like properties are intrinsic, but the protein might or might not exist in the prion-like state or confirmation. When we are using the term conversion from non-prion to prion-like form we mean to suggest a conformational conversion leading to the eventual formation of the oligomeric species. We also noted the terminology of non-prion to prion-like state change is used in several papers (Satpute-Krishnan & Serio, 2005; Sw & Yo, 2012; Uptain et al, 2001).

      Scale bars and text are too small in several figures

      We have now mentioned in the figure legends the size of the scale bars. For several images we have made the scale bars also larger.

      Not sure why Fig 4C is supplemental, seems like an important piece of data.

      We have kept this data in the supplemental data as we performed this experiment with recombinant protein which is tagged with 6X His and we are not sure if this high degree of oligomerization/aggregation of recombinant Mrj and further precipitation over time, happens inside the cells/ brain.

      Intro to Mrj KO in page 7 is too long. Most of it belongs in the discussion

      We have now moved the portions on mammalian DNAJB6 which were earlier in the results section to the discussions section.

      Change red panels in IF to other color to make it easier for colorblind readers.

      We have now changed the red panels to magenta. We apologize for our figures not being colorblind friendly earlier.

      The discussion is a little diffuse by trying to compare Orb2 with mammalian prions and amyloids and yeast prions.

      We looked into the functional prion data and couldn’t find much on chaperone mediated regulation of these. Also, we felt comparing with the amyloids and yeast prions brings out the contrast with respect to the Mrj mediated regulatory differences between the two.

      Reviewer #3 (Significance (Required)):

      This is a paper with a broad scope and approaches. The paper describes the role of Mrj in the oligomerization of Orb2 by protein biochemistry techniques and determine the role of loss of Mrj in the mushroom bodies in fly behavior.

      The audience for this content is basic research and specialized. The role of Mrj in Orb2 aggregation and function sheds new light on the mechanisms regulating the function of this protein involved in a novel mechanism of learning and memory.

      References:

      Bengoechea R, Findlay AR, Bhadra AK, Shao H, Stein KC, Pittman SK, Daw JA, Gestwicki JE, True HL & Weihl CC (2020) Inhibition of DNAJ-HSP70 interaction improves strength in muscular dystrophy. J Clin Invest 130: 4470–4485

      Berger C, Renner S, Lüer K & Technau GM (2007) The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the Drosophila embryonic CNS. Dev Dyn 236: 3562–3568

      Fayazi Z, Ghosh S, Marion S, Bao X, Shero M & Kazemi-Esfarjani P (2006) A Drosophila ortholog of the human MRJ modulates polyglutamine toxicity and aggregation. Neurobiol Dis 24: 226–244

      Heinrich SU & Lindquist S (2011) Protein-only mechanism induces self-perpetuating changes in the activity of neuronal Aplysia cytoplasmic polyadenylation element binding protein (CPEB). Proc Natl Acad Sci U S A 108: 2999–3004

      Hervás R, Li L, Majumdar A, Fernández-Ramírez MDC, Unruh JR, Slaughter BD, Galera-Prat A, Santana E, Suzuki M, Nagai Y, et al (2016) Molecular Basis of Orb2 Amyloidogenesis and Blockade of Memory Consolidation. PLoS Biol 14: e1002361

      Hervas R, Rau MJ, Park Y, Zhang W, Murzin AG, Fitzpatrick JAJ, Scheres SHW & Si K (2020) Cryo-EM structure of a neuronal functional amyloid implicated in memory persistence in Drosophila. Science 367: 1230–1234

      Izawa I, Nishizawa M, Ohtakara K, Ohtsuka K, Inada H & Inagaki M (2000) Identification of Mrj, a DnaJ/Hsp40 family protein, as a keratin 8/18 filament regulatory protein. J Biol Chem 275: 34521–34527

      Jana NR, Tanaka M, Wang G h & Nukina N (2000) Polyglutamine length-dependent interaction of Hsp40 and Hsp70 family chaperones with truncated N-terminal huntingtin: their role in suppression of aggregation and cellular toxicity. Hum Mol Genet 9: 2009–2018

      Kakkar V, Månsson C, de Mattos EP, Bergink S, van der Zwaag M, van Waarde MAWH, Kloosterhuis NJ, Melki R, van Cruchten RTP, Al-Karadaghi S, et al (2016) The S/T-Rich Motif in the DNAJB6 Chaperone Delays Polyglutamine Aggregation and the Onset of Disease in a Mouse Model. Mol Cell 62: 272–283

      Kim S, Nollen EAA, Kitagawa K, Bindokas VP & Morimoto RI (2002) Polyglutamine protein aggregates are dynamic. Nat Cell Biol 4: 826–831

      Li L, Sanchez CP, Slaughter BD, Zhao Y, Khan MR, Unruh JR, Rubinstein B & Si K (2016a) A Putative Biochemical Engram of Long-Term Memory. Curr Biol 26: 3143–3156

      Li S, Zhang P, Freibaum BD, Kim NC, Kolaitis R-M, Molliex A, Kanagaraj AP, Yabe I, Tanino M, Tanaka S, et al (2016b) Genetic interaction of hnRNPA2B1 and DNAJB6 in a Drosophila model of multisystem proteinopathy. Hum Mol Genet 25: 936–950

      Liebman SW & Chernoff YO (2012) Prions in yeast. Genetics 191: 1041–1072

      Lu W-H, Yeh N-H & Huang Y-S (2017) CPEB2 Activates GRASP1 mRNA Translation and Promotes AMPA Receptor Surface Expression, Long-Term Potentiation, and Memory. Cell Rep 21: 1783–1794

      Prusiner SB (2001) Neurodegenerative Diseases and Prions. New England Journal of Medicine 344: 1516–1526

      Satpute-Krishnan P & Serio TR (2005) Prion protein remodelling confers an immediate phenotypic switch. Nature 437: 262–265

      Scior A, Buntru A, Arnsburg K, Ast A, Iburg M, Juenemann K, Pigazzini ML, Mlody B, Puchkov D, Priller J, et al (2018) Complete suppression of Htt fibrilization and disaggregation of Htt fibrils by a trimeric chaperone complex. EMBO J 37: 282–299

      Si K (2015) Prions: what are they good for? Annu Rev Cell Dev Biol 31: 149–169

      Si K, Choi Y-B, White-Grindley E, Majumdar A & Kandel ER (2010) Aplysia CPEB can form prion-like multimers in sensory neurons that contribute to long-term facilitation. Cell 140: 421–435

      Si K, Lindquist S & Kandel ER (2003) A neuronal isoform of the aplysia CPEB has prion-like properties. Cell 115: 879–891

      Sw L & Yo C (2012) Prions in yeast. Genetics 191

      Thiruvalluvan A, de Mattos EP, Brunsting JF, Bakels R, Serlidaki D, Barazzuol L, Conforti P, Fatima A, Koyuncu S, Cattaneo E, et al (2020) DNAJB6, a Key Factor in Neuronal Sensitivity to Amyloidogenesis. Mol Cell 78: 346-358.e9

      Uptain SM & Lindquist S (2002) Prions as protein-based genetic elements. Annu Rev Microbiol 56: 703–741

      Uptain SM, Sawicki GJ, Caughey B & Lindquist S (2001) Strains of [PSI(+)] are distinguished by their efficiencies of prion-mediated conformational conversion. EMBO J 20: 6236–6245

      Watson ED, Mattar P, Schuurmans C & Cross JC (2009) Neural stem cell self-renewal requires the Mrj co-chaperone. Dev Dyn 238: 2564–2574

      Wickner RB (2016) Yeast and Fungal Prions. Cold Spring Harb Perspect Biol 8: a023531

      Wickner RB, Edskes HK, Maddelein ML, Taylor KL & Moriyama H (1999) Prions of yeast and fungi. Proteins as genetic material. J Biol Chem 274: 555–558

      Wickner RB, Masison DC, Edskes HK & Maddelein ML (1996) Prions of yeast, [PSI] and [URE3], as models for neurodegenerative diseases. Cold Spring Harb Symp Quant Biol 61: 541–550

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The manuscript submitted by Desai et al. identifies a chaperone of the Hsp40 family (Mrj) that binds Orb2 and modulates its oligomerization, which is critical for Orb2 function in learning and memory in Drosophila. Orb2 are proteins with prion-like properties whose oligomerization is critical for their function in the storage of memories. The main contribution of the article is the screen of Hsp40 and Hsp70-family proteins that bind Orb2. The authors show IP results for all the candidates tested, including those that bind Fig. 1) and those that don't (Supp Fig 3). There is also a figure devoted to examining the interaction of Mrj with polyglutamine models (Htt). They also generate a KO mutant that is viable and shows no gross defects or protein aggregation. Lastly, they show that the silencing of Mrj in the mushroom body gamma neurons results in weaker memories in a courtship paradigm. Although the data is consistent and generally supportive of the hypothesis, key details are missing in several areas, including controls. Additionally, the interpretation of some results leaves room for debate. Overall, this is an ambitious article that needs additional work before publication.

      Specific comments:

      1. General concern over the interpretation of IP experiments and colocalization. These experiments don't necessarily reflect direct interactions. They are consistent with direct interaction but not the only explanation for a positive IP or colocalization.
      2. The Huntingtin section has a few concerns. The IF doesn't show all controls and the quantification is not well done in terms of what is relevant. A major problem is the interpretation of Fig 2F. The idea is that Mrj prevents the aggregation of Htt, which is the opposite of what is observed with Orb2. The panel actually shows a large Htt aggregate instead of multiple small aggregates. This has been reported before in Drosophila and other systems with different polyQ models. Mrj and other Hsp40 and Hsp70 proteins modify Htt aggregation, but in an unexpected way. This affects the model shown in Fig. 6H. Lastly, Fig 2H and 2I show very different level of total Htt.
      3. Endogenous expression of Mrj using Gal4 line: where else is it expressed in the brain / head and in muscle. Fig 3G shows no muscle abnormalities but no evidence is shown for muscle expression. It is nice that Fig 3E and F show no abnormal aggregates in the Mrj mutant, but this would be maybe more interesting if flies were subjected to some form of stress.
      4. Fig. 5B shows no Mrj detectable from head homogenates in flies silencing Mrj in neurons with Elav-Gal4. It would be nice if they could show that ONLY neurons express Mrj in the head. Also noted, Elav-Gal4 is a weak driver, so it is surprising that it can generate such robust loss of Mrj protein
      5. Fig 4-Colocalization of Orb2 with Mrj lacks controls. The quantification could describe other phenomena because the colocalization is robust but the numbers shown describe something else.
      6. Fly behavior. The results shown for Mrj RNAi alleles is fine but it would be more robust if this was validated with the KO line AND rescued with Mrj overexpression.

      Minor comments:

      Please, revise minor errors, there are several examples of words together without a space.

      Intro: describe the use of functional prions. Starting the paragraph with this sentence and then explaining what prion diseases are is a little confusing. Also "prion proteins" can be confusing because the term refers to PrP, the protein found in prions.

      Results, second subtitle in page 5. This sentence is quite confusing using prion-like twice

      Page 6: "conversion from non-prion to prion-like form...". This can be presented differently. Prion-like properties are intrinsic, proteins don't change from non-prion to prion-like. They may be oligomeric or monomeric or highly aggregated but the prion-like property doesn't change

      Scale bars and text are too small in several figures

      Not sure why Fig 4C is supplemental, seems like an important piece of data.

      Intro to Mrj KO in page 7 is too long. Most of it belongs in the discussion

      Change red panels in IF to other color to make it easier for colorblind readers.

      The discussion is a little diffuse by trying to compare Orb2 with mammalian prions and amyloids and yeast prions.

      Significance

      This is a paper with a broad scope and approaches. The paper describes the role of Mrj in the oligomerization of Orb2 by protein biochemistry techniques and determine the role of loss of Mrj in the mushroom bodies in fly behavior.

      The audience for this content is basic research and specialized. The role of Mrj in Orb2 aggregation and function sheds new light on the mechanisms regulating the function of this protein involved in a novel mechanism of learning and memory.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      The manuscript describes the role of the Hsp40 family protein Mrj in the prion-like oligomerization of Orb2. The authors demonstrate that Mrj promotes the oligomerization of Orb2, while a loss in Mrj diminishes the extent of Orb2 oligomerization. They observe that while Mrj is not an essential gene, a loss in Mrj causes deficiencies in the consolidation of long-term memory. Further, they demonstrate that Mrj associates with polysomes and increases the association of Orb2 with polysomes.

      Major comments: None

      Minor comments:

      1. In the section describing the chaperone properties of Mrj in clearing Htt aggregates (Fig 2), the legend describes that "Mrj-HA constructs are more efficient in decreasing Htt aggregation compared to Mrj-RFP". It would be helpful to add Mrj-RFP to the quantification in Fig 2G to know exactly the difference in efficiency. Is there an explanation for why the 2 constructs behave differently?
      2. Figs A, B, C, G need to have quantification of the percentage of colocalization with details about the number of cells quantified for each experiment.
      3. In Fig 6 B, C, F, G it would be helpful to label the 40S, 60S and 80S peaks in the A 254 trace.
      4. It's interesting that Mrj has opposing functions with regard to aggregation when comparing huntingtin with Orb2. From the literature presented in the discussion, it appears as though chaperones including Mrj have an anti-aggregation role for prions. It would be helpful to have more discussion around why, in the case of Orb2, this is different. The discussion states that "The only Hsp40 chaperone which was found similar to Mrj in increasing Orb2's oligomerization is the yeast Jjj2 protein" - this point needs elaboration, as well as a reference.

      Significance

      General assessment:

      Overall, the work is clearly described and the manuscript is very well-written. The motivation behind the study and its importance are well-explained. I only have minor comments and suggestions to improve the clarity of the work. The study newly describes the interaction between the chaperone Mrj and the translation regulator Orb2. The experiments that the screen for proteins that interact with Orb2 and promote its oligomerization are very thorough. The experiments that delve into the role of Mrj in protein synthesis are a good start, and need to be explored further, but that is beyond the scope of this study.

      Advance:

      The study describes a new interaction between the chaperone Mrj and the translation regulator Orb2. The study is helpful in expanding our knowledge of prion regulators as well factors that affect memory acquisition and consolidation.

      Audience:

      This paper will be of most interest to basic researchers. My expertise is in Drosophila genetics and neuronal injury.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this MS, Mrj - a member of the JDP family of Hsp70 co-chaperones was identified as a regulator of the conversion of Orb2A (the Dm ortholog of CPEB) to its prion-like form.

      In drosophila, Mrj deletion does not cause any gross neurodevelopmental defect nor leads to detectable alterations in protein homeostasis. Loss of Mrj, however, does lead to altered Orb2 oligomerization. Consistent with a role of prion-like characteristics of Orb2 in memory consolidation, loss of Mrj results in a deficit in long-term memory.

      Aside from the fact that there are some unclarities related to the physicochemical properties of Orb2 and how Mrj affects this precisely, the finding that a chaperone could be important for memory is an interesting observation, albeit not entirely novel.

      In addition, there are several minor technical concerns and questions I have that I feel the authors should address, including a major one related to the actual approach used to demonstrate memory deficits upon loss of Mrj.

      Significance

      Figure 1 (plus related Supplemental figures):

      • There seem to be two isoforms of Mrj (like what has been found for human DNAJB6). I find it striking to see that only (preferentially?) the shorter isoform interacts with Orb2. For DNAJB6, the long isoform is mainly related to an NLS and the presumed substrate binding is identical for both isoforms. If this is true for Dm-Mrj too, the authors could actually use this to demonstrate the specificity of their IPs where Orb2 is exclusively non-nuclear?
      • I would be interested to know a bit more about the other 5 JDPs that are interactors with Orb2: are the human orthologs of those known? It is striking that these other 5 JDPs interact with Orb2 in Dm (in IPs) but have no impact on Sup35 prion behavior. Importantly, this does not imply they may not have impact on the prion-like behavior of other Dm substrates, including Dm-Orb2.
      • The data in panels H,I indeed suggest that Mrj1 alters the (size of) the oligomers. It would be important to know what is the actual physicochemical change that is occurring here. The observed species are insoluble in 0.1 % TX100 but soluble in 0.1% SDS, which suggest they could be gels, but not real amyloids such as formed by the polyQ proteins that require much higher SDS concentrations (~2%) to be solubilized. This is relevant as Mrj1 reduces polyQ amyloidogenesis whereas is here is shown to enhance Orb2A oligomerization/gelidification. In the same context, it is striking to see that without Mrj the amount of Orb2A seems drastically reduced and I wonder whether this might be due to the fact that in the absence of Mrj a part of Orb2A is not recovered/solubilized due to its conversion for a gel to a solid/amyloid state? In other words: Mrj1 may not promote the prion state, but prevents that state to become an irreversible, non-functional amyloid?

      Figure 2 (plus related Supplemental figures):

      • It may be good for clarity to refer to the human Mrj as DNAJB6 according to the HUGO nomenclature. Also, the first evidence for its oligomerization was by Hageman et al 2010.
      • It is striking to see that Mrj co-IPs with Hsp70AA, Hsp70-4 but not Hsp70Cb. The fact that interactions were detected without using crosslinking is also striking given the reported transient nature of J-domain-Hsp70 interactions Together, this may even suggest that Mrj-1 is recognized as a Hsp70 substrate (for Hsp70AA, Hsp70-4 but not Hsp70Cb) rather than as a co-chaperone. In fact, a variant of Mrj-1 with a mutation in the HPD motif should be used to exclude this option.
      • The rest of these data reconfirm nicely that Mrj/DNAJB6 can suppress polyQ-Htt aggregation. Yet note that in this case the oligomers that enter the agarose gel are smaller, not bigger. This argues that Mrj is not an enhancer of oligomerization, but rather an inhibitor of the conversion of oligomers to a more amyloid like state.

      Figure 3:

      • The finding that knockout of DNAJB6 in mice is embryonic lethal is related to a problem with placental development and not embryonic development (Hunter et al, 1999; Watson et al, 2007, 2009, 2011) as well recognized by the authors. Therefore, the finding that deletion of Dm-Mrj has no developmental phenotype in Drosophila may not be that surprising.
      • It is a bit more surprising that Mrj knockout flies showed no aggregation phenotype or muscle phenotype, especially knowing that DNAJB6 mutations are linked to human diseases associated with aggregation (again well recognized by the authors). However, most of these diseases are late-onset and the phenotype may require stress to be revealed. So, while important to this MS in terms of not being a confounder for the memory test, I would like to ask the authors to add a note of caution that their data do not exclude that loss of Mrj activity still may cause a protein aggregation-related disease phenotype. Yet, I also do think that for the main message of this MS, it is not required to further test this experimentally.

      Figure 4:

      • IPs were done with Orb2A as bite and clearly pulled down substantial amounts of GFP-tagged Mrj. For interactions with Orb2B, a V5-tagged Mrj was use and only a minor fraction was pulled down. Why were two different Mrj constructs used for Arb2A and Orb2b?
      • In addition, I think it would be important what one would see when pulling on Mrj1, especially under non-denaturing conditions and what is the status of the Orb2 that is than found to be associated with Mrj (monomeric, oligomeric and what size).
      • This also relates to my remark at figure 1 and the subsequent fractionation experiments they show here in which there is a slight (not very convincing) increase in the ratio of TX100-soluble and insoluble (0.1% SDS soluble) material. My question would be if there is a remaining fraction of 0.1% insoluble (2% soluble) Orb2 and how Mrj affects that? As stated before, this is (only) mechanistically relevant to understanding why there is less oligomers of Orb2 in terms of Mrj either promoting it or by preventing it to transfer from a gel to a solid state. The link to the memory data remains intriguing, irrespective of what is going on (but also on those data I do have several comments: see below).
      • I also find the sentence that "Mrj is probably regulating the oligomerization of endogenous Orb2 in the brain" somewhat an overstatement. I would rather prefer to say that the data show that Mrj1 affects the oligomeric behavior/status of Orb2.

      Figure 5:

      • To my knowledge, the Elav driver regulates expression in all neurons, but not in glial cells that comprise a significant part of the fly heads/brain. The complete absence of Mrj in the fly-heads when using this driver is therefore somewhat surprising. Or do we need to conclude from this that glial cells normally already lack Mrj expression?
      • Why not use these lines also for the memory test for confirmation? I understand the concerns of putative confounding effects of a full knockdown (which were however not reported), but now data rely only on the mushroom body-specific knockdown for the 201Y Gal4 line, for which the knockdown efficiency is not provided. But even more so, here a temperature shift (22oC-30oC) was required to activate the expression of the siRNA. For the effects of this shift alone no controls were provided. The functional memory data are nice and consistent with the hypothesis, but can it be excluded that the temperature shift (rather than the Mrj) knockdown has caused the memory defects? I think it is crucial to include the proper controls or use a different knockdown approach that does not require temperature shifts or even use the knockout flies.

      Figure 6:

      The finding of a co-IP between Rpl18 and Mrj (one-directional only) by no means suffices to conclude that Mrj may interact with nascent Orb2 chains here (which would be the relevant finding here). The fact that Mrj is a self-oligomerising protein (also in vitro, so irrespective of ribosomal associations!), and hence is found in all fractions in a sucrose gradient, also is not a very strong case for its specific interaction with polysomes. The finding that there is just more self-oligomerizing Orb2A co-sedimenting with polysomes in sucrose gradients neither is evidence for a direct effect of Mrj enhancing association of Orb2A with the translating ribosomes even though it would fit the hypothesis. So all in all, I think the data in this figure and non-conclusive and the related conclusions should be deleted.

      Overall, provided that proper controls/additional data can be provided for the key experiments of memory consolidation, I find this an intriguing study that would point towards a role of a molecular chaperone in controlling memory functions via regulating the oligomeric status of a prion-like protein and that is worthwhile publishing in a good journal.

      However, in terms of mechanistical interpretations, several points have to be reconsidered (see remarks on figure 1,4); this pertains especially to what is discussed on page 13. In addition, I'd like the authors to put their data into the perspective of the findings that in differentiated neurons DNAJB6 levels actually decline, not incline (Thiruvalluvan et al, 2020), which would be counterintuitive if these proteins are playing a role as suggested here in memory consolidation.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their time and for the helpful comments. We felt the reviews overall were fair and quite positive. All three reviewers felt the manuscript could be of broad, general interest, especially given the relevance of the protein (Pbp1/ataxin-2) to neurodegenerative conditions and stress granule biology. Reviewer 3 seems to have some doubt there could be specificity for the types of transcripts regulated by Pbp1, given prior studies of mammalian ataxin-2 which implicated 16,000+ mRNAs that could bind via PAR-CLIP experiments! However, our study shows the power of utilizing a simpler model organism and thinking about the metabolic state of cells for elucidating the function of this interesting protein. Although our demonstration of the specificity of Pbp1 for regulating Puf3-target mRNAs involved in mitochondrial biogenesis and mitochondrial function may be surprising to this reviewer, we have the utmost confidence in our data and feel the study represents a highly significant finding that will be of interest to many researchers.

      1. Point-by-point description of the revisions

      This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *

      *Reviewer #1 (Evidence, reproducibility and clarity (Required)): *

      *In this manuscript, van de Poll et al. aim to further establish the function of poly(A) binding protein-binding protein 1 (Pbp1) and its relationship to the RNA-binding protein Puf3 in regulating the expression of mitochondrial proteins. This work builds upon a solid body of previous studies from this group regarding the function of Puf3 and the role of Pbp1 in regulating TORC1 signaling. Here, the authors show that Pbp1 has a physical and functional interaction with Puf3 and that ablation or disruption of Pbp1 eliminates this interaction and reduces the expression of some Puf3 target proteins. This work provides reliable data supporting a role for Pbp1 in the regulation of mitochondrial protein expression and that there is a clear functional interaction between Puf3 and Pbp1. Nonetheless, there are several issues that should be addressed before the manuscript is suitable for publication. *

      *1.) The model put forward suggests that Pbp1 works to recruit Puf3 to the vicinity of mitochondria, where Puf3 can then promote the expression of its target mRNAs. In Figure 3A, however, deletion of Pbp1 has a stronger affect on the expression of COX2 than deletion of Puf3 alone, which would not be expected if the role of Pbp1 is to modulate Puf3 function. Similarly, the expression of COX2 is higher in the double deletion versus the Pbp1 single deletion. The authors should attempt to clarify this experimentally, or at least make mention of alternative mechanisms for Pbp1 which may be causing this. *

      We have mentioned alternative mechanisms in the text. We suggest that Puf3-target mRNAs also can be translated through Tom20, in the absence of Puf3 (p. 8, ref 18). In single deletion strains lacking Pbp1 (but with Puf3 present), Puf3 may direct some of its target mRNAs to decay pathways, leading to lower Cox2 expression compared to double deletion strains that also lack Puf3. We performed qPCR analysis of several Puf3-target and other mRNAs in pbp1∆puf3∆ double deletion strains and some transcripts (e.g., COX17) would support this possibility (Fig S4).

      * 2.) The authors mention that the increased pull-down of Puf3 with Pbp1 in respiratory conditions suggests that the Pbp1-Puf3 interaction is responsive to the cellular metabolic state (Figure 3B). However, the increase in Puf3 expression makes it difficult to compare the interactions between the two conditions. *

      Yes this is correct, we stated this in the legend of Fig 4B as: “Increased amounts of Puf3 are associated with Pbp1 in respiratory conditions.” We clarified in the text that Puf3 expression increases in respiratory conditions and this likely explains the increased pull-down of Puf3 with Pbp1 (p. 10).

      * 3.) The authors only look at a very small subset of Puf3 target mRNAs using qPCR when it would be much more informative and overall convincing to examine a larger amount using RNA-seq experiments. *

      We conducted an RNA-seq experiment to compare transcriptomes of WT vs pbp1∆ cells in fermentative (YPD) vs respiratory (YPL) conditions and observed mRNAs with functions associated with mito-translation and mito-respiration (i.e., Puf3-targets) to be most differentially expressed – and majority of these are lower in abundance in pbp1∆ cells (new Fig 2).

      * 4.) The authors consistently mention that Pbp1 function is helping to stabilize Puf3 target mRNAs. However, if the authors wish to prove this particular mode-of-action, more direct evidence should be provided, such as a pulse-chase experiment. Otherwise, other models allowing for increased mRNA abundance should be noted. *

      Using thiolutin which is the standard for such expts, we measured mRNA half-lives of several Puf3-target and other mRNAs (COX17, COX10, POR1, ACT1) by qPCR in WT vs pbp1∆ cells. However, these data turned out to be difficult to interpret, as several “control” mRNAs exhibited different decay profiles in pbp1∆ vs WT cells, and their behavior was different in respiratory conditions compared to what was reported in common glucose media. Nonetheless, the data are included as Fig S2, and the important observation is that each of the Puf3-target mRNAs tested behaves similarly following thiolutin treatment, compared to non Puf3-target mRNAs. Given that Puf3-target mRNAs were more stable in pbp1∆ cells (compared to PGK1) following thiolutin treatment, we have deleted the term “stabilize” throughout the text. The exact fate of these mRNAs in normal vs pbp1∆ mutant cells will require more sophisticated investigation in future studies.

      * 5.) Given the proposed model, one would expect Puf3 to have reduced mRNA binding upon deletion of Pbp1. It would be interesting to examine Puf3 mRNA binding, perhaps through cross-linking immunoprecipitation (CLIP), to see if this indeed is the case. This would provide further direct evidence that Pbp1 is functioning through Puf3 and facilitating its function. Similarly, the authors mention that Pbp1 contains putative RNA binding domains, however, they make no mention if these domains may contribute to its function in mitochondrial protein expression. *

      We performed an RNA-IP experiment to test whether Puf3 has reduced binding to its target mRNAs in the absence of Pbp1. In new Fig 7, Puf3 is still able to bind its mRNA targets in the absence of Pbp1. However, the association of Pbp1 with these mRNAs is reduced in puf3∆ knockouts. Such results are perhaps expected as Puf3 has been shown to bind in a sequence-specific manner to a ~8 nt motif in the 3’UTR of its target mRNAs. However, it is unclear whether the Lsm / LsmAD domains of Pbp1 actually bind RNAs directly (hence our use of the term “putative”) - they may be involved in protein-protein interactions. Moreover, Fig 5 shows that deletion of both domains has no apparent effect on mitochondrial protein expression. We prefer to address the role of the Lsm and LsmAD domains of Pbp1 in a future study.

      * Reviewer #1 (Significance (Required)):

      Overall, this manuscript provides a modest advance, but one that could prove to have important implications for the field-especially if the Pbp1 findings prove relevant to its human ortholog, ataxin-2. The advance is limited by the robustness of the specific molecular model proposed and the extent to which the Pbp1-Puf3 relationship is examined on the gene-expression level.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, the authors found that the pbp1∆ mutant grew poorly on nonfermentable carbon source medium (YP Lactate medium) and that the pbp1∆ mutant had decreased amount of Cox2 protein, a cytochrome c oxidase. The pbp1∆ mutant also had decreased amounts of COX17, COX10, and MRP51 mRNAs. Since these mRNAs are target mRNAs of the RNA-binding protein Puf3, the authors next investigated the relationship between Pbp1 and Puf3. The analysis of the GFP reporter gene containing Puf3-binding sites in the 3' UTR showed that the levels of GFP reporter mRNA and protein were decreased in the pbp1∆ mutant strain. This reduction was dependent on the Puf3-binding site in the 3' UTR. Next, the authors examined the genetic interaction between the pbp1∆ and puf3∆ mutants, and found that the levels of Cox2 protein were reduced in the two mutants. Finally, the authors showed the interaction between Pbp1 and Puf3 by co-immunoprecipitation and determined the regions of Pbp1 and Puf3 required for the interaction. They also showed that these regions in Pbp1 and Puf3 proteins are also important for the regulation of Cox2 protein levels. The story is very clear and the data is reliable. However, the data from Western blotting should be shown quantitatively to make the results more reliable. Also, although the story is based on the reduction of Cox2 protein level, it would be better to discuss whether other proteins or mRNAs should be considered as well.

      Major comments:

      Figure 2C. Protein levels of GFP should be quantified and the data should be shown. *

      These data have been quantified (now Fig 3C).

      * Figure 3. Not only the Cox2 protein level but also mRNA levels of COX2, COX17, COX10, MRP51, etc in pbp1∆ mutant, puf3∆ mutant and pbp1∆ puf3∆ double mutant should be shown. Then the point of action of Pbp1 and Puf3 would become clearer. *

      The mRNA levels have been determined by qPCR and are now in Fig S4.

      Figure 4. * For the domain analysis of Pbp1 protein, showing differences in cell proliferation as in Figure 1B would indicate the physiological importance of the domain. *

      Growth curves of the various Pbp1 domain deletions have been performed and shown in Fig 5D. They do support the physiological importance of the domain(s).

      * Figure 4B. Quantification of the amount of co-immunoprecipitated proteins would indicate the strength of binding. *

      These data have been quantified (now Fig 5B).

      * Figure 4C. Protein levels should be quantified and the data presented. *

      These data have been quantified (now Fig 5C).

      * Line 153-8 The description of Line 153-8 is not appropriate for this position because it breaks up the flow of the story before and after. *

      These text have been moved as requested.

      * Minor comments:

      Line 153 Isn't the following the first reference cited for Pbp1 is a negative regulator of TORC1? Transient sequestration of TORC1 into stress granules during heat stress Terunao Takahara 1, Tatsuya Maeda Mol Cell. 2012 Jul 27;47(2):242-52. doi: 10.1016/j.molcel.2012.05.019. Epub 2012 Jun 21.

      Ref19. Ref 19 also shows that the pbp1∆ mutant strains grow poorly on the medium containing glycerol and lactate as carbon sources.

      Overall, the gene is not italicized. *

      These requested edits to the references and text have been made in the revised version of the manuscript.

      * Reviewer #2 (Significance (Required)):

      This manuscript analyzes the relationship between Pbp1 and Puf3 in yeast. Since these proteins are evolutionarily conserved from yeast to humans and are also associated with disease in humans, this reviewer believes this manuscript will be of interest to a wide audience. *

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): *

      In this study, van de Poll et al. describe the involvement of a cytosolic RNA-binding protein (Pbp1) in the transcriptional regulation of mitochondrial biogenesis during the shift from fermentative to respiratory growth in budding yeast. Using the advantage of yeast genetics and molecular biology, they show that a number of mitochondrial transcripts and proteins are downregulated in pbp1Δ cells both under normal growth conditions and during respiratory shift. Since Puf3, another RNA-binding protein, is known to regulate the fate of these transcripts, they further investigate the interaction between Pbp1 and Puf3. Through a series of biochemical assays, they characterize the interaction between Pbp1 and Puf3 taking place through their low-complexity domains, which is suggested by authors to stabilize and promote the translation of Puf3-target transcripts.

      As stated in the manuscript, Pbp1 is an evolutionarily conserved protein, encoded by ATXN2 gene in humans. Due to its involvement in multiple neurological disorders, it has been widely studied in mouse models and patient samples. The transcriptome profiles of Atxn2-KO mouse liver and cerebellum have been published (albeit having used a relatively older microarray technology for today's standards), revealing a prominent dysregulation of global translational machinery, and the ER-protein secretion pathway (Fittschen et al., 2015). These findings were followed by numerous studies showing dysregulations of distinct transcript pools under examination. Moreover, a PAR-CLIP study showed ATXN2 to associate with ~16.000 transcripts, 8000 of which depended on its interaction with PABPC1 (Yokoshi et al., 2014). In that study, ATXN2 was shown to preferentially bind to target transcripts on 3'-UTR AU-rich sequences. In addition to PABPC1, some other RNA-binding proteins, like TDP-43, were also shown to modulate the indirect interaction of ATXN2 with transcripts, while it also maintained direct interactions through its Lsm and LsmAD domains. Altogether, the mammalian data on ATXN2 thus far depicts it as an avid interactor of numerous RNA-binding proteins and countless transcripts, including microRNAs. The authors however have not cited or compared their findings with this vast array of mammalian literature (with the exception of two properly discussed papers in Discussion).

      Considering its stress-responsive nature and association with RNP granules, it is plausible to assume that ATXN2/Pbp1 could regulate certain groups of transcripts in terms of their stability (in stress granules and p-bodies) or active translation under given environmental conditions and cellular state. The work of van de Poll et al. in this regard is an important step in expanding our knowledge about the many downstream effects of ATXN2/Pbp1. Yet, the following issues should be solved:

      1) The pre-eminence of the proposed group of affected transcripts (i.e. those associated with mitochondrial biogenesis) has to be empirically established. Among all its interactions with other RNA-binding proteins, how important or dominant is the interaction of Pbp1 with Puf3 for mitochondrial biogenesis during the shift towards respiratory growth? Line 74 in the Results says "Analysis of a panel of nuclear- and mitochondrial-encoded mRNAs..."; how broad was this panel? how were the genes selected? Considering the fact that ATXN2/Pbp1 is associated with an immense number of transcripts, hand-picking a number of Puf3 targets and selectively analyzing their expression will surely give some significant dysregulations. Therefore, an unbiased transcriptomic survey is necessary to see all Pbp1-dependent dysregulations during respiratory shift. Since it's a process that requires heavy mitogenesis, one can assume that many dysregulations will concern mitochondrial factors. Indeed, proteome surveys in Atxn2-KO mouse tissues and pbp1Δ yeast (under fermentative growth and stress) point out to a strong mitochondrial dysregulation, so it raises hopes to see an even stronger Pbp1 impact during the respiratory shift in yeast. Then, bioinformatic analyses can reveal what proportion of those are Puf3 targets. If the authors' premise is valid, then the Puf3-targets will stand out in the transcriptome data, and give them an unbiased, solid and much stronger base for the following interaction analyses. They can then compare this dataset to the readily available mouse transcriptome from Atxn2-KO or polyQ-disease models, and strengthen their hypothesis about ATXN2/Pbp1 regulating mitochondrial biogenesis in association with Puf3.

      The Results text about Figure 1 in its current state is an overstatement of the available data. Line 81-84 suggests mitochondrially encoded Cox2 levels are reduced because some mitoribosome subunits are Puf3 targets, but pbp1Δ itself is known to have altered mitochondrial membrane potential which negatively impacts mitochondrial import. So, the reduction of Cox2 levels (and potentially other mitochondrial-encoded proteins, it was never checked) may have nothing to do with Puf3, but rather be a direct consequence of reduced mitoribosome import in pbp1Δ. In order to make this statement, the total mitochondrial translation rates of WT and pbp1Δ strains would have to be compared, and if they are found the same, a selective effect on Puf3-target proteins has to be shown among many tested candidates. Same applies to line 86 "the specific decrease in Puf3-target mRNAs in pbp1Δ cells" referring to Figure 3C. This statement cannot be made without analyzing a larger group of transcripts including the targets of other RNA-binding proteins. The current data does not support any specific dysregulation of Puf3-targets, it just shows some Puf3 targets to be dysregulated, however without the knowledge of how many significant among all Puf3-targets, or how significant are Puf3-targets compared to others. An unbiased, high-throughput transcriptome data, and detailed bioinformatic analyses should replace Figure 1C. The high variation among replicates at 1h-3h-5h time points is also alarming, and puts the reproducibility of these experiments under question. *

      As mentioned in the response to Reviewer 1, we performed an unbiased RNA-seq experiment comparing transcriptomes of WT vs pbp1∆ cells. The data are quite striking and strongly support our hypothesis (new Fig 2). To address the reviewer’s concern that pbp1∆ phenotypes may be due to altered mito membrane potential and mito protein import, we have performed an experiment to examine import of Cox4, which is a protein substrate that is commonly used for this purpose (note COX4 is not a Puf3-target mRNA). Steady-state Cox4 protein amounts are similar in WT vs pbp1∆ cells. Moreover, following treatment of cells with the uncoupler CCCP, there is more of the “pre”-processed Cox4 form in WT cells compared to pbp1∆ cells. These data would argue against the reviewer’s hypothesis and are included in the revised manuscript as Fig S1. Since every mitochondrial ribosomal subunit gene transcript is a target of Puf3 (PMID: 16254148) and therefore subject to regulation by Pbp1, we would argue that a defect in mito biogenesis (due to compromised translation of these mRNAs) precedes and may explain any subsequent defect in mito membrane potential. *

      2) Stabilization of mRNAs The basal reduction in the mRNA levels of the reporter construct in pbp1Δ is a strong but not necessarily direct evidence of stabilization by Pbp1. mRNA half-life analyses (i.e. degradation curves) should be performed with desired targets to measure stability in WT and pbp1Δ strains. *

      As mentioned above in the response to Reviewer 1, we performed mRNA half-life analyses for several transcripts in WT vs pbp1∆ strains using thiolutin treatment. The results are not straightforward to interpret as loss of Pbp1 led to a stabilization of Puf3-target mRNAs (relative to PGK1), however all Puf3-target mRNAs that we examined exhibited similar decay profiles. Thus, we deleted the term “stabilize” and further determination of the fate of these mRNAs in the absence of new transcription will require more careful and sophisticated experiments.*

      3) Cox2 levels Regarding Line 125: "Cox2 protein levels, which are dependent on the translation of Puf3-target mRNAs": This may be generally true, but the data here suggests otherwise. pbp1Δ cells have completely diminished Cox2 levels, whereas puf3Δ have approx. 50% reduction. This means that Pbp1 is more important to maintain normal Cox2 levels, and does so independent of Puf3. In contrast, puf3Δ "rescues" some of the defect in pbp1Δ cells and increases Cox2 abundance to ~50%. As stated above, Cox2 reduction in pbp1Δ could be a direct consequence of mitochondrial membrane depolarization unrelated to Puf3, and could be accompanied by many other non-Puf3-targets being downregulated. Therefore, the authors should refrain from "Cox2 levels are dependent on the translation of Puf3-target mRNAs" statements throughout the text without an experimental proof in the context of pbp1Δ strain. *

      See response to Reviewer 1. We believe that in the absence of Pbp1, Puf3 may now preferentially promote decay of various mito biogenesis transcripts, leading to apparently lower Cox2 levels. Moreover, per the results of our Cox4 experiment (Fig S1), we would respectfully disagree with the reviewer’s hypothesis. Nonetheless, we included an additional statement that mitochondrial membrane depolarization, as a consequence of reduced expression of numerous Puf3-targets, could also contribute to lower Cox2 abundance (p. 6 and 15). *

      4) Pbp1-Puf3 interaction The authors state that Pbp1-Puf3 interaction is required for Puf3-target mRNA stabilization and translation. This suggests that Pbp1 stabilizes this pool of mRNAs because of its interaction with Puf3 primarily, not the mRNAs themselves. One general question while studying the interaction between two RNA-binding proteins is whether they interact in an RNA-dependent manner in vivo. The co-IP analyses show the interaction between Pbp1 and Puf3 to increase under respiratory shift as expected. However, in co-IPs from cell lysates, many RNA-binding proteins may seemingly interact due to their association with translation machinery at that given time. But this does not mean "direct" protein-protein interaction, just a co-existence around actively translating ribosomes. In order to ensure the direct interaction of these two proteins, the same co-IPs should be performed with/out RNase treatment of the lysate (many protocols available online). Only if Pbp1-Puf3 interaction persists in RNase+ samples, they can conclude a direct interaction. In addition, RNA-immunoprecipitation analyses should be performed in Pbp1-Flag and Pbp1-Flag/ puf3Δ strains to check if the association of Pbp1 with Puf3-target mRNAs indeed depends on Puf3. *

      This is a good suggestion. We performed an experiment to test whether RNase treatment alters interaction between Pbp1 and Puf3 and there was minimal effect, supporting the hypothesis that the interaction may be direct. We also performed RNA-IP of Pbp1 in the presence of absence of Puf3 (new Fig 7). As the reviewer predicted, the RNA-IP enrichment of Puf3-target mRNAs was reduced in puf3∆ strains, suggesting that the association of Pbp1 with such transcripts depends on Puf3. It is known from work by others that Puf3 contains a PUF domain that enables sequence-specific binding to a motif in the 3’UTR of its target mRNAs, so these results are quite sensible.

      * Minor comments: • Second sentence of the Abstract ("How mutations in its mammalian ortholog ataxin-2 are linked to neurodegenerative conditions remains unclear") is semantically incorrect. The term "linked" suggests an observed but uncharacterized effect of a genetic variation on a certain syndrome. Diseases can be linked to a chromosome or a locus without knowing the exact causative mutation. How the CAG repeat expansion mutations in ATXN2 are causative of SCA2, ALS or Parkinson-plus syndromes are very well known. One should also be careful with using "mutations" as a general term in the context of ATXN2, because there are certain variations in and around ATXN2 locus leading to a decrease in its activity and metabolic problems, which is far from its neurodegeneration-causing mutations. If the authors meant to state that the pathological mechanism is unclear by this sentence, that would also be a negligence of the extensive literature around this topic. Multiple disease models in mouse, Drosophila and C. elegans collectively point out to an RNA metabolism deficit, caused by toxic ATXN2 aggregates that sequestrate other RNA-binding proteins and their target transcripts. The specific downstream effects involve synaptic strength, Calcium-related action potentials, ER stress and cholesterol/sphingolipid synthesis. Therefore, this sentence could be rephrased to "PolyQ expansion mutations in its mammalian ortholog ataxin-2 lead to spinocerebellar dysfunction due to toxic protein aggregation." and simply avoid going into mechanistic details as it is not necessary for this manuscript.

      • Lines 241-243: "Human sequencing" is also an incorrect term. Can be rephrased to "PolyQ expansion mutations in ATXN2 are associated with SCA2 and ALS". The references 22-24 are the first association of polyQ mutations with SCA2, however a reference for ALS is missing. Elden et al. Nature 2010 should be cited here.

      • The authors should discuss the relevance of these findings to the mammalian ortholog of Pum3, namely PUM1/2. Afterall, it is also a very important conserved protein and well-studied in mammalian literature. *

      These changes to the text and references have been made.

      * Following a better characterization of the transcript pools selectively affected by Pbp1 (meaning a transcriptome survey), a graphical abstract sort of scheme could be useful in putting the findings in perspective and conveying the message.*

      We decided not to include a graphical abstract at this time, since it is difficult for us to “picture” what is going on inside an Pbp1-containing RNP granule at this time. * Reviewer #3 (Significance (Required)):

      The intricate experiments characterizing the nature of interaction between Pbp1 and Puf3 (Figures 3B, 4, 5, 6) are quite convincing. However, some fundamental questions remain especially regarding the primary rationale of studying Pbp1-Puf3 relationship and the breadth of some conclusions. The data are of general interest to a broad audience. The statistical tests in Figure 1 are of concern. The reviewer(s) has experience both with yeast molecular biology and with mammalian Atxn2 function. *

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this study, van de Poll et al. describe the involvement of a cytosolic RNA-binding protein (Pbp1) in the transcriptional regulation of mitochondrial biogenesis during the shift from fermentative to respiratory growth in budding yeast. Using the advantage of yeast genetics and molecular biology, they show that a number of mitochondrial transcripts and proteins are downregulated in pbp1Δ cells both under normal growth conditions and during respiratory shift. Since Puf3, another RNA-binding protein, is known to regulate the fate of these transcripts, they further investigate the interaction between Pbp1 and Puf3. Through a series of biochemical assays, they characterize the interaction between Pbp1 and Puf3 taking place through their low-complexity domains, which is suggested by authors to stabilize and promote the translation of Puf3-target transcripts.

      As stated in the manuscript, Pbp1 is an evolutionarily conserved protein, encoded by ATXN2 gene in humans. Due to its involvement in multiple neurological disorders, it has been widely studied in mouse models and patient samples. The transcriptome profiles of Atxn2-KO mouse liver and cerebellum have been published (albeit having used a relatively older microarray technology for today's standards), revealing a prominent dysregulation of global translational machinery, and the ER-protein secretion pathway (Fittschen et al., 2015). These findings were followed by numerous studies showing dysregulations of distinct transcript pools under examination. Moreover, a PAR-CLIP study showed ATXN2 to associate with ~16.000 transcripts, 8000 of which depended on its interaction with PABPC1 (Yokoshi et al., 2014). In that study, ATXN2 was shown to preferentially bind to target transcripts on 3'-UTR AU-rich sequences. In addition to PABPC1, some other RNA-binding proteins, like TDP-43, were also shown to modulate the indirect interaction of ATXN2 with transcripts, while it also maintained direct interactions through its Lsm and LsmAD domains. Altogether, the mammalian data on ATXN2 thus far depicts it as an avid interactor of numerous RNA-binding proteins and countless transcripts, including microRNAs. The authors however have not cited or compared their findings with this vast array of mammalian literature (with the exception of two properly discussed papers in Discussion).

      Considering its stress-responsive nature and association with RNP granules, it is plausible to assume that ATXN2/Pbp1 could regulate certain groups of transcripts in terms of their stability (in stress granules and p-bodies) or active translation under given environmental conditions and cellular state. The work of van de Poll et al. in this regard is an important step in expanding our knowledge about the many downstream effects of ATXN2/Pbp1. Yet, the following issues should be solved:

      1. The pre-eminence of the proposed group of affected transcripts (i.e. those associated with mitochondrial biogenesis) has to be empirically established. Among all its interactions with other RNA-binding proteins, how important or dominant is the interaction of Pbp1 with Puf3 for mitochondrial biogenesis during the shift towards respiratory growth? Line 74 in the Results says "Analysis of a panel of nuclear- and mitochondrial-encoded mRNAs..."; how broad was this panel? how were the genes selected? Considering the fact that ATXN2/Pbp1 is associated with an immense number of transcripts, hand-picking a number of Puf3 targets and selectively analyzing their expression will surely give some significant dysregulations. Therefore, an unbiased transcriptomic survey is necessary to see all Pbp1-dependent dysregulations during respiratory shift. Since it's a process that requires heavy mitogenesis, one can assume that many dysregulations will concern mitochondrial factors. Indeed, proteome surveys in Atxn2-KO mouse tissues and pbp1Δ yeast (under fermentative growth and stress) point out to a strong mitochondrial dysregulation, so it raises hopes to see an even stronger Pbp1 impact during the respiratory shift in yeast. Then, bioinformatic analyses can reveal what proportion of those are Puf3 targets. If the authors' premise is valid, then the Puf3-targets will stand out in the transcriptome data, and give them an unbiased, solid and much stronger base for the following interaction analyses. They can then compare this dataset to the readily available mouse transcriptome from Atxn2-KO or polyQ-disease models, and strengthen their hypothesis about ATXN2/Pbp1 regulating mitochondrial biogenesis in association with Puf3.

      The Results text about Figure 1 in its current state is an overstatement of the available data. Line 81-84 suggests mitochondrially encoded Cox2 levels are reduced because some mitoribosome subunits are Puf3 targets, but pbp1Δ itself is known to have altered mitochondrial membrane potential which negatively impacts mitochondrial import. So, the reduction of Cox2 levels (and potentially other mitochondrial-encoded proteins, it was never checked) may have nothing to do with Puf3, but rather be a direct consequence of reduced mitoribosome import in pbp1Δ. In order to make this statement, the total mitochondrial translation rates of WT and pbp1Δ strains would have to be compared, and if they are found the same, a selective effect on Puf3-target proteins has to be shown among many tested candidates. Same applies to line 86 "the specific decrease in Puf3-target mRNAs in pbp1Δ cells" referring to Figure 3C. This statement cannot be made without analyzing a larger group of transcripts including the targets of other RNA-binding proteins. The current data does not support any specific dysregulation of Puf3-targets, it just shows some Puf3 targets to be dysregulated, however without the knowledge of how many significant among all Puf3-targets, or how significant are Puf3-targets compared to others. An unbiased, high-throughput transcriptome data, and detailed bioinformatic analyses should replace Figure 1C. The high variation among replicates at 1h-3h-5h time points is also alarming, and puts the reproducibility of these experiments under question. 2. Stabilization of mRNAs The basal reduction in the mRNA levels of the reporter construct in pbp1Δ is a strong but not necessarily direct evidence of stabilization by Pbp1. mRNA half-life analyses (i.e. degradation curves) should be performed with desired targets to measure stability in WT and pbp1Δ strains. 3. Cox2 levels Regarding Line 125: "Cox2 protein levels, which are dependent on the translation of Puf3-target mRNAs": This may be generally true, but the data here suggests otherwise. pbp1Δ cells have completely diminished Cox2 levels, whereas puf3Δ have approx. 50% reduction. This means that Pbp1 is more important to maintain normal Cox2 levels, and does so independent of Puf3. In contrast, puf3Δ "rescues" some of the defect in pbp1Δ cells and increases Cox2 abundance to ~50%. As stated above, Cox2 reduction in pbp1Δ could be a direct consequence of mitochondrial membrane depolarization unrelated to Puf3, and could be accompanied by many other non-Puf3-targets being downregulated. Therefore, the authors should refrain from "Cox2 levels are dependent on the translation of Puf3-target mRNAs" statements throughout the text without an experimental proof in the context of pbp1Δ strain. 4. Pbp1-Puf3 interaction The authors state that Pbp1-Puf3 interaction is required for Puf3-target mRNA stabilization and translation. This suggests that Pbp1 stabilizes this pool of mRNAs because of its interaction with Puf3 primarily, not the mRNAs themselves. One general question while studying the interaction between two RNA-binding proteins is whether they interact in an RNA-dependent manner in vivo. The co-IP analyses show the interaction between Pbp1 and Puf3 to increase under respiratory shift as expected. However, in co-IPs from cell lysates, many RNA-binding proteins may seemingly interact due to their association with translation machinery at that given time. But this does not mean "direct" protein-protein interaction, just a co-existence around actively translating ribosomes. In order to ensure the direct interaction of these two proteins, the same co-IPs should be performed with/out RNase treatment of the lysate (many protocols available online). Only if Pbp1-Puf3 interaction persists in RNase+ samples, they can conclude a direct interaction. In addition, RNA-immunoprecipitation analyses should be performed in Pbp1-Flag and Pbp1-Flag/ puf3Δ strains to check if the association of Pbp1 with Puf3-target mRNAs indeed depends on Puf3.

      Minor comments:

      • Second sentence of the Abstract ("How mutations in its mammalian ortholog ataxin-2 are linked to neurodegenerative conditions remains unclear") is semantically incorrect. The term "linked" suggests an observed but uncharacterized effect of a genetic variation on a certain syndrome. Diseases can be linked to a chromosome or a locus without knowing the exact causative mutation. How the CAG repeat expansion mutations in ATXN2 are causative of SCA2, ALS or Parkinson-plus syndromes are very well known. One should also be careful with using "mutations" as a general term in the context of ATXN2, because there are certain variations in and around ATXN2 locus leading to a decrease in its activity and metabolic problems, which is far from its neurodegeneration-causing mutations. If the authors meant to state that the pathological mechanism is unclear by this sentence, that would also be a negligence of the extensive literature around this topic. Multiple disease models in mouse, Drosophila and C. elegans collectively point out to an RNA metabolism deficit, caused by toxic ATXN2 aggregates that sequestrate other RNA-binding proteins and their target transcripts. The specific downstream effects involve synaptic strength, Calcium-related action potentials, ER stress and cholesterol/sphingolipid synthesis. Therefore, this sentence could be rephrased to "PolyQ expansion mutations in its mammalian ortholog ataxin-2 lead to spinocerebellar dysfunction due to toxic protein aggregation." and simply avoid going into mechanistic details as it is not necessary for this manuscript.
      • Lines 241-243: "Human sequencing" is also an incorrect term. Can be rephrased to "PolyQ expansion mutations in ATXN2 are associated with SCA2 and ALS". The references 22-24 are the first association of polyQ mutations with SCA2, however a reference for ALS is missing. Elden et al. Nature 2010 should be cited here.
      • The authors should discuss the relevance of these findings to the mammalian ortholog of Pum3, namely PUM1/2. Afterall, it is also a very important conserved protein and well-studied in mammalian literature.
      • Following a better characterization of the transcript pools selectively affected by Pbp1 (meaning a transcriptome survey), a graphical abstract sort of scheme could be useful in putting the findings in perspective and conveying the message.

      Significance

      The intricate experiments characterizing the nature of interaction between Pbp1 and Puf3 (Figures 3B, 4, 5, 6) are quite convincing. However, some fundamental questions remain especially regarding the primary rationale of studying Pbp1-Puf3 relationship and the breadth of some conclusions. The data are of general interest to a broad audience.<br /> The statistical tests in Figure 1 are of concern. The reviewer(s) has experience both with yeast molecular biology and with mammalian Atxn2 function.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, the authors found that the pbp1∆ mutant grew poorly on nonfermentable carbon source medium (YP Lactate medium) and that the pbp1∆ mutant had decreased amount of Cox2 protein, a cytochrome c oxidase. The pbp1∆ mutant also had decreased amounts of COX17, COX10, and MRP51 mRNAs. Since these mRNAs are target mRNAs of the RNA-binding protein Puf3, the authors next investigated the relationship between Pbp1 and Puf3. The analysis of the GFP reporter gene containing Puf3-binding sites in the 3' UTR showed that the levels of GFP reporter mRNA and protein were decreased in the pbp1∆ mutant strain. This reduction was dependent on the Puf3-binding site in the 3' UTR. Next, the authors examined the genetic interaction between the pbp1∆ and puf3∆ mutants, and found that the levels of Cox2 protein were reduced in the two mutants. Finally, the authors showed the interaction between Pbp1 and Puf3 by co-immunoprecipitation and determined the regions of Pbp1 and Puf3 required for the interaction. They also showed that these regions in Pbp1 and Puf3 proteins are also important for the regulation of Cox2 protein levels.

      The story is very clear and the data is reliable. However, the data from Western blotting should be shown quantitatively to make the results more reliable. Also, although the story is based on the reduction of Cox2 protein level, it would be better to discuss whether other proteins or mRNAs should be considered as well.

      Major comments:

      Figure 2C.

      Protein levels of GFP should be quantified and the data should be shown.

      Figure 3.

      Not only the Cox2 protein level but also mRNA levels of COX2, COX17, COX10, MRP51, etc in pbp1∆ mutant, puf3∆ mutant and pbp1∆ puf3∆ double mutant should be shown. Then the point of action of Pbp1 and Puf3 would become clearer.

      Figure 4.

      For the domain analysis of Pbp1 protein, showing differences in cell proliferation as in Figure 1B would indicate the physiological importance of the domain.

      Figure 4B.

      Quantification of the amount of co-immunoprecipitated proteins would indicate the strength of binding.

      Figure 4C.

      Protein levels should be quantified and the data presented.

      Line 153-8

      The description of Line 153-8 is not appropriate for this position because it breaks up the flow of the story before and after.

      Minor comments:

      Line 153

      Isn't the following the first reference cited for Pbp1 is a negative regulator of TORC1? Transient sequestration of TORC1 into stress granules during heat stress Terunao Takahara 1, Tatsuya Maeda Mol Cell. 2012 Jul 27;47(2):242-52. doi: 10.1016/j.molcel.2012.05.019. Epub 2012 Jun 21.

      Ref19.

      Ref 19 also shows that the pbp1∆ mutant strains grow poorly on the medium containing glycerol and lactate as carbon sources.

      Overall, the gene is not italicized.

      Significance

      This manuscript analyzes the relationship between Pbp1 and Puf3 in yeast. Since these proteins are evolutionarily conserved from yeast to humans and are also associated with disease in humans, this reviewer believes this manuscript will be of interest to a wide audience.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, van de Poll et al. aim to further establish the function of poly(A) binding protein-binding protein 1 (Pbp1) and its relationship to the RNA-binding protein Puf3 in regulating the expression of mitochondrial proteins. This work builds upon a solid body of previous studies from this group regarding the function of Puf3 and the role of Pbp1 in regulating TORC1 signaling. Here, the authors show that Pbp1 has a physical and functional interaction with Puf3 and that ablation or disruption of Pbp1 eliminates this interaction and reduces the expression of some Puf3 target proteins. This work provides reliable data supporting a role for Pbp1 in the regulation of mitochondrial protein expression and that there is a clear functional interaction between Puf3 and Pbp1. Nonetheless, there are several issues that should be addressed before the manuscript is suitable for publication.

      1. The model put forward suggests that Pbp1 works to recruit Puf3 to the vicinity of mitochondria, where Puf3 can then promote the expression of its target mRNAs. In Figure 3A, however, deletion of Pbp1 has a stronger affect on the expression of COX2 than deletion of Puf3 alone, which would not be expected if the role of Pbp1 is to modulate Puf3 function. Similarly, the expression of COX2 is higher in the double deletion versus the Pbp1 single deletion. The authors should attempt to clarify this experimentally, or at least make mention of alternative mechanisms for Pbp1 which may be causing this.
      2. The authors mention that the increased pull-down of Puf3 with Pbp1 in respiratory conditions suggests that the Pbp1-Puf3 interaction is responsive to the cellular metabolic state (Figure 3B). However, the increase in Puf3 expression makes it difficult to compare the interactions between the two conditions.
      3. The authors only look at a very small subset of Puf3 target mRNAs using qPCR when it would be much more informative and overall convincing to examine a larger amount using RNA-seq experiments.
      4. The authors consistently mention that Pbp1 function is helping to stabilize Puf3 target mRNAs. However, if the authors wish to prove this particular mode-of-action, more direct evidence should be provided, such as a pulse-chase experiment. Otherwise, other models allowing for increased mRNA abundance should be noted.
      5. Given the proposed model, one would expect Puf3 to have reduced mRNA binding upon deletion of Pbp1. It would be interesting to examine Puf3 mRNA binding, perhaps through cross-linking immunoprecipitation (CLIP), to see if this indeed is the case. This would provide further direct evidence that Pbp1 is functioning through Puf3 and facilitating its function. Similarly, the authors mention that Pbp1 contains putative RNA binding domains, however, they make no mention if these domains may contribute to its function in mitochondrial protein expression.

      Significance

      Overall, this manuscript provides a modest advance, but one that could prove to have important implications for the field-especially if the Pbp1 findings prove relevant to its human ortholog, ataxin-2. The advance is limited by the robustness of the specific molecular model proposed and the extent to which the Pbp1-Puf3 relationship is examined on the gene-expression level.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The manuscript by Naeli et al., presents study on effects of SARS-CoV-2 NSP2 protein on miRNA mediated translational repression. Authors show in multiple ways using reporter mRNAs with various miRNA sites that NSP2 protein stimulates miRNA mediated repression. The increase in miRNA repression is likely due to the interaction of NSP2 with either GIGYF2 or Argonaute protein directly thus making more stable repressive complex on mRNA. The manuscript is written clearly and methods provide enough details for reproducibility. Only major comment would be that authors could have tested multiple endogenous targets of miRNAs for extent of miRNA mediated expression in the presence of NSP2. This could be achieved using either western blots for known targets (looking at protein levels) or using targeted qRT-PCR or distribution of mRNAs in polysome fractions (mRNA translational repression. An alternative would be Ribo-Seq experiment.

      Minor comment:

      Line in introduction arguing: "The GIGYF2/4EHP complex is recruited by a variety of factors including miRNAs" should state miRISC instead of miRNAs.

      Significance

      General assessment: The study presents sold evidence that NSP2 protein interacts with miRISC complex and increases miRNA-mediated translational repression of reporter mRNAs. Multiple target sites for miR20, let7 and miR92 are tested as well as two different human cell lines (Hek293 and U87) which gives strength to study and reproducibility of the results. Focus on the endogenous miRNA targets in the presence or absence of the NSP2 protein would make study even stronger.

      The advance of the study is more rigorous analyses of NSP2 protein effects on miRNA-mediated gene expression regulation with some novel mechanistic insights. The study will be of interest for specialized and basic research audience with potential impact on translational research.

      My field of expertise covers mechanisms of gene expression regulation by miRNAs and RBPs as well as impact of mRNAs, nascent peptides and ribosomes on protein synthesis.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this study, Naeli and collaborators propose a role for the SARS-CoV2 protein NSP2 in the miRNA-mediated translational repression. Their data show that NSP2 co-immunoprecipitate with the Argonaute AGO2 and the previously reported translation modulator GIGYF2. Using different reporters sensitive to miRNA repression, they show that overexpressing NSP2 enhances miRNA-mediated translational repression in different cell lines as well as one endogenous miRNA target CDK1 and thus without affecting the stability of targeted mRNAs. Interestingly, their data show that the effect of NSP2 depends on the number of miRNA binding sites suggesting that highly repressed mRNAs, due to the presence of several miRNA binding sites, are not affected by NSP2. Finally, using an AGO2 tethering reporter assay that does not rely on miRNA binding but needs two NSP2 interactors GIGYF2 and 4EHP, they demonstrate that overexpressing NSP2 still stimulates mRNA repression, suggesting that NSP2 can have a broader impact on miRISC-dependent silencing.

      Overall, this is an interesting follow-up study from their previous paper (Xu et al., 2022) that have the potential to add another dimension to the modulation of mRNA translation by the SARS-CoV2 protein NSP2. But unfortunately, in its current form, the work falls short of supporting their claims appropriately and providing sufficient and relevant insights about the role of NSP2 in regulating the miRNA-mediate gene regulation. To overcome this, the authors should perform and add the following experiments to strengthen their study.

      1. Interaction of NSP2 with the miRISC: With the data presented here, we can only conclude that NPS2 forms a complex with AGO2. Is their interaction direct or indirect? Is miRNA- and TNRC6-bound AGO2 (and thus miRISC) associated with NSP2? To address those important questions, the authors should perform NSP2 immunoprecipitations in GIGYF2 (and 4EHP) KO cell lines and monitor the presence of AGO2 and miRNAs in the immunoprecipitated complex. Those experiments will define the type of interaction NSP2 has with the miRISC (GIGYF2 dependent or not).
      2. Along this line, is NSP2 action on miRNA-mediated gene regulation dependent or not of GIGYF2? Again, testing this by monitoring the repression of the different reporters upon NSP2 overexpression in the presence or not of GIGYF2 in cells will precise the contribution of NSP2 in miRNA-mediated gene silencing.

      Besides these two sets of critical experiments that will define the relationship between NSP2 mRNA modulation and the microRNA pathway, it would be interesting for this study to readily test the effect of NSP2 on miRNA targets related to immune-regulatory processes and antiviral response. As the authors pointed out in their discussion, several mRNAs are involved in the control of genes found in those pathways. Demonstrating the contribution of NSP2 in the regulation of a few of them will strengthen their study's significance and interest by providing a possible mechanism at play during a SARS-CoV2 infection. Also, it would be interesting to test if the modulation of translation inhibition by NSP2 occurs in cells infected by the SARS-CoV2 virus. For instance, is NSP2 and miRISC interaction enhances during the viral infection? As the authors propose, NSP2 could also have improved antiviral microRNA repression, so it would be interesting to characterize this interplay in a relevant biological context.

      Minor comment:

      From the data presented in Figure S1A, it is impossible to conclude "that miR-20a represses the expression of the target mRNA in a GIGFY2-dependent manner" as its KO also affect the level/stability of 4EHP. Therefore, we cannot distinguish the contribution of GIGFY2 and 4EHP in this context as both protein levels decrease. The authors should tone down this statement on page 3.

      Significance

      With the addition of the proposed experiments, the revised study will better define the direct contribution of NSP2 with the miRISC. This work has the potential to provide another aspect of the mRNA translation modulation by the SARS-CoV2 protein NSP2 with the interesting angle of miRNA-mediated gene silencing.

      As mentioned by the authors, another recent paper reports the potential impact of NSP2 on post-transcriptional silencing (Zou et al., iScience 2022). However, in contrast to the current study, this previous work did not directly test the interaction of NSP2 with the miRISC. Furthermore, it only used a single miRNA reporter (let-7) to support NSP2 contribution in miRNA-mediated gene silencing, which does not demonstrate the broader impact of NSP2 on this gene regulatory mechanism as tested in this current study. Upon revision, this study will provide more definitive proof of the involvement of NSP2 in miRNA-mediated gene regulation and thus will be of interest to experts in the miRNA field and scientists interested in understanding viruses/hosts interaction.

      Although not essential, if the authors want to add data that addresses the function of NSP2 on this regulatory pathway in the context of viral infection (which seems feasible for this group), that will definitely increase the broader significance of their work.

      I am an expert in molecular biology and molecular genetics, miRNA-mediated gene regulation, and small non-coding RNA biology.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript the authors examine whether SARS-CoV-2 protein, NSP2 mediate translation repression of cellular transcripts by increasing miRNA mediated suppression. The same authors previously demonstrated NSP2 interacts with GIGYF2 and this interaction suppresses the translation of the Ifnb mRNA. Here they extend this finding and using a series of reporters they illustrate that at least part of NSP2 translation suppression is mediated by increasing GIGYF2 mediated miRNA translation suppression. Overall the manuscript is clearly written and the experiments well executed.

      Major comments:

      Optional- The authors show that the ability of NSP2 to enhance miRNA-mediated repression is dependent on the extent of the initial repression and suggest this dependency on the initial repression levels may explain the discrepancy with published work showing NSP2 actually impairs (and not increase) microRNA-mediated silencing . Therefore, an important addition could be to examine what happen to translation in cells that express NSP2 and whether generally translation repression is significant in transcripts (native) that are enriched in miRNA binding site. This experiment will help to show NSP2 effect on native transcripts and potentially help to understand how much of these changes are likely explained by miRNAs.

      Minor comments:

      1. Personally I found the term repression fold quite confusing and unintuitive. Why not to present the actual measurements so that the control (blue bars) have high value and the red bars (representing repression) have lower values?
      2. It seems inadequate to present on the same graph two values that are normalized to 1. For example, in figure 1D it will be important to show the mir20-Mut real values (at least mir20-Mut in NSP2 cells should not be normalized to 1). This will allow to show that the differences are indeed mediated by stronger translation repression of miR-20 WT luciferase in the presence of NSP2 and not by unexplained differences in mir20-mut luciferase expression. This is true for almost all the figures in the manuscript. Correspondingly, the statistical test should be two-factor ANOVA test examining if NSP2 expression significantly increase the difference between Luciferase miR20-WT and luciferase miR20-mut.

      Significance

      There is an urgent need for better molecular understanding of how SARS-CoV-2 proteins influence the machineries of the host cell.

      This study investigates how NSP2 interaction with GIGYF2 mediate translation repression of cellular transcript. The authors also address the discrepancy with previously published work that showed NSP2 actually impairs (and not increase) microRNA-mediated silencing.

      The paper would be of interest to RNA biologists and for molecular virologists that study SARS-CoV-2

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      I summarise the major findings of the work below. In my opinion the range and application of approaches has provided a broad evidence base that, in general, supports the authors conclusions. However, there are, in my opinion, particular failures to utilise and communicate this evidence. The manuscript may be much improved with attention in the following areas. In each case I will give general criticism with a few examples, but the principals of my comments could be applied throughout the work.

      1) Insufficient quantification. The investigation combines various sources of qualitative data (EM, fluorescence microscopy, western blotting) to generate a reasonably strong evidence base. However, the work is over-reliant on representative images and should include more quantification from repeat experiments. When there are multiple fluorescence micrographs with intensity changes (not necessarily just representative images) (e.g. Figure 1 or 2) the authors should consider making measurements of these. Also the VLP production assays, which are assessed by western blotting would particularly benefit from a quantitative assessment (either by densitometry or, if samples remain, ELISA/similar approach).

      We have performed quantification of immunofluoresence, western blotting and VLP experiments from existing data. These quantification are presented in our revised manuscript. An overview of new quantification is shown below:

      Data shown

      Quantification now shown in

      Method

      Analysis

      Figure 1A

      Supp F1C

      IF

      HAE (-/+ SARS-CoV-2)

      • Tetherin total fluorescence intensity

      Figure 1D

      Supp F1E

      IF

      HeLa+ACE2 (-/+ SARS-CoV-2 )

      • Tetherin total fluorescence intensity

      Figure 2C

      Supp F2B

      IF

      A549+ACE2 (-/+ SARS-CoV-2)

      • Tetherin total fluorescence intensity

      Figure 2G

      Supp F2D

      IF

      T84 (-/+ SARS-CoV-2)

      • Tetherin total fluorescence intensity

      Supp F4A

      Supp F4B

      IF

      HeLa + ss-HA-Spike transients (-/+ HA stained cells) - Tetherin total fluorescence intensity

      Figure 4D

      Supp F4E

      IF

      HeLa + TetOne ss-HA-Spike stables (-/+ Dox)

      • Tetherin total fluorescence intensity

      Figure 4F

      Supp F4G

      W blot

      HeLa + TetOne ss-HA-Spike stables (-/+ Dox)

      – Tetherin abundance

      Figure 4G

      Supp F4I

      W blot – lysates

      Spike VLP experiments

      – tetherin abundance

      Figure 4G

      Supp F4J

      W blot - VLPs

      Spike VLP experiments

      • N-FLAG abundance

      Figure 6A

      Supp F7A

      W blot – lysates

      ORF3a VLP experiments

      – tetherin abundance

      Figure 6A

      Supp F7B

      W blot - VLPs

      ORF3a VLP experiments

      • N-FLAG

      For immunofluoresence anaysis, the mean, standard deviation, number of cells analysed and number of independent experiments are shown in the updated figure legends. Statistical analysis is also detailed in figure legends. Methods for the quantificaiton of fluoresence intensity is included in the Methods section.

      Densitometry was performed on western blots and VLP experiments as suggested. The mean, standard devisation and number of independent expreiments analysed are expressed in figure legends. Methods for densityometry quantification is now included.

      2) Insufficient explanation. I found some of the images and legends contained insufficient annotation and/or description for a non-expert reader to appreciate the result(s). Particularly if the authors want to draw attention to features in micrographs they should consider using more enlarged/inset images and annotations (e.g. arrows) to point out structures (e.g DMVs etc.). This short coming exacerbates the lack of quantification.

      Additional detail has been provided to the figure legends, and we have updated several figures to draw attention to features in micrographs. Black arrowheads have been added to Figures 1E, 2D, 2H to highlight plasma membrane-associated virions, and asterisks to highlight DMVs in Figures 1E, 2D and Supplemental Figures 2C, 2E. Similarly, typical Golgi cisternae are highlighted by white arrowheads micrographs in Figure 2E. These figure legends have also been modified to highlight these additions.

      3) Insufficient exploration of the data. I had a sense that some aspects of the data seem unconsidered or ignored, and the discussion lacks depth and reflection. For example the tetherin down-regulation apparent in Figures 1 and 2 is not really explained by the spike/ORF3a antagonism described later on, but this is not explicitly addressed.

      We have made changes throughout the manuscript, but the discussion especially has been modified. We now discuss the ORF3a data in more depth, discuss possible mechanisms by which ORF3a alone enhances VLP release, and discuss our ORF7a data in context to previous reports.

      The discussion has been updated to now include a better description of our data, and additional writing putting our work in to context with previously published work. See discussion section of revised manuscript.

      Also, Figure 6 suggests that ORF3a results in high levels of incorporation of tetherin in to VLPs, but I don't think this is even described(?). The discussion should also include more comparison with previous studies on the relationship between SARS-2 and tetherin.

      We have added a section to discuss how ORF3a may enhance VLP release,

      ‘We found that the expression of ORF3a enhanced VLP independently of its ability to relocalise tetherin (Figure 6A). This may be due to either the ability of ORF3a to induce Golgi fragmentation [38] which facilitates viral trafficking [39], or due to enhanced lysosomal exocytosis [37]. Tetherin was also found in VLPs upon co-expression with ORF3a (Figure 6A) which may also indicate to enhanced release via lysosomal exocytosis [37].

      The secretion of lysosomal hydrolases has been reported upon expression of ORF3a [31] and whilst this may in-part be due to enhanced lysosome-plasma membrane fusion, our data highlights that ORF3a impairs the retrograde trafficking of CIMPR (Supplemental Figures 6B, 6F, 6G), which may similarly increase hydrolase secretion.’ – (Line 625-654).

      The discussion has been developed to compare the relationship between SARS-CoV-2 and tetherin in previous studies,

      ‘SARS-CoV-1 ORF7a is reported to inhibit tetherin glycosylation and localise to the plasma membrane in the presence of tetherin [18]. We did not observe any difference in total tetherin levels, tetherin glycosylation, ability to form dimers, or surface tetherin upon expression of either SARS-CoV-1 or SARS-CoV-2 ORF7a (Figures 4A, 4B, 4C).

      Others groups have demonstrated a role for ORF7a in sarbecovirus infection and both SARS-CoV-1 and SARS-CoV-2 virus lacking ORF7a show impaired virus replication in the presence of tetherin [18,41]. A direct interaction between SARS-CoV-1 ORF7a and SARS-CoV-2 ORF7a and tetherin have been described [18,41], although the precise mechanism(s) by which ORF7a antagonises tetherin remains enigmatic. We cannot exclude that ORF7a requires other viral proteins to antagonise tetherin, or that ORF7a antagonises tetherin via another mechanism. For example, ORF7a can potently antagonise IFN signalling [42] which would impair tetherin induction in many cell types.’ – (Line 667-704).

      I have no minor comments on this draft of the manuscript.

      Reviewer #1 (Significance (Required)):

      Tetherin, encoded by the BST2 gene, is an antiviral restriction factor that inhibits the release of enveloped viruses by creating tethers between viral and host membranes. It also has a capacity for sensing and signalling viral infection. It is most widely understood in the context of HIV-1, however, there is evidence of restriction in a wide variety of enveloped viruses, many of which have evolved strategies for antagonising tetherin. This knowledge informs on viral interactions with the innate immune system, with implications for basic virology and translational research.

      This study investigates tetherin in the context of SARS-CoV-2. The authors use a powerful collection of tools (live virus, gene knock out cells, recombinant viral and host expression systems) and a variety of approaches (microscopy, western blotting, infection assays), which is, itself, a strength. The study provides evidence to support a series of conclusions: I) BST2/tetherin restricts SARS-CoV-2 II) SARS-CoV-2 ablates tetherin expression III) spike protein can modestly down-regulate tetherin IV) ORF3A dysregulates tetherin localisation by altering retrograde trafficking. These conclusions are broadly supported by the data and this study make significant contributions to our understanding of SARS-CoV-2/tetherin interactions.

      My enthusiasm is reduced by, in my opinion, a failure of the authors to fully quantify, explain and explore their data. I expect the manuscript could be significantly improved without further experimentation by strengthening these aspects.

      This manuscript will be of interest to investigators in virology and/or cellular intrinsic immunity. Given the focus on SARS-CoV-2 it is possible/likely that it will find a slightly broader readership.

      I have highly appropriate skills for evaluating this work being experienced in virology, SARS-CoV-2, cell biology and microscopy.

      We wish to thank Reviewer #1 for their comments which have helped us to improve the quality of our revised manuscript.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      BST2/tetherin can restrict the release and transmission of many enveloped viruses, including coronaviruses. In many cases, restricted viruses have developed mechanisms to abrogate tetherin-restriction by expressing proteins that antagonize tetherin; HIV-1 Vpu-mediated antagonism of tetherin restriction is a particularly well studied example. In this paper, Stewart et al. report their studies of the mechanism(s) underlying SARS-CoV-2 antagonism of tetherin restriction. They conclude that Orf3a is the primary virally encoded protein involved and that Orf3a manipulates endo-lysosomal trafficking to decrease tetherin cycling and divert the protein away from putative assembly sites.

      Major comments:- In my view some of the claims made by the authors are not fully supported by the data. For example, the bystander effect discussed in line 162 may suggest that infected cells can produce IFN but does not 'indicate' that they do

      This text has now been edited,

      ‘The levels of tetherin in uninfected HAE cells is lower than observed in uninfected neighbours in infected wells demonstrating that infected HAE cells are able to generate IFN to act upon uninfected neighbouring cells, enhancing tetherin expression.’ - (Lines 163-172).

      Most of the EM images show part of a cell profile, so statements such as (line 192) 'virus containing tubulovesicular organelles were often polarised towards sites of significant surface-associated virus' should be backed up with appropriate images, or indicated as 'not shown', or removed (the observation is not so important for this story). Line 196, DMVs can't be seen in these micrographs.

      The statement 'virus containing tubulovesicular organelles were often polarised towards sites of significant surface-associated virus' has been removed. The micrographs in Figure 1E have been re-cropped, and image iii replaced with an image showing DMVs and budding virions. Plasma membrane-associated virions are highlighted by black arrowheads, DMVs by black asterisks, and intracellular virion by a white arrow.

      Line 391, I can't see much change in CD63 distribution.

      CD63 reproducibly appears clustered towards the nuclei in ORF3a expressing cells, whilst CD63 positive puncta are abundant in the periphery of mock cells. CD63 puncta are also larger, and the staining of CIMPR and VPS35 also appears to be associated with larger organelles. We have amended the text to now read,

      ‘Expression of ORF3a also disrupted the distribution of numerous endosome-related markers including CIMPR, VPS35, CD63, which all localised to larger and less peripheral puncta (Supplemental Figure 6B), and the mixing of early and late endosomal markers’ - (Line 469).

      Quantification of the diameter of CD63 puncta indicate that they are larger in ORF3a expressing cells than in mock cells. Mock cells - 0.71μm (SD; 0.19), ORF3a - 1.15μm (SD;0.35). At least 75 organelles per sample, from 10 different cells. We have not included this data as we do not wish to labor this point but are happy to include this quantification if required to do so.

      Line 321, the authors show that ORF7a does not affect tetherin localization, abundance, glycosylation or dimer formation, but they don't show that it doesn't restrict SARS-CoV-2. Can they be sure that epitope tagging this molecule does not abrogate function (or the functions of any of the other tagged proteins for that matter), or that ORF7a works in conjunction with one of the other viral proteins?

      We are careful in the manuscript not to claim that ORF7a has no effect on tetherin. Our data indicate that ‘ORF7a does not directly influence tetherin localisation, abundance, glycosylation or dimer formation’ - (Line 361-362).

      We were unable to reproduce an effect of ORF7a on tetherin glycosylation. Our data conflicts with that presented by Taylor et al, 2015, where ORF7a impaired tetherin glycosylation and ORF7a localised to the plasma membrane in tetherin expressing cells. The experiments performed by Taylor et al used HEK293 cells and ectopically expressed tagged tetherin. The differences in results may be attributed to the differences between cell lines or due to differences between endogenous or ectopic / tagged tetherin.

      The study by Taylor et al uses SARS-CoV-1 ORF7a-HA from Kopecky-Bromberg et al., 2007 (DOI: 1128/JVI.01782-06), where the -HA tag is positioned at the C-terminus. Our ORF7a-FLAG constructs have a C-terminal epitope tag. While we cannot exclude the possibility that tagged proteins may act differently from untagged ones, the differences between our findings and previous work appear unlikely to be due to epitope tags.

      Our manuscript states that although we cannot find any effect of ORF7a on tetherin localisation, abundance, glycosylation, or dimer formation, we cannot exclude that ORF7a impacts tetherin by another mechanism. For example, ORF7a has been found to antagonise interferon responses. Tetherin is abundantly expressed in HeLa cells and expression does not require induction through interferon. None of our experiments above would be impacted by interferon antagonism yet this could impact other cell types besides infection in vivo. These possibilities may explain the reported differential impact of ORF7a by different labs. An addition comment has been added to the discussion to reflect this,

      ’We cannot exclude that ORF7a requires other viral proteins to antagonise tetherin, or that ORF7a antagonises tetherin via another mechanism. For example, ORF7a potently antagonises IFN signalling [38], which would impair tetherin induction in many cell types. - (Line 701-704).

      Note - Reference 38 has been added to the manuscript – Xia et al., Cell Reports DOI: 10.1016/j.celrep.2020.108234

      In the ORF screen, a number of the constructs are expressed at low level, is it possible they [the authors] are missing something?

      Some of the ORFs expressed in the miniscreen appear poorly expressed. We accept that in the use of epitope tagged constructs expression levels of individual viral proteins may impact upon a successful screen. However, this screen was performed to identify any potential changes in tetherin abundance or localisation, and the screen did successfully identify ORF3a, which we were able to follow-up and verify.

      Line 376, the authors refer to ORF3a being a viroporin. A recent eLife paper (doi: 10.7554/eLife.84477; initially published in BioRxiv) refutes this claim and builds on other evidence that ORF3a interacts with the HOPS complex. The authors should at least mention this work, especially in the discussion, as it would seem to provide a molecular mechanism to support their conclusions.

      This paper had not been peer reviewed at the time of our initial submission. We have now included the following text,

      ‘SARS-CoV-2 ORF3a is an accessory protein that localises to and perturbs endosomes and lysosomes [29]. It may do so by acting either as a viroporin [30] or by interacting with, and possibly interfering with the function of VPS 39, a component of the HOPS complex which facilitates tethering of late endosomes or autophagosomes with lysosomes [29,31]. Given ORF3a likely impairs lysosome function, the observed increased….’ - (Lines 444-449).

      Fig 3, the growth curves illustrated in Fig3 C and D do not have errors bars; how many times were these experiments repeated?

      These experiments require more repeats to include error bars. Infection and plaque assay (Figure 3C, 3D) are currently ongoing and we plan to complete them in the next 6-8 weeks and include them in the finalised manuscript.

      In the new experiments, infections will additionally be performed at MOI 0.01, in addition to the previous MOIs (1 and 5).

      Line 396, the authors show increased co-localization with LAMP1. As LAMP1 is found in late endosomes as well as lysosomes, they cannot claim the redistributed tetherin is specifically in lysosomes.

      We have altered the text to now say:

      ‘The ORF3a-mediated increase in tetherin abundance within endolysosomes could be due to defective lysosomal degradation.’ - (Line 475).

      There seems to be a marked difference in the anti-rb555 signal in the 'mock' cells in panels 5H and Suppl 6E. Is there a good reason for this, or does this indicate variability between experiments?

      Antibody uptake experiments in Figure 5H and Supp Figure 6E were performed and acquired on different days. Relatively low levels of signal are available in these antibody uptake experiments, and the disperse labelling seen in the mocks does not aid this.

      Fig 6a, why is there negligible VLP release from cells lacking BST2 and ORF3a-strep? How many times were these experiments performed? Is this a representative image? I think it confusing to refer to the same protein by two different names in the same figure (i.e. BST2 and tetherin). Do the authors know how the levels of ORF3a expressed in cells in these experiments compares to those seen in infected cells?

      We have changed the blot in Figure 6A for one with clearer FLAG bands. Three independent experiments were performed for Figure 6A. Quantification of VLPs is now included in Supplemental Figure 7B.

      We have changed ‘Bst2’ to ‘tetherin’ in all previous figures relating to protein; Figure 4G, Figure 6A, B, C.

      We have no current information to compare ORF3a levels in these experiments versus in infected cells. We can investigate quantifying this if necessary.

      My final point is, perhaps, the trickiest to answer, but nevertheless needs to be considered. As far as we know, SARS-CoV-2 and at least some other coronaviruses, bud into organelles of the early secretory pathway, often considered to be ERGIC. In the experiments shown here the authors provide evidence that ORF3a can influence tetherin recycling, but the main way of showing this is through its increased association with endocytic organelles. Do the authors have any evidence that Orf3a reduces tetherin levels in the ERGIC or whether the tetherin cycling pathway(s) involve the ERGIC?

      This is an interesting point, and as the reviewer concedes, this is tricky to answer. Expression of ORF3a causes the redistribution or remodeling of various organelles (Figures 1E, 2D, 2F, Supp Figures 2C, 2E, 3E, 6B, 6C, 6D). We have been unable to test the direct involvement of ERGIC, despite attempts with a number of commercial antibodies. Given the huge rearrangements of organelles during SARS-CoV-2 infection, it is unclear exactly what will happen to the distribution of ERGIC.

      Minor comments: Line 53, delete 'shell' its redundant and confusing when the authors have said coronaviruses have a membrane.

      Deleted.

      Line 61, delete 'the'

      Deleted.

      Line 72, delete 'enveloped'; coronaviruses already described as enveloped viruses (line 53)

      Deleted.

      Lines 93 - 100, lop-sided discussion of the viral life cycle; this paragraph is mostly about entry, which is not relevant to this paper, and does not really deal with the synthesis and assembly side of the cycle.

      We have now added the following text,

      ‘….liberating the viral nucleocapsid to the cytosol of the cell. Upon uncoating, the RNA genome is released into the host cytosol and replication-transcription complexes assemble to drive the replication of the viral genome and the expression of viral proteins. Coronaviruses modify host organelles to generate viral replication factories - so-called DMVs (double-membrane vesicles) that act as hubs for viral RNA synthesis [10]. SARS-CoV-2 viral budding occurs at ER-to-Golgi intermediate compartments (ERGIC) and newly formed viral particles traffic through secretory vesicles to the plasma membrane where they are released to the extracellular space.’ - (Lines 95-104).

      Line 103, why are the neighbouring cells 'naive'?

      ‘naïve’ removed.

      Line 112 - 113, delete last phrase; tetherin is described as an IFN stimulated gene in line 111; to be accurate, the beginning of the sentence should be 'Tetherin is expressed from a type 1 Interferon stimulated gene ...'

      Amended.

      Line 118 - 119, should say 'For tetherin-restricted enveloped viruses' as not all enveloped viruses are restricted by tetherin.

      Amended.

      Line 131, coronaviruses are not the only family of tetherin-restricted viruses that assemble on intracellular membranes, e.g. bunyaviruses.

      This has been modified and now reads,

      ‘In order for tetherin to tether coronaviruses, tetherin must be incorporated in the virus envelope during budding which occurs in intracellular organelles.’ - (Lines 133-135).

      Line 192, there is no EM data in Supplemental Fig 1C.

      This has now been removed.

      Line 251, 'a synchronous infection event' should be 'synchronous infection' as there will be multiple infection events.

      This has been changed.

      Page 13 (and elsewhere), unlike Southern, 'Western' should not have a capital letter, except at the start of a sentence.

      These have been updated throughout the manuscript (Lines 183, 341, 3549, 356, 392, 509, 763, 1330, 1399).

      Lines 330 and 352, can the authors quantitate S protein-induced reduction in cell surface tetherin rather than using the somewhat subjective 'mild'?

      These are now changed to,

      ‘Transient transfection of cells with ss-HA-Spike caused a 32% decrease in tetherin as observed by immunofluorescence (Supplemental Figure 4A, 4B), with…’ – (Line 370).

      ‘To explore whether the Spike-induced tetherin downregulation altered virus release, we performed experiments with virus like particles (VLPs) in HEK293T …’ – (Line 399).

      Line 379, OFR, should be ORF.

      Yes, changed.

      Line 448, 'Tetherin retains the ability' - did it ever loose it?

      This has been rephrased to,

      ‘Tetherin has the ability to restrict a number of different enveloped viruses that bud at distinct organelles.’ - (Line 547).

      Line 451, 'luminal' is confusing in this context.

      This has been modified to,

      ‘Tetherin forms homodimers between opposing membranes (e.g., plasma membrane and viral envelope) that are linked via disulphide bonds.’ - (Line 549).

      Line 453, the process of virus envelopment is likely to be more than a 'single step'

      This now reads,

      ‘…virus during viral budding, which occurs in modified ERGIC organelles.’ - (Line 552).

      Line 457, in my view the notion that Vpu abrogation of tetherin restriction is just due to redistribution of tetherin to the TGN is somewhat simplistic and disregards a lot of other work.

      We have removed mention of mechanisms of tetherin antagonism by other viruses. The key point we wish to make here is that tetherin is lost from the budding compartment. This now reads,

      ‘Many enveloped viruses antagonise tetherin by altering its localisation and removing it from the respective site of virus budding.’ – (Line 552-553).

      Line 472, what is meant by 'resting states'?

      This should have been ‘in the absence of stimulation’ and have now been re-written,

      ‘Tetherin is an IFN-stimulated gene (ISG) [13], and many cell types express low levels of tetherin in the absence of stimulation.’ - (Line 577).

      Line 1204, how were 'mock infected cells .......... infected'?

      This has now been re-written,

      ‘Differentiated nasal primary human airway epithelial (HAE) cells were embedded to OCT….’ - (Line 1385).

      Reviewer #2 (Significance (Required)):

      This study builds on published work supporting the notion that SARS-Cov-2 ORF3a is an antagonist for the restriction factor tetherin. Importantly, it provides insights to the the mechanism of ORF3a mediated tetherin antagonism, specifically to ORF3a inhibits tetherin cycling, diverting the protein to lysosomes and away from compartment(s) where virions assemble. Overall, the authors provide good supporting evidence for these conclusions, however there are issues that the authors need to address.

      We wish to thank Reviewer #2 for their insightful comments and suggestions for improving this work.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Restriction factors are major barriers against viral infections. A prime example is Tetherin (aka BST2), which is able to physically tether budding virions to the plasma membrane preventing release of the infectious particles. Of note, tetherin has broad anti-viral activity and has been established as a crucial innate immune defense factor against HIV, IAV, SARS-CoV-2 and other important human pathogens. However, successful viruses like SARS-CoV-2 evolved strategies to counteract restriction factors and promote their replication. Important restriction factors, such as tetherin, may often be targeted by multiple viral strategies to ensure complete suppression of their anti-viral activities by the pathogen. Of note, it was previously published that the accessory protein ORF7a of SARS-CoV-2 binds to (Petrosino et al, Chemistry Europe, 2021) and antagonizes it (Martin-Sancho et al, Molecular Cell, 2021). Previous data on SARS-CoV also revealed that ORF7a promotes cleavage of tetherin (Taylor et al, 2015, J Virol). In this manuscript, the authors show that tetherin restricts SARS-CoV-2 by tethering virions to the plasma membrane and propose that tetherin is targeted by two proteins of SARS-CoV-2. Whereas the Spike protein promotes degradation of tetherin, the accessory protein ORF3a redirects tetherin away from newly forming SARS-CoV-2 virions. While the overall findings that both S and ORF3a are additionally targeting tetherin is both novel and intriguing, additional evidence is needed to support this. In addition, the authors show that in their experimental setups ORF7a does not induce cleavage of tetherin. This is in direct contrast to previously published data both on SARS-CoV(-1) and -2 (Taylor et al, 2015, J Virol; Petrosino et al, Chemistry Europe, 2021; Martin-Sancho et al, Molecular Cell, 2021). From my point of view that needs further experimental confirmation. While the authors state that the impact of Spike on tethrin is mild, the experiments should still allow the conclusion whether there is a (mild) effect or not. The mechanism of ORF3a is fortunately more robustly assessed and provides some novel insights. Unfortunately, the whole manuscript suffers from a striking lack of quantifications. In addition, it is not clear whether and how many times experiments were repeated to the same results. Overall, the data in this manuscript seem very speculative and preliminary and thus do not support the authors conclusions.

      Major:

      Much of the data seems like it was only done once. As I am sure that this is a writing issue, please clearly state how many times the individual assays were repeated, provide the quantification graphs and appropriate statistics. Some experiments may need additional quantification and confirmation by other methods to be convincing.

      Quantification is provided throughout the revised manuscript. Figure legends have also been updated to provide information on quantification and statistical analysis.

      For example, Figure 1A, C and D: Please quantify the levels of tetherin and use an alternative readout, e.g. Western blotting of infected cells.

      Quantification has been performed and included in our revised manuscript in Supplemental Figures 1C, 1E. Tetherin is not shown in Figure 1C.

      A table is provided (above) to highlight the additional quantification.

      Figure 2A: Please quantify.

      We are not sure we understand this point. The western blot shown in Figure 2A demonstrates the ectopic expression of ACE2 in our A549 cell line. A549 cells have been used by many labs to study SARS-CoV-2 infection, but express negligible ACE2.

      Fig 3A: Please show and confirm successful tetherin KO in the cell lines that are used not only in microscopy.

      A new blot is now shown in Figure 3A, including a blot demonstrating tetherin loss in both KO lines.

      Figure 4C: Please quantify

      Currently flow cytometry experiments have been performed twice each and this is now detailed in the figure legends. The data shown in each panel is representative and the data has been explored using analogous approaches. For example, Figure 4C is complemented by Figures 4A and 4B, Figures 4E is complemented by 4D and 4F. We do not feel that repeating these flow cytometry analysis will significantly improve the manuscript.

      Figure 4D: Please quantify the effects are not obvious from the images provided.

      Quantification is now provided in Supplemental Figure 4E.

      Figure 4E, F Please provide a quantification of multiple independent repeats, the claimed differences are neither striking nor obvious.

      Quantification of 4F is now provided in Supplemental Figure 4G. Tetherin levels were quantified to be reduced by 25% (SD: 8%) by addition of Doxycycline and induction of ss-HA-Spike. Information for quantification is provided in figure legends.

      Figure 5A: Please quantify

      These experiments have currently been performed twice and this is now described in the figure legends. Data shown is representative. We can perform one more repeat of these experiments to quantify if neccessary, but do not feel it will significantly alter the manuscript.

      Figure 3C and D: At timepoint 0 the infection input levels are different. The initial infection levels have to be the same to draw the conclusion that tetherin KO affects virion release and not the initial infection efficiency. Can the authors either normalize or ensure that the initial infection is the same in all conditions and that variations in the initial infection efficiency do not correlated with the impact of tetherin on replication/release ? How often were those experiments repeated? Are the marginal differences in infectious titre significant? Overall the impact of tetherin on SARS-CoV-2 is very underwhelming but that may be due to efficient viral tetherin-counteraction strategies. Why is the phenotype inverted at 72 h?

      Equal amounts of virus, as measured by plaque-forming units (PFU), were used for both HeLa cell lines and thus at 0 hpi the variation seen is within the parameters of the assay used. It remains possible that tetherin affects virus entry but this is unlikely and this assay was not designed to investigate that effect.

      Growth curve assays are currently being repeated using an MOI of 0.01, 1 and 5. We are removing the 72 hpi sample from future experiments. At this time point, we find that the extensive cell death caused by viral replication (especially at higher MOIs) makes it difficult to accurately separate the released from intracellular fractions and conclusions cannot be accurately drawn from the data.

      Additional repeats of these experiments are in progress and will be included in the finalised manuscript.

      Figure 4B and C: Can the authors provide an explanation why SARS-CoV ORF7a is not inducing cleavage/removes glycosylation of tetherin. To show that the assays work, an independent positive control needs to be included. The FACS data in C is unfortunately not quantified.

      See above comments (Reviewer #2) regarding discussion on ORF7a. Additional text has been included to discuss ORF7a data,

      ‘SARS-CoV-1 ORF7a is reported to inhibit tetherin glycosylation and localise to the plasma membrane in the presence of tetherin [18]. We did not observe any difference in total tetherin levels, tetherin glycosylation, ability to form dimers, or surface tetherin upon expression of either SARS-CoV-1 or SARS-CoV-2 ORF7a (Figures 4A, 4B, 4C).

      Others groups have demonstrated a role for ORF7a in sarbecovirus infection and both SARS-CoV-1 and SARS-CoV-2 virus lacking ORF7a show impaired virus replication in the presence of tetherin [18,41]. A direct interaction between SARS-CoV-1 ORF7a and SARS-CoV-2 ORF7a and tetherin have been described [18,41], although the precise mechanism(s) by which ORF7a antagonises tetherin remains enigmatic. We cannot exclude that ORF7a requires other viral proteins to antagonise tetherin, or that ORF7a antagonises tetherin via another mechanism. For example, ORF7a can potently antagonise IFN signalling [42] which would impair tetherin induction in many cell types.’ – (Line 667-704).

      Fig 4G: The rationale and result of this experiment are not clear.

      The rationale for Spike VLP experiments is explained at Line 403. Given that Spike caused a reproducible decrease in cellular tetherin, we examined whether this downregulation was sufficient to antagonise tetherin and increase VLP yield.

      Fig 6: What is the benefit of doing the VLP assays as opposed to genuine virus experiments? To me it rather seems to be making the data unnecessarily complex. Again, no quantifications or repeats are provided.

      VLPs are used to separate the budding and release process from the replication process of RNA viruses. VLPs have been used in a number of SARS-CoV (DOI: 1002/jmv.25518) and HIV-1 (DOI: https://doi.org/10.1186/1742-4690-7-51) studies to analyse the impact of tetherin (and tetherin mutants) on release.

      VLP experiment quantification are now included throughout.

      Minor: Fig 1D: How do the authors explain the mainly intracellular Spike staining?

      We do not understand this point. Spike staining is intracellular, whether expressed alone or in the context of infected cells.

      Please add statistical analyses on the data e.g. Fig. 3 C and D

      Additional repeats of these experiments are in progress and will be included in the finalised manuscript.

      Fig. 4B and F: Why do the annotated sizes of tetherin differ between the blots?

      Figures 4B and 4F are run in non-reduced and reduced conditions respectively. In order to best show the dimer deficient C3A-Tetherin, blots are typically run in non-reduced conditions to exemplify dimer formation and to highlight any defects in dimer formation. The rest of the blots in the manuscript are run in denaturing conditions to aid blotting of other proteins. (Lines 957-958) and now (Lines 1356-1357).

      Fig. 5A: What is ORF6a? Do the authors mean ORF6?

      Yes, this has been changed.

      An MOI of 1 is NOT considered a low or relevant MOI. Can the authors either rephrase or repeat experiments with an actual low or relevant MOI i.e. 0.01 ?

      We are currently repeating these experiments and are including MOIs of 0.01, 1 and 5.

      Why were the cell models switched between Figure 1 and 2 and essentially the same experiments repeated?

      HeLa cells express high levels of tetherin at steady state, whilst A549 cells require IFN stimulation. HeLa cells demonstrate that tetherin downregulation occurs via an IFN-independent manner. A549 and T84 cells are more physiologically relevant cell types for SARS-CoV-2 infection. These points are stated in Lines 230 and 261.

      The manuscript may benefit a lot from streamlining and removing unessential deviations from the main message (e.g. discussions why multistep/single step growth curves are used/not relevant; why are they shown if the authors conclude that a single step is not relevant?). The discussion is extremely lengthy and does not provide sufficient discussion of the presented data.

      The multistep/single step growth curve text will be adapted, but it will be re-written after additional infection experiments.

      We have removed from the Discussion a small section discussing ORF7a mutants, given that the emphasis of our manuscript is not on ORF7a.

      We have also removed a small section describing the rearrangements of intracellular organelles by SARS-CoV-2 as it does not directly relate to the central message of our manuscript.

      According to my opinion, the current manuscript does not provide significant advancement for the field. While the intention was to update and expand our existing knowledge about tetherin restriction by SARS-CoV-2, the experiments do not support this yet. However, the general premise and approach/concept of the manuscript would be appealing to a broader audience. I especially like the notion that multiple proteins of SARS-CoV-2 could synergistically counteract an important innate immune defense factor, tetherin. My expertise is on SARS-CoV-2 and the interplay between the virus and host cell restriction factors.

      Reviewer #3 (Significance (Required)):

      According to my opinion, the current manuscript does not provide significant advancement for the field. While the intention was to update and expand our existing knowledge about tetherin restriction by SARS-CoV-2, the experiments do not support this yet. However, the general premise and approach/concept of the manuscript would be appealing to a broader audience. I especially like the notion that multiple proteins of SARS-CoV-2 could synergistically counteract an important innate immune defense factor, tetherin. My expertise is on SARS-CoV-2 and the interplay between the virus and host cell restriction factors.

      We thank Reviewer#3 for their comments and suggestions for improving this work.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Restriction factors are major barriers against viral infections. A prime example is Tetherin (aka BST2), which is able to physically tether budding virions to the plasma membrane preventing release of the infectious particles. Of note, tetherin has broad anti-viral activity and has been established as a crucial innate immune defense factor against HIV, IAV, SARS-CoV-2 and other important human pathogens. However, successful viruses like SARS-CoV-2 evolved strategies to counteract restriction factors and promote their replication. Important restriction factors, such as tetherin, may often be targeted by multiple viral strategies to ensure complete suppression of their anti-viral activities by the pathogen. Of note, it was previously published that the accessory protein ORF7a of SARS-CoV-2 binds to (Petrosino et al, Chemistry Europe, 2021) and antagonizes it (Martin-Sancho et al, Molecular Cell, 2021). Previous data on SARS-CoV also revealed that ORF7a promotes cleavage of tetherin (Taylor et al, 2015, J Virol).

      In this manuscript, the authors show that tetherin restricts SARS-CoV-2 by tethering virions to the plasma membrane and propose that tetherin is targeted by two proteins of SARS-CoV-2. Whereas the Spike protein promotes degradation of tetherin, the accessory protein ORF3a redirects tetherin away from newly forming SARS-CoV-2 virions.

      While the overall findings that both S and ORF3a are additionally targeting tetherin is both novel and intriguing, additional evidence is needed to support this. In addition, the authors show that in their experimental setups ORF7a does not induce cleavage of tetherin. This is in direct contrast to previously published data both on SARS-CoV(-1) and -2 (Taylor et al, 2015, J Virol; Petrosino et al, Chemistry Europe, 2021; Martin-Sancho et al, Molecular Cell, 2021). From my point of view that needs further experimental confirmation. While the authors state that the impact of Spike on tethrin is mild, the experiments should still allow the conclusion whether there is a (mild) effect or not. The mechanism of ORF3a is fortunately more robustly assessed and provides some novel insights. Unfortunately, the whole manuscript suffers from a striking lack of quantifications. In addition, it is not clear whether and how many times experiments were repeated to the same results. Overall, the data in this manuscript seem very speculative and preliminary and thus do not support the authors conclusions.

      Major

      Much of the data seems like it was only done once. As I am sure that this is a writing issue, please clearly state how many times the individual assays were repeated, provide the quantification graphs and appropriate statistics. Some experiments may need additional quantification and confirmation by other methods to be convincing. For example, Figure 1A, C and D: Please quantify the levels of tetherin and use an alternative readout, e.g. Western blotting of infected cells. Figure 2A: Please quantify. Fig 3A: Please show and confirm successful tetherin KO in the cell lines that are used not only in microscopy. Figure 4C: Please quantify. Figure 4D: Please quantify the effects are not obvious from the images provided. Figure 4E,F Please provide a quantification of multiple independent repeats, the claimed differences are neither striking nor obvious. Figure 5A: Please quantify.

      Figure 3C and D: At timepoint 0 the infection input levels are different. The initial infection levels have to be the same to draw the conclusion that tetherin KO affects virion release and not the initial infection efficiency. Can the authors either normalize or ensure that the initial infection is the same in all conditions and that variations in the initial infection efficiency do not correlated with the impact of tetherin on replication/release ? How often were those experiments repeated? Are the marginal differences in infectious titre significant? Overall the impact of tetherin on SARS-CoV-2 is very underwhelming but that may be due to efficient viral tetherin-counteraction strategies. Why is the phenotype inverted at 72 h? Figure 4B and C: Can the authors provide an explanation why SARS-CoV ORF7a is not inducing cleavage/removes glycosylation of tetherin. To show that the assays work, an independent positive control needs to be included. The FACS data in C is unfortunately not quantified.

      Fig 4G: The rationale and result of this experiment are not clear.

      Fig 6: What is the benefit of doing the VLP assays as opposed to genuine virus experiments? To me it rather seems to be making the data unnecessarily complex. Again, no quantifications or repeats are provided.

      Minor

      Fig 1D: How do the authors explain the mainly intracellular Spike staining?

      Please add statistical analyses on the data e.g. Fig. 3 C and D

      Fig. 4B and F: Why do the annotated sizes of tetherin differ between the blots?

      Fig. 5A: What is ORF6a? Do the authors mean ORF6?

      An MOI of 1 is NOT considered a low or relevant MOI. Can the authors either rephrase or repeat experiments with an actual low or relevant MOI i.e. 0.01 ?

      Why were the cell models switched between Figure 1 and 2 and essentially the same experiments repeated? The manuscript may benefit a lot from streamlining and removing unessential deviations from the main message (e.g. discussions why multistep/single step growth curves are used/not relevant; why are they shown if the authors conclude that a single step is not relevant?). The discussion is extremely lengthy and does not provide sufficient discussion of the presented data.

      According to my opinion, the current manuscript does not provide significant advancement for the field. While the intention was to update and expand our existing knowledge about tetherin restriction by SARS-CoV-2, the experiments do not support this yet. However, the general premise and approach/concept of the manuscript would be appealing to a broader audience. I especially like the notion that multiple proteins of SARS-CoV-2 could synergistically counteract an important innate immune defense factor, tetherin. My expertise is on SARS-CoV-2 and the interplay between the virus and host cell restriction factors.

      Significance

      According to my opinion, the current manuscript does not provide significant advancement for the field. While the intention was to update and expand our existing knowledge about tetherin restriction by SARS-CoV-2, the experiments do not support this yet. However, the general premise and approach/concept of the manuscript would be appealing to a broader audience. I especially like the notion that multiple proteins of SARS-CoV-2 could synergistically counteract an important innate immune defense factor, tetherin.

      My expertise is on SARS-CoV-2 and the interplay between the virus and host cell restriction factors.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      BST2/tetherin can restrict the release and transmission of many enveloped viruses, including coronaviruses. In many cases, restricted viruses have developed mechanisms to abrogate tetherin-restriction by expressing proteins that antagonize tetherin; HIV-1 Vpu-mediated antagonism of tetherin restriction is a particularly well studied example. In this paper, Stewart et al. report their studies of the mechanism(s) underlying SARS-CoV-2 antagonism of tetherin restriction. They conclude that Orf3a is the primary virally encoded protein involved and that Orf3a manipulates endo-lysosomal trafficking to decrease tetherin cycling and divert the protein away from putative assembly sites.

      Major comments:

      In my view some of the claims made by the authors are not fully supported by the data. For example, the bystander effect discussed in line 162 may suggest that infected cells can produce IFN but does not 'indicate' that they do. Most of the EM images show part of a cell profile, so statements such as (line 192) 'virus containing tubulovesicular organelles were often polarised towards sites of significant surface-associated virus' should be backed up with appropriate images, or indicated as 'not shown', or removed (the observation is not so important for this story). Line 196, DMVs can't be seen in these micrographs. Line 391, I can't see much change in CD63 distribution.

      Line 321, the authors show that ORF7a does not affect tetherin localization, abundance, glycosylation or dimer formation, but they don't show that it doesn't restrict SARS-CoV-2. Can they be sure that epitope tagging this molecule does not abrogate function (or the functions of any of the other tagged proteins for that matter), or that ORF7a works in conjunction with one of the other viral proteins? In the ORF screen, a number of the constructs are expressed at low level, is it possible they are missing something?

      Line 376, the authors refer to ORF3a being a viroporin. A recent eLife paper (doi: 10.7554/eLife.84477; initially published in BioRxiv) refutes this claim and builds on other evidence that ORF3a interacts with the HOPS complex. The authors should at least mention this work, especially in the discussion, as it would seem to provide a molecular mechanism to support their conclusions.

      Fig 3, the growth curves illustrated in Fig3 C and D do not have errors bars; how many times were these experiments repeated?

      Line 396, the authors show increased co-localization with LAMP1. As LAMP1 is found in late endosomes as well as lysosomes, they cannot claim the redistributed tetherin is specifically in lysosomes.

      There seems to be a marked difference in the anti-rb555 signal in the 'mock' cells in panels 5H and Suppl 6E. Is there a good reason for this, or does this indicate variability between experiments?

      Fig 6a, why is there negligible VLP release from cells lacking BST2 and ORF3a-strep? How many times were these experiments performed? Is this a representative image? I think it confusing to refer to the same protein by two different names in the same figure (i.e. BST2 and tetherin). Do the authors know how the levels of ORF3a expressed in cells in these experiments compares to those seen in infected cells?

      My final point is, perhaps, the trickiest to answer, but nevertheless needs to be considered. As far as we know, SARS-CoV-2 and at least some other coronaviruses, bud into organelles of the early secretory pathway, often considered to be ERGIC. In the experiments shown here the authors provide evidence that ORF3a can influence tetherin recycling, but the main way of showing this is through its increased association with endocytic organelles. Do the authors have any evidence that Orf3a reduces tetherin levels in the ERGIC or whether the tetherin cycling pathway(s) involve the ERGIC?

      Minor comments:

      Overall, the manuscript should be carefully edited to ensure the text reads clearly. A few examples of thing that need to be fixed are:-

      Line 53, delete 'shell' its redundant and confusing when the authors have said coronaviruses have a membrane.

      Line 61, delete 'the'

      Line 72, delete 'enveloped'; coronaviruses already described as enveloped viruses (line 53)

      Lines 93 - 100, lop-sided discussion of the viral life cycle; this paragraph is mostly about entry, which is not relevant to this paper, and does not really deal with the synthesis and assembly side of the cycle.

      Line 103, why are the neighbouring cells 'naive'?

      Line 112 - 113, delete last phrase; tetherin is described as an IFN stimulated gene in line 111; to be accurate, the beginning of the sentence should be 'Tetherin is expressed from a type 1 Interferon stimulated gene ...'

      Line 118 - 119, should say 'For tetherin-restricted enveloped viruses' as not all enveloped viruses are restricted by tetherin.

      Line 131, coronaviruses are not the only family of tetherin-restricted viruses that assemble on intracellular membranes, e.g. bunyaviruses.

      Line 192, there is no EM data in Supplemental Fig 1C.

      Line 251, 'a synchronous infection event' should be 'synchronous infection' as there will be multiple infection events

      Page 13 (and elsewhere), unlike Southern, 'Western' should not have a capital letter, except at the start of a sentence.

      Lines 330 and 352, can the authors quantitate S protein-induced reduction in cell surface tetherin rather than using the somewhat subjective 'mild'?

      Line 379, OFR, should be ORF.

      Line 448, 'Tetherin retains the ability' - did it ever loose it?

      Line 451, 'luminal' is confusing in this context.

      Line 453, the process of virus envelopment is likely to be more than a 'single step'

      Line 457, in my view the notion that Vpu abrogation of tetherin restriction is just due to redistribution of tetherin to the TGN is somewhat simplistic and disregards a lot of other work.

      Line 472, what is meant by 'resting states'?

      Line 1204, how were 'mock infected cells .......... infected'?

      Significance

      This study builds on published work supporting the notion that SARS-Cov-2 ORF3a is an antagonist for the restriction factor tetherin. Importantly, it provides insights to the the mechanism of ORF3a mediated tetherin antagonism, specifically to ORF3a inhibits tetherin cycling, diverting the protein to lysosomes and away from compartment(s) where virions assemble. Overall, the authors provide good supporting evidence for these conclusions, however there are issues that the authors need to address.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      I summarise the major findings of the work below. In my opinion the range and application of approaches has provided a broad evidence base that, in general, supports the authors conclusions. However, there are, in my opinion, particular failures to utilise and communicate this evidence. The manuscript may be much improved with attention in the following areas. In each case I will give general criticism with a few examples, but the principals of my comments could be applied throughout the work.

      1. Insufficient quantification. The investigation combines various sources of qualitative data (EM, fluorescence microscopy, western blotting) to generate a reasonably strong evidence base. However, the work is over-reliant on representative images and should include more quantification from repeat experiments. When there are multiple fluorescence micrographs with intensity changes (not necessarily just representative images) (e.g. Figure 1 or 2) the authors should consider making measurements of these. Also the VLP production assays, which are assessed by western blotting would particularly benefit from a quantitative assessment (either by densitometry or, if samples remain, ELISA/similar approach).
      2. Insufficient explanation. I found some of the images and legends contained insufficient annotation and/or description for a non-expert reader to appreciate the result(s). Particularly if the authors want to draw attention to features in micrographs they should consider using more enlarged/inset images and annotations (e.g. arrows) to point out structures (e.g DMVs etc.). This short coming exacerbates the lack of quantification.
      3. Insufficient exploration of the data. I had a sense that some aspects of the data seem unconsidered or ignored, and the discussion lacks depth and reflection. For example the tetherin down-regulation apparent in Figures 1 and 2 is not really explained by the spike/ORF3a antagonism described later on, but this is not explicitly addressed. Also, Figure 6 suggests that ORF3a results in high levels of incorporation of tetherin in to VLPs, but I don't think this is even described(?). The discussion should also include more comparison with previous studies on the relationship between SARS-2 and tetherin.

      I have no minor comments on this draft of the manuscript.

      Significance

      Tetherin, encoded by the BST2 gene, is an antiviral restriction factor that inhibits the release of enveloped viruses by creating tethers between viral and host membranes. It also has a capacity for sensing and signalling viral infection. It is most widely understood in the context of HIV-1, however, there is evidence of restriction in a wide variety of enveloped viruses, many of which have evolved strategies for antagonising tetherin. This knowledge informs on viral interactions with the innate immune system, with implications for basic virology and translational research.

      This study investigates tetherin in the context of SARS-CoV-2. The authors use a powerful collection of tools (live virus, gene knock out cells, recombinant viral and host expression systems) and a variety of approaches (microscopy, western blotting, infection assays), which is, itself, a strength. The study provides evidence to support a series of conclusions: I) BST2/tetherin restricts SARS-CoV-2 II) SARS-CoV-2 ablates tetherin expression III) spike protein can modestly down-regulate tetherin IV) ORF3A dysregulates tetherin localisation by altering retrograde trafficking. These conclusions are broadly supported by the data and this study make significant contributions to our understanding of SARS-CoV-2/tetherin interactions.

      My enthusiasm is reduced by, in my opinion, a failure of the authors to fully quantify, explain and explore their data. I expect the manuscript could be significantly improved without further experimentation by strengthening these aspects.

      This manuscript will be of interest to investigators in virology and/or cellular intrinsic immunity. Given the focus on SARS-CoV-2 it is possible/likely that it will find a slightly broader readership.

      I have highly appropriate skills for evaluating this work being experienced in virology, SARS-CoV-2, cell biology and microscopy.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their enthusiasm for our work and constructive feedback.

      Below please find our point-by-point response to the comments:

      Reviewer #1 -Key conclusions that were less convincing: -RhoA and NMII are in the title as mechanistic downstream regulators of CaM, but the results in Fig 8 call into question the role of RhoA. Why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wt phenotype? The role of NMII is also not clear - why does overexpressing MLCK-CA not have a phenotype but overexpressing MLCK downstream target MRLC show the phenotype? Are there any alternative pathways to regulate MRLC? It's not being discussed or described in 6D's schematic.

      Response: Rho activation usually leads to the formation of more stress fibers and therefore does not lead to decreased cell size and increased circularity observed in MFN2 KO. The phenotype is restored by either ROCK or MLCK knockdown. We have discussed in the main text that the formation of PAB requires both RhoA and NMII activation under restricted spatiotemporal control.

      MRLC has three major regulators (Ikebe & Hartshorne, 1985; Isotani et al., 2004). As we discussed, MLCK and ROCK phosphorylate MRLC at either Ser19 or Ser19 and Thr18. MRLC is dephosphorylated and inactivated by its phosphatase MLCP. We tried to knock down MLCP in wt MEF cells but failed to see any cell morphology changes (data not shown).

      We were also surprised to see MRLC-GFP overexpression with Rho Activator can phenocopy PAB, but “MLCK-CA + Rho Activator” failed to. We believe it is because MLCK-CA constitutively over-activates a broad range of downstream effectors while overexpressing MRLC mimics endogenous activation or NMII alone. Also, only a proportion of cells acquired PAB structure under Rho Activator and MRLC overexpression, which indicates PAB formation also requires specific spatiotemporal controls.

      *Rewrite for clarity -The role of ER/mito contacts in the system was unclear (since ER/mito contacts were not observed nor evaluated directly). *

      __Response: __We have included additional data to measure ER/mito contacts in MEFs. Our result is consistent with numerous previous reports that MFN2 regulates ER/mito contacts. The data is now included in Fig. S3.

      * -What role does focal adhesions have on PAB formation or any part of the model - There were results showing larger focal adhesions in the MFN2-/- cells, but not sure how this fits in with the bigger picture of contractility and PABs, and focal adhesions were not in the model in Figure 5.*

      __Response: __Focal adhesion and actomyosin are tightly coupled, and our work focuses on the actin network. Our model did not include FAs since FA is not a significant focus in this study.

      * -Whether regulating calcium impacts PAB formation*

      __Response: __Calcium likely regulates PAB formation. We have shown PAB cell percentage decreases in mfn2-/- with ER-mito tethering contrast in Fig. S3.

      -The role of PABs in migration is also unclear - can you affect PAB formation or get rid of PABs and quantify cell migration?

      __Response: __Our data suggest that PAB formation and cell migration are inversely correlated. Since PAB results from a contractile actin band on the cell periphery, its role in defective cell spreading and migration is expected. We demonstrated that MLCK and ROCK knockdown reduced PABs and rescued cell spreading.

      -It was hard to understand the correlation between the membrane tension of MFN2-/- cells and their ability to spread on softer substrates. How does this result fit in with the overarching model?

      __Response: __Reduced membrane tension is presumably associated with decreased cell spreading. Softer substrates attenuate the mechanical force on focal adhesion proteins and the actin cytoskeleton (Burridge & Chrzanowska-Wodnicka, 2003; Pelham & Wang, 1997; Wong et al., 2015), which is required for focal adhesion maturation. As a result, softer substrates can reduce the over-contraction in the MFN2 KO cells. The results support the model that MFN2 KO cells have enhanced cell contraction on the substrates dependent on substrate interaction and force transduction on focal adhesions. Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      __Response: __We have removed the MFN2-related disease from the introduction to focus the paper more on cell biology in vitro.

      *-There were a number of findings that did not seem to fit in with the paper, or they were included, but were not robustly described nor quantified. As an example, Paxillin-positive focal adhesions were evaluated in MFN2-/- and with various pharmacological approaches, but there is no quantification with respect to size, number, or distribution of focal adhesions, despite language in the main text that there are differences between conditions. *

      __Response: __We have quantified the focal adhesions in the KO cells, and the data is now included in Fig. 5. We used the actin distribution to quantify the “PAB”; therefore, FAs are not a significant focus of this study.

      *Also, the model was presented in figure 5, and then there were several pieces of data presented afterward, some that are included in the model (myosin regulation), and some that are not in the model (membrane tension, TFM, substrate stiffness, etc). * __Response: __Membrane tension and substrate stiffness dependence are physical properties of the cell. The model focuses on the molecular mechanism that leads to PAB formation.

      The stiffness/tension figure was not clear to me, and it was difficult to make sense of the data since one would predict that an increase in actomyosin contractility at the cortex would lead to higher membrane tension, not lower, and then how membrane tension relates to spreading on soft matrices is also unclear.

      __Response: __The result was surprising to us initially. However, the MFN2 KO cells have increased actomyosin contractility only at the cell-substrate interface but not throughout the entire cell cortex. A less spread cell would have a more relaxed membrane and display a lower membrane tension, consistent with our observation. Softer matrices reduce cell contractility at the cell-substrate interface, which allows MFN2 KO cells to relax and spread better. We have emphasized in the discussion of our manuscript that MFN2 KO cells have an increase in actomyosin contractility only at the cell-substrate interface.

      The manuscript seems like an amalgamation of different pieces of data that do not necessarily fit together into a cohesive story, so the authors are encouraged to either remove these data, or shore them up and weave them into the narrative.

      __Response: __We respectfully disagree with the reviewer since the cell morphology, actin structure, substrate interaction, and cell mechanics are tightly correlative and provide a complete picture of the role of MFN2 in regulating cell behavior.

      * Request additional experiments 1. -The imaging used for a lot of the quantification (migration, circularity) is difficult to resolve. The cells often look like they are not imaged in the correct imaging plane. It would be helpful to have better representative images such that it is clear how the cells were tracked and how cell periphery regions of interest were manually drawn. Focal adhesions should also be shown without thresholding.*

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      2. -For most of the quantification, it appears that the experiment was only performed once and that a handful of cells were quantified. The figure legend indicates the number of cells (often reported as >12 cells or >25 cells), but the methods indicate that high content imaging was performed, and so the interpretation is that these experiments were only performed once. Biological replicates are required. If the data do represent at least 3 biological replicates, then more cell quantification is required (12 or 25 cells in total would mean quantifying a small number of cells per replicate).

      Response: __We quantified more cells and indicated the number of cells quantified in the figure legends. The experiments are with three biological replicates.__

      * 3. -Mitochondrial morphology and quantification should be performed in the MFN2 knockdown and rescue lines.*

      __Response: __Mitochondrial morphology is well characterized in the Mfn2 KO and rescue MEF cells (Chen et al., 2003; Naon et al., 2016; Samanas et al., 2020). We observed a similar phenotype using mito-RFP to label mitochondrial structure (Fig. S1).

      4.-Many of the comparisons throughout the figures is between MFN2 knockdown and MFN2 knockdown plus rescue or genetic/pharmacological approaches, but a comparison that is rarely made is between wildtype and experimental. These comparisons could be useful in comparing partial rescues and potential redundancies with the other mitofusin.

      Response: We have included the WT in our assays (Fig. 2-6). We also confirmed that MFN1 could not rescue the MFN2 defects (Fig. 2). We observed partial and complete rescue in different assays. It would be difficult to conclude whether the phenotype is due to the redundancies with the other mitofusin because not all cells are rescued at the endogenous level.

      * 5. -For the mito/ER tethering experiments, it is important to show that ER/mito contacts are formed and not formed in the various conditions with imaging approaches.*

      __Response: __We adopted a previously established method to quantify ER-mitochondria contacts with the probe SPLICSL (Cieri et al., 2017; Vallese et al., 2020). Our results align with previous reports that Mfn2-null MEFs displayed significantly decreased ER-mitochondria contacts. MFN2 re-expression or ER-mitochondria tethering structure restored the contacts. (Fig. S3).

      * 6. -For some of the pharmacological perturbations, it would be helpful to show that the perturbation actually led to the expected phenotype - as an example, in cells treated with different concentrations of A23187, what are the intracellular calcium levels and how do these treatments influence PAB formation? This aspect should be generally applied across the study - when a modification is made, that particular phenotype should first be evaluated, before dissecting how the perturbation affects downstream phenotypes.*

      __Response: __We selected a collection of well-characterized inhibitors broadly used in the literature for pharmacological perturbations. For example, numerous studies used A23187 treatment to raise intracellular calcium to examine related actin cytoskeleton changes (Carson et al., 1994; Goldfine et al., 1981; Shao et al., 2015). We titrated the drugs in WT in preliminary experiments and observed similar phenotypes. (data not shown). We then use the same concentration to treat the MFN2 KO cells. Overall, we use pharmacological perturbations as supporting evidence. We use genetics (knockdown or overexpression) to validate our results.

      7. -In Figures 4 and 5, the thresholding approaches in the images make the focal adhesions difficult to resolve, and therefore it is difficult to determine the size. As described above, these metrics should be defined and quantified.

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      8. -What is a PAB? How is it defined? What metrics make a structure a PAB versus regular cortical actin - are there quantifiable metrics? In figure 8, there are some structures that are labelled as a PAB, but some aren't (as an example, the left panel in 8b is a PAB, but the right panel in 8A is not, but they look the same), so a PAB should be defined with quantifiable measures, and then applied to the entire study.

      __Response: __We developed an algorism to quantify PAB cells. We first used the ImageJ plugin FiloQuant (Jacquemet et al., 2019) to identify the cell border and cytoskeleton, then used our custom algorism to quantify the percentage of actin in the cell border area. The cellular circularity is also calculated at the same time. If the cell contains more than 50% actin in the cell border area, and the circularity is higher than 0.6, we then count it as a “PAB” cell (Fig. S2).

      -As described above, why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wildtype phenotype?

      __Response: __Rho activation usually leads to the formation of more stress fibers and therefore does not lead to decreased cell size and increased circularity observed in MFN2 KO.

      We are sorry that we don’t understand the rationale of this experiment proposed by the reviewer. ROCK inhibition restored the wildtype phenotype in MFN2 KO cells (Fig.7). Figure 8 is to create the MFN2 KO phenotype in WT cells, which requires both Rho and MRLC overactivation.

      * 10 Are the data and the methods presented in such a way that they can be reproduced? -We appreciate that the authors quantified many parameters, although some quantifications were missing. There are some missing methods - how was directionality quantified, was migration quantified by selecting the approximate center of cells using MTrackJ or were centroids quantified by outlining cells, for instance. Also, given that some of the phenotypes were somewhat arbitrarily assigned (ie. what constitutes a PAB?), it may be difficult to reproduce these approaches and interpret data appropriately.*

      __Response: __We have clarified directionality quantification methods and other details. We used MTrackJ to track cell migration. And as we mentioned above, we came up with a customized algorithm to quantify PAB cells, which shows the critical effectors in a more quantifiable way.

      * 11. Are the experiments adequately replicated and statistical analysis adequate? -Unfortunately, while the approximate number of cells was reported, the number of biological replicates were not reported, and therefore, the experimental information and statistical analyses are not adequate.*

      __Response: __We have quantified more cells and indicated the number of repeats and cells quantified in the figure legend. Minor comments: Specific experimental issues that are easily addressable.

      * 12. - for some of the graphs - mostly about calcium levels - fold change is shown, but raw values should also be included to determine whether the basal levels of calcium are different across the conditions.*

      __Response: __Delta F/F0 is the standard method to normalize dye loading in cells for calcium concentration measurements (Kijlstra et al., 2015; Zhou et al., 2021).

      13. - scale bars in every panel should also help make the points clearer.

      __Response: __We have added scale bars in all panels.

      * Reviewer #2 (Evidence, reproducibility and clarity (Required)): 1. Fig. 1A: The Mfn1 Western Blot is not of publication quality. Moreover, quantitation is necessary.*

      __Response: __We performed additional western blots, changed the representative images, and quantified the level of knockdown and overexpression (Fig.2 and 7). We did not quantify the WB in Fig.1A since it was to confirm that the Mfn1-/- or Mfn2-/- were knock-out cell lines.

      2. Fig. 1B (as well as Fig. 2G and others): the date do not reflect cellular size but instead spread cellular area.

      __Response: __We thank the reviewer for this suggestion. We have changed all similar descriptions to “Spread Area” in the main text and figures.

      3. Fig. 1C, D: Mfn1-null MEFs appear to be more spindle-shaped than wt cells, yet their circularity tends to be elevated. Do the authors have an explanation?

      __Response: __The circularity of Mfn1-/- MEFs has a slight increase but is not significant compared to the wt cells. As we observed, Mfn1-/- MEFs have fewer protrusions than wt, which may contribute to the slight increase in its circularity (Fig. 5C). However, this is not the focus of this study.

      * 4. Fig. 2A: The Mfn1 levels in Mfn2-/- + Mfn2 are lower than Mfn2-/-? Does this imply a crosstalk between Mfn1 and Mfn2 expression.*

      __Response: __We agree with the reviewer that a compensatory change in MFN1 expression might happen in Mfn2-/- + MFN2 MEFs. Previous research also indicated crosstalk between MFN1 and MFN2 expression (Sidarala et al., 2022).

      * 5. Fig. 2H: The authors should provide co-staining of mitochondria and Mfn2 as well.*

      __Response: __Co-staining of mitochondria and MFN2 in Mfn2-/- MEFs or rescue lines has been done in numerous previous studies (Chen et al., 2003; Naon et al., 2016; Samanas et al., 2020). In this work, we transfected our cells with mito-RFP and showed mitochondria changes in Mfn2-/- and rescue MEF cells (Fig. S1G).

      6. Fig. 4D-E: Western blots are not of publication quality. Looking at the blots provided in Fig. 4D, the reviewer is not convinced with the quantitative data shown in Fig. 4E. For instance, the intensity of pCaMKII band for "vec" does not look 3x higher than that of "+MFN2", whereas that of "+MFN2" looks much higher than that of WT.

      __Response: __We have performed additional western blots and changed the representative images.

      * 7. Fig. 5C: The authors should stain for vinculin, which are present in mature FAs only, rather than paxillin which are present in all FAs. This would strengthen the authors' conclusions. Also, FA size should be quantified.*

      __Response: __We have quantified FA size in Figure 5. The maturity of FAs is not a major focus of this study. It is likely that most FAs here are mature since they are connected with stress fibers.

      * 8. Fig. 6C - Why does the background have a grid and appear grey in color? Also, the cell interior appears in different colors in the different images. The authors should take a z-stack of images and provide the raw image files.*

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      9. Fig 7C: The MLCII Western blot is not of publication quality, and may affect the quantification provided in Fig. 7D.

      __Response: __We have performed additional western blots and changed the representative images.

      * 10. Fig 8: Do cell treatments with Rho Activator and MLCK-CA also impair migration velocity similar to Mfn2-null cells?*

      __Response: __Our data indicated that Rho Activator and MRLC induced the “PAB” structure seen in MFN2 KO cells. It is likely that cell migration is impaired here. Spatiotemporal regulation of Rho Activation is important to cell migration, it is known that Rho overactivation can significantly inhibit cell migration (Nobes & Hall, 1999). Showing Rho Activator and MLCK-CA will reduce cell migration will not add new knowledge to the cell migration field. However not all cell migration defects are associated with the PAB. We, therefore, focused on PAB quantification in this figure.

      11. Fig. 9A: The authors claim that wt cells have actin bundles that protrude against the membrane while Mfn2-null cells do not. This does not look convincing as the Mfn2-null actin bundle seem to be pushing against the membrane at the bottom of the image. No quantification is provided. It is unclear what conclusion can be drawn from the super-resolution images.

      __Response: __We used super-resolution imaging to demonstrate the details of the peripheral actin band (PAB) structure. We have used two boxes to enlarge the regions where membrane parallel actin structures are predominant. The quantification of PAB is provided in other figures.

      12. Suppl. Fig. 5C: The authors should take images using a confocal microscope for cells with Flipper-TR construct, eliminate the background and the cell center to only consider the cell periphery. Nikon TE2000 does not seem to be a confocal microscope.

      Response: __The amount of Flipper-TR that MEF cells can take in was limited. With the current signal-to-noise ratio, complete background elimination is not feasible. A confocal microscope is not necessary for Flipper-TR FLIM imaging (García-Calvo et al., 2022). __* Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      General Comments (Major) 1. Data Presentation and analysis: The data analysis would benefit from using a method such as Super-Plots to show the data from separate biological repeats and to use N numbers that represent the number of biological repeats rather than the number of cells analysed. Please see the following reference for a suggestion on how to analyse the data: Lord SJ, Velle KB, Mullins RD, Fritz-Laylin LK. SuperPlots: Communicating reproducibility and variability in cell biology. J Cell Biol. 2020 Jun 1;219(6):e202001064. doi: 10.1083/jcb.202001064. PMID: 32346721; PMCID: PMC7265319.*

      __Response: __We have changed the dot colors to show data from separate biological repeats.

      • Another general comment is that many of the experiments show analysis of very few numbers of cells or maybe only one field of view in a microscopy quantification experiment. This seems unusually low - for example, in Figure 1E only 6 cells have been analysed. It seems like more could have been done and if statistical analysis like we suggest in 1 above is used, this might reveal that some of the differences are less significant than the authors think/report. This is important, as cells are noisy and it is unusual to have such high significance for experiments like cell migration and other parameters unless a lot of measurements are made. In Figure 1G, it appears that only one field of view has been used to quantify the data. We routinely use 3-5 fields of view to get a representative sample of what the cells are doing.*

      __Response: __We have quantified more cells and indicated the number of repeats and cells quantified in the figure legend.

      • Some of the micrographs appear to be missing scale bars- e.g. Fig. 2H, Fig. 8*

      __Response: __We have included scale bars in the lower right corner of all panels.

      * 4. In the cell tracking experiments, only some of the cells in the images appear to have been tracked. How were the tracked cells chosen? Normally, we would track every cell to avoid bias in selection.*

      __Response: __We tracked all the cells in the view at the beginning of the experiments.

      5. The western blot images do not show the molecular size of the bands. Show ladder position

      __Response: __We have added bands to show molecular weights.

      6. Mostly the graphs show individual data points, which is good, but in some cases only a bar is shown- it would be nice to have individual points overlaid on the bars- e.g. Figure 1I, 4E, 5B, 5E, 7B, 7D

      __Response: __We have updated the graph to show individual points.

      7. Many of the confocal images look very processed- they have no background and have a hazy black halo around the cell. I am not familiar with the type of processing that was done and I worry that the images are only showing a masked and processed version of the actual data. The authors need to explain what processing they have done and probably also to provide the unprocessed images in a supplementary figure or dataset for readers to see. The methods description is inadequate as it only says Image J was used to process the data.

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      * Individual comments on Figures: Figure 1: See general comments above- consider to use Superplots, more cells and more fields of view in quantifications. Show experimental points in bar graph.*

      __Response: __We have quantified more cells and used super plots to display the data. The number of repeats and cells quantified are indicated in the figure legend.

      Figure 2: In 2E, the colours are very similar for two of the experiments so it is difficult to distinguish them- e.g. the MFN1 vs MFN2 rescue data both appear dark blue. Response: We have changed the color for MFN1 rescue to distinguish the two samples better.

      In 2H are the magnifications really the same for the WT as the +DOX and -DOX? The cell in the WT looks huge. Is this representative? Also, the phalloidin stain looks very spotty on the WT. This seems unusual.

      __Response: __The images are of the same scale. The Mfn2-/- MEFs are smaller, and DOX-induced MFN2 expression can only partially rescue the cell size.

      * Figure 3: Not many cells were analysed in 3B, especially the zero time point.*

      __Response: __We have quantified more cells.

      * Please define +T, we assume it is the tether construct, but it is not defined*

      __Response: __We defined T as a tether in the main text and the figure legend. In 3F, how were the tracked cells chosen?

      __Response: __We tracked all the cells in the view at the beginning of the experiments.

      * Figure 4:* 4B: Why have they not tested FK506 and STO609 on the WT cells?

      __Response: __We focused on understanding the MFN2 KO phenotype. Since neither FK506 nor STO609 altered the MFN2 KO phenotype, we did not include them in the WT group.

      4C: How were the tracked cells chosen?

      __Response: __We tracked all the cells in the view at the start of the experiments.

      4D-E: The blot doesn't look representative of the quantification- were the numbers normalised to vinculin? The difference between WT and vector looks too large to be real if the amounts were normalised to the vinculin, as vinculin is increased in vector. Likewise, the pCAMKII looks to be substantially decreased from the +MFN2, but this is not what the quantification shows.

      __Response: __We have performed additional western blots and changed the representative images.

      Figure 5: 5B- please clarify which ratio is shown here. I assume it is the ratio of RhoA-GTP vs RhoA between the zero and 4 minute time points.

      __Response: __Yes, we have clarified this point in the figure legend.

      5C- These images appear to have a mask around the cell. It is hard to tell where the edge of the cell really is- what sort of processing was used? Especially for the paxillin staining, why is there no cytoplasm shown? Is this because the image is in TIRF?

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      Figure 6: Figure 6C- the blebbistatin treated cell looks very large- is this representative?

      __Response: __Yes, Blebbistatin-treated cells are larger (Fig. 6A).

      Figure 7: Fig 7C- The lanes for MLCII are all run together- is this from a different gel? Is this quantification accurate?

      __Response: __We have performed additional western blots and changed the representative images.

      Fig. 7F- What is the % level of knockdown achieved?

      __Response: __The level of knockdown is labeled on the figure.

      Figure 8: Fig 8A,B- does the scale bar represent all of the images in these two panels?

      __Response: __Yes, the figure legend is updated to clarify this point.

      Fig 8C,D- Superplots would be helpful here.

      __Response: __We have used super plots to display the data.

      Supplementary Data: The OCR data do not add much and are not discussed much in the manuscript. Perhaps they could be omitted.

      __Response: __Our OCR data ruled out the possibility of metabolic regulation. Since MFN2 is a mitochondria protein with its typical functions in metabolic pathways, we cannot omit its influence on metabolism here. As we observed, shMLCK enhanced OCR, shROCK reduced OCR, and both knock-down rescued cell morphology and motility. We believe that PAB formation is independent of MFN2’s function in metabolic regulation.

      Figure S3- The figure label doesn't match the manuscript test- was fibrinogen or collagen used?

      __Response: __We tried cover glass alone, collagen, and fibronectin-coated glass. The PAB formation is independent of these extracellular substrates. We did not try fibrinogen because MEF cell is reported to prefer fibronectin (Lehtimäki et al., 2021).

      Reference

      Burridge, K., & Chrzanowska-Wodnicka, M. (2003). FOCAL ADHESIONS, CONTRACTILITY, AND SIGNALING. Http://Dx.Doi.Org/10.1146/Annurev.Cellbio.12.1.463, 12, 463–519. https://doi.org/10.1146/ANNUREV.CELLBIO.12.1.463

      Carson, S. D., Perry, G. A., & Pirruccello, S. J. (1994). Fibroblast Tissue Factor: Calcium and Ionophore Induce Shape Changes, Release of Membrane Vesicles, and Redistribution of Tissue Factor Antigen in Addition to Increased Procoagulant Activity. Blood, 84(2), 526–534. https://doi.org/10.1182/BLOOD.V84.2.526.526

      Chen, H., Detmer, S. A., Ewald, A. J., Griffin, E. E., Fraser, S. E., & Chan, D. C. (2003). Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. The Journal of Cell Biology, 160(2), 189. https://doi.org/10.1083/JCB.200211046

      Cieri, D., Vicario, M., Giacomello, M., Vallese, F., Filadi, R., Wagner, T., Pozzan, T., Pizzo, P., Scorrano, L., Brini, M., & Calì, T. (2017). SPLICS: a split green fluorescent protein-based contact site sensor for narrow and wide heterotypic organelle juxtaposition. Cell Death & Differentiation 2018 25:6, 25(6), 1131–1145. https://doi.org/10.1038/s41418-017-0033-z

      García-Calvo, J., López-Andarias, J., Maillard, J., Mercier, V., Roffay, C., Roux, A., Fürstenberg, A., Sakai, N., & Matile, S. (2022). HydroFlipper membrane tension probes: imaging membrane hydration and mechanical compression simultaneously in living cells. Chemical Science, 13(7), 2086–2093. https://doi.org/10.1039/D1SC05208J

      Goldfine, S. M., Schroter, E. H., & Izzard, C. S. (1981). Calcium-dependent shortening of fibroblasts induced by the ionophore, A23187. Journal of Cell Science, 50(1), 391–405. https://doi.org/10.1242/JCS.50.1.391

      Ikebe, M., & Hartshorne, D. J. (1985). Phosphorylation of Smooth Muscle Myosin at Two Distinct Sites by Myosin Light Chain Kinase*. Journal of Biological Chemistry, 260, 10027–10031. https://doi.org/10.1016/S0021-9258(17)39206-2

      Isotani, E., Zhi, G., Lau, K. S., Huang, J., Mizuno, Y., Persechini, A., Geguchadze, R., Kamm, K. E., & Stull, J. T. (2004). Real-time evaluation of myosin light chain kinase activation in smooth muscle tissues from a transgenic calmodulin-biosensor mouse. Proceedings of the National Academy of Sciences of the United States of America, 101(16), 6279–6284. https://doi.org/10.1073/PNAS.0308742101

      Kijlstra, J. D., Hu, D., Mittal, N., Kausel, E., van der Meer, P., Garakani, A., & Domian, I. J. (2015). Integrated Analysis of Contractile Kinetics, Force Generation, and Electrical Activity in Single Human Stem Cell-Derived Cardiomyocytes. Stem Cell Reports, 5(6), 1226. https://doi.org/10.1016/J.STEMCR.2015.10.017

      Lehtimäki, J. I., Rajakylä, E. K., Tojkander, S., & Lappalainen, P. (2021). Generation of stress fibers through myosin-driven reorganization of the actin cortex. ELife, 10, 1–43. https://doi.org/10.7554/ELIFE.60710

      Naon, D., Zaninello, M., Giacomello, M., Varanita, T., Grespi, F., Lakshminaranayan, S., Serafini, A., Semenzato, M., Herkenne, S., Hernández-Alvarez, M. I., Zorzano, A., De Stefani, D., Dorn, G. W., & Scorrano, L. (2016). Critical reappraisal confirms that Mitofusin 2 is an endoplasmic reticulum-mitochondria tether. Proceedings of the National Academy of Sciences of the United States of America, 113(40), 11249–11254. https://doi.org/10.1073/PNAS.1606786113/SUPPL_FILE/PNAS.201606786SI.PDF

      Nobes, C. D., & Hall, A. (1999). Rho GTPases Control Polarity, Protrusion, and Adhesion during Cell Movement. The Journal of Cell Biology, 144(6), 1235. https://doi.org/10.1083/JCB.144.6.1235

      Pelham, R. J., & Wang, Y. L. (1997). Cell locomotion and focal adhesions are regulated by substrate flexibility. Proceedings of the National Academy of Sciences of the United States of America, 94(25), 13661. https://doi.org/10.1073/PNAS.94.25.13661

      Samanas, N. B., Engelhart, E. A., & Hoppins, S. (2020). Defective nucleotide-dependent assembly and membrane fusion in Mfn2 CMT2A variants improved by Bax. Life Science Alliance, 3(5). https://doi.org/10.26508/LSA.201900527

      Shao, X., Li, Q., Mogilner, A., Bershadsky, A. D., & Shivashankar, G. V. (2015). Mechanical stimulation induces formin-dependent assembly of a perinuclear actin rim. Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2595–E2601. https://doi.org/10.1073/PNAS.1504837112/SUPPL_FILE/PNAS.1504837112.SM03.AVI

      Sidarala, V., Zhu, J., Levi-D’Ancona, E., Pearson, G. L., Reck, E. C., Walker, E. M., Kaufman, B. A., & Soleimanpour, S. A. (2022). Mitofusin 1 and 2 regulation of mitochondrial DNA content is a critical determinant of glucose homeostasis. Nature Communications 2022 13:1, 13(1), 1–16. https://doi.org/10.1038/s41467-022-29945-7

      Vallese, F., Catoni, C., Cieri, D., Barazzuol, L., Ramirez, O., Calore, V., Bonora, M., Giamogante, F., Pinton, P., Brini, M., & Calì, T. (2020). An expanded palette of improved SPLICS reporters detects multiple organelle contacts in vitro and in vivo. Nature Communications, 11(1). https://doi.org/10.1038/S41467-020-19892-6

      Wong, S. Y., Ulrich, T. A., Deleyrolle, L. P., MacKay, J. L., Lin, J. M. G., Martuscello, R. T., Jundi, M. A., Reynolds, B. A., & Kumar, S. (2015). Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Cancer Research, 75(6), 1113–1122. https://doi.org/10.1158/0008-5472.CAN-13-3426

      Zhou, W., Hsu, A. Y., Wang, Y., Syahirah, R., Wang, T., Jeffries, J., Wang, X., Mohammad, H., Seleem, M. N., Umulis, D., & Deng, Q. (2021). Mitofusin 2 regulates neutrophil adhesive migration and the actin cytoskeleton. Journal of Cell Science, 133(17). https://doi.org/10.1242/JCS.248880/VIDEO-11

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This study explores the importance of MFN2, a known endoplasmic reticulum-mitochondria linker protein, in cell motility and actin-myosin organization. It is known that the mitofusin proteins MFN1 and MFN2 can tether the mitochondria to the ER and are connected with calcium regulation in muscle and non-muscle cell types. Calcium flux mediated by mitofusins has previously been implicated in apoptosis and ER stress. In this study, the authors show that loss or depletion of MFN2 (but not MFN1) can lead to aberrant calcium increase in the cytoplasm and trigger actin-myosin reorganisation. They show that the actin and myosin changes are linked with activation of RhoA and also that they can be suppressed by inhibiting myosin light chain phosphorylation/ activation. They also show that cells with reduced MFN2 are softer (using atomic force microscopy), which agrees with activation of RhoA and contractility. If cells are plated on softer substrata, it partially compensates for the over-activation of RhoA.

      In many places, the data support the claims made, but in several places the experiments could be made more convincing or be more clearly presented. Some of the experiments appear to have been repeated only 1-2 times and very few cells or fields of view have been analysed.

      General Comments (Major)

      1. Data Presentation and analysis: The data analysis would benefit from using a method such as Super-Plots to show the data from separate biological repeats and to use N numbers that represent the number of biological repeats rather than the number of cells analysed. Please see the following reference for a suggestion on how to analyse the data: Lord SJ, Velle KB, Mullins RD, Fritz-Laylin LK. SuperPlots: Communicating reproducibility and variability in cell biology. J Cell Biol. 2020 Jun 1;219(6):e202001064. doi: 10.1083/jcb.202001064. PMID: 32346721; PMCID: PMC7265319.
      2. Another general comment is that many of the experiments show analysis of very few numbers of cells or maybe only one field of view in a microscopy quantification experiment. This seems unusually low - for example, in Figure 1E only 6 cells have been analysed. It seems like more could have been done and if statistical analysis like we suggest in 1 above is used, this might reveal that some of the differences are less significant than the authors think/report. This is important, as cells are noisy and it is unusual to have such high significance for experiments like cell migration and other parameters unless a lot of measurements are made. In Figure 1G, it appears that only one field of view has been used to quantify the data. We routinely use 3-5 fields of view to get a representative sample of what the cells are doing.
      3. Some of the micrographs appear to be missing scale bars- e.g. Fig. 2H, Fig. 8
      4. In the cell tracking experiments, only some of the cells in the images appear to have been tracked. How were the tracked cells chosen? Normally, we would track every cell to avoid bias in selection.
      5. The western blot images do not show the molecular size of the bands.
      6. Mostly the graphs show individual data points, which is good, but in some cases only a bar is shown- it would be nice to have individual points overlaid on the bars- e.g. Figure 1I, 4E, 5B, 5E, 7B, 7D
      7. Many of the confocal images look very processed- they have no background and have a hazy black halo around the cell. I am not familiar with the type of processing that was done and I worry that the images are only showing a masked and processed version of the actual data. The authors need to explain what processing they have done and probably also to provide the unprocessed images in a supplementary figure or dataset for readers to see. The methods description is inadequate as it only says Image J was used to process the data.

      Individual comments on Figures:

      Figure 1: See general comments above- consider to use Superplots, more cells and more fields of view in quantifications. Show experimental points in bar graph.

      Figure 2: In 2E, the colours are very similar for two of the experiments so it is difficult to distinguish them- e.g. the MFN1 vs MFN2 rescue data both appear dark blue. In 2H are the magnifications really the same for the WT as the +DOX and -DOX? The cell in the WT looks huge. Is this representative? Also, the phalloidin stain looks very spotty on the WT. This seems unusual.

      Figure 3: Not many cells were analysed in 3B, especially the zero time point. Please define +T, we assume it is the tether construct, but it is not defined In 3F, how were the tracked cells chosen?

      Figure 4: 4B: Why have they not tested FK506 and STO609 on the WT cells? 4C: How were the tracked cells chosen? 4D-E: The blot doesn't look representative of the quantification- were the numbers normalised to vinculin? The difference between WT and vector looks too large to be real if the amounts were normalised to the vinculin, as vinculin is increased in vector. Likewise, the pCAMKII looks to be substantially decreased from the +MFN2, but this is not what the quantification shows.

      Figure 5: 5B- please clarify which ratio is shown here. I assume it is the ratio of RhoA-GTP vs RhoA between the zero and 4 minute time points. 5C- These images appear to have a mask around the cell. It is hard to tell where the edge of the cell really is- what sort of processing was used? Especially for the paxillin staining, why is there no cytoplasm shown? Is this because the image is in TIRF?

      Figure 6: Figure 6C- the blebbistatin treated cell looks very large- is this representative?

      Figure 7: Fig 7C- The lanes for MLCII are all run together- is this from a different gel? Is this quantification accurate? Fig. 7F- What is the % level of knockdown achieved?

      Figure 8: Fig 8A,B- does the scale bar represent all of the images in these two panels? Fig 8C,D- Superplots would be helpful here.

      Supplementary Data:

      The OCR data do not add much and are not discussed much in the manuscript. Perhaps they could be omitted. Figure S3- The figure label doesn't match the manuscript test- was fibrinogen or collagen used?

      Significance

      The main novelty here appears to be the connection between excess cytoplasmic calcium, MFN2 loss and RhoA/myosin activation. This is interesting and a useful addition to the literature. It is unclear what the significance is perhaps, as increased cytoplasmic calcium is likely to cause multiple effects in addition to these. So, this effect may be a side-effect of uncoupling the ER and the mitochondria. Nonetheless, it is important to know about this and it will likely inform future studies on the mitofusins.

      This will be of interest to basic researchers studying mitochondria function and the connections between signaling and mitochondria function.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, Wang et al. investigate the role of Mitofusin 2 (Mfn2) in MEF morphology and migration. MEFs lacking Mfn2 exhibit a rather circular shape and reduced migratory potential due to increased cytosolic Ca2+, which activates Ca2+/calmodulin-dependent protein kinase II, RhoA and myosin light-chain kinase (MLCK), triggering non-muscle myosin II overactivation and formation of an F-actin ring at the cell periphery. Overall, this is an interesting study. However, additional work is needed for this manuscript to reach publication quality.

      Major Concerns:

      • Several of the Western blots are not of publication quality. This may affect their quantification, and the authors' conclusions.
      • The authors should examine how treatment of wt MEFs with Rho Activator and MLCK-CA affect cell motility (point #10).
      • The reviewer is not convinced that the membrane tension measurements were performed correctly (see point #12 below). The reviewer would expect that the presence of an F-actin ring at the cell periphery would increase the membrane tension, which is opposite to the authors' findings.

      Specific Comments:

      1. Fig. 1A: The Mfn1 Western Blot is not of publication quality. Moreover, quantitation is necessary.
      2. Fig. 1B (as well as Fig. 2G and others): the date do not reflect cellular size but instead spread cellular area.
      3. Fig. 1C, D: Mfn1-null MEFs appear to be more spindle-shaped than wt cells, yet their circularity tends to be elevated. Do the authors have an explanation?
      4. Fig. 2A: The Mfn1 levels in Mfn2-/- + Mfn2 are lower than Mfn2-/-? Does this imply a crosstalk between Mfn1 and Mfn2 expression.
      5. Fig. 2H: The authors should provide co-staining of mitochondria and Mfn2 as well.
      6. Fig. 4D-E: Western blots are not of publication quality. Looking at the blots provided in Fig. 4D, the reviewer is not convinced with the quantitative data shown in Fig. 4E. For instance, the intensity of pCaMKII band for "vec" does not look 3x higher than that of "+MFN2", whereas that of "+MFN2" looks much higher than that of WT.
      7. Fig. 5C: The authors should stain for vinculin, which are present in mature FAs only, rather than paxillin which are present in all FAs. This would strengthen the authors' conclusions. Also, FA size should be quantified.
      8. Fig. 6C - Why does the background have a grid and appear grey in color? Also, the cell interior appears in different colors in the different images. The authors should take a z-stack of images and provide the raw image files.
      9. Fig 7C: The MLCII Western blot is not of publication quality, and may affect the quantification provided in Fig. 7D.
      10. Fig 8: Do cell treatments with Rho Activator and MLCK-CA also impair migration velocity similar to Mfn2-null cells?
      11. Fig. 9A: The authors claim that wt cells have actin bundles that protrude against the membrane while Mfn2-null cells do not. This does not look convincing as the Mfn2-null actin bundle seem to be pushing against the membrane at the bottom of the image. No quantification is provided. It is unclear what conclusion can be drawn from the super-resolution images.
      12. Suppl. Fig. 5C: The authors should take images using a confocal microscope for cells with Flipper-TR construct, eliminate the background and the cell center to only consider the cell periphery. Nikon TE2000 does not seem to be a confocal microscope.

      Significance

      Delineating the role of Mfn2 in cell migration will represent a good, fundamental contribution to the field of cell migration. The reviewer finds this manuscript to be conceptually interesting. Unfortunately, there are technical issues, which need to be fixed so that the readers feel confident about the conclusion of this study.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Wang et al use a combination of cell biological and biochemical approaches to show that Mitofusin2 (MFN2) - a protein typically known to regulate mitochondrial morphology - regulates cell morphology by regulating calcium levels and downstream cell contractility players. They show that cells deficient in MFN2 exhibit increased intracellular calcium levels, and overactivation of myosin II, leading to increased cell contractility. Furthermore, MFN2-deficient cells exhibit an F-actin ring around the cell periphery (which they call PABs). The study takes advantage of both pharmacological and genetic perturbations, as well a variety of assays to support many of their findings; however, it is unclear how these findings are related to each other. Furthermore, MFN2-related disease was raised a few times in the abstract and throughout the manuscript, but it's unclear how the findings in the paper relate to disease states, both in terms of the cell biology, as well as the model that was used (MEFs). This reviewer applauds the authors for exploring MFN2 function outside of its conventional role in mitochondria; but it was difficult to parse through the findings to resolve a mechanistic explanation for how MFN2 affect cell behavior, and what role, if any, PABs have on biological function. While it is important to dissect mitochondrial-independent functions for MFN2, given the whole scale changes in cells in MFN2-deficient cells, and the fact that there is a metabolic phenotype, it is difficult to know how many of the observed phenotypes are downstream of perturbed mitochondrial function versus on cytoskeletal dynamics directly.

      Major comments:

      Are the key conclusions convincing?

      • Key conclusions that were convincing:
        • MFN2-/- cells exhibit decreased cell velocity, decreased cell size, increased cell circularity, and increased intracellular calcium
        • modifying the levels of calcium has an effect on cell circulariy.
        • MFN2-/- cells exhibit increased activation of contractility players
      • Key conclusions that were less convincing:
        • RhoA and NMII are in the title as mechanistic downstream regulators of CaM, but the results in Fig 8 call into question the role of RhoA. Why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wt phenotype? The role of NMII is also not clear - why does overexpressing MLCK-CA not have a phenotype but overexpressing MLCK downstream target MRLC show the phenotype? Are there any alternative pathways to regulate MRLC? It's not being discussed or described in 6D's schematic.
        • The role of ER/mito contacts in the system was unclear (since ER/mito contacts were not observed nor evaluated directly).
        • What role does focal adhesions have on PAB formation or any part of the model - There were results showing larger focal adhesions in the MFN2-/- cells, but not sure how this fits in with the bigger picture of contractility and PABs, and focal adhesions were not in the model in Figure 5.
        • Whether regulating calcium impacts PAB formation
        • The role of PABs in migration is also unclear - can you affect PAB formation or get rid of PABs and quantify cell migration?
        • It was hard to understand the correlation between the membrane tension of MFN2-/- cells and its ability to spread on softer substrates. How does this result fit in with the overarching model?

      Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      • There were a number of findings that did not seem to fit in with the paper, or they were included, but were not robustly described nor quantified. As an example, Paxillin-positive focal adhesions were evaluated in MFN2-/- and with various pharmacological approaches, but there is no quantification with respect to size, number, or distribution of focal adhesions, despite language in the main text that there are differences between conditions. Also, the model was presented in figure 5, and then there were several pieces of data presented afterward, some that are included in the model (myosin regulation), and some that are not in the model (membrane tension, TFM, substrate stiffness, etc). The stiffness/tension figure was not clear to me, and it was difficult to make sense of the data since one would predict that an increase in actomyosin contractility at the cortex would lead to higher membrane tension, not lower, and then how membrane tension relates to spreading on soft matrices is also unclear. The manuscript seems like an amalgamation of different pieces of data that do not necessarily fit together into a cohesive story, so the authors are encouraged to either remove these data, or shore them up and weave them into the narrative.

      Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      • The imaging used for a lot of the quantification (migration, circularity) is difficult to resolve. The cells often look like they are not imaged in the correct imaging plane. It would be helpful to have better representative images such that it is clear how the cells were tracked and how cell periphery regions of interest were manually drawn. Focal adhesions should also be shown without thresholding.
      • For most of the quantification, it appears that the experiment was only performed once and that a handful of cells were quantified. The figure legend indicates the number of cells (often reported as >12 cells or >25 cells), but the methods indicate that high content imaging was performed, and so the interpretation is that these experiments were only performed once. Biological replicates are required. If the data do represent at least 3 biological replicates, then more cell quantification is required (12 or 25 cells in total would mean quantifying a small number of cells per replicate).
      • Mitochondrial morphology and quantification should be performed in the MFN2 knockdown and rescue lines.
      • Many of the comparisons throughout the figures is between MFN2 knockdown and MFN2 knockdown plus rescue or genetic/pharmacological approaches, but a comparison that is rarely made is between wildtype and experimental. These comparisons could be useful in comparing partial rescues and potential redundancies with the other mitofusin.
      • For the mito/ER tethering experiments, it is important to show that ER/mito contacts are formed and not formed in the various conditions with imaging approaches
      • For some of the pharmacological perturbations, it would be helpful to show that the perturbation actually led to the expected phenotype - as an example, in cells treated with different concentrations of A23187, what are the intracellular calcium levels and how do these treatments influence PAB formation? This aspect should be generally applied across the study - when a modification is made, that particular phenotype should first be evaluated, before dissecting how the perturbation affects downstream phenotypes.
      • In Figures 4 and 5, the thresholding approaches in the images make the focal adhesions difficult to resolve, and therefore it is difficult to determine the size. As described above, these metrics should be defined and quantified.
      • What is a PAB? How is it defined? What metrics make a structure a PAB versus regular cortical actin - are there quantifiable metrics? In figure 8, there are some structures that are labelled as a PAB, but some aren't (as an example, the left panel in 8b is a PAB, but the right panel in 8A is not, but they look the same), so a PAB should be defined with quantifiable measures, and then applied to the entire study.
      • As described above, why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wildtype phenotype?

      Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      • These suggested experiments described above will take a substantial amount of time and money, as it appears that some experiments were only performed once, and therefore many of these experiments might need to be performed 2-3 more times. Also, experiments showing that addition of drugs lead to expected outcomes prior to analyzing downstream phenotypes will also require a significant amount of time. It is hard to predict how long it will take, but we would guess, 6-8 months?

      Are the data and the methods presented in such a way that they can be reproduced?

      • We appreciate that the authors quantified many parameters, although some quantifications were missing. There are some missing methods - how was directionality quantified, was migration quantified by selecting the approximate center of cells using MTrackJ or were centroids quantified by outlining cells, for instance. Also, given that some of the phenotypes were somewhat arbitrarily assigned (ie. what constitutes a PAB?), it may be difficult to reproduce these approaches and interpret data appropriately.

      Are the experiments adequately replicated and statistical analysis adequate?

      • Unfortunately, while the approximate number of cells was reported, the number of biological replicates were not reported, and therefore, the experimental information and statistical analyses are not adequate.

      Minor comments:

      Specific experimental issues that are easily addressable. - for some of the graphs - mostly about calcium levels - fold change is shown, but raw values should also be included to determine whether the basal levels of calcium are different across the conditions. - scale bars in every panel should also help make the points clearer.

      Are prior studies referenced appropriately?

      • Yes

      Are the text and figures clear and accurate?

      • Some of the data in the figures were unclear - see above for more info.

      Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      • See above for more info.

      Significance

      Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      • There is a growing field of mitochondrial biology and how it relates to cell migration. This paper examines the function of a key mitochondrial morphology regulator, MFN2, and dissects a role for MFN2 in migration at the level of cytoskeletal regulation. We think that this is interesting, and that it's clear that MFN2 has multiple functions in the cell, but the phenotypes are so pleiotropic that it's difficult to parse out mechanistic understanding. The authors also describe a new actin architecture - a structure that they refer to as PABs - but there is no indication that PABs form in other cell types or tissues, or in other contexts, so it is unclear whether PABs are an important structure or an artifact of the system. Furthermore, part of the motivation of the work seems to be to understand MFN-related pathologies, but using a MEF system does not necessarily allow for that. One way to strengthen this part of the manuscript is to potentially use disease-relevant MFN2 mutations and determine downstream effects on cell morphology and migration.

      State what audience might be interested in and influenced by the reported findings.

      • This work would appeal to card-carrying cell biologists.

      Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      • cell migration; actin; mitochondria
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would like to thank all the reviewers for their positive evaluations of our work and constructive comments, in particular for highlighting that our work “provides new insight into cancer metabolism knowledge”, is “conceptually interesting and experimentally well performed” and “the findings presented here will be very interesting to a broad range of researchers, including the cancer, metabolism and wider cell biology communities”.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): Nazemi et al. show that the extracellular matrix (ECM) has a crucial role in sustaining the growth of invasive breast and pancreatic cells during nutrient deprivation. In particular, under amino acid starvation, cancer cells internalize ECM by macropinocytosis and activate phenylalanine and tyrosine catabolism, which in turn support cell growth in nutrient stress conditions. The paper is well written and the results shown are very interesting. The experimental plan is well designed to assess the hypothesis and the description of the methods is sufficiently detailed to reproduce the analyses, which are also characterized by appropriate internal controls. Finally, the data provided sustain the conclusions proposed by the authors.

      * Major comment:*

      Since the authors performed their experiments on invasive breast and pancreatic cancers and it has been noted that stress conditions could promote the escape of cancer cells from the site of origin (e.g., Jimenez and Goding, Cell Metabolism 2018; Manzano et al, EMBO Reports 2020), it would be interesting to evaluate how ECM internalization could have a role in sustaining the invasive abilities of cancer cells under amino acid starvation. Which is the impact of the inhibition of macropinocytosis and tyrosine catabolism on cell invasion? The authors could evaluate this aspect by in vitro 2D and 3D analysis.

      This is a very important point, and we are planning to investigate this by using:

      • 2D single cell migration assays on cell-derived matrices (we have extensively used this system to characterise invasive cell migration; Rainero et al., 2015; Rainero et al., 2012)
      • 3D spheroids assays, to assess collective/3D cell invasion through collagen I and matrigel mixtures. Both experiments will be performed under amino acid starvation, in the presence of pharmacological inhibitors and siRNAs targeting macropinocytosis (FRAX597, PAK1) and tyrosine catabolism (Nitisinone, HPDL). Preliminary data suggest that both FRAX597 and Nitisinone reduce cell invasiveness.

      In addition, to strengthen the paper and give a stronger significance in terms of clinical translatability, it could be useful to implement the analysis of breast and pancreatic patients by publicly dataset evaluating for example free survival, disease free survival, overall survival and metastasis free survival.

      We have now included in the manuscript new data in figure 6 O-R showing that high HPDL expression correlates with reduces overall survival, distant metastasis-free survival, relapse-free survival and palliative performance scale in breast cancer patients. In response to other reviewers’ comments, we have removed the pancreatic cancer data from our manuscript.

      Minor Comment:

      The text and the figures are clear and accurate. The references cited support the hypothesis, rightly introduce the results and are appropriate for the discussion. However, the paragraph relative to figure 4 is a little confusing. Changing the order of the description of the results could be useful.

      We apologise for the lack of clarity in this section. We have now re-organised the data both in the figure and in the result section, to describe the findings in a more logical way.

      Reviewer #1 (Significance (Required)): Based on my metabolic background in tumour aetiology and progression, I think that this study provides new insights into cancer metabolism knowledge, in particular on how the stroma may drive metabolic reprogramming of cancer cells sustaining cell growth in nutrient stress conditions. Together with other similar studies on the stromal non-cellular components, the data here shown can contribute to expand the knowledge on the factors that promote cancer metabolic plasticity, which is exploited from cancer cells to obtain advantages in terms of growth, survival and progression. In conclusion, I think that the results shown are new and the manuscript is well presented. Following the short revision process suggested, it will be eligible for a final publication in a medium-high impact factor journal.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      • Please find enclosed my reviewing comments on the manuscript entitled "The extracellular matrix supports cancer cell growth under amino acid starvation by promoting tyrosine catabolism" by Nazemi et al.*

      In this manuscript the group of Elena Romero and colleagues provides evidence that breast cancer cells, and pancreatic cancer cell, use matrix proteins degradation to feed their proliferative metabolic needs under amino acid starvation. Under this drastic condition, cancer cells use micropinocytosis to uptake matrix proteins, a process that requires mTORC1 activation and PAK1. Furthermore, a metabolomic study demonstrates that ECM-dependent cancer cell growth relies on tyrosine catabolism. Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript, therefore, please find below some experimental propositions. 1. Despite the reviewer proposition, I believe that the additional experiments using the PDAC cancer cell does not improve the quality of the manuscript. Instead, it brings confusion to me, since the relative addition is minor compare to what is demonstrated using breast cancer cells.

      We have decided to remove the pancreatic cancer cell data from the manuscript.

      To importantly improve the potential impact of this manuscript, I suggest to add in vivo data using either syngenic mice model of breast cancer or xenografted human breast cancer cells in nude mice. What would be the impact of micropinocytosis and tyrosine catabolism inhibition on cancer growth, in vivo, should be demonstrated? If possible, it may be interesting to demonstrate that this micropinocytosis may interfere with cancer evolution toward a metastatic phenotype using, for example, the PyMT-MMTV mice model of breast cancer development?

      We will perform orthotopic mammary fat pad injections in immunocompetent mice, to monitor primary tumour growth and localised invasion in the presence of Nitisinone or vehicle control. PyMT-driven breast cancer cells have been generated in the Blyth lab, from FVB-pure MMTV-PyMT mice and we have preliminary data indicating that these cells are able to internalise ECM and grow under starvation in an ECM-dependent manner. Prior to performing any in vivo work, we will perform further in vitro experiment to confirm the role of tyrosine catabolism in these cells. Nitisinone is an FDA-approved drug that has already been used in mouse models. Blood tyrosine levels can be measured to assess tyrosine catabolism inhibition by Nitisinone. These experiments will be conducted in collaboration with the Blyth lab at the CRUK Beatson Institute in Glasgow.

      Data obtained using cancer cells with different metastatic property suggest that the ability to use ECM to compensate for soluble nutrient starvation is acquired during cancer progression. To further demonstrate that it is the case, would it be possible that non metastatic breast cancer cells are not able to perform micropinocytosis? Is PAK1 overexpressed with increase cancer cells metastatic ability, without affecting invasive capacity in 3D spheroids?

      To address these points, we have started to measure PAK1 expression across the MCF10 series of cell lines, where MCF10A are non-transformed mammary epithelial cells, MCF10A-DCIS are ductal carcinoma in situ cells and MCF10CA1 are metastatic breast cancer cells. Our preliminary data show that there is no upregulation of PAK1 expression in the metastatic cells compared to non-transformed or non-invasive cancer cells. This suggest that the over-expression of PAK1 might not be a valuable strategy to address this point.

      In addition, we found that collagen I uptake was upregulated in MCF10CA1 compared to MCF10A and MCF10A-DCIS. We will corroborate our preliminary data by quantifying collagen I and cell-derived matrices internalisation across the 3 cell lines.

      What would be the efficacy to promote the ECM-dependent growth under starvation following a mTORC1 in non-invasive cancer cells?

      We will measure the growth of MCF10A and MCF10A-DCIS on ECM under starvation in the presence of the mTOR activator MHY1485. Western blot analysis of downstream targets of mTORC1 (p-S6 and p-4EBP1) will confirm the extent of mTOR activation.

      The discrepancy of cancer cells proliferation under starvation condition between plastic and ECM-based supports could be explained by the massive difference of support rigidity. This is also probably the case between CDM made by normal fibroblast and CAF. It brings the question of studying the role of matrix stiffness in regard to micropinocytosis-dependent cancer cells growth. It would also explain why this process is link to aggressive cancer cell behaviour, as ECM goes stiffer with time in cancer development. It may not be the case, but the demonstration that mechanical cues from the ECM could regulate the micropinocytosis-dependent cancer cells growth under amino acid starvation could bring additional value to the manuscript.

      We will use 2 experimental approaches to address the effect of different stiffness in ECM-dependent cell growth:

      1. Polyacrylamide hydrogels coated with different ECM components.
      2. Collagen I gels in which the stiffness is modified by Ribose treatment (this approach has been published by the Parson’s lab). Our preliminary data confirmed that ribose cross-linking increased YAP nuclear localisation and collagen I can still be internalised under these conditions. We will assess ECM endocytosis and cell growth under starvation conditions (using EdU incorporation in conjunction with A and high throughput imaging with B)

      Along with this, it has been demonstrated that matrix rigidity regulates glutaminolysis in breast cancer, resulting in aspartate production and cancer cells proliferation. Is asparate production increase by micropinocytosis? Could you rescue cancer cells growth by aspartate supplementation?

      Our metabolomics experiments were performed under amino acid starvation; therefore glutamine was not present in the media. Nor glutaminolysis intermediates nor aspartate were upregulated on ECM compared to plastic in our datasets, suggesting that aspartate might not be involved in this system. We added this point in the discussion. However, glutamine, glutamate and aspartate were found to be upregulated on collagen I compared to plastic in complete media, where the most enriched pathway was alanine, aspartate and glutamate metabolism. Future work will address the role of the ECM in supporting cancer cell metabolism in the absence of nutrient starvation.

      Data presented in Fig 1 and SF1 show that breast cancer cell lines growth in a comparable manner either they are cultured on plastic or on 3D ECM substrates in complete media. Again, on thick 3D substrates, in which the stiffness is lower compared to plastic, I would have thought that cancer cells would have grown slower. Could you please discuss this finding in regard to the literature?

      Our experiments in full media were performed in the presence of dialysed serum, to represent a better control for the starvation conditions, which were in the presence of dialysed serum. This is consistent with a vast body of literature assessing nutrient starvation conditions in the presence of dialysed serum. This could explain the discrepancy between ours and published results. We have addressed this point in the discussion.

      If you have the capacity to do so in your lab or in collaboration, would it be possible to measure the exact stiffness of the different matrix you use in this manuscript? Or using hydrogel, would it be possible to study the role of matrix stiffness in the ECM-dependent cancer cells growth under AA starvation? I would understand that this may be out of the scope of the present manuscript, but I again believe that such finding would reinforce the manuscript.

      We don’t have the capacity to measure the stiffness in our lab, however NF-CDM and CAF-CDM, generated by the same cells and using the same protocol, have been previously measured at ~0.4kPa and ~0.8 kPa, respectively (Hernandez-Fernaud et al., 2017). We have now included this in the paper. As mentioned in response to point 4, we will use hydrogels to directly test the effect of matrix stiffness on ECM-dependent cell growth under nutrient starvation.

      In SF 3A-C, it is shown that ECM does not affect caspase-dependent cell death under AA starvation. Did you considered a non-caspase dependent cell death that may be triggered by AA starvation?

      We will complement the caspase 3/7 data by performing PI staining, to detect all forms of cell death. Preliminary data indicate that, consistent with our cas3/7 data, amino acid starvation promotes cell death, but the presence of the ECM doesn’t affect the percentage of PI positive cells, corroborating our conclusions that the ECM modulates cell proliferation and not cell death. We will complete these experiments in both MDA-MB-231 and MCF10CA1 cells and will include them in figure S3.In fig 5, it is shown that inhibition of Focal Adhesion Kinase (FAK) does not impair the ECM-dependent rescue of cancer cell growth under starvation. To further decipher the concept of adhesion dependent signalling, maybe the authors could also inhibit the Src kinase or ITG-beta1 activation?

      Integrin b1 is also required for ECM internalisation (our unpublished data), therefore interfering with integrin function would make the interpretation of the data quite complex. As suggested by the reviewer, we will use the Src inhibitor PP2, which has been extensively used in the literature in MDA-MB-231 cells. Preliminary data indicate that, despite significantly reducing cell proliferation in complete media, Src inhibition does not affect cell growth on collagen I under amino acid starvation, consistent with our FAK inhibitor data. We will complete these experiments on both collagen I and cell-derived matrices and will include them in figure 5.

      Minor comment, in F1B, it is written "AA free starvation" while in every others legend, it is written "AA starvation". I believe the "free" should be removed.

      We apologise for this mistake; we have now removed “free” from the legend.

      Reviewer #2 (Significance (Required)): Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): In this manuscript the authors explore the mechanisms that metastatic cancer cells use to adapt their metabolism. The authors show that the growth of cancer cell lines is supported by uptake of ECM components in nutrient-starved conditions. The authors propose a very interesting mechanism in which the cells adapt their metabolism to ECM uptake as nutrient source via a PAK1-dependent macropinocytosis pathway which in turn increases tyrosine catabolism. Several key aspects of the authors complex hypothesis require further controls to fully support the authors ideas. As a disclaimer we do not feel qualified enough to comment on the metabolite experiments. Please find our detailed comments below.

      * Major -The ECM mediated increase of cell growth under amino acid (AA) starvation is nicely shown In Fig.1 but the authors should include the full medium data from figure S1 in the graphs of Fig. 1 to enable the reader to evaluate the magnitude of rescue effect of the ECM components. The values should also be included in the results text*.

      We have now moved all the complete media data into the main figure and highlighted the extent of the rescue in the result section.

      Also the authors only glutamine starve in Fig1&2 and then don't mention it again can the authors please include a sentence to explain why this experiment was dropped.

      As now highlighted in the result section, we focused on the amino acid starvation as it resulted in the strongest difference between normal and cancer. On the one hand, also non-invasive breast cancer cells can use ECM (namely matrigel) to grow under glutamine starvation, while this is not the case under amino acid starvation. On the other hand, only CAF-CDM, but not normal-CDM, could rescue cell growth under amino acid starvation. We reasoned that this condition was more likely to identify cancer-specific phenotypes.

      - The evaluation of uptake pathways is very interesting. The focus on macropinocytosis is not entirely justified in our opinion looking at FigS4A. Caveolin1/2 and DNM1/3 seem to have strongest effect on uptake of Matrigel and not PAK1? Statements like "Since our data indicate that macropinocytosis is the main pathway controlling ECM endocytosis..." are not justified nor are they really needed in our opinion. Several pathways can be implicated in passive uptake.

      We have now removed the statement, as suggested by the reviewer. In addition, we will assess CDM uptake upon caveolin 1/2 and DNM 2/3 knock-down, to test whether the effects are matrigel specific.

      - The authors use FAK inhibition to evaluate the effect of focal adhesion signalling on their phenotypes and conclude that there is no connection between the observed increase of cell proliferation in presence of ECM and adhesion signalling. To make this assessment the authors need at the very least to show that their FAK inhibitor treatment at the used concentration results in changes in focal adhesions and the associated force transduction.

      In the result section, we are including a western blot analysis showing that the concentration of FAK inhibitor used in sufficient so significantly reduced FAK auto-phosphorylation. Based on published evidence (Horton et al., 2016), FAK inhibition does not affect focal adhesion formation, but only the phosphorylation events. Therefore, we don’t think that we will be able to detected changes in focal adhesions regardless of the concentration of the inhibitor we use. To strengthen the observation that ECM-dependent cell growth in independent from adhesion signalling, as suggested by reviewer #2, we will use the Src inhibitor PP2, which has been extensively used in the literature in MDA-MB-231 cells. Preliminary data indicate that, despite significantly reducing cell proliferation in complete media, Src inhibition does not affect cell growth on collagen I under amino acid starvation, consistent with our FAK inhibitor data. We will complete these experiments on both collagen I and cell-derived matrices and will include them in figure 5.

      -The pancreatic cancer data currently feels a bit like an afterthought. We suggest to remove this data from the manuscript. If this data is included we suggest the authors should expand this section and repeat key experiments of earlier figures.

      We have now removed these data from the manuscript, as this was also the suggestion of reviewer #2.

      -Was the fetal bovine serum (FBS) and Horse Serum (HS) the authors use in their experiments tested for ECM components? The authors mention that the FBS for MDA231 cells was dialysed but not the HS.

      HS was used at a much lower concentration that FBS in our cell proliferation experiments (2.5% compared to 10%). We will characterise both sera components by mass spectrometry analysis, in collaboration with Dr Collins, biOMICS Facility, University of Sheffield.

      Minor comments:

      -Please can the authors provide experimental data directly comparing NF-CAM versus CAF-CDM on the same graph (Figure 1D-E).

      In the experiments included in the manuscript, the two matrices were generated independently, and we don’t feel it is appropriate to combine the results in the same graph. We are now repeating these experiments by generating both matrices in the same plates, so that we can present the data in the same graph. -Please can the authors give more insight to the use of 25% Plasmax to mimic starved tumor microenvironment. Is there previous research that suggests the nutrient values are representative of TME?

      Apologies for not clarifying this in the initial submission, the rationale behind this choice is based on the observation that, in pancreatic cancers, nutrients were shown to be depleted between 50-75% (Kamphorst et al., 2015). We have now stated this in the result section.

      -Fig3E Can the authors please include example images of the pS6 staining in the supplementary figures and explain "mTOR endosomal index" in figure legend.

      We have now included the representative images (new figure 3E) and we have described how the mTOR endosomal index was calculated both in the figure legend and in the method section. -Can the authors include a negative control for the mTORC1 localisation in Fig.3 (such as use of rapamycin/Torin)?

      Amino acid starvation is the gold-standard control for mTORC1 lysosomal targeting, as described in a variety of publications, including Manifava et al., 2016; Meng et al., 2021; Averous et al., 2014. In addition, Torin 1 treatment has been shown to result in a significant accumulation of mTOR on lysosomes compared with untreated cells (Settembre et al., 2012). Consistent with this, we looked at mTOR localisation in the presence of Rapamycin and we did not detect any reduction in lysosomal targeting.

      - The PAK1 expression level blots in the knockdown experiments should be quantified from N=3.

      We have not included the quantification of the western blots in the new supplementary figure 5.

      -What is the FA index in Fig.5, explain how it is calculated. Why not use FA size alone?

      We have now defined this is the method section. We haven’t used FA size alone, as this measure can be affected by cell size. If a cell is bigger, the overall FA size will be bigger, but this doesn’t necessarily reflect a change in adhesions.

      -Can the authors please use paragraphs on page 9 to improve readability. We apologise for overlooking this, we have now used paragraph in this section.

      Reviewer #3 (Significance (Required)): The findings presented here will be very interesting to a broad range of researchers including the cancer, metabolism and wider cell biology communities. The Rainero lab has progressed the idea that ECM uptake supports cancer progression and the data presented here has the potential to significantly advance our understanding of the underlying cellular mechanisms.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript the authors explore the mechanisms that metastatic cancer cells use to adapt their metabolism. The authors show that the growth of cancer cell lines is supported by uptake of ECM components in nutrient-starved conditions. The authors propose a very interesting mechanism in which the cells adapt their metabolism to ECM uptake as nutrient source via a PAK1-dependent macropinocytosis pathway which in turn increases tyrosine catabolism. Several key aspects of the authors complex hypothesis require further controls to fully support the authors ideas. As a disclaimer we do not feel qualified enough to comment on the metabolite experiments. Please find our detailed comments below.

      Major

      • The ECM mediated increase of cell growth under amino acid (AA) starvation is nicely shown In Fig.1 but the authors should include the full medium data from figure S1 in the graphs of Fig. 1 to enable the reader to evaluate the magnitude of rescue effect of the ECM components. The values should also be included in the results text. Also the authors only glutamine starve in Fig1&2 and then don't mention it again can the authors please include a sentence to explain why this experiment was dropped.
      • The evaluation of uptake pathways is very interesting. The focus on macropinocytosis is not entirely justified in our opinion looking at FigS4A. Caveolin1/2 and DNM1/3 seem to have strongest effect on uptake of Matrigel and not PAK1? Statements like "Since our data indicate that macropinocytosis is the main pathway controlling ECM endocytosis..." are not justified nor are they really needed in our opinion. Several pathways can be implicated in passive uptake.
      • The authors use FAK inhibition to evaluate the effect of focal adhesion signalling on their phenotypes and conclude that there is no connection between the observed increase of cell proliferation in presence of ECM and adhesion signalling. To make this assessment the authors need at the very least to show that their FAK inhibitor treatment at the used concentration results in changes in focal adhesions and the associated force transduction.
      • The pancreatic cancer data currently feels a bit like an afterthought. We suggest to remove this data from the manuscript. If this data is included we suggest the authors should expand this section and repeat key experiments of earlier figures.
      • Was the fetal bovine serum (FBS) and Horse Serum (HS) the authors use in their experiments tested for ECM components? The authors mention that the FBS for MDA231 cells was dialysed but not the HS.

      Minor comments:

      • Please can the authors provide experimental data directly comparing NF-CAM versus CAF-CDM on the same graph (Figure 1D-E)
      • Please can the authors give more insight to the use of 25% Plasmax to mimic starved tumor microenvironment. Is there previous research that suggests the nutrient values are representative of TME?
      • Fig3E Can the authors please include example images of the pS6 staining in the supplementary figures and explain "mTOR endosomal index" in figure legend.
      • Can the authors include a negative control for the mTORC1 localisation in Fig.3 (such as use of rapamycin/Torin)?
      • The PAK1 expression level blots in the knockdown experiments should be quantified from N=3
      • What is the FA index in Fig.5, explain how it is calculated. Why not use FA size alone?
      • Can the authors please use paragraphs on page 9 to improve readability.

      Significance

      The findings presented here will be very interesting to a broad range of researchers including the cancer, metabolism and wider cell biology communities. The Rainero lab has progressed the idea that ECM uptake supports cancer progression and the data presented here has the potential to significantly advance our understanding of the underlying cellular mechanisms.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Please find enclosed my reviewing comments on the manuscript entitled "The extracellular matrix supports cancer cell growth under amino acid starvation by promoting tyrosine catabolism" by Nazemi et al.

      In this manuscript the group of Elena Romero and colleagues provides evidence that breast cancer cells, and pancreatic cancer cell, use matrix proteins degradation to feed their proliferative metabolic needs under amino acid starvation. Under this drastic condition, cancer cells use micropinocytosis to uptake matrix proteins, a process that requires mTORC1 activation and PAK1. Furthermore, a metabolomic study demonstrates that ECM-dependent cancer cell growth relies on tyrosine catabolism.

      Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript, therefore, please find below some experimental propositions.

      1. Despite the reviewer proposition, I believe that the additional experiments using the PDAC cancer cell does not improve the quality of the manuscript. Instead, it brings confusion to me, since the relative addition is minor compare to what is demonstrated using breast cancer cells.
      2. To importantly improve the potential impact of this manuscript, I suggest to add in vivo data using either syngenic mice model of breast cancer or xenografted human breast cancer cells in nude mice. What would be the impact of micropinocytosis and tyrosine catabolism inhibition on cancer growth, in vivo, should be demonstrated? If possible, it may be interesting to demonstrate that this micropinocytosis may interfere with cancer evolution toward a metastatic phenotype using, for example, the PyMT-MMTV mice model of breast cancer development?
      3. Data obtained using cancer cells with different metastatic property suggest that the ability to use ECM to compensate for soluble nutrient starvation is acquired during cancer progression. To further demonstrate that it is the case, would it be possible that non metastatic breast cancer cells are not able to perform micropinocytosis? Is PAK1 overexpressed with increase cancer cells metastatic ability, without affecting invasive capacity in 3D spheroids? What would be the efficacy to promote the ECM-dependent growth under starvation following a mTORC1 activation or PAK1 activation in non-invasive cancer cells?
      4. The discrepancy of cancer cells proliferation under starvation condition between plastic and ECM-based supports could be explained by the massive difference of support rigidity. This is also probably the case between CDM made by normal fibroblast and CAF. It brings the question of studying the role of matrix stiffness in regard to micropinocytosis-dependent cancer cells growth. It would also explain why this process is link to aggressive cancer cell behaviour, as ECM goes stiffer with time in cancer development. It may not be the case, but the demonstration that mechanical cues from the ECM could regulate the micropinocytosis-dependent cancer cells growth under amino acid starvation could bring additional value to the manuscript.
      5. Along with this, it has been demonstrated that matrix rigidity regulates glutaminolysis in breast cancer, resulting in aspartate production and cancer cells proliferation. Is asparate production increase by micropinocytosis? Could you rescue cancer cells growth by aspartate supplementation?
      6. Data presented in Fig 1 and SF1 show that breast cancer cell lines growth in a comparable manner either they are cultured on plastic or on 3D ECM substrates in complete media. Again, on thick 3D substrates, in which the stiffness is lower compared to plastic, I would have thought that cancer cells would have grown slower. Could you please discuss this finding in regard to the literature? If you have the capacity to do so in your lab or in collaboration, would it be possible to measure the exact stiffness of the different matrix you use in this manuscript? Or using hydrogel, would it be possible to study the role of matrix stiffness in the ECM-dependent cancer cells growth under AA starvation? I would understand that this may be out of the scope of the present manuscript, but I again believe that such finding would reinforce the manuscript.
      7. In SF 3A-C, it is shown that ECM does not affect caspase-dependent cell death under AA starvation. Did you considered a non-caspase dependent cell death that may be triggered by AA starvation?
      8. In fig 5, it is shown that inhibition of Focal Adhesion Kinase (FAK) does not impair the ECM-dependent rescue of cancer cell growth under starvation. To further decipher the concept of adhesion dependent signalling, maybe the authors could also inhibit the Src kinase or ITG-beta1 activation?
      9. Minor comment, in F1B, it is written "AA free starvation" while in every others legend, it is written "AA starvation". I believe the "free" should be removed.

      Significance

      Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Nazemi et al. show that the extracellular matrix (ECM) has a crucial role in sustaining the growth of invasive breast and pancreatic cells during nutrient deprivation. In particular, under amino acid starvation, cancer cells internalize ECM by macropinocytosis and activate phenylalanine and tyrosine catabolism, which in turn support cell growth in nutrient stress conditions.

      The paper is well written and the results shown are very interesting. The experimental plan is well designed to assess the hypothesis and the description of the methods is sufficiently detailed to reproduce the analyses, which are also characterized by appropriate internal controls. Finally, the data provided sustain the conclusions proposed by the authors.

      Major comment:

      Since the authors performed their experiments on invasive breast and pancreatic cancers and it has been noted that stress conditions could promote the escape of cancer cells from the site of origin (e.g., Jimenez and Goding, Cell Metabolism 2018; Manzano et al, EMBO Reports 2020), it would be interesting to evaluate how ECM internalization could have a role in sustaining the invasive abilities of cancer cells under amino acid starvation. Which is the impact of the inhibition of macropinocytosis and tyrosine catabolism on cell invasion? The authors could evaluate this aspect by in vitro 2D and 3D analysis. In addition, to strengthen the paper and give a stronger significance in terms of clinical translatability, it could be useful to implement the analysis of breast and pancreatic patients by publicly dataset evaluating for example free survival, disease free survival, overall survival and metastasis free survival.

      Minor Comment:

      The text and the figures are clear and accurate. The references cited support the hypothesis, rightly introduce the results and are appropriate for the discussion. However, the paragraph relative to figure 4 is a little confusing. Changing the order of the description of the results could be useful.

      Significance

      Based on my metabolic background in tumour aetiology and progression, I think that this study provides new insights into cancer metabolism knowledge, in particular on how the stroma may drive metabolic reprogramming of cancer cells sustaining cell growth in nutrient stress conditions. Together with other similar studies on the stromal non-cellular components, the data here shown can contribute to expand the knowledge on the factors that promote cancer metabolic plasticity, which is exploited from cancer cells to obtain advantages in terms of growth, survival and progression.

      In conclusion, I think that the results shown are new and the manuscript is well presented. Following the short revision process suggested, it will be eligible for a final publication in a medium-high impact factor journal.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      This study by Viedor et al. examines the role of TIS7 (IFRD1) and its ortholog SKMc15 (IFRD2) in the regulation of adipogenesis via their ability to modulate the levels of DLK1 (Pref-1), a well-known inhibitor of adipogenesis. They generate SKMc15 KO mice and cross them to previously published TIS7 KO mice. All 3 mutant strains show decreased fat mass, with the effect being most pronounced in double KO mice (dKO). Using mouse embryonic fibroblasts (MEFs) from mutant mice, they authors ascribe a defect in adipogenic differentiation of mutant cells to an upregulation of DLK-1. In the case of TIS7, they propose that this is due to its known inhibition of Wnt signaling, which regulates DLK-1 expression. In the case of SKMc15, they suggest a new mechanism linked to its ability to suppress translation. Overall, the work is of interest, with the finding, that SKMc15 regulates adipocyte differentiation being its novelty, and generally well done, though multiple aspects need to be improved to bolster the conclusions put forth.

      **Major concerns:**

      1)The main mechanism put forth by the authors to explain the inability of dKO cells to differentiate into adipocytes is the upregulation of DLK-1 levels. However, this notion is never directly tested. Authors should test if knockdown of DLK-1 in dKO cells is sufficient to correct the defect in differentiation, or if additional factors are involved.

      Response: In response to the reviewer’s concerns, we have generated two stable cell lines expressing short hairpin RNAs directed against DLK1 in the TIS7 SKMc15 dKO MEFs. With these two and the parental dKO MEF cell line, we have performed adipogenesis differentiation experiments as explained in the manuscript before. Figure EV2C (left and right panels) shows that knockdown of DLK1 with two different DLK1 shRNA constructs (targeting DLK1 with or without the extracellular cleavage site) significantly (P2)There are multiple instances were the authors refer to "data not shown", such as when discussing the body length of dKO mice. Please show the data in all cases (Supplementary Info is fine) or remove any discussion of data that is not shown and cannot be evaluated.

      Response: Following three results were in the initial version of our manuscript mentioned as “data not shown”:

      • line 137: “body length, including the tail did not significantly differ between WT and dKO mice”
      • line 307: “higher concentrations of free fatty acids in the feces of dKO mice”
      • line 331: “effects of ectopic expression of TIS7, SKMc15 and their co-expression on DLK-1 levels” In the current version of the manuscript, we provide these results as:

      • Figure EV1A shows no significant difference in body length.

      • The significantly elevated levels of free fatty acids and energy determined by bomb calorimetry in the feces of dKO animals fed HFD are shown in Figures 6A and B, respectively.
      • The significant inhibitory effect of ectopic expression of TIS7 and SKMc15 on DLK1 levels was identified by both qPCR and WB analyses, which are shown in Figure 3B. 3)Indirect calorimetry data shown in Fig. S1 should include an entire 24 hr cycle and plots of VO2, activity and other measured parameters shown (only RER and food intake are shown), not just alluded to in the legend.

      Response: Based on the reviewer’s suggestion, we present here a table containing all parameters measured in the indirect calorimetry experiment.

      Metabolic phenotyping presented in Figure EV1B containing 21 hours measurement was performed exactly according to the standardized protocol previously published by Rozman J. et al. [1]. All phenotyping tests were performed following the International Mouse Phenotyping Resource of Standardized Screens (IMPReSS) pipeline routines.

      4)It is surprising that the dKO mice weight so much less than WT even though their food consumption and activity levels are similar, and their RER does not indicate a switch in fuel preference. An explanation could be altered lipid absorption. The authors indicate that feces were collected. An analysis of fat content in feces (NEFAs, TG) needs to be performed to examine this possibility. The discussion alludes to it, but no data is shown.

      __Response: __We thank the reviewer for bringing up this important point that prompted us to present data clarifying this aspect of the metabolic phenotype of dKO mice. As shown in Figures 6A,B, while fed with HFD, dKO mice had higher concentrations of free fatty acids in the feces (109 ± 10.4 µmol/g) when compared to the WT animals (78 ± 6.5 µmol/g) and a consequent increase in feces energy content (WT: 14.442 ± 0.433 kJ/g dry mass compared to dKO: 15.497 ± 0.482 kJ/g dry mass). Thus, lack of TIS7 and SKMc15 reduced efficient free fatty acid uptake in the intestines of mice.

      5)It would be important to know if increased MEK/ERK signaling and SOX9 expression are seen in fat pads of mutant mice, not just on the MEF system. Similarly, what are the expression levels of PPARg and C/EBPa in WAT depots of mutant mice?

      Response: To address this point, we have now performed the MEK/ERK activity measurement for the revised version of the manuscript in gonadal WAT tissue (GWAT). As noted in samples from several mice, there was an increase in p42 and p44 MAPK phosphorylation in G WAT isolated from dKO mice compared with the G WAT from WT control mice (Figure 4G).).

      The mRNA expression levels of PPARg and C/EBPa were significantly downregulated in GWAT samples isolated from dKO mice compared with levels from WT control animals (Figure 4H). However, we did not find any significant difference in SOX9 expression in fat pads. Total amounts of Sox9 mRNA in terminally differentiated adipocytes were very low and not within the reliable detection range, and the variation between animals within the same group was too great. Therefore, we provide these data only for the reviewer’s information here and do not present them in the manuscript.

      6)Analysis of Wnt signaling in Fig. 3c should also include a FOPflash control reporter vector, to demonstrate specificity. Also, data from transfection studies should be shown as mean plus/minus STD and not SEM. This also applies to all other cell-based studies (e.g., Fig. 6b,c).

      Response: To address the reviewer’s concerns, we performed FOPflash control reporter measurements in MEFs of all four genotypes. As expected, in every tested cell line the luciferase activity of the FOPflash reporter was substantially lower than that of TOPflash, confirming the specificity of this reporter system.

      We also thank the reviewer for this important reference to our statistical analyses. We have revised the original data and found that the abbreviation SEM was inadvertently used in the legends instead of STD. STD was always used in the original analyses and therefore we have corrected all legends accordingly in the new version of the manuscript.

      7)It is unclear why the authors used the MEF model rather than adipocyte precursors derived from the stromal vascular fraction (SVF) of fat pads from mutant mice. If they did generate data from SVF progenitors, they should include it.

      __Response: __We agree with this comment, although performing the experiments was challenging enough for us. Therefore, we isolated inguinal fat pads and obtained SVF cells from mice of all four genotypes (WT, TIS7, SKMc15 single and double KOs) and have repeated crucial experiments, i.e. adipocyte differentiation, DLK1, PPARg and C/EBPa mRNA and protein analyses in these cells. Novel data gained in this cell system fully confirmed our previous observations in MEFs. Therefore, in the current version of the manuscript we have replaced figures describing the effects of lacking TIS7 and SKMc15 in MEFs by adipose tissues samples (Figures 2D,E, 4G,H,I and 6C) or SVF cells from inguinal WAT (Figures 2A,B,F,G,H, 3C,D,E and F). In addition to the results obtained from SVF cells of inguinal WAT, we also obtained comparable data from SVF cells isolated from fat pads of gonadal WAT. We provide the results from gonadal WAT hereafter for the reviewers' information only.

      amido black

      • 60 kDa

      • 50 kDa

      __G WAT __tissues

      dKO

      WT

      GAPDH

      DLK-1

      • 60 kDa

      • 50 kDa

      • 35 kDa

      WT

      dKO

      DLK-1

      • 60 kDa

      • 50 kDa

      __G WAT __undifferentiated cells

      undifferentiated G WAT cells

      The only experiments where we have still used data obtained in MEFs are those where the ectopic expression or effects of shRNA were necessary (e.g. Figures 2C, 3B,H,I, 5F,G EV2B,C and EV3 A-F).

      8)Given that the authors' proposed mechanism involves both, transcriptional and post-transcriptional regulation of DLK-1 by TIS7 and SKMc15, Fig. 4d should be a Western blot capturing both of these events, and not just quantitation of mRNA levels.

      Response: As requested by the reviewer, we have added in Figure 3B the Western blot analysis of DLK1 expression. Secondly, this experiment was entirely redone and we now show the effects of ectopic expression of SKMc15, TIS7 alone and their combination side by side with the control GFP. We present here the effects of stable expression of ectopic TIS7 and SKMc15 in dKO MEFs following the viral delivery of expression constructs, antibiotic selection and 8 days of adipocyte differentiation.

      9)There is no mention of the impact on brown adipose tissue (BAT) differentiation of KO of TIS7, SKMc15, or the combination. Given the role of BAT in systemic metabolism beyond energy expenditure, the authors need to comment on this issue.

      Response: We thank the reviewer for bringing up this important point that prompted us to better describe the phenotype of TIS7, SKMc15 and double knockout mice. We measured DLK1 protein levels in BAT isolated from WT, TIS7, and SKMc15 mice with single and double knockout and detected a significant increase in DLK1 protein levels in all three knockout genotypes. Five mice per genotype were analyzed, and the statistical analysis in Figure 4I represents the mean ± STD. The p-values are based on the results of the Student's t-test and one-way Anova analysis (p-value = 0.0241).

      **Minor comments:**

      10)The y axis in Fig. 2c is labeled as gain of body weight (g). Is it really the case that WT mice gained 30 g of body weight after just 3 weeks of HFD? This rate of increase seems extraordinary, and somewhat unlikely. Please re-check the accuracy of this panel.

      Response: We thank the reviewer for drawing our attention to the apparent mislabeling of the y-axis. The correct labeling is: "Increase in body weight in %" and Figure 1F has been corrected accordingly.

      11)The Methods indicates all statistical analysis was performed using t tests, but this is at odds with some figure legends that indicate additional tests (e.g., ANCOVA).

      Response: This inaccurate information in the manuscript was corrected.

      12)Please specify in all cases the WAT depot used for the analysis shown (e.g., Fig. 3d is just labeled as WAT, as are Fig. 4a,e, etc.).

      Response: This information was added at all appropriate places of the manuscript.

      13)Fig. 5d is missing error bars, giving the impression that this experiment was performed only once (Fig. 5c). The legend has no details. Please amend.

      __Response: __We thank the reviewer for this important point regarding the statistical analyses. In the new version of the manuscript, we have included a graph (now Figure 4D) depicting results of three independent experiments including the results of the statistical analysis performed. Statistical analysis was performed using One-Way ANOVA (P=0.0016).

      Reviewer #1 (Significance (Required)):

      The role of TIS7 in adipocyte differentiation is well established. The only truly novel finding in this work is the observation that SKMc15 also plays a role in adipogenesis. The molecular mechanisms proposed (modulation of DLK-1 levels) are not novel, but make sense. However, they need to be bolstered by additional data.

      **Referees cross-commenting**

      I think we are all in agreement that the findings in this work are of interest, but that significant additional work is required to discern the mechanisms involved. In my view, a direct and specific link between SKMc15 and translation of DLK-1 needs to be established and its significance for adipogenesis in cells derived from the SVF of fat pads determined. Reviewer 2 has suggested some concrete ways to provide evidence of a direct link.

      __Response: __We agree with the reviewer's comment and have also noted that this point will be crucial in assessing the novelty value of our manuscript, as was also expressed in the referees cross-commenting. Therefore, we have now additionally performed a polysomal RNA analysis, which has of course been included in the current version of the manuscript.

      We analyzed the differences in DLK-1 translation between wild-type control cells and SKMc15 knockout cells in the gradient-purified ribosomal fractions by DLK-1 qPCR. Our analysis identified significantly (pSimilarly, as proposed by the reviewer, we have established stromal vascular fraction cell cultures from inguinal fat pads. In SVF cells of TIS7 and SKMc15 single and double knockout mice, we found increased DLK1 mRNA and protein levels (Figures 2F,G and H) as well as decreased PPARg and C/EBPa levels (Figures 3C,D,E and F). Specifically, we found that the ability of knockout SVF cells to differentiate into adipocytes was significantly downregulated (Figures 2A and B), fully confirming our original findings in TIS7 and SKMc15 knockout MEFs.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      **Summary:**

      In the current study, Vietor et al. aimed to explore the regulation of Delta-like homolog 1 (DLK-1), an inhibitor of adipogenesis, and demonstrated a role for TIS7 and its orthologue SKMc15 in the regulation of adipogenesis by controlling the level of DLK-1. Using mouse models with whole body deficiency of TIS7 (TIS7 KO) or SKMc15 (SKMc15KO) and double KO (TIS7 and SKMc15 dKO) mice, the authors used a combination of in-vivo experiments and cell culture experiments with mouse embryonic fibroblasts derived from the KO animals, to show that the concurrent depletion of TIS7 and SKMc15 dramatically reduced the amount of adipose tissues and protected against diet-induced obesity in mice, which was associated with defective adipogenesis in vitro.

      **Major Comments:**

      Overall, this study presents convincing evidence that TIOS7 and SKMc15 are necessary for optimal adipogenesis, and proposes a novel mechanism for the control of DLK1 abundance via coordinated regulation of DLK-1 transcription and translation. However, a number of questions remain largely unanswered. In particular, the direct ability of SKMc15 to regulate the translation of DLK-1 is lacking, and this claim remains speculative. SKMc15 being a general inhibitor of translation, SKMc15 may have an effect on adipogenesis independently of its regulation of DLK-1. Thus, addressing the following comments would further improve the quality of the manuscript:

      Response:

      We have been very attentive to these comments to improve the novelty and quality of our manuscript and have tried to address them experimentally. Therefore, this thorough revision of our manuscript took a longer time. First, we identified polysomal enrichment of DLK-1 RNA in SKMc15 KO MEFs, demonstrating that SKMc15 translationally affects DLK-1 levels (Figure 3I). Second, treatment with a recombinant DLK-1 protein as well as its ectopic expression quite clearly blocked adipocyte differentiation of WT MEFs (Figures EV3B,C). In addition, two different shRNA constructs targeting DLK-1 significantly induced adipocyte differentiation of TIS7 SKMc15 dKO MEFs (Figure EV2C, left and right panels). We believe that these results, taken together, sufficiently support our proposed mechanism, namely that TIS7 and SKMc15 control adipocyte differentiation through DLK-1 regulation.

      • The experimental evidence supporting that SKMc15 controls DLK-1 protein levels comes primarily from the observations that DLK-1 abundance is further increased in SKMc15 KO and dKO WAT than in TIS7KO WAT (Fig 3d), and that translation is generally increased in SKMc15 KO and dKO cells (Fig 5a). However, since the rescue experiment is performed in dKO cells, by restoring both TIS7 and SKMc15 together, it is impossible to disentangle the effects on DLK-1 transcription, DLK-1 translation and on adipogenesis. A more detailed description of the TIS7 and SKM15c single KO cells, with or without re-expression of TIS7 and SKMc15 individually, at the level of DLK-1 mRNA expression and DLK-1 protein abundance would be necessary. In addition, polyribosome fractioning followed by qPCR for DLK-1 in each fraction, and by comparison with DLK-1 global expression in control and SKMc15 KO cells, would reveal the efficiency of translation for DLK-1 specifically, and directly prove a translational control of DLK-1 by SKMc15. Alternatively, showing that DLK-1 is among the proteins newly translated in SKMc15 KO cells (Fig. 5a) would be helpful. Response: As suggested by the reviewer we used single TIS7 and SKMc15 knockout cells and demonstrated that both, TIS7 and SKMc15, affect Dlk-1 mRNA levels. We identified a highly significant effect on total DLK-1 mRNA levels in SKMc15 knockout MEFs as presented in Figure 3H. We also show that DLK-1 mRNA is specifically enriched in polysomal fractions obtained from proliferating SKMc15 knockout MEFs when compared to WT MEFs. However, the strong accumulation of DLK-1 mRNA in polysomes cannot be explained by transcriptional upregulation of DLK-1 alone, suggesting that regulation also occurs at the translational level. We took up this suggestion and ectopically expressed TIS7 and SKMc15 separately or together. For this purpose, we used not only MEF cell lines with double knockout but also with single knockout. Our recent data showed that stable ectopic expression of SKMc15 significantly increased adipocyte differentiation in both, single and double TIS7 and SKMc15 knockout MEF cell lines (Figures EV1C,D and EV2A). Ectopic expression of TIS7 significantly induced the adipocyte differentiation in TIS7 single knockout MEFs (Figure EV1C). In addition, both genes down regulated DLK-1 mRNA expression in dKO MEFs (Figure EV2A, bar chart on the right). We fully agree with the opinion of both reviewers and as already explained above we identified by qPCR in the polysomes that SKMc15 directly regulates DLK-1 translation (Figure 3I).

      • While the scope of the study focuses on the molecular control of adipogenesis by TIS7 and SKMc15 via the regulation of DLK-1, basic elements of the metabolic characterization of the KO animals providing the basis for this study would be useful. Since the difference in body weight between WT and dKO animals is already apparent 1 week after birth (Fig 1a), it would be interesting to determine whether the fat mass is decreased at an earlier age than 6 months (Fig 1b). The dKO mice are leaner despite identical food intake, activity and RER (Sup Fig 1). It remains unclear whether defective fat mass expansion is a result or consequence of this phenotype. Is the excess energy stored ectopically? The authors mention defective lipid absorption, however, these data are not presented in the manuscript. It would be interesting to investigate the relative contribution of calorie intake and adipose lipid storage capacity in the resistance to diet-induced obesity. In addition, data reported in Fig 1c seem to indicate a preferential defect in visceral fat development, as compared to subcutaneous fat. It would be relevant if the authors could quantify it and comment on it. Are TIS7 and SKMc15 differentially expressed in various adipose depots? The authors used embryonic fibroblasts as a paradigm to study adipogenesis. It would be important to investigate, especially in light of the former comment, whether pre-adipocytes from subcutaneous and visceral stroma-vascular fractions present similar defects in adipogenesis. Response: We addressed the issue of lipid storage capacity raised by the reviewer using two experimental methods. First, we have analyzed feces of mice fed with high fat diet. The free fatty acids content in dKO mice feces was significantly (PConcerning the question of younger animals, we have repeated microCT fat measurements on a group of 1-2 months old WT and dKO male mice (n=4 per group). The total amount of abdominal fat was in WT mice significantly higher than in dKO mice (P=0.019; Student’s T-test). We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      We have also followed the reviewer’s advice and revisited our microCT measurements of abdominal fat and anylyzed the possible differences between subcutaneous and visceral fat. In all three types of abdominal fat mass measurement (total, subcutaneous and visceral) there was always significantly (ANOVA P=0.034 subcutaneous, P=0.002 total and P=0.002 visceral fat) less fat in the dKO group (n=8) of mice when compared to WT (n=12) mice. However, the difference was more prominent in visceral (P=0.001; Student’s T-test) than in subcutaneous fat (P=0.027; Student’s T-test). We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      In addition, we have analyzed the expression of TIS7 and SKMc15 mRNA expression in both, inguinal and gonadal WAT. Our qPCR result showed that both genes are expressed in different types of WAT. The qPCR analysis was performed on RNA isolated from undifferentiated SVF cells isolated from several animals. The expression of TIS7 and SKMc15 was normalized on GAPDH. Data represent mean and standard deviation of technical replicates from several mice as labeled in the graph. We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      Topics of a) stromal vascular fraction as a source of pre-adipocytes and b) comparison of TIS7 and SKMc15 roles in gonadal vs. inguinal fat pads we answered in response to the Reviewer #1, point 7. The results are presented in Figures 2, 3 and 4 and in this document.

      Both data and methods are explained clearly. The experiments are, for the most part, adequately replicated. However, whenever multiple groups are compared, ANOVA should be employed instead of t-test for statistical analysis.

      Response: Thank you for pointing this out. Wherever it was applicable, we used ANOVA for the statistical analysis of data.

      **Minor comments:**

      • Figure 4 d. The appropriate control would be WT with empty vector Response: this experiment was entirely replaced by the new Figure 3B where stably transfected MEF cells expressing TIS7 or SKMc15 were used.

      • Figure 7c/d. The appropriate control would be WT with empty vector Response: We have now generated new, confirmatory data in MEF cells stably expressing TIS7 or SKMc15 following lentiviral expression.

      • Figure 5C. An additional control would be WT with WT medium __Response: __We agree with your suggestion and therefore we have incorporated this control in all experimental repeats presented in the new Figure 4C.

      • Figure 2: In the legends, the "x" is missing for the dKO regression formula __Response: __Thank you, we have corrected this mistake. In the current version of the manuscript it is Figure 1D.

      • Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO. __Response: __The original reason for focusing on dKO mice and cells was the obvious and dominant phenotype in this animal model. However, we have sought to address the reviewer's concerns and have now also examined DLK-1 mRNA levels in proliferating SKMc15 knockout MEFs (Figure 3H). In addition to this experiment, we measured DLK-1 mRNA levels also during the process of adipocyte differentiation of single knockout cells. In WT MEFs we observed a transient increase of DLK-1 mRNA only on day 1. In contrast, significantly elevated DLK-1 mRNA levels were found in TIS7 single-knockout MEFs throughout the differentiation process, with the highest level reached at day 8. Interestingly, in SKMc15 single knockout MEFs we found an upregulation of DLK-1 mRNA level in proliferating cells but not a further increase during the differentiation. This supported our idea that SKMc15 acts mainly via translational regulation of DLK-1. We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      To emphasize this point, we revised the entire manuscript accordingly and added data on SKMc15 knockout mice. In particular, experiments presenting data characterizing SKMc15 single knockout mice are presented in: Figures 1C,D,E and F, Figures 2A,B,C and D, Figures 3E,F,H and I, Figures 4A and I and in Figure EV1D.

      Reviewer #2 (Significance (Required)):

      While the effects of DLK-1 on adipogenesis have been widely documented, the factors controlling DLK-1 expression and function remain poorly understood. Here the authors propose a novel mechanism for the regulation of DLK-1, and how it affects adipocyte differentiation. This study should therefore be of interest for researchers interested in the molecular control of adipogenesis and cell differentiation in general. Furthermore, the characterization of the function of SKMc15 in the control of translation may be of interest to a broader readership.

      **Referees cross-commenting**

      I agree with all the comments raised by the other reviewers. Addressing the often overlapping but also complementary questions would help to clarify the molecular mechanisms by which TIS7 and SKMc15 control adipogenesis, and support the conclusions raised by the authors.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In the article, "The negative regulator DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15 (IFRD2)", the authors performed a double knockout (dKO) of TIS7 and its orthologue SKMc15 in mice and could show that those dKO mice had less adipose tissue compared to wild-type (WT) mice and were resistant to a high fat-diet induced obesity. The study takes advantage of number of different methods and approaches and combines both in vivo and in vitro work. However, some more detailed analysis and clarifications would be needed to fully justify some of the statements. Including the role of TIS7 as a transcriptional regulator of DLK1, SKMc15 as translational regulator of DLK1 and overall contribution of DLK1 in the observed differentiation defects. The observed results could still be explained by many indirect effects caused by the knock-outs and more direct functional connections between the studied molecules would be needed. Moreover, some assays appear to be missing biological replicates and statistical analysis. Please see below for more detailed comments:

      **Major comments:**

      -Are the key conclusions convincing? Yes.

      -Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? No.

      -Would additional experiments be essential to support the claims of the paper? Yes. Please see my comments.

      -Are the suggested experiments realistic in terms of time and resources? Recombinant DLK1 10 μg - Tetu-bio - 112€ ; 8 days of adipocyte differentiation in 3 biological replicate ~ 1 month.

      __Response: __We followed the advice of the individual reviewers as expressed in “Referees cross-commenting” and tested this idea experimentally. Since the manufacturer couldn’t suppy information on biological activities of recombinant DLK-1 proteins, we analyzed in vivo the effects of two different ones, namely RPL437Mu01 and RPL437Mu02. The 8-day adipocyte differentiation protocol showed that the RPL437Mu02 protein was cytotoxic to WT MEF cells and therefore could not be used for analysis. On the other hand, treatment with the Mu01 recombinant DLK-1 protein did not result in a substantial cell death. According to oil red O staining, incubation with 3.3 mg/ml (final concentration) RPL437Mu01 led to 75% inhibition of adipocyte differentiation when compared to not treated WT MEFs (Figure EV3B and C).

      -Are the data and the methods presented in such a way that they can be reproduced? Yes.

      -Are the experiments adequately replicated and statistical analysis adequate?

      Adequately reproduced yes. Please see my comments concerning the statistical analysis.

      1)Fig1a: In the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, here something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance between the mice. Moreover, the details of this should be clearly stated in the corresponding Figure legend.

      __Response: __Based on this suggestion, we have revised all of our statistical analyses. In several cases, (Figures 1F, 2B and C) we have replaced the statistical analysis using Student’s T test with Anova. However, based on the definition “the difference between ANOVA and MANOVA is merely the number of dependent variables fit. If there is one dependent variable then the procedure ANOVA is used”, in case of Figure 1A we used ANOVA.

      2)Fig2a: please use an appropriate title for Fig2a instead of "Abdominal fat vs. body mass".

      Response: Title of the Figure 1D (formerly Figure 2a) we changed to “Effect of TIS7 and SKMc15 on the abdominal fat mass”.

      3)Fig2c: in the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, in Fig2c 4 groups are compared (WT, TIS7 KO, SKMc15 KO and dKO) and thus something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance.

      Response: For Figure 1F (formerly Figure 2c), in the revised version of the manuscript, we applied the ordinary one-way ANOVA with Holm-Šidák's multiple comparison test. This analysis gave us statistically even more significant results concerning the difference between WT and dKO mice than previously found by Student's T test. The results in detail were as follows:

      Holm-Šidák's multiple comparisons test Summary Adjusted P Value

      WT vs. TIS7 KO ** 0,0096

      WT vs. SKMc15 KO * 0,0308

      WT vs. dKO **** 4)Fig2 conclusion: Additive or just showing stronger effect?

      Response: We have re-phrased the concluding summary for Figure 1F (formerly Figure 2c). We agree that the precise description of differences found between the weight of single and double knockout animals should be described as “stronger” and not additive effect of knockout of both genes.

      5)Fig3a: the microscope picture for SKMc15 KO shows that cells might have died. Please state the percentage of cell death.

      Response: We would like to comment on these concerns of the reviewer as follows: In the image in Figure 3 of the original manuscript, the density of SKMc15 KO MEF cells after the adipocyte differentiation protocol was lower than in the WT control. Regarding the possible cell death, the cells stained with Oil Red O were adherent and alive. The adipocyte differentiation protocol consists of 3 days proliferation and further 5 days of differentiation including three changes of media during which dead cells are washed away and their vitality cannot be checked. However, in the meantime, we have repeated this protocol and the density of SKMc15 knockout MEFs was now not substantially lower than those of controls. Despite the comparable cell density, we have seen a substantial negative effect of the SKMc15 knockout on the adipogenic differentiation ability of these cells. Several examples are shown here:

      TIS7 +/+ SKMc15 +/+ MEFs

      TIS7 +/+ SKMc15 -/- MEFs

      oil red O staining; 8d differentiated cells

      Importantly, in the current version of our manuscript we replaced MEFs (shown in the former Figure 3a) by SVF cells (Figure 2A in the current manuscript). In these cells we did not see any significant difference in their density after 8 days of the adipocyte differentiation protocol.

      6)Fig3b: It would be informative to additionally observe some of marker genes for adipogenesis and whether all of them are affected.

      Response: In our newly established SVF cell lines, derived from inguinal WAT we have confirmed data previously identified in MEFs. As shown in the new Figure 3, PPARg and C/EBPa mRNA levels were downregulated in all knockout SVF cell lines, both undifferentiated (Figures 3C and D) and adipocyte differentiated (Figures 3E and F). On the other hand, DLK-1 mRNA and protein levels, both in undifferentiated (Figures 2F and G) and adipocyte differentiated (Figure 2H) SVF cells were significantly upregulated in dKO cells when compared to WT cells.

      7)Fig3b: instead of using an unpaired 2-tailed Student's t test with proportion, an one-way ANOVA would be more appropriate.

      __Response: __On the recommendation of the reviewer, we applied a simple ANOVA to our new data from SVF cells using the Holm-Šidák test for multiple comparisons. The Anova summary using GraphPad Prism Ver. 9.2 identified statistically highly significant (P value 8)Fig3c: Same comment as for Fig3b.

      __Response: __Also, in this experiment (now Figure 2C) we used ordinary one-way ANOVA with Holm-Šidák's multiple comparisons test. The ANOVA summary identified statistically highly significant (P value 9)Fig3d: A representative Western blot for 3 independent experiments is shown. Please add the other two as supplementary materials.

      __Response: __Here we provide examples of the requested two additional, independent experiments. These refer now to the Figure 2D in the revised version of the manuscript:

      31 07 2020

      = manuscript

      b____-catenin

      22 07 2020

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      actin

      b____-catenin

      30 07 2020

      actin

      b____-catenin

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      actin

      10)Fig3d:Is this distinguishing between the active and inactive catenin?

      __Response: __No, the b-catenin antibody, that we used is not discriminating between active and inactive b-catenin forms.

      11)Fig4a: Please perform qPCR for measuring DLK-1 mRNA levels in TIS7 KO and SKMc15 KO samples to check whether there is a correlation between mRNA and protein level as the statement of the authors is that "DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15".

      Response: Similar questions were raised by Reviewer 2 on p. 11 “Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO.” Please see our reply to his comment.

      12)Fig4c: please add the other two western blots as supplementary materials.

      __Response: __Here we provide data from two additional, independent experiments.

      13)Fig4d: The effects in MEFs appear quite modest. What about a rescue with TIS7 or SKMc15 alone?

      __Response: __As mentioned already in response to the question 2 of Reviewer #1, in our newly performed experiments we found significant inhibitory effects of ectopic TIS7 and SKMc15 expression on DLK1 levels, identified both by qPCR and WB analyses (Figure 3B).

      14)Page 12, row 207: I would not call histones transcription factors.

      __Response: __We re-phrased this sentence accordingly.

      15)Fig4e: Would be good to see a schematic overview of the locations of the ChIP primers in relation to the known binding sites and the gene (TSS, gene body). Moreover, the results include an enrichment for only one region while in the text two different regions are discussed. Importantly, to confirm the specificity of the observed enrichment, a primer pair targeting an unspecific control region not bound by the proteins should be included.

      __Response: __The selection of oligonucleotide sequences used for ChIP analyses of the binding of b-catenin, TIS7 and SKMc15 to the Dlk-1 promoter was, based on the following reference, as mentioned in Methods section of our original manuscript on p.21, line 494: Paul C, Sardet C, Fabbrizio E. “The Wnt-target gene Dlk-1 is regulated by the Prmt5-associated factor Copr5 during adipogenic conversion”. Biol Open. 2015 Feb 13;4(3):312-6. doi: 10.1242/bio.201411247.

      We used two regions of the Dlk-1 promoter: a proximal one, encompassing the TCF binding site 2 (TCFbs2) and a more distal one, annotated as “A”:

      Oligonucleotide sequences used for ChIP PCR:

      Dlk-1 TCFbs2 5'f CATTTGACGGTGAACATATTGG

      5'r GCCCAGACCCCAAATCTGTC

      Dlk-1 region A (-2263/-2143) 5'f TTGTCTAACCACCCTACCTCAAA

      5’r CTCTGAGAAAAGATGTTGGGATTT

      We observed specific binding at the proximal site.

      16)Fig5a: Has this experiment been replicated? That is no mention about the reproducibility or quantification of this result. This is the main experiment regarding the role of SKMc15 as a translational regulator of DLK1, also mentioned in the title of the manuscript.

      __Response: __This relates to the Figure 4A in the revised manuscript. Yes, we repeated this experiment several times. Here we provide images and quantifications of three independent experiments.

      17)Fig5b: Showing another unaffected secreted protein would be an appropriate control here.

      Response: As recommended by the reviewer, we have performed an additional WB with a recombinant anti-Collagen I antibody [Abcam, [EPR22209-75] ab255809]. Medium from 8 days adipocyte differentiated WT and dKO MEFs was concentrated using Centriprep 30K and resolved on 10% SDS-PAGE gel. Western blot presented in the new Fig 4 B shows even slightly higher amounts of Collagen-1 protein in medium from WT than in dKO MEFs. Mw of the detected band was approximately 35 kDa, which corresponded to the manufacturer’s information.

      18)Fig5c: I would recommend to perform additional experiments to prove that DLK-1 secreted in the medium can contribute and is responsible for the inhibition of the differentiation. Indeed, a time course of adipocyte differentiation followed by the addition of soluble DLK-1 would confirm that DLK-1 can inhibit adipocyte differentiation in this experimental setup. Moreover, silencing (for example RNAi) of DLK1 in the dKO cells before harvesting the conditioned media would allow to estimate the contribution of DLK1 to the observed inhibition of differentiation by the media. This is important because many other molecules could also be mediating this inhibition.

      __Response: __We agree with this reviewer’s concern, which are shared by other reviewers. Similarly, as in response to Reviewer #2 and as already mentioned above, in response to “major comments” of Reviewer #3, in our novel experiments we found that treatment with recombinant DLK-1 protein as well as ectopic expression of DLK-1 blocked adipocyte differentiation of WT MEFs (Figures EV3B,C,D and E) as well as medium from dKO shDLK-1 391 cells (Figure EV3F).

      19)Fig5c: The details and the timeline of the experiment with conditioned media are not provided in the figure or in the methods. At what time point was conditioned media changed? How long were the cells kept in conditioned media? How does this compare to the regular media change intervals? Could the lower differentiation capacity relate to turnover of the differentiation inducing compounds in the media due to longer period between media change? Moreover, is the result statistically significant after replication?

      __Response: __Based on the reviewer`s comment we have added technical information concerning the experimental protocol of the treatment with conditioned media. In general, the treatment for adipocyte differentiation was identical with the previous experiments. The only difference was that after three days in proliferation medium, we used either fresh differentiation medium or 2-day-old differentiation medium from dKO control or dKO-shDLK-1 391 cell cultures then for wild-type cells, as shown in the figure (Figure EV3F). Cells were incubated additional five days with the differentiation medium with two changes of media, every second day. The adipocyte differentiation of medium “donor” cells and the DLK-1 protein levels in these cells were monitored by oil red O staining and Western blot analysis, respectively.

      Additionally, we show now in Figure 4C representative images from three independent biological repeats and in Figure 4D the statistical analysis confirming a significant decrease in adipocyte differentiation ability of WT MEFs following their incubation with a conditioned differentiation medium from dKO MEFs.

      20)Fig5d: please add a statistical analysis of the oil-red-o quantification.

      __Response: __As requested, we included statistical analysis of at least three independent experiments. In Figure 4D we present the statistical analysis confirming a significant decrease in adipocyte differentiation of WT MEFs following their incubation with the differentiation medium from dKO cells. Additionally, Figure 4C shows representative images of oil red O staining from several independent experiments.

      21)Fig7c-d: Does overexpression also rescue the PPARg and CEBPa induction during differentiation. The importance of their induction in undifferentiated MEFs is a little difficult to judge.

      __Response: __We have focused our attention primarily on the ability of TIS7 and SKMc15 to “rescue” the adipocyte differentiation phenotype of dKO MEFs. dKO MEFs stably expressing SKMc15, TIS7 or both genes were differentiated into adipocytes for 8 days and afterwards stained with oil red O. There was a statistically significant increase in oil red O staining following the individual ectopic expression of SKMc15 (p=5.7E-03), a negative effect of TIS7 ectopic expression and a significant (p=9.3E-03), positive effect of co-expression of both genes (Figure EV2A). We found a significant decrease in Dlk-1 mRNA expression following the ectopic expression of TIS7 and/or SKMc15 (Figure EV2A, very right panel). However, C/EBPa mRNA levels were only partially rescued in 8 days differentiated MEFs by TIS7 and/or SKMc15 ectopic expression, and PPARg mRNA levels were not significantly altered.

      22)Fig8: it is not surprising that PPARg targets are not induced in the absence of PPARg. What is the upstream event explaining this defect? Is DLK1 alone enough to explain the results? Could there be additional mediators of the differences? How big are transcriptome-wide differences between WT MEFs and dKO MEFs?

      __Response: __We agree with the reviewer that the lean phenotype of dKO mice most likely cannot be explained by simple transcriptional regulation of PPARg. Although we showed that in undifferentiated MEFs, the levels of PPARg and C/EBPa are controlled (or upregulated) by both TIS7 and SKMc15, we also expected differences in the expression of genes regulating fat uptake. To determine changes in expression of lipid processing and transporting molecules, we performed transcriptome analyses of total RNA samples isolated from the small intestines of HFD-fed WT type and dKO animals. Cluster analyses of lipid transport-related gene transcripts revealed differences between WT type and dKO animals in the expression of adipogenesis regulators. Those included among other genes the following, mentioned as examples:

      • peroxisome proliferator-activated receptors γ (PPARγ) and d [2], fatty acid binding proteins 1 and 2 (FABP1, 2) [3],
      • cytoplasmic fatty acid chaperones expressed in adipocytes,
      • acyl-coenzyme A synthetases 1 and 4 (ACSL1,4) found to be associated with histone acetylation in adipocytes, lipid loading and insulin sensitivity [4],
      • SLC27a1, a2 fatty acid transport proteins, critical mediators of fatty acid metabolism [5],
      • angiotensin-converting enzyme (ACE) playing a regulatory role in adipogenesis and insulin resistance [6],
      • CROT, a carnitine acyltransferase important for the oxidation of fatty acids, a critical step in their metabolism [7],
      • phospholipase PLA2G5 robustly induced in adipocytes of obese mice [8]; [9]. Parts of the following text are embedded in the manuscript.

      We decided to study in more detail the regulation of CD36 that encodes a very long chain fatty acids (VLCFA) transporter because CD36 is an important fatty acid transporter that facilitates fatty acids (FA) uptake by heart, skeletal muscle, and also adipose tissues [10]. PPARγ induces CD36 expression in adipose tissue, where it functions as a fatty acid transporter, and therefore, its regulation by PPARγ contributes to the control of blood lipids. Diacylglycerol acyltransferase 1 (DGAT1), a protein associated with the enterocytic triglyceride absorption and intracellular lipid processing is besides CD36 another target gene of adipogenesis master regulator PPARγ [11]. DGAT1 mRNA levels are strongly up regulated during adipocyte differentiation [12], its promoter region contains a PPARγ binding site and DGAT1 is also negatively regulated by the MEK/ERK pathway. DGAT1 expression was shown to be increased in TIS7 transgenic mice [13] and its expression was decreased in the gut of high fat diet-fed TIS7 KO mice [14]. Importantly, DGAT1 expression in adipocytes and WAT is up regulated by PPARγ activation [11].

      Heatmap of hierarchical cluster analysis of intestinal gene expression involved in lipid transport altered in TIS7 SKMc15 dKO mice fed a high-fat diet for 3 weeks.

      What is the upstream event explaining this defect?

      Wnt pathway causes epigenetic repression of the master adipogenic gene PPARγ. There are three epigenetic signatures implicated in repression of PPARγ: increased recruitment of MeCP2 (methyl CpG binding protein 2) and HP-1α co-repressor to PPARγ promoter and enhanced H3K27 dimethylation at the exon 5 locus in a manner dependent on suppressed canonical Wnt. These epigenetic effects are reproduced by antagonism of canonical Wnt signaling with Dikkopf-1.

      Zhu et al. showed that Dlk1 knockdown causes suppression of Wnt and thereby epigenetic de-repression of PPARγ [15]. Dlk1 levels positively correlate with Wnt signaling activity and negatively with epigenetic repression of PPARγ [16]. Activation of the Wnt pathway caused by DLK1 reprograms lipid metabolism via MeCP2-mediated epigenetic repression of PPARγ [17]. Blocking the Wnt signaling pathway abrogates epigenetic repressions and restores the PPARγ gene expression and differentiation [18].

      **Minor comments:**

      1)Please use the same font in the main text for the references.

      Response: We thank the reviewer for the remark. This issue was corrected.

      Reviewer #3 (Significance (Required)):

      The study provides interesting insights into the role of these factors in adipocyte differentiation that would be relevant especially to researchers working on adipogenesis and cellular differentiation in general. The authors find the studied factors to have additive contribution to the differentiation efficiency. However, the exact nature of the roles and whether they are strictly speaking additive or synergistic is not clear. More detailed analysis of their contribution and molecular interplay would add to the broader interest of the study on molecular networks controlling cellular differentiation.

      **Referees cross-commenting**

      I very much agree on the different points raised by the other reviewers, some of which are also matching my own already raised concerns. And therefore it makes sense to request these modifications from the authors.

      References

      1. Rozman, J., M. Klingenspor, and M. Hrabe de Angelis, A review of standardized metabolic phenotyping of animal models. Mamm Genome, 2014. 25(9-10): p. 497-507.
      2. Lefterova, M.I., et al., PPARgamma and the global map of adipogenesis and beyond. Trends Endocrinol Metab, 2014. 25(6): p. 293-302.
      3. Garin-Shkolnik, T., et al., FABP4 attenuates PPARgamma and adipogenesis and is inversely correlated with PPARgamma in adipose tissues. Diabetes, 2014. 63(3): p. 900-11.
      4. Joseph, R., et al., ACSL1 Is Associated With Fetal Programming of Insulin Sensitivity and Cellular Lipid Content. Mol Endocrinol, 2015. 29(6): p. 909-20.
      5. Anderson, C.M. and A. Stahl, SLC27 fatty acid transport proteins. Mol Aspects Med, 2013. 34(2-3): p. 516-28.
      6. Riedel, J., et al., Characterization of key genes of the renin-angiotensin system in mature feline adipocytes and during in vitro adipogenesis. J Anim Physiol Anim Nutr (Berl), 2016. 100(6): p. 1139-1148.
      7. Zhou, S., et al., Increased missense mutation burden of Fatty Acid metabolism related genes in nunavik inuit population. PLoS One, 2015. 10(5): p. e0128255.
      8. Wootton, P.T., et al., Tagging SNP haplotype analysis of the secretory PLA2-V gene, PLA2G5, shows strong association with LDL and oxLDL levels, suggesting functional distinction from sPLA2-IIA: results from the UDACS study. Hum Mol Genet, 2007. 16(12): p. 1437-44.
      9. Sergouniotis, P.I., et al., Biallelic mutations in PLA2G5, encoding group V phospholipase A2, cause benign fleck retina. Am J Hum Genet, 2011. 89(6): p. 782-91.
      10. Coburn, C.T., et al., Defective uptake and utilization of long chain fatty acids in muscle and adipose tissues of CD36 knockout mice. J Biol Chem, 2000. 275(42): p. 32523-9.
      11. Koliwad, S.K., et al., DGAT1-dependent triacylglycerol storage by macrophages protects mice from diet-induced insulin resistance and inflammation. J Clin Invest, 2010. 120(3): p. 756-67.
      12. Cases, S., et al., Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis. Proc Natl Acad Sci U S A, 1998. 95(22): p. 13018-23.
      13. Wang, Y., et al., Targeted intestinal overexpression of the immediate early gene tis7 in transgenic mice increases triglyceride absorption and adiposity. J Biol Chem, 2005. 280(41): p. 34764-75.
      14. Yu, C., et al., Deletion of Tis7 protects mice from high-fat diet-induced weight gain and blunts the intestinal adaptive response postresection. J Nutr, 2010. 140(11): p. 1907-14.
      15. Zhu, N.L., et al., Hepatic stellate cell-derived delta-like homolog 1 (DLK1) protein in liver regeneration. J Biol Chem, 2012. 287(13): p. 10355-10367.
      16. Zhu, N.L., J. Wang, and H. Tsukamoto, The Necdin-Wnt pathway causes epigenetic peroxisome proliferator-activated receptor gamma repression in hepatic stellate cells. J Biol Chem, 2010. 285(40): p. 30463-71.
      17. Tsukamoto, H., Metabolic reprogramming and cell fate regulation in alcoholic liver disease. Pancreatology, 2015. 15(4 Suppl): p. S61-5.
      18. Miao, C.G., et al., Wnt signaling in liver fibrosis: progress, challenges and potential directions. Biochimie, 2013. 95(12): p. 2326-35.
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In the article, "The negative regulator DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15 (IFRD2)", the authors performed a double knockout (dKO) of TIS7 and its orthologue SKMc15 in mice and could show that those dKO mice had less adipose tissue compared to wild-type (WT) mice and were resistant to a high fat-diet induced obesity. The study takes advantage of number of different methods and approaches and combines both in vivo and in vitro work. However, some more detailed analysis and clarifications would be needed to fully justify some of the statements. Including the role of TIS7 as a transcriptional regulator of DLK1, SKMc15 as translational regulator of DLK1 and overall contribution of DLK1 in the observed differentiation defects. The observed results could still be explained by many indirect effects caused by the knock-outs and more direct functional connections between the studied molecules would be needed. Moreover, some assays appear to be missing biological replicates and statistical analysis. Please see below for more detailed comments:

      Major comments:

      -Are the key conclusions convincing? Yes.

      -Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? No.

      -Would additional experiments be essential to support the claims of the paper? Yes. Please see my comments.

      -Are the suggested experiments realistic in terms of time and resources? Recombinant DLK1 10 μg - Tetu-bio - 112€ ; 8 days of adipocyte differentiation in 3 biological replicate ~ 1 month.

      -Are the data and the methods presented in such a way that they can be reproduced? Yes.

      -Are the experiments adequately replicated and statistical analysis adequate? Adequately reproduced yes. Please see my comments concerning the statistical analysis.

      1)Fig1a: In the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, here something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance between the mice. Moreover, the details of this should be clearly stated in the corresponding Figure legend.

      2)Fig2a: please use an appropriate title for Fig2a instead of "Abdominal fat vs. body mass".

      3)Fig2c: in the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, in Fig2c 4 groups are compared (WT, TIS7 KO, SKMc15 KO and dKO) and thus something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance.

      4)Fig2 conclusion: Additive or just showing stronger effect?

      5)Fig3a: the microscope picture for SKMc15 KO shows that cells might have died. Please state the percentage of cell death.

      6)Fig3b: It would be informative to additionally observe some of marker genes for adipogenesis and whether all of them are affected.

      7)Fig3b: instead of using an unpaired 2-tailed Student's t test with proportion, an one-way ANOVA would be more appropriate.

      8)Fig3c: Same comment as for Fig3b.

      9)Fig3d: A representative Western blot for 3 independent experiments is shown. Please add the other two as supplementary materials.

      10)Fig3d:Is this distinguishing between the active and inactive catenin?

      11)Fig4a: Please perform qPCR for measuring DLK-1 mRNA levels in TIS7 KO and SKMc15 KO samples to check whether there is a correlation between mRNA and protein level as the statement of the authors is that "DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15".

      12)Fig4c: please add the other two western blots as supplementary materials.

      13)Fig4d: The effects in MEFs appear quite modest. What about a rescue with TIS7 or SKMc15 alone?

      14)Page 12, row 207: I would not call histones transcription factors.

      15)Fig4e: Would be good to see a schematic overview of the locations of the ChIP primers in relation to the known binding sites and the gene (TSS, gene body). Moreover, the results include an enrichment for only one region while in the text two different regions are discussed. Importantly, to confirm the specificity of the observed enrichment, a primer pair targeting an unspecific control region not bound by the proteins should be included.

      16)Fig5a: Has this experiment been replicated? That is no mention about the reproducibility or quantification of this result. This is the main experiment regarding the role of SKMc15 as a translational regulator of DLK1, also mentioned in the title of the manuscript.

      17)Fig5b: Showing another unaffected secreted protein would be an appropriate control here.

      18)Fig5c: I would recommend to perform additional experiments to prove that DLK-1 secreted in the medium can contribute and is responsible for the inhibition of the differentiation. Indeed, a time course of adipocyte differentiation followed by the addition of soluble DLK-1 would confirm that DLK-1 can inhibit adipocyte differentiation in this experimental setup. Moreover, silencing (for example RNAi) of DLK1 in the dKO cells before harvesting the conditioned media would allow to estimate the contribution of DLK1 to the observed inhibition of differentiation by the media. This is important because many other molecules could also be mediating this inhibition.

      19)Fig5c: The details and the timeline of the experiment with conditioned media are not provided in the figure or in the methods. At what time point was conditioned media changed? How long were the cells kept in conditioned media? How does this compare to the regular media change intervals? Could the lower differentiation capacity relate to turnover of the differentiation inducing compounds in the media due to longer period between media change? Moreover, is the result statistically significant after replication?

      20)Fig5d: please add a statistical analysis of the oil-re3d-o quantification.

      21)Fig7c-d: Does overexpression also rescue the PPARg and CEBPa induction during differentiation. The importance of their induction in undifferentiated MEFs is a little difficult to judge.

      22)Fig8: it is not surprising that PPARg targets are not induced in the absence of PPARg. What is the upstream event explaining this defect? Is DLK1 alone enough to explain the results? Could there be additional mediators of the differences? How big are transcriptome-wide differences between WT MEFs and dKO MEFs?

      Minor comments:

      1)Please use the same font in the main text for the references.

      Significance

      The study provides interesting insights into the role of these factors in adipocyte differentiation that would be relevant especially to researchers working on adipogenesis and cellular differentiation in general. The authors find the studied factors to have additive contribution to the differentiation efficiency. However, the exact nature of the roles and whether they are strictly speaking additive or synergistic is not clear. More detailed analysis of their contribution and molecular interplay would add to the broader interest of the study on molecular networks controlling cellular differentiation.

      Referees cross-commenting

      I very much agree on the different points raised by the other reviewers, some of which are also matching my own already raised concerns. And therefore it makes sense to request these modifications from the authors.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      In the current study, Vietor et al. aimed to explore the regulation of Delta-like homolog 1 (DLK-1), an inhibitor of adipogenesis, and demonstrated a role for TIS7 and its orthologue SKMc15 in the regulation of adipogenesis by controlling the level of DLK-1. Using mouse models with whole body deficiency of TIS7 (TIS7 KO) or SKMc15 (SKMc15KO) and double KO (TIS7 and SKMc15 dKO) mice, the authors used a combination of in-vivo experiments and cell culture experiments with mouse embryonic fibroblasts derived from the KO animals, to show that the concurrent depletion of TIS7 and SKMc15 dramatically reduced the amount of adipose tissues and protected against diet-induced obesity in mice, which was associated with defective adipogenesis in vitro.

      Major Comments:

      Overall, this study presents convincing evidence that TIOS7 and SKMc15 are necessary for optimal adipogenesis, and proposes a novel mechanism for the control of DLK1 abundance via coordinated regulation of DLK-1 transcription and translation. However, a number of questions remain largely unanswered. In particular, the direct ability of SKMc15 to regulate the translation of DLK-1 is lacking, and this claim remains speculative. SKMc15 being a general inhibitor of translation, SKMc15 may have an effect on adipogenesis independently of its regulation of DLK-1. Thus, addressing the following comments would further improve the quality of the manuscript:

      •The experimental evidence supporting that SKMc15 controls DLK-1 protein levels comes primarily from the observations that DLK-1 abundance is further increased in SKMc15 KO and dKO WAT than in TIS7KO WAT (Fig 3d), and that translation is generally increased in SKMc15 KO and dKO cells (Fig 5a). However, since the rescue experiment is performed in dKO cells, by restoring both TIS7 and SKMc15 together, it is impossible to disentangle the effects on DLK-1 transcription, DLK-1 translation and on adipogenesis. A more detailed description of the TIS7 and SKM15c single KO cells, with or without re-expression of TIS7 and SKMc15 individually, at the level of DLK-1 mRNA expression and DLK-1 protein abundance would be necessary. In addition, polyribosome fractioning followed by qPCR for DLK-1 in each fraction, and by comparison with DLK-1 global expression in control and SKMc15 KO cells, would reveal the efficiency of translation for DLK-1 specifically, and directly prove a translational control of DLK-1 by SKMc15. Alternatively, showing that DLK-1 is among the proteins newly translated in SKMc15 KO cells (Fig. 5a) would be helpful.

      •While the scope of the study focuses on the molecular control of adipogenesis by TIS7 and SKMc15 via the regulation of DLK-1, basic elements of the metabolic characterization of the KO animals providing the basis for this study would be useful. Since the difference in body weight between WT and dKO animals is already apparent 1 week after birth (Fig 1a), it would be interesting to determine whether the fat mass is decreased at an earlier age than 6 months (Fig 1b). The dKO mice are leaner despite identical food intake, activity and RER (Sup Fig 1). It remains unclear whether defective fat mass expansion is a result or consequence of this phenotype. Is the excess energy stored ectopically? The authors mention defective lipid absorption, however, these data are not presented in the manuscript. It would be interesting to investigate the relative contribution of calorie intake and adipose lipid storage capacity in the resistance to diet-induced obesity. In addition, data reported in Fig 1c seem to indicate a preferential defect in visceral fat development, as compared to subcutaneous fat. It would be relevant if the authors could quantify it and comment on it. Are TIS7 and SKMc15 differentially expressed in various adipose depots? The authors used embryonic fibroblasts as a paradigm to study adipogenesis. It would be important to investigate, especially in light of the former comment, whether pre-adipocytes from subcutaneous and visceral stroma-vascular fractions present similar defects in adipogenesis.

      We estimate the suggested experiments above realistic in terms of time and resources and important to support the major conclusions of the study. Both data and methods are explained clearly. The experiments are, for the most part, adequately replicated. However, whenever multiple groups are compared, ANOVA should be employed instead of t-test for statistical analysis.

      Minor comments:

      •Figure 4 d. The appropriate control would be WT with empty vector

      •Figure 7c/d. The appropriate control would be WT with empty vector

      •Figure 5C. An additional control would be WT with WT medium

      •Figure 2: In the legends, the "x" is missing for the dKO regression formula

      •Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO.

      Significance

      While the effects of DLK-1 on adipogenesis have been widely documented, the factors controlling DLK-1 expression and function remain poorly understood. Here the authors propose a novel mechanism for the regulation of DLK-1, and how it affects adipocyte differentiation. This study should therefore be of interest for researchers interested in the molecular control of adipogenesis and cell differentiation in general. Furthermore, the characterization of the function of SKMc15 in the control of translation may be of interest to a broader readership.

      Referees cross-commenting

      I agree with all the comments raised by the other reviewers. Addressing the often overlapping but also complementary questions would help to clarify the molecular mechanisms by which TIS7 and SKMc15 control adipogenesis, and support the conclusions raised by the authors.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This study by Viedor et al. examines the role of TIS7 (IFRD1) and its ortholog SKMc15 (IFRD2) in the regulation of adipogenesis via their ability to modulate the levels of DLK1 (Pref-1), a well-known inhibitor of adipogenesis. They generate SKMc15 KO mice and cross them to previously published TIS7 KO mice. All 3 mutant strains show decreased fat mass, with the effect being most pronounced in double KO mice (dKO). Using mouse embryonic fibroblasts (MEFs) from mutant mice, they authors ascribe a defect in adipogenic differentiation of mutant cells to an upregulation of DLK-1. In the case of TIS7, they propose that this is due to its known inhibition of Wnt signaling, which regulates DLK-1 expression. In the case of SKMc15, they suggest a new mechanism linked to its ability to suppress translation. Overall, the work is of interest, with the finding that SKMc15 regulates adipocyte differentiation being its novelty, and generally well done, though multiple aspects need to be improved to bolster the conclusions put forth.

      Major concerns:

      1)The main mechanism put forth by the authors to explain the inability of dKO cells to differentiate into adipocytes is the upregulation of DLK-1 levels. However, this notion is never directly tested. Authors should test if knockdown of DLK-1 in dKO cells is sufficient to correct the defect in differentiation, or if additional factors are involved.

      2)There are multiple instances were the authors refer to "data not shown", such as when discussing the body length of dKO mice. Please show the data in all cases (Supplementary Info is fine) or remove any discussion of data that is not shown and cannot be evaluated.

      3)Indirect calorimetry data shown in Fig. S1 should include an entire 24 hr cycle and plots of VO2, activity and other measured parameters shown (only RER and food intake are shown), not just alluded to in the legend.

      4)It is surprising that the dKO mice weight so much less than WT even though their food consumption and activity levels are similar, and their RER does not indicate a switch in fuel preference. An explanation could be altered lipid absorption. The authors indicate that feces were collected. An analysis of fat content in feces (NEFAs, TG) needs to be performed to examine this possibility. The discussion alludes to it, but no data is shown.

      5)It would be important to know if increased MEK/ERK signaling and SOX9 expression are seen in fat pads of mutant mice, not just on the MEF system. Similarly, what are the expression levels of PPARg and C/EBPa in WAT depots of mutant mice?

      6)Analysis of Wnt signaling in Fig. 3c should also include a FOPflash control reporter vector, to demonstrate specificity. Also, data from transfection studies should be shown as mean plus/minus STD and not SEM. This also applies to all other cell-based studies (e.g., Fig. 6b,c).

      7)It is unclear why the authors used the MEF model rather than adipocyte precursors derived from the stromal vascular fraction (SVF) of fat pads from mutant mice. If they did generate data from SVF progenitors, they should include it.

      8)Given that the authors' proposed mechanism involves both, transcriptional and post-transcriptional regulation of DLK-1 by TIS7 and SKMc15, Fig. 4d should be a Western blot capturing both of these events, and not just quantitation of mRNA levels.

      9)There is no mention of the impact on brown adipose tissue (BAT) differentiation of KO of TIS7, SKMc15, or the combination. Given the role of BAT in systemic metabolism beyond energy expenditure, the authors need to comment on this issue.

      Minor comments:

      10)The y axis in Fig. 2c is labeled as gain of body weight (g). Is it really the case that WT mice gained 30 g of body weight after just 3 weeks of HFD? This rate of increase seems extraordinary, and somewhat unlikely. Please re-check the accuracy of this panel.

      11)The Methods indicates all statistical analysis was performed using t tests, but this is at odds with some figure legends that indicate additional tests (e.g., ANCOVA).

      12)Please specify in all cases the WAT depot used for the analysis shown (e.g., Fig. 3d is just labeled as WAT, as are Fig. 4a,e, etc.).

      13)Fig. 5d is missing error bars, giving the impression that this experiment was performed only once (Fig. 5c). The legend has no details. Please amend.

      Significance

      The role of TIS7 in adipocyte differentiation is well established. The only truly novel finding in this work is the observation that SKMc15 also plays a role in adipogenesis. The molecular mechanisms proposed (modulation of DLK-1 levels) are not novel, but make sense. However, they need to be bolstered by additional data.

      Referees cross-commenting

      I think we are all in agreement that the findings in this work are of interest, but that significant additional work is required to discern the mechanisms involved. In my view, a direct and specific link between SKMc15 and translation of DLK-1 needs to be established and its significance for adipogenesis in cells derived from the SVF of fat pads determined. Reviewer 2 has suggested some concrete ways to provide evidence of a direct link.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary: The manuscript analyzes how the constriction of a tissue by an enveloping basement membrane alters the migration of cells migrating through that tissue. The tissue analyzed is the Drosophila egg chamber, an important model for basement membrane studies in vivo, and the cells migrating through it are the border cells. The border cells migrate through the center of the egg chamber, moving as a cluster between the nurse cells, which are in turn surrounded by follicle cells, which secrete the basement membrane on the outside of the egg chamber. The authors decrease and increase the basement membrane stiffness with various genetic perturbations, and they find that the border cells move more rapidly when the stiffness is reduced. They then investigate how basement membrane stiffness is communicated to the border cells several cell layers inside, by measuring cortical tension with laser-recoil. They found that external basement membrane stiffness alters the cortical tension of the nurse cells and the follicle cells, such that reduced matrix stiffness causes reduced cortical tension; further, reducing cortical tension directly within the cells also results in increased border cell migration rates. They conclude that basement membrane stiffness can alter cell migration in a new way, by altering constriction and cortical tension, with an inverse relationship between stiffness and migration rate. This is a strong manuscript and I would request very few changes.

      The authors are commended on the rigor and completeness of their study. Several independent methods are used to alter basement membrane stiffness (loss of laminin, knock-down of laminin, knock-down of collagen IV, over-production of collagen IV - all of which end up changing collagen IV levels) and all show the same result. Further, they are extremely rigorous about testing and excluding an attractive alternative hypothesis, that the basement membrane of the border cell cluster itself controls its migration rate. The use of mirror-Gal4 is very elegant and convincing, as it expressed only in the central part of the egg chamber, and they found border cells responded differently only in that region. Moreover, the authors were exceptionally thorough in reproducing the basement membrane mechanical data in their own hands using the bursting assay. Overall, the experimental data support the claims of the paper. There is only one more control I would like to see, for the knockdown of laminin in the border cell cluster with a triple-Gal4 combination. Presumably using all three Gal4 lines was necessary to get complete knockdown, and it would be nice to see anti-laminin for the border cell cluster under these knockdown conditions.

      Despite the rigor, because all of the manipulations to the basement membrane alter the levels of collagen IV, the authors cannot formally exclude the possibility that collagen IV in the basement membrane has another function besides stiffness, perhaps sequestering a signaling ligand, and that this other function somehow alters the cortical tension of the egg chamber. In the paper by Crest et al, externally applied collagenase served as a control for this possibility, but collagenase will not work for the authors because this study is in vivo. I suggest the authors bring up this caveat in the discussion. If they wanted to extend the study (optional), they could knock down the crosslinking enzyme peroxidasin in the egg chamber, which ought to reduce basement membrane stiffness without changing the collagen content. The problem here is that it hasn't already been shown to work that way in the egg chamber, and so both stiffness and collagen levels would need to be measured. Testing the stiffness directly would be difficult, since the bursting assay is not actually a measurement of stiffness (more on that below). Rather than go this route, I suggest just acknowledging the formal possibility, which seems to me unlikely anyway.

      In terms of clarity, the manuscript absolutely needs a schematic at the beginning to introduce the egg chamber and border cell migration, labeling the cell types, showing the route and direction of border cell migration, and labeling the A/P axis. Without this the non-expert reader cannot readily understand the study.

      Finally, in terms of clarity, the authors repeatedly use statements such as "stiffness influences migration rate". Influences how? These results are not intuitive to me, and it would help enormously if the authors would make statements like, decreasing stiffness increases migration (as I tried to in my summary). Here are two examples of statements to refine: • Line 189 - "We found that reducing laminin levels affected the migration speed of both phases (Fig.1F, G)." Please say increased, not affected. • Line 245 -"Altogether, these results demonstrate that the stiffness of the follicle BM influences dynamics and mode of BC migration." Again, be specific about how. There are many such statements, from the abstract to the results to the discussion, where it would help the clarity to be more precise about what kind of influence.

      Minor comments: • The movies are beautiful! • All the quantitative data are shown in bar charts with means and errors. It is much better to show the individual data points, superimposing the means and distributions on top of the individual points. • The bursting assay does not actually measure basement membrane stiffness; rather, it measures failure after elastic expansion. These are related, as was found by Crest et al and the authors say that at one point, but stiffness and failure are not the same thing. Please change the language discussing this assay to "mechanical properties" rather than stiffness. • The laser-recoil assays are done well and are convincing. Throughout the results section, the authors describe these as measuring "cortical tension", which is correct. However, in the figure legends the language changes to "membrane tension" which is only one component of cortical tension. Change them all to cortical tension. • In the Discussion, it would be nice to include something on the two different modes of migration (tumbling and not tumbling). • I suggest changing the title to remove the word "forces", because forces are never directly measured from basement membrane. • Although Dai et al (Science 2020) is discussed near the end, I suggest bringing this reference up to the introduction, so the reader can have the background on the mechanical aspects of border cell migration at the start of this study. • Two typos (there may be more): At the bottom of Fig. 2, text turns strangely white that should probably be black; and in line 260, you mean Fig. S5 not S4 (laser ablation).

      Significance

      Mechanobiology, and mechanobiology of the basement membrane, is a vibrant area of study now, arising from the intersection of biophysics/engineering and genetics. There is general interest in how the basement membrane alters forces within the tissue, and this study is the first to my knowledge to relate basement membrane mechanics to migration via constriction and cortical tension. The authors do a great job of discussing the broader significance of their work in the Discussion. To greatly broaden the scope of this work in the future, the authors could collaborate with a mouse team to look for similar responses in a mammalian tissue, as they discuss. It is worth noting that there is a lot of work on matrix stiffness and migration showing that stiffness promotes migration speed; in these cases, matrix is a substrate, not a compression mechanism. But the opposite nature of the result in interesting and makes this work non-intutive and perhaps hard for some readers to grasp.<br /> As the paper is written now, I think the audience for this work would mostly be oogenesis, border cell migration, and/or basement membrane researchers in the Drosophila community, of which there are many (I am in this camp). With some rewriting to make it more accessible to other audiences, I think it would be interesting to a larger developmental biology audience. The content is not like any other paper I know, but it may be similar in scope and subject matter to the papers detailing how follicle cells and basement membrane interact during follicle rotation.