Selection of ESR1 Y537S on treatment
[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 15
Evidence Type(s): Predictive
Justification: Predictive: The mention of "Selection of ESR1 Y537S on treatment" suggests that the variant is associated with treatment response or resistance, indicating its predictive nature regarding therapy outcomes.
Gene→Variant (gene-first): 5728:Y537S
Genes: 5728
Variants: Y537S
For PIK3CA, considering both treatment arms, 39 variants in 37 patients (37/195, 19.0%) were identified in the day 1 samples (Figure 2A), consistent with previous findings and indicating low levels of polyclonality. Almo
[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 14
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the acquisition of PIK3CA mutations, including E542K, E545K, H1047L, and H1047R, in patients during treatment, indicating that these somatic variants contribute to tumor development or progression. Functional: The validation of acquired PIK3CA mutations using ddPCR and the mention of their allele fraction estimation suggest that these variants alter molecular or biochemical function, supporting their functional impact in the context of cancer.
Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047L 5290:H1047R
Genes: 5290
Variants: E542K E545K H1047L H1047R
Six patients acquired detectable RB1 mutations at end of treatment (p = 0.041, McNemar's test with continuity correction), all of these patients having received palbociclib plus fulvestrant. Two of these 6 patients had 2
[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Predictive
Justification: Oncogenic: The Q257X mutation is described as part of RB1 aberrations that are likely to result in abrogated Rb function, indicating its contribution to tumor development or progression in the context of resistance to therapy. Predictive: The emergence of RB1 aberrations, including the Q257X mutation, is discussed in relation to the treatment with palbociclib plus fulvestrant, suggesting a correlation with resistance to this specific therapy.
Gene→Variant (gene-first): 5925:Q257X
Genes: 5925
Variants: Q257X
A second patient, 253, during treatment with palbociclib plus fulvestrant exhibited marked selection of a subclone featuring an activating mutation in the tyrosine kinase domain of FGFR2 p.K569E, not detectable in the da
[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 6
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the selection of a subclone featuring the FGFR2 p.K569E mutation during treatment with palbociclib plus fulvestrant, indicating a correlation with resistance to therapy. Oncogenic: The FGFR2 p.K569E mutation is described as an activating mutation that contributes to the development of a resistant subclone, suggesting its role in tumor progression.
Gene→Variant (gene-first): 2263:D538G 2099:Q75E 2263:p.K569E
Genes: 2263 2099
Variants: D538G Q75E p.K569E
Clonal evolution and selection on palbociclib plus fulvestrant was clearly evident between day 1 and EOT plasma in 85.7% 12/14 patients (Figure 1, Supplementary figure 6). Patient 390 had two RB1 truncating mutations, p.
[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 5
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the presence of RB1 mutations, including p.Q257X and p.N519fs, in a resistant subclone during treatment with palbociclib plus fulvestrant, indicating a correlation with treatment resistance. Oncogenic: The RB1 mutations are described as contributing to the development of a resistant subclone, suggesting their role in tumor progression and resistance to therapy.
Gene→Variant (gene-first): 5925:p.N519fs 5925:p.Q257X
Genes: 5925
Variants: p.N519fs p.Q257X
As described earlier, ATRX and IDH1/2 mutations co-occur frequently in glioma, and we and others have reported that the latter induce HR defects and PARP inhibitor sensitivity. We thus wanted to understand how PARPi sens
[Paragraph-level] PMCID: PMC8203843 Section: RESULTS PassageIndex: 11
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how IDH1 mutations, specifically R132H, induce sensitivity to PARP inhibitors, indicating a correlation with treatment response. Oncogenic: The context implies that the IDH1 R132H mutation contributes to tumor behavior, particularly in the context of glioma and its interaction with ATRX mutations.
Gene→Variant (gene-first): 3417:R132H
Genes: 3417
Variants: R132H
We first asked whether the EGFR inhibitor afatinib could reduce BTSC viability and sphere formation, using alamarBlue and neurosphere assays. Afatinib inhibited BTSC growth and sphere-forming capacity in a dose-dependent
[Paragraph-level] PMCID: PMC7086303 Section: RESULTS PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how the G598V mutation influences the sensitivity of BTSC cultures to the EGFR inhibitor afatinib, indicating a correlation with treatment response. Oncogenic: The G598V mutation is described as an activating mutation in the context of EGFR, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 1956:G598V
Genes: 1956
Variants: G598V
Somatic mutations in the epidermal growth factor receptor (EGFR) gene are present in approximately 20% (in Caucasians) to 40% (in East Asians) of adenocarcinomas of the lung. Targeted therapy for these lung cancers has b
[Paragraph-level] PMCID: PMC5021039 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the response rates of various EGFR mutations, including E709K, G719X, L858R, and L861Q, to targeted therapies such as gefitinib and erlotinib, indicating their correlation with treatment sensitivity. Oncogenic: The passage mentions that somatic mutations in the EGFR gene, including the variants listed, are present in lung adenocarcinomas and contribute to tumor development, which supports their classification as oncogenic.
Gene→Variant (gene-first): 1956:E709K 1956:G719X 1956:L858R 1956:L861Q 1956:S768I
Genes: 1956
Variants: E709K G719X L858R L861Q S768I
The Kaplan-Meier survival analysis of individual subtypes of KRAS mutation performed in this study showed the following results: the G12D subtype was associated with poor prognosis in PFS (log-rank p = 0.02), other subty
[Paragraph-level] PMCID: PMC4378307 Section: RESULTS PassageIndex: 7
Evidence Type(s): Prognostic
Justification: Prognostic: The passage indicates that the G12D and G12S subtypes of KRAS mutations are associated with poor prognosis in progression-free survival (PFS) and overall survival (OS), respectively, which correlates with disease outcomes independent of therapy.
Gene→Variant (gene-first): 3845:G12D 3845:G12S
Genes: 3845
Variants: G12D G12S
Results: Among a total of 148 patients, 48 (32%) had mutated KRAS, 77% at codon 12 and 23% at codon 13. The PFS was significantly worse in the mutant KRAS patients in comparison to wild type KRAS patients (p < 0.05). The
[Paragraph-level] PMCID: PMC4378307 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage indicates that KRAS mutation, specifically G12D, is associated with a poor prognosis in progression-free survival (PFS), demonstrating its role as an independent negative prognostic factor. Diagnostic: The mention of KRAS mutations, including G12D, being associated with specific outcomes in patients suggests that these mutations can be used to classify or define disease subtypes.
Gene→Variant (gene-first): 3845:G12D
Genes: 3845
Variants: G12D
Interestingly, the irreversible EGFR inhibitor CL-387,785 is more effective than gefitinib or erlotinib for inhibition of colony formation by cells expressing the exon 20 insertion mutant (Figure 4C). Calculated IC50 val
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 19
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the effectiveness of the irreversible EGFR inhibitor CL-387,785 in inhibiting colony formation and autophosphorylation in cells expressing the L858R variant, indicating a correlation with treatment response. Oncogenic: The L858R variant is described in the context of its role in transformation assays, suggesting that it contributes to tumor development or progression.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Given the association between the presence of activating EGFR mutations and clinical responses to gefitinib or erlotinib in lung adenocarcinoma patients, we assessed the ability of these EGFR inhibitors to inhibit anchor
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 16
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the correlation between the presence of activating EGFR mutations, including G719S, L747_E749del A750P, and L858R, and clinical responses to gefitinib or erlotinib, indicating their sensitivity to these therapies. Oncogenic: The passage describes the ability of the mentioned EGFR mutations to promote anchorage-independent growth in cell lines, which is indicative of their role in tumor development or progression.
Gene→Variant (gene-first): 1956:G719S 1956:L747_E749del A750P 1956:L858R
Genes: 1956
Variants: G719S L747_E749del A750P L858R
Constitutive phosphorylation of mutant EGFR on Y1068 (see Figure 2A), the binding site for the phosphatidylinositol 3-kinase interacting protein Gab1, indicated that signaling pathways downstream of phosphatidylinositol
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the mutant EGFR leads to the constitutive activation of the serine/threonine kinase Akt, indicating an alteration in molecular function related to cell survival signaling pathways.
Gene→Variant (gene-first): 207:serine/threonine
Genes: 207
Variants: serine/threonine
Consistent with previous reports on L858R mutant EGFR, STAT signaling pathways are constitutively activated in the transformed NIH-3T3 cells. Immunoblotting with antibodies specific for phosphorylated Y705, the tyrosine
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage describes how the L858R mutant EGFR alters molecular function by activating STAT signaling pathways and increasing STAT3-dependent gene expression, as demonstrated through immunoblotting and reporter assays. Oncogenic: The L858R variant is associated with transformed NIH-3T3 cells, indicating its contribution to tumor development or progression.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
We next asked whether constitutive activation of mutant EGFR is associated with alterations in downstream signaling pathways. Because Y1173, a docking site for the adaptor protein Shc, is constitutively phosphorylated on
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the L858R variant of EGFR alters the molecular function of Shc binding and phosphorylation, indicating a change in biochemical activity associated with the mutant protein. Oncogenic: The L858R variant is described as contributing to constitutive activation of EGFR, which is associated with tumor development or progression, as evidenced by the downstream signaling alterations observed in the study.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The constitutive increase in EGFR activity appears to be ligand-independent, as a combination of neutralizing antibodies against EGF, TGFalpha, and EGFR failed to inhibit elevated basal levels of L858R autophosphorylatio
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the L858R variant alters the molecular function of EGFR, specifically its autophosphorylation activity in response to EGF stimulation, indicating a change in biochemical function. Oncogenic: The L858R variant is associated with tumor development, as it is mentioned in the context of a lung adenocarcinoma cell line, suggesting its role in cancer progression.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
To determine the ability of mutant EGFR to transform a more physiologically relevant cell type, retroviruses expressing the L858R and G719S mutant forms of EGFR were introduced into hTBE cells expressing the SV40 early r
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 6
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage describes how the mutant forms of EGFR (L858R, G719S, L747_E749del A750P, and D770_N771insNPG) contribute to enhanced anchorage-independent growth in hTBE cells, indicating their role in tumor development or progression. Functional: The passage discusses the expression levels of the deletion and insertion mutants (L747_E749del A750P and D770_N771insNPG) and their ability to form colonies in soft agar, suggesting alterations in molecular function related to tumorigenesis.
Gene→Variant (gene-first): 1956:D770_N771insNPG 1956:G719S 1956:L747_E749del A750P 1956:L858R 3265:V12
Genes: 1956 3265
Variants: D770_N771insNPG G719S L747_E749del A750P L858R V12
Representative exon 19 deletion and exon 20 insertion mutations of EGFR were then assessed for transforming activity. Mutants L747_E749del, A750P and D770_N771insNPG (K. Naoki and M. M., unpublished data) were introduced
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 5
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses how the EGFR variants A750P, D770_N771insNPG, L747_E749del, L858R, and G719S contribute to tumor development, as evidenced by their ability to form colonies in soft agar and exhibit loss of contact inhibition in NIH-3T3 cells.
Gene→Variant (gene-first): 1956:A750P 1956:D770_N771insNPG 1956:E749del 1956:G719S 1956:L858R
Genes: 1956
Variants: A750P D770_N771insNPG E749del G719S L858R
Transformation of NIH-3T3 cells by L858R or G719S EGFR was further assessed in two independent assays. Expression of the EGFR point mutants in NIH-3T3 cells caused loss of contact inhibition, resulting in focus formation
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 4
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage describes how the L858R and G719S EGFR variants contribute to tumor development, as evidenced by their ability to transform NIH-3T3 cells and form tumors in immunocompromised mice. Functional: The passage indicates that the expression of the EGFR point mutants (L858R and G719S) in NIH-3T3 cells caused loss of contact inhibition, suggesting that these variants alter the molecular function of the EGFR protein.
Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R
Genes: 1956
Variants: D837A G719S L858R
To assess the oncogenic potential of EGFR kinase domain mutants, tumor-derived mutations were introduced into the wild-type human EGFR cDNA by site-directed mutagenesis. The resulting wild-type and mutant EGFR cDNAs were
[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the ability of the G719S and L858R mutations to transform NIH-3T3 cells, indicating that these somatic variants contribute to tumor development. Functional: The passage describes how the mutations G719S and L858R alter the ability of EGFR to induce colony formation in soft agar, demonstrating a change in molecular function related to tumorigenesis.
Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R
Genes: 1956
Variants: D837A G719S L858R
Functional mutations were found in 31%(9/29) of patients; 7 of these mutations were novel and another was the L858R mutation. All missense mutations were found to be activating mutations and responsive to erlotinib. Of t
[Paragraph-level] PMCID: PMC2970593 Section: ABSTRACT PassageIndex: 6
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage indicates that the L858R mutation is an activating mutation that is responsive to erlotinib, suggesting a correlation with treatment response. Oncogenic: The mention of the L858R mutation as an activating mutation implies its contribution to tumor development or progression, consistent with oncogenic behavior.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Tumour tissue from the pons of 66 DIPG patients was screened for K27M mutation in histone H3 as previously described. 42/66 (64 %) were found to be mutated for K27M-H3.3, with an additional eight patients with K27M-H3.1
[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 9
Evidence Type(s): Prognostic, Diagnostic, Oncogenic
Justification: Prognostic: The passage indicates that patients with the K27M mutation in histone H3 have worse overall survival compared to patients with no histone mutations, suggesting a correlation between the variant and disease outcome. Diagnostic: The K27M mutation is associated with specific tumor histologies and is used to classify patients into different groups based on their histone mutation status, indicating its role in defining disease subtypes. Oncogenic: The K27M mutation in histone H3 is described as contributing to tumor development, as it is found in a significant proportion of tumors and correlates with specific tumor characteristics.
Gene→Variant (gene-first): 90:K27M
Genes: 90
Variants: K27M
K27M-H3.3 mutations and histology
[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 8
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 90:K27M
Genes: 90
Variants: K27M
For 44 patients sufficient tissue was available to assess extent of spread and the presence of disseminated disease. Seventeen of 44 patients (38.6 %) had leptomeningeal spread at autopsy (for example, see Fig. 1b). Furt
[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 7
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage discusses overall survival rates for patients with and without leptomeningeal spread, indicating that the presence of the K27M mutation correlates with worse survival outcomes. Oncogenic: The K27M variant is mentioned in the context of tumor spread and is associated with specific tumor types (GBM), suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 90:K27M 5290:p.Glu545Gly 90:p.Gly328Val
Genes: 90 5290
Variants: K27M p.Glu545Gly p.Gly328Val
1,449 genes with somatic CNA were observed in at least 10% of tumors (S1 Table) and were located on 26 genomic segments on chromosomes 1, 2, 3, 5, 8, 10, 11, 17, 18, 19 and 20. The size of these genomic loci ranged from
[Paragraph-level] PMCID: PMC7467277 Section: RESULTS PassageIndex: 5
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses somatic copy number alterations (CNAs) and specifically mentions a segment on chromosome 8 that exhibits deletion, indicating a potential role in tumor development or progression.
Gene→Variant (gene-first): NA:chr8:208343-27992852
Genes: NA
Variants: chr8:208343-27992852
Diffuse intrinsic pontine glioma (DIPG) is the most severe paediatric solid tumour, with no significant therapeutic progress made in the past 50 years. Recent studies suggest that diffuse midline glioma, H3-K27M mutant,
[Paragraph-level] PMCID: PMC4654747 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Predictive
Justification: Oncogenic: The passage discusses how mutations in histone H3, specifically K27M and K27I, contribute to tumor development and progression in diffuse intrinsic pontine glioma (DIPG), indicating their role as somatic variants driving distinct oncogenic programs. Predictive: The K27M mutation is associated with a lack of clinical response to radiotherapy and earlier relapse, suggesting that this variant correlates with treatment resistance and impacts patient outcomes.
Gene→Variant (gene-first): 3021:K27I 3021:K27M 126961:lysine-to-isoleucine
Genes: 3021 126961
Variants: K27I K27M lysine-to-isoleucine
G309 or S310 mutations on the HER2 extracellular domain II induce receptor activation. Clinically, S310F is most frequent among HER2 extracellular domain mutations and patients with the S310F mutation without HER2 amplif
[Paragraph-level] PMCID: PMC6843359 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the response of patients with the S310F mutation to trastuzumab and pertuzumab treatments, indicating a correlation between the variant and treatment response. Functional: The passage describes how the S310F mutation alters the ability of the HER2 receptor to form homodimers or heterodimers and its interaction with EGFR, demonstrating a change in molecular function.
Gene→Variant (gene-first): 2064:G309A 2064:G309E 2064:S310 2064:S310F 2064:S310Y
Genes: 2064
Variants: G309A G309E S310 S310F S310Y
All patients with a T790M mutation were treated with osimertinib (n=8). There were six partial remissions and one stable disease on osimertinib, one patient had not been assessed at data bank lock. Two patients progresse
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 25
Evidence Type(s): Predictive, Prognostic
Justification: Predictive: The passage discusses the response of patients with a T790M mutation to osimertinib treatment, indicating a correlation between the variant and treatment response. Prognostic: The passage mentions progression-free survival (PFS) and overall survival (OS) in relation to the T790M mutation, suggesting a correlation with disease outcome independent of therapy.
Gene→Variant (gene-first): 1956:T790M
Genes: 1956
Variants: T790M
Of eleven patients with acquired resistance to 1st/2nd generation EGFR-TKI therapy, ten had an accessible progressive lesion and were re-biopsied. In the remaining case, liquid biopsy was used. In eight patients (73%), a
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 24
Evidence Type(s): Predictive, Diagnostic, Oncogenic, Functional
Justification: Predictive: The passage discusses the T790M mutation in the context of resistance to EGFR-TKI therapy and its correlation with treatment response, particularly with osimertinib. Diagnostic: The T790M mutation is mentioned as a resistance mutation detected in patients with acquired resistance to EGFR-TKI therapy, indicating its role in classifying the disease state. Oncogenic: The T790M mutation is described as a resistance mutation that contributes to tumor progression in patients undergoing treatment, indicating its role in cancer development. Functional: The passage implies that the T790M mutation alters the response to therapy, suggesting a change in molecular function related to drug resistance mechanisms.
Gene→Variant (gene-first): 1956:G719C 1956:T790M 673:V600E 1956:c.2155G>T 1956:p.G719C 7157:p.R248W
Genes: 1956 673 7157
Variants: G719C T790M V600E c.2155G>T p.G719C p.R248W
Forty-seven of 55 patients with a sensitizing driver mutation received targeted therapy. Their treatment course is shown in the swimmer plot (Figure 4). Eight driver-positive patients did not receive targeted therapy eit
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 17
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses patients with sensitizing driver mutations receiving targeted therapy, indicating a correlation between the presence of these mutations (including E709A and G719S) and the response to treatment. Oncogenic: The mention of E709A and G719S as part of a complex EGFR mutation suggests that these somatic variants contribute to tumor development or progression, particularly in the context of the patient's advanced disease stage.
Gene→Variant (gene-first): 1956:E709A 1956:G719S
Genes: 1956
Variants: E709A G719S
ALK/ROS1/BRAF: 111 patients (97% EGFR negative) were tested for an ALK translocation with 8 positive results (7%). Five of 56 men (8.9%), and 3 of 54 women (5.6%) had a positive ALK-FISH test. In line with the literature
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 13
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage indicates that the classic V600E mutation was detected in patients, suggesting its role in tumor development or progression, particularly in the context of BRAF mutations.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
Transition exon 21 c.2527G>A; p.V843I mutation in an ex-smoker with NSCLC (NOS) who did not receive targeted EGFR-TKI therapy. This mutation has been reported twice in lung cancer (COSMIC databank, accessed 31.10.16) and
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 11
Evidence Type(s): Diagnostic, Predictive, Oncogenic
Justification: Diagnostic: The variant c.2527G>A; p.V843I is associated with lung cancer, as indicated by its reporting in the COSMIC databank and its presence in a patient with NSCLC. Predictive: The passage states that the mutation does not confer sensitivity to EGFR-TKIs, indicating a lack of response to this specific therapy. Oncogenic: The variant is described as "activating from a biological point of view," suggesting it contributes to tumor development or progression in lung cancer.
Gene→Variant (gene-first): 1956:c.2527G>A 1956:p.V843I
Genes: 1956
Variants: c.2527G>A p.V843I
Transition exon 21 c.2543C>T; p.P848L in a male ex-smoker with AC G1 stage IV (M1b). This patient showed stable disease on erlotinib with a relatively short PFS of 4.6 months. This mutation has been previously described
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Diagnostic, Oncogenic
Justification: Predictive: The passage indicates that the patient showed stable disease on erlotinib, suggesting a correlation between the variant and response to therapy. Diagnostic: The variant is mentioned in the context of being previously described in lung samples, indicating its association with a specific disease subtype (lung cancer). Oncogenic: The variant is discussed in relation to a patient with stage IV lung cancer, suggesting its potential role in tumor development or progression.
Gene→Variant (gene-first): 1956:c.2543C>T 1956:p.P848L
Genes: 1956
Variants: c.2543C>T p.P848L
Transition exon 19 c.2258T>C; p.P753L in a female smoker with SCC stage IIIA. This mutation has not been described previously in lung cancer (COSMIC databank search 31.10.2016). Upon recurrence after resection, the patie
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the patient's treatment with erlotinib and mentions early progression after disease stabilization, indicating a correlation between the variant and treatment response. Oncogenic: The variant is associated with a patient who has stage IIIA SCC, suggesting that it may contribute to tumor development or progression in the context of lung cancer.
Gene→Variant (gene-first): 1956:c.2258T>C 1956:p.P753L
Genes: 1956
Variants: c.2258T>C p.P753L
Transition exon 19 c.2203G>A; p.G735S in a female ex-smoker with AC G3 stage IV (M1b). This mutation has been described twice in lung cancer (COSMIC databank accessed 31.10.2016) with no data on response to EGFR-TKI ther
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 8
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the patient's progressive disease on 2nd line EGFR-TKI therapy with gefitinib, indicating a lack of response to the treatment associated with the variant. Oncogenic: The variant c.2203G>A; p.G735S is mentioned in the context of lung cancer, suggesting it may contribute to tumor development or progression.
Gene→Variant (gene-first): 1956:c.2203G>A 1956:p.G735S
Genes: 1956
Variants: c.2203G>A p.G735S
Driver mutations were detected in 55 patients of 265 tested AC patients (20.8%). The distribution and frequency of the 55 patients with an oncogenic driver mutation are shown in Figure 1A. Sensitizing EGFR-mutations were
[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 6
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage indicates that the BRAF mutation V600E is classified as an oncogenic driver mutation, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
To test our results in a high-throughput manner, we utilized the CTD2 database, where we examined the area under the curve (AUC) of 39 different ovarian cancer cell lines and 406 different compounds (targeted and cytotox
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 28
Evidence Type(s): Predictive
Justification: Predictive: The passage discusses the association between the rs1801018 variant and response to different treatments, indicating a correlation with treatment sensitivity.
Gene→Variant (gene-first): 596:(AUC) of 39 596:rs1801018
Genes: 596
Variants: (AUC) of 39 rs1801018
Since differences in localization sometimes produce differences that might lead to observed paclitaxel resistance, we studied BCL2 spatial expression patterns in the reference form and in the 21 T > C form. HEK293T cells
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 26
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the study of BCL2 spatial expression patterns in relation to paclitaxel resistance, indicating a potential correlation between the 21 T > C variant and treatment response. Functional: The passage describes an immunofluorescence assay that assesses the localization patterns of the BCL2 variant, indicating an alteration in molecular function related to protein localization.
Gene→Variant (gene-first): 596:21 T > C
Genes: 596
Variants: 21 T > C
To observe transcript differences at the level of the single transcript, we used digital PCR, which brings potential advantages over real-time PCR, including the ability to obtain absolute quantification without external
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 25
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how the variant 21 T > C leads to higher BCL2 expression, which is associated with resistance to the therapy paclitaxel. Oncogenic: The variant 21 T > C is implicated in contributing to tumor behavior by leading to increased expression of BCL2, which is associated with resistance to treatment, indicating a role in tumor progression.
Gene→Variant (gene-first): 596:21 T > C
Genes: 596
Variants: 21 T > C
Transcripts that include the 21 T > C variant are more abundant in the presence of paclitaxel
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 24
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage indicates that the presence of the 21 T > C variant correlates with increased abundance of transcripts when treated with paclitaxel, suggesting a relationship with treatment response. Functional: The mention of increased abundance of transcripts implies that the 21 T > C variant alters molecular function, likely affecting gene expression in response to paclitaxel.
Gene→Variant (gene-first): 596:21 T > C
Genes: 596
Variants: 21 T > C
These results thus show that cells with a BCL2 sequence with a C at location 21 present a more stable BCL2 transcript, which may lead to higher protein levels. To directly quantify the effect of the variant on the in vit
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 22
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the in vitro sensitivity to paclitaxel in relation to the 21 T > C variant, indicating that this variant may influence the response to the therapy. Functional: The variant is shown to alter the stability of the BCL2 transcript, which may lead to higher protein levels, indicating a change in molecular function.
Gene→Variant (gene-first): 596:21 T > C
Genes: 596
Variants: 21 T > C
These results suggest a general BCL2-related mechanism. That is, the findings we described so far are not necessarily intrinsic to any cancer mechanism and should be observable in other cell types. Variation at location
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 20
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the 21 T > C variant may regulate the transcriptional activity of the BCL2 gene, indicating an alteration in molecular function as evidenced by the increase in BCL2 mRNA levels in lymphocytes.
Gene→Variant (gene-first): 596:21 T > C 596:C instead of a T
Genes: 596
Variants: 21 T > C C instead of a T
These findings led us to hypothesize that the + 21 T > C substitution leads, through a more stable transcript, to an increase in BCL2 protein levels. We tested this hypothesis in cell lines, in 1417 patient samples from
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the + 21 T > C substitution alters BCL2 protein levels, indicating a change in molecular function due to the variant. Oncogenic: The context of the study involves ovarian cancer patients, and the variant is associated with increased BCL2 protein levels, which can contribute to tumor development or progression.
Gene→Variant (gene-first): 596:+ 21 T > C 596:C instead of a T
Genes: 596
Variants: + 21 T > C C instead of a T
Changing T to C at location 21 leads to an increase in protein levels in vitro
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 15
Evidence Type(s): Functional
Justification: Functional: The passage indicates that changing T to C at a specific location alters protein levels, which demonstrates a change in molecular function.
Gene→Variant (gene-first): 596:T to C
Genes: 596
Variants: T to C
These findings rely on the hypothesis that genomic variation alters transcript stability. To measure the stability of the different BCL2 mRNA transcripts, we used the same set of transfected cells and variants described
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the T > C variant alters the stability of BCL2 mRNA transcripts, indicating a change in molecular function.
Gene→Variant (gene-first): 596:T > C
Genes: 596
Variants: T > C
To experimentally validate these computational results, we studied the effect of sequence modification on transcript stability. Ovarian carcinoma HeyA8 cells were transfected with GFP or one of three GFP-BCL2 variants: r
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional
Justification: Functional: The passage discusses how sequence modifications of BCL2 variants affect transcript stability and expression levels, indicating that the variants alter molecular function.
Gene→Variant (gene-first): 596:+21 C 596:+21 T 728378:+23 C > T 596:T > C
Genes: 596 728378
Variants: +21 C +21 T +23 C > T T > C
Changing location 21 in BCL2 from C to T stabilizes BCL2 RNA secondary structure in vitro
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional
Justification: Functional: The variant C to T alters the molecular function by stabilizing the BCL2 RNA secondary structure, as indicated by the in vitro analysis.
Gene→Variant (gene-first): 596:C to T
Genes: 596
Variants: C to T
Here, we used RNA-folding prediction software to assess structural changes that could result from the C > T change in BCL2. As demonstrated in ref. , synonymous changes in UTRs that alter the mRNA structural ensemble of
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 11
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the C > T change in BCL2 alters the mRNA structural ensemble, indicating that the variant affects molecular function related to RNA structure.
Gene→Variant (gene-first): 596:+ 21 T > C 728378:+ 23 C > T 596:C > T 596:T > C 596:T at position 21
Genes: 596 728378
Variants: + 21 T > C + 23 C > T C > T T > C T at position 21
The T >C variant at location 21 of BCL2 changes its RNA secondary structure
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 9
Evidence Type(s): Functional
Justification: Functional: The passage indicates that the T > C variant alters the RNA secondary structure of BCL2, which is a change in molecular function.
Gene→Variant (gene-first): 596:T >C
Genes: 596
Variants: T >C
This variation is referred to as rs1801018 in the NCBI's public archive of all short-sequence variations (dbSNP). The variation status matched patient resistance to paclitaxel in a manner that was able to retrospectively
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 7
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses how the variant rs1801018 correlates with patient resistance to paclitaxel, indicating its predictive value for treatment response. Diagnostic: The variation is associated with the classification of patients based on their treatment response, helping to define which patients are likely to respond to single or multiple lines of therapy.
Gene→Variant (gene-first): 596:T instead of a C 596:rs1801018
Genes: 596
Variants: T instead of a C rs1801018
However, one variation, the transition from a C to a T at location 21 of BCL2 (+ 21 T > C, Fig. 1b), showed a significant association with resistance to paclitaxel (Fig. 1c).
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 6
Evidence Type(s): Predictive
Justification: Predictive: The passage indicates that the variant + 21 T > C is associated with resistance to paclitaxel, which correlates the variant with treatment response.
Gene→Variant (gene-first): 596:+ 21 T > C 596:C to a T
Genes: 596
Variants: + 21 T > C C to a T
Combined, TUBB1 and BCL2 have 11 variable loci (Fig. 1b and Fig. S1, Tables S1-S4). These variable regions have all been recorded as single-nucleotide polymorphisms (SNPs). Among these 11 loci, eight showed variation in
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 5
Evidence Type(s): Diagnostic
Justification: Diagnostic: The variant rs6070697 is discussed in the context of its distribution among treatment groups and its presence in both patients and controls, indicating its association with the study population and suggesting a role in defining or classifying the patient cohort.
Gene→Variant (gene-first): 81027:rs6070697
Genes: 81027
Variants: rs6070697
A T > C variation at position 21 of the BCL2 sequence predicts response to paclitaxel
[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 2
Evidence Type(s): Predictive
Justification: Predictive: The passage states that the T > C variation at position 21 of the BCL2 sequence predicts response to paclitaxel, indicating a correlation with treatment response.
Gene→Variant (gene-first): 596:T > C variation at position 21
Genes: 596
Variants: T > C variation at position 21
To assess this possibility, we first estimated, using the NetMHCpan-4.0 algorithm, how frequently in the general population neopeptides derived from the out-of-frame sequence following pathogenic mutations were predicted
[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 26
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses common founder mutations such as BRCA2:c.5946delT and BRCA1:c.68_69delAG, indicating their association with neopeptides that are likely presented in the population, which relates to defining or classifying a disease. Oncogenic: The mention of pathogenic mutations and their associated neoantigens suggests that these variants contribute to tumor development or progression, as they are described as potential tumor antigens.
Gene→Variant (gene-first): 672:c.5266dupC 675:c.5946delT 672:c.68_69delAG
Genes: 672 675
Variants: c.5266dupC c.5946delT c.68_69delAG
Interestingly, we noted very few missense pathogenic mutations in the set of reported reversions. For example, in the Incidence tumour sequencing datasets used previously, we found that (40/849, 4.7%) of these pathogenic
[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the presence of pathogenic missense mutations, specifically mentioning the BRCA1:p.C61S and p.M1I mutations, in the context of their association with disease, indicating their role in defining or confirming a disease subtype. Oncogenic: The passage refers to the BRCA1:p.C61S and p.M1I mutations as pathogenic, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.
Gene→Variant (gene-first): 672:p.C61S 672:p.M1I
Genes: 672
Variants: p.C61S p.M1I
For each of these common founder mutations, we noted that the reversions that emerged in these patients were generally localised to the 3' flanking sequence of the original pathogenic mutation (transcriptionally downstre
[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 675:c.7355delA
Genes: 675
Variants: c.7355delA
Amongst the 91 patients we collated data from, most (68/91, 75%) had unique pathogenic mutations (Figure 1E, annotated as "single-patient mutations" and Supplementary Figure 1). There were eight pathogenic mutations repr
[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.
Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG
Genes: 672 675
Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG
Median OS was 48 weeks (range=4-140). None of the following factors had a significant impact on OS: PS (P=0.403), histology (P=0.198), smoking (P=0.242), sex (P=0.475), skin rash (P=0.182) and EFGR IHC expression (P=0.63
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The median follow-up period was 109 weeks and the median time to tumour progression (TTP) 20 weeks (range=4-140). A total of 23 (36%) patients had a TTP>24 weeks and 7 (10.9%) >52 weeks (Table 5). There was no difference
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The DCR was significantly higher in patients of the 'classical' mutations than in patients of the 'wild-type' (90.9 and 43.3%, respectively; P=0.006) group; conversely, there was no significant difference between the DCR
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.
Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R
Genes: 1956
Variants: E746V G719D L858R
A total of 1 (1.1%) patient (no. 13) had two 'other' mutations, while 3 (3.4%) patients (nos. 9, 11 and 18), who were included in the 'classical mutations' group, had both the exon 21 L858R mutation and an 'other' mutati
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
According to the mutational status, three groups of patients were identified as follows: (i) the 'wild-type' group (n=61 patients; 71%) with no detectable mutations; (ii) 'classical' mutations group (n=11 patients, 13%;
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.
Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R
Genes: 1956
Variants: E746V G719D L858R
'Classical' mutations in the EGFR tyrosine kinase domain (exons 18, 19 and 21) have been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. The aim of the current study was to evalua
[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.
Gene→Variant (gene-first): 1956:G719X 1956:L858R
Genes: 1956
Variants: G719X L858R
The finding that gilteritinib inhibited FLT3-D835Y and FLT3-ITD-D835Y, both of which harbor mutations in the activation loop essential for binding type 2 inhibitors, suggests that gilteritinib is a type 1 FLT3 inhibitor.
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.
Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691
Genes: 2322
Variants: D835 D835Y F691
Since mutations within the TKD of FLT3 (eg, FLT3-D835Y or FLT3-F691) often confer resistance to FLT3 inhibitors that were previously effective against FLT3-ITD, the effect of gilteritinib on these resistance mutations wa
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.
Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I
Genes: 2322
Variants: D835Y F691 F691 L F691I
Inhibitory activity of gilteritinib against FLT3 containing ITD +- D835Y or F691 L/I mutations
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.
Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I
Genes: 2322
Variants: D835Y F691 L/I
Four human NSCLC cell lines expressing different forms of the EGFR were investigated. Sensitivity of each cell line to the anti-proliferative effect of erlotinib was evaluated by methylene blue assay and is presented in
[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.
Gene→Variant (gene-first): 1956:L858R 1956:T790M
Genes: 1956
Variants: L858R T790M
In addition to the main driver mutations discussed above, several patients carry recurrent mutations that are clearly subclonal (present in some but not all tumour areas in a patient) and occur at later stages of tumour
[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.
Gene→Variant (gene-first): 5290:H1047R
Genes: 5290
Variants: H1047R
We analysed 134 punch cores from nine DIPG whole brain specimens obtained at autopsy as previously described. Selected punch cores represented multiple spatial regions of the primary tumour and adjacent areas within the
[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic
Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.
Gene→Variant (gene-first): 8358:K27M
Genes: 8358
Variants: K27M
Diffuse Intrinsic Pontine Gliomas (DIPGs) are deadly paediatric brain tumours where needle biopsies help guide diagnosis and targeted therapies. To address spatial heterogeneity, here we analyse 134 specimens from variou
[Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Diagnostic
Justification: Oncogenic: The passage discusses how the K27M mutation contributes to tumorigenesis in DIPGs, indicating its role in tumor development and progression. Diagnostic: The K27M mutation is associated with the diagnosis of DIPGs, as it helps guide diagnosis and targeted therapies in these tumors.
Gene→Variant (gene-first): 8358:K27M
Genes: 8358
Variants: K27M
Somatic mutations found within the tyrosine kinase domain (TKD) of the human epidermal growth factor (HER) family of receptors have been implicated in the development and progression of non-small cell lung cancer (NSCLC)
[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Predictive, Functional
Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Taken together, these data suggest that the V855A mutation alters the activity of HER3, which may correlate with a malignant phenotype.
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To elucidate and predict the impact of mutant V855A on the conformation of the wild-type HER3, protein modeling was performed via the automated I-TASSER server. Server predicted models were further refined by submitting
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Impact of V855A on HER3 protein structure
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24
Evidence Type(s): Functional
Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We further examined the effects of the inhibitors on HER-related signaling activity and survival using the Ba/F3 model system. Afatinib (100nmol/L) potently inhibited NRG1beta-induced phosphorylation of HER3, wild type H
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23
Evidence Type(s): Predictive
Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To assess the effect of the inhibitors on colony formation, Ba/F3 co-transfectants were seeded onto methyl-cellulose and treated with HER inhibitors in the presence of NRG1beta. As shown in Fig 6b, afatinib (100 nmol/L)
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To investigate whether HER3-V855A can be therapeutically targeted; we examined the growth inhibitory effects of inhibitors targeting the extracellular and kinase domain of the HER receptors. These inhibitors include: erl
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To further confirm that the V855A mutation provides increased activity to HER3 through enhanced physical interaction with HER2, we performed co-immunoprecipitaton experiments on Ba/F3 co-transfectants stimulated with or
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Tyrosine trans-phosphorylation is a major event in HER signaling. To examine if HER3-V855A enhances trans-phosphorylation of HER2, we performed immunoblot analysis on Ba/F3 and HEK 293Tlysates after 16hr incubation in se
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We next examined the effect of chronic treatment with NRG1beta on HER3/HER2 phosphorylation and their downstream targets AKT and ERK 1/2 in the Ba/F3 co-transfectants. As shown in Figure 3e, a five-day chronic treatment
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We also investigated the functional relevance of stable Ba/F3 transfectants co-expressing HER3-V855A and EGFR (Supplemental Fig. 1a). While Ba/F3 cells co-expressing HER3-V855A and EGFR exerted a robust growth response t
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To assess the ability of HER3-V855A to form colonies we performed a methyl cellulose-based colony formation assay. As shown in Fig 3c & 3d, while NRG1beta treatment did not induce an increase in colony number between the
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To determine the transforming potential of HER3-V855A in the context of IL-3 -independent growth, Ba/F3 transfectants were grown in the absence or presence of IL-3, or HER cognate ligands (neuregulin1beta (NRG1beta) or t
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
HER3 has been described as a contributor to oncogenic transformation and tumorigenesis, particularly when combined with its HER2 dimerization partner. Therefore, we hypothesized that the HER3 kinase mutation may cause a
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To analyze the location and significance of the novel HER3-V855A mutation, we performed protein sequence alignment of exon 21 of the EGFR and HER3. Although, the amino acid at position 855 in HER3 is not conserved relati
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.
Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A
Genes: 673 1956 324
Variants: L597V L858 L858R V855 V855A
EGFR pathogenic mutations sensitize in varying degrees to inhibition by small molecule TKIs. These mutations include both class I short in-frame deletions and class II missense mutations. One of these mutations, the L858
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Homology between the HER3-V855A and EGFR-L858R kinase mutation
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 1956:L858R 324:V855A
Genes: 1956 324
Variants: L858R V855A
A single arm multicenter phase II clinical study initiated in 2006 (FIELT1 study; NCT00339586) was coordinated by our department to evaluate the safety and efficacy of first-line erlotinib in patients with advanced NSCLC
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5
Evidence Type(s): Oncogenic, Predictive
Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.
Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855
Genes: 2065 324
Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855
Identification of a novel HER3-V855A mutation
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
A single case with p.N822K (c.2466T>A) [Figure 4b] was identified. The tumor originated in jejunum in an elderly man with spindle morphology.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.
Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K
Genes: 3815
Variants: c.2466T>A p.N822K
Three cases involving p.K642E mutation (c.1924A>G) [Figure 4a], 2/3 were in elderly men, at gastric, an anorectal site with mixed morphology. One was a double mutation in association with exon 11 [Table 2].
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E
Genes: 3815
Variants: c.1924A>G p.K642E
Mutations were identified in 10 cases located in the small intestine with significant association (P = 0.004). One was located in the retroperitoneum. Ninety percent (9/10) tumors revealed internal tandem duplications (I
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.
Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY
Genes: 3815
Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY
Insertion of 3 nucleotides, p.K558delinsBP (c.1673_1674insTCC), and duplication p.Y577_K580dup (c.1731_1742dupTTATGATCACAA) was seen 1 case (1.8%) each, respectively.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.
Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP
Genes: 3815
Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP
The substitution mutations were p.V559D (3/57; 5%), p.V560D (3/57; 5%), p.V559A (2/57; 3.5%), and 1 (1.8%) cases each with p.V560G, p.T574I, and p.L576P among this 9 were homozygous and 2 heterozygous.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.
Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G
Genes: 3815
Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G
One case with simultaneous mutations in exons 11 and 13 harbored in-frame deletion in exon 11; p.M552_K558del (c.1654_1674delATGTATGAAGTACAGTGGAAG) and a novel substitution mutation; p.K642R (c.1925A>G) [Figure 1d] in ex
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R
Genes: 3815 5156 728378
Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R
Exon 11 mutations were heterogeneous with in-frame deletion of 3-51 nucleotides (codons 550-576) in classic hot-spot region at the 5' end of the exon (codons 550-560). Double mutations were identified in 9 cases (16%), 8
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.
Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup
Genes: 728378 3815
Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup
Exon 11 mutations were in 57% of cases [Table 2]. In-frame deletions in 35 (61.4%), 11 substitutions (19.3%), 9 double mutations (15.7%), 1 insertion and duplication (1.8%), respectively. Common mutation was p.W557_K558
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.
Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D
Genes: 3815
Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D
Results: We found that rs3786362 G allele of thymidylate synthase (TYMS) gene was significantly associated with PFS (P = 1.10 x 10-2), OS (P = 2.50 x 10-2) and DCR (P = 5.00 x 10-3). The expression of TYMS was overexpres
[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).
Gene→Variant (gene-first): 7298:rs3786362
Genes: 7298
Variants: rs3786362
Thirty-two patients with BRAF V600E positive metastatic colorectal cancer (mCRC) and 7 patients with other cancers were enrolled. No dose-limiting toxicities were observed in escalation, with vemurafenib 960 mg twice dai
[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
BRAF V600E mutant metastatic colorectal cancer represents a significant clinical problem, with combination approaches being developed clinically with oral BRAF inhibitors combined with EGFR-targeting antibodies. While co
[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
Whole exome sequencing identified a total of 15 somatic mutations, including nine missense mutations. Interestingly, we identified two activating mutations affecting FGFR1, including FGFR1 p.K656E (NM_023110.3:c.1966A>G)
[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.
Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M
Genes: 2260
Variants: c.1681G>A c.1966A>G p.K656E p.V561M
Patient is an 18-month-old otherwise healthy boy who presented with acute onset nausea, vomiting, and gait instability, resulting in a fall on the day of presentation. On arrival to the ED, vital signs were notable for h
[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.
Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E
Genes: 3417 673
Variants: p.R132H p.V600E
Comparisons of PFS and OS (univariate and multivariate) of patients with mutation variants to patients with non-mutated tumors revealed the KRAS exon 2 G12C-variant (n = 28) to correlate with inferior OS compared with no
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.
Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D
Genes: 3845
Variants: G12C G12D G12V G13D
The median PFS of patients with KRAS exon 2 mutant tumor subtypes ranged from 8.8 [95% confidence interval (CI) 7.6-10.0] months (G13D mutation) to 10.5 (95% CI 9.0-11.9) months in (G12D variants). The median OS widely r
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.
Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H
Genes: 3845
Variants: A146T G12C G12D G13D Q61H
Of 1239 analyzed tumors, in 664 tumors (53.6%), no mutation was detected, whereas 462 tumors harboring KRAS (37.3%) mutations and 39 NRAS (3.1%) mutations were found. Additionally, a total of 74 tumors (6.0%) were carryi
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
This is the first report to our knowledge to demonstrate activity of osimertinib in a patient with NSCLC harboring HER2 exon 19, p.L755P mutation resulting in intra- and extracranial response. In the future, osimertinib
[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.
Gene→Variant (gene-first): 2064:p.L755P
Genes: 2064
Variants: p.L755P
A 68-year-old female with a past medical history of type 2 diabetes and minimal smoking was diagnosed with stage IV NSCLC. Next generation sequencing on tumor tissue demonstrated an ERBB2 exon 19 c.2262_2264delinsTCC, p.
[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)
Genes: 2064
Variants: c.2262_2264delinsTCC p.(L755P)
Extracranial arteriovenous malformation (AVM) is most commonly caused by MAP2K1 mutations in the endothelial cell. The purpose of this study was to determine if local tissue overgrowth associated with AVM is caused by di
[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.
Gene→Variant (gene-first): 5604:p.K57N
Genes: 5604
Variants: p.K57N
We describe a 57-year-old woman with resected stage IIIB pancreatic cancer who underwent several lines of conventional chemotherapy after multiple lymph node metastases. When the disease progressed again, the patient rec
[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.
Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A
Genes: 79728
Variants: c.2514+1G>C c.3114-1G>A
This analysis examined 45 single missense mutations detected in PCa with metastasis or high Gleason scores, and which extend along the entire length of the protein. Our sensitive assay system uncovered a previously unide
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.
Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A
Genes: 2232 367 1387 10514 10499
Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A
Mutations with no apparent change of activity from WT may be able to drive cancer progression though several diverse routes. These include altered binding to co-repressors or co-regulators e.g. M886I, regulatory element-
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.
Gene→Variant (gene-first): 9611:M886I
Genes: 9611
Variants: M886I
The LBD mutations had a greater dependence on the regulatory elements, emphasizing the importance of interdomain communication for receptor function. While the major losses of function seen with M749I at 10 nM DHT were c
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.
Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E
Genes: 367 1387 10514
Variants: H874Y M749I Q798E
Mutations within the DBD and hinge domains of the AR would be expected to have the greatest influence on regulating ARE binding and indeed, the profile for T575A in the first zinc finger of the DBD was markedly different
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.
Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A
Genes: 2908 10499
Variants: I672 I672T R629 R629Q T575A
The results for the AR NTD mutations investigated with PSA61Luc closely matched those for GRE2-TATA-Luc. AR mutation L57Q had loss of function at all concentrations of DHT with both reporters although they were less pron
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.
Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S
Genes: 2232 367
Variants: G142V L57Q P390L P533S
In general, the profiles of PSA61Luc stimulation for the different AR mutations were very similar to those for GRE2-TATA-Luc; indicating that the findings in the broad GRE2-TATA-Luc study accurately reveal the effects of
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.
Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A
Genes: 367 10499
Variants: P390L R629Q T575A
The LBD contained two mutations, D879G and Q919R, which fall within the grouping of loss to gain of function, although recovery to a modest 19% gain of function and WT levels respectively took place at only the highest c
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.
Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A
Genes: 10499 367
Variants: D879G H874Y Q919R T877A
Mutations K720E and R726L, which is implicated in a 6-fold increased risk of prostate cancer, reside in a positive cluster in helix 3 with lysine 720 creating a charged clamp with glutamate 897, and both residues partici
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29
Evidence Type(s): Predisposing, Functional
Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.
Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720
Genes: 367 9611
Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720
Within the LBD, all but two loss of function mutations were clustered between residues 720 and 798. Of these, half had essentially no transactivational activity at physiological levels of DHT and comprise of L744F, A748V
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.
Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C
Genes: 367 9611 1387 10514
Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C
Mutations in the LBD have historically been considered as the most likely candidates for driving PCa, therefore, the finding that the majority of mutations under investigation had no change from WT or loss of function wa
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.
Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I
Genes: 367 9611
Variants: K910R M886 M886I
Within the hinge region, mutation I672T has been included in the arbitrary classification of no change from WT due to deviation of less than 10% at 0 and 0.1 nM DHT changing to a 14% gain of function at 10 nM. Interestin
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.
Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A
Genes: 597 367 2908 10499
Variants: A586V A587S I672T R629Q T575A
The only mutation to function like WT at low DHT and then gain function compared to WT upon DHT binding was P533S in the NTD. As with other groupings, mutations leading to constitutive transactivation activity were prese
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.
Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S
Genes: 2232 367
Variants: G142V G524D M523V M537V P533S
The novel class of mutation, namely loss of function at low levels or in the absence of DHT recovering to WT values or a gain of function upon binding of DHT was present in the NTD. Mutations P269S and S515G had WT level
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.
Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G
Genes: 367 10514
Variants: P269S P390L P514S S515G
Interestingly, there was exiguous rescue at the highest concentration of DHT with D221H, P504L and D528G, while P340L manifested a striking dose-dependent recovery. The S296R mutation has been shown to have altered inter
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.
Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P
Genes: 207 367 2232 9611
Variants: D221H D528G E198G P269S P340L P504L S296R S334P
The predominant type of mutation i.e. loss of function, was well represented in the NTD. Mutations L57Q, E198G, D221H, A234T, S296R; S334P, P340L, P504L and D528G all displayed loss of function with E198G showing the gre
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).
Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P
Genes: 1387 207 367 2232 9611
Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P
All five classes of mutation were represented within the NTD. Of the five mutations in AR classified as having no change from WT, G166S showed the least variance from the unmutated receptor. The mutation M537R also had m
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.
Gene→Variant (gene-first): 367:G166S 367:M537R
Genes: 367
Variants: G166S M537R
Unsurprisingly, the DBD is virtually unaltered across a wide range of species with 100% homology between the examples shown here; except for two conservative substitutions in Xenopus, one of which T575, has been included
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6
Evidence Type(s): Functional
Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.
Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575
Genes: 2908 10499
Variants: I672 R629 T575
The NTD is by far the least conserved domain with mouse, chicken and Xenopus having only 75, 32 and 34% similarity to human respectively. Alignment of the investigated human AR mutations to the primary sequence of AR in
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5
Evidence Type(s): Diagnostic, Functional
Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.
Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334
Genes: 1387 207 367 2232 10514
Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334
To further investigate this we solved the structure of BCL-2 G101V bound to S55746 (Table 1). We obtained diffraction to 2.0 A in a P 21 spacegroup with two molecules in the asymmetric unit. The BCL-2 G101V:S55746 struct
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.
Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101
Genes: 596
Variants: E152 E152A G101V V101
S55746 is another BCL-2 selective antagonist that has progressed to the clinic. The recently disclosed crystal structure of BCL-2 WT bound to S55746 revealed binding to the P1, P2 and P3 pockets, in contrast to venetocla
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.
Gene→Variant (gene-first): 596:G101V
Genes: 596
Variants: G101V
E152 moved into the base of the P2 pocket in the BCL-2 G101V:venetoclax structure (Fig. 2b, c). To test the role of E152 in reducing affinity we generated a BCL-2 G101V/E152A double mutant. Alanine does not have a Cgamma
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.
Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V
Genes: 596
Variants: E152 E152A G101A G101V
The role of E152 in venetoclax affinity
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive
Justification: Predictive: The passage discusses the role of E152 in venetoclax affinity, indicating a correlation with response or sensitivity to the therapy.
Gene→Variant (gene-first): 596:E152
Genes: 596
Variants: E152
SPR experiments were performed using a BIMBH3 or BAXBH3 immobilised sensor surface with BCL-2 mutants as the analyte and determining venetoclax affinity by competition experiments, (Fig. 3, Table 2 and Supplementary Fig.
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.
Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V
Genes: 596
Variants: F104C F104L G101V
The crystals of venetoclax complexed with BCL-2 F104L and BCL-2 WT are isomorphous (Table 1). Well-defined electron density for the drug in the mutant complex structure (Supplementary Fig. 1) suggests two conformations f
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.
Gene→Variant (gene-first): 596:F104 596:F104L 596:L104
Genes: 596
Variants: F104 F104L L104
To understand how these BCL-2 mutations compromise drug binding we solved crystal structures of both complexes (Table 1 and Fig. 2). The G101V mutation resides on the BCL-2 alpha2 helix packing against the alpha5 helix a
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.
Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V
Genes: 596
Variants: E152 G101 G101A G101V
Crystal structures of BCL-2 with ABT-263 and various analogues of venetoclax have been deposited in the PDB and described in the literature (Fig. 1a, b). One of those analogues is 4-[4-((4'-chloro-3-[2-(dimethylamino)eth
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 596:F104
Genes: 596
Variants: F104
Multiple jejunalgastrointestinal stromal tumors (GISTs) were found in a 52-year-old woman with a history of neurofibromatosis type 1. These tumors were composed of interlacing fascicles of uniform spindle cells with eosi
[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Diagnostic
Justification: Oncogenic: The passage describes a missense point mutation (Trp557Gly) identified in the KIT gene associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Diagnostic: The variant Trp557Gly is mentioned in the context of identifying and characterizing the tumors associated with neurofibromatosis type 1, suggesting its role in defining the disease subtype.
Gene→Variant (gene-first): 3815:Trp557Gly
Genes: 3815
Variants: Trp557Gly
Fusions involving ETV6 in leukemia have long been recognized. Other mutation types, including single nucleotide variations, insertions, deletions, frame-shifts and non-sense alterations are also becoming increasingly evi
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12
Evidence Type(s): Diagnostic, Functional
Justification: Diagnostic: The passage discusses the identification of rare germline variants (V37M, R181H) in patients with B-ALL, indicating their association with the disease. Functional: Luciferase assays performed on the variants showed no significant changes in transcriptional repression activity compared to WT ETV6, indicating an assessment of their molecular function.
Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916
Genes: 2120
Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916
To examine whether the L349P and N385fs mutations negatively impact translation or alter subcellular localization of the ETV6 protein, we performed cell fractionation assays and western blotting of HeLa cells transiently
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional
Justification: Functional: The detection of different localization patterns for the mutants P214L, R369Q, and R399C also suggests alterations in their molecular or biochemical function.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C
Genes: 2120
Variants: L349P N385fs P214L R369Q R399C
To evaluate the functional consequences of these mutations, we first assessed whether L349P and N385fs might impair transcriptional repression by ETV6. HeLa cells were transiently co-transfected with constructs encoding
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the mutations L349P, N385fs, P214L, R369Q, and R399C impair the transcriptional repression function of ETV6, indicating that these variants alter molecular function.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C
Genes: 2120
Variants: L349P N385fs P214L R369Q R399C
Both ETV6 variants were absent in the National Heart Lung Blood Institute (NHLBI) Exome Sequencing Project (ESP) (http://evs.gs.washington.edu/EVS/), Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/),
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the L349P and N385fs mutations are predicted to alter the molecular function of the ETV6 protein, including conformational changes and truncation that affect DNA interaction.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs
Genes: 2120
Variants: L349P N385fs
Fibroblast and lymphocyte DNA from the proband with ALL and parents in Kindred 2 were analyzed by clinical whole exome sequencing (Ambry Genetics, Aliso Viejo, CA, USA). The proband and his mother harbored a heterozygous
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of a heterozygous deletion in ETV6 that is associated with the diagnosis of acute lymphoblastic leukemia (ALL) in the proband, indicating its role in defining the disease. Oncogenic: The variant N385fs is described as leading to a truncation of the ETV6 protein, which is implicated in tumor development, specifically in the context of acute lymphoblastic leukemia (ALL).
Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG
Genes: 2120
Variants: N385fs c.1153-5_1153_1delAACAG
DNA from 16 individuals in Kindred 1 (9 individuals with thrombocytopenia and/or ALL and 7 unaffected individuals) was subjected to Sanger sequencing for all exons of a targeted panel of leukemia-associated genes (Method
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5
Evidence Type(s): Diagnostic, Predisposing, Oncogenic
Justification: Diagnostic: The variant 415 T>C is associated with thrombocytopenia and leukemia, as it was identified in all affected family members and absent in unaffected individuals, indicating its role in defining the disease. Predisposing: The passage describes the variant as being present in affected individuals and absent in unaffected individuals, suggesting it confers inherited risk for developing the disease, although it does not explicitly state that it is germline. Oncogenic: The variant is described in the context of leukemia, indicating its potential role in tumor development or progression, particularly as it is a missense mutation in a gene associated with leukemia.
Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349
Genes: 10320 2120
Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349
In 2017, the third-generation EGFR inhibitor osimertinib was approved for use in patients who developed the EGFR T790M mutation as a mechanism of resistance. In this year, of the 254 patients who received an EGFR inhibit
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the T790M mutation as a mechanism of resistance to the EGFR inhibitor osimertinib, indicating its correlation with treatment response. Oncogenic: The T790M mutation is described as contributing to resistance in patients treated with EGFR inhibitors, suggesting its role in tumor progression.
Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M
Genes: 1956
Variants: G719S L858R L861Q T790M
Uni- and multivariable Cox regression analyses were performed to evaluate whether the type of EGFR mutation is associated with OS (Table 3). Because OS for patients with EGFR exon 20 insertions and patients with not acti
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses overall survival (OS) outcomes associated with the L858R variant, indicating that it correlates with disease outcome independent of therapy. Diagnostic: The mention of the type of EGFR mutation, including L858R, being associated with overall survival suggests its role in classifying or defining disease outcomes.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The proportion of patients receiving first-line targeted therapy was highest for those with an exon 19 deletion (321/390; 82%) or L858R mutation (227/287; 79%), lower for those with uncommon, actionable variants (69/103;
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16
Evidence Type(s): Predictive, Prognostic
Justification: Predictive: The passage discusses the proportion of patients receiving first-line targeted therapy based on the presence of the L858R mutation, indicating a correlation with treatment response. Prognostic: The median overall survival (OS) for patients with the L858R mutation is reported, demonstrating its correlation with disease outcome independent of therapy.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
OS in patients with any EGFR mutation was higher for those diagnosed in 2017 (median 18.1 months; 95% CI, 15.7-20.5) compared to 2013 (median 14.3 months; 95% CI, 12.5-16.1; p = 0.035), but similar to 2015 (median 17.6 m
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses overall survival (OS) in patients with the L858R variant, indicating a correlation between this variant and disease outcome, independent of therapy. Diagnostic: The mention of distinct survival patterns observed in different EGFR mutation subclasses, including L858R, suggests that this variant is used to classify or define a subtype of disease.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Treatment and survival data were available for 10,237 out of 10,254 patients (99.8%). This included 390 patients with an exon 19 deletion, 287 patients with L858R, 103 patients with an uncommon, actionable variant, 69 pa
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Of the 7908 patients tested for EGFR mutations at initial diagnosis, one or more mutations were reported in 11.7% of all cases (95% CI, 11.0-12.4%; n = 925) (Table 2). Female patients were more likely to harbor EGFR muta
[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the prevalence of EGFR mutations, including L858R and L861X, in patients at initial diagnosis, indicating their association with the disease and their use in defining the mutation status of patients. Oncogenic: The variants L858R and L861X are described as actionable mutations within the context of EGFR, suggesting their role in tumor development or progression.
Gene→Variant (gene-first): 1956:L858R 1956:L861X
Genes: 1956
Variants: L858R L861X
An in-house database search for insertions comparable to the VMOS RAS variants revealed one in-frame insertion in KRAS in a case suspected for Noonan syndrome (Fig. 7A). Furthermore, a screen of the current literature an
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the impact of the insertions on the catalytic Gln61 might be stronger, indicating an alteration in molecular function related to GTP hydrolysis.
Gene→Variant (gene-first): 5921:Gln61
Genes: 5921
Variants: Gln61
The biophysical characterisation of the VMOS RAS variants showed two opposing effects. VMOS RAS variants appeared insensitive to the action of GEFs with a consequently decrease of signalling capability. On the other hand
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the HRAS p.G12V variant alters the signaling capability by affecting GTP hydrolysis and inducing phosphorylation of ERK and AKT, indicating a change in molecular function. Oncogenic: The HRAS p.G12V variant is implicated in inducing signaling pathways that are associated with tumor development, as evidenced by the increased levels of phosphorylated ERK and AKT in the transfected cells.
Gene→Variant (gene-first): 3845:p.G12V
Genes: 3845
Variants: p.G12V
To analyse the effect of the VMOS RAS variants on GAP catalysed GTP hydrolysis, G-proteins were incubated in the presence of various concentration of RAS-GAP. GTP and GDP content was analysed after termination of the rea
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the classical oncogenic variant KRAS p.G12V in the context of its effect on GTP hydrolysis, indicating its role in tumor development or progression. Functional: The passage describes how the variant KRAS p.G12V affects the biochemical function of GTP hydrolysis, demonstrating its impact on molecular activity in the presence of RAS-GAP.
Gene→Variant (gene-first): 3845:p.G12V
Genes: 3845
Variants: p.G12V
GTP hydrolysis was followed over time by terminating the reactions at different points in time, and GDP and GTP contents analysis by HPLC. The intrinsic GTP hydrolysis rates of VMOS RAS variants were reduced by a factor
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the p.G12V variant alters the intrinsic GTP hydrolysis rates, indicating a change in molecular function related to protein activity. Oncogenic: The p.G12V variant is described as a classical oncogenic variant, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 3845:p.G12V
Genes: 3845
Variants: p.G12V
The interaction of G-protein and the nucleotide is stabilised in the ternary complex with the effector and in consequence the rate of nucleotide dissociation is reduced. This effect was used to analyse the interaction of
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression. Functional: The passage discusses how KRAS p.G12V alters the intrinsic dissociation rate of mGppNHp compared to wild type, indicating a change in molecular function.
Gene→Variant (gene-first): 3845:p.G12V
Genes: 3845
Variants: p.G12V
The clinical context indicated that VMOS RAS variants cause enhanced RAS signalling, but the outcome of the in silico analysis is not unambiguously supporting this expectation. In fact, it strongly suggested deficiencies
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the impact of the p.Q61L variant on nucleotide exchange, effector binding, and GTP hydrolysis, indicating that it alters molecular or biochemical function. Oncogenic: The p.Q61L variant is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.
Gene→Variant (gene-first): 4893:p.Q61L
Genes: 4893
Variants: p.Q61L
On amino acid level the DNA duplications and insertions found in the VMOS RAS variants resulted in an insertion of mainly duplicated sequence around position 65 (Fig. 2A). It is difficult to predict to what extent the in
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the insertions around Gln61 likely alter the molecular interactions and functions of the protein, particularly affecting GTP hydrolysis and interactions with GEFs and GAPs.
Gene→Variant (gene-first): 5921:Gln61
Genes: 5921
Variants: Gln61
Sensitive NGS based screening of frequently mutated positions in a panel of multiple genes were applied in 299 cases. In 108 cases, putative causative variants were identified, of which in 15 cases RAS genes were affecte
[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses mutations in RAS genes, including p.G12A, p.G13H, and p.Q22K, which are described as classical oncogenic mutations that affect tumor development and progression. Functional: The passage indicates that the p.Q22K mutation is associated with increased GTP loading, suggesting that it alters molecular function related to protein activity.
Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K
Genes: 3845
Variants: p.G12A p.G13H p.Q22K
Oncogenic mutations in the serine/threonine kinase B-RAF are found in 50-70% of malignant melanomas. Pre-clinical studies have demonstrated that the B-RAFV600E mutation predicts a dependency on the mitogen activated prot
[Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, and this is validated by the success of RAF and MEK inhibitors in clinical trials, indicating a correlation with treatment response. Oncogenic: The passage discusses oncogenic mutations in B-RAF, specifically the B-RAFV600E mutation, which is implicated in tumor development and progression in malignant melanomas.
Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine
Genes: 673
Variants: B-RAFV600E serine/threonine
Structural details can provide mechanistic insight into variant effects on protein function. However, the structure of the RAD51C protein had not been experimentally determined at the time of this study. Initially, a hom
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how several variants, including K131, R168G, G130R, and others, alter the molecular function of RAD51C by disrupting the ATP-binding site and influencing RAD51C activity, as demonstrated in HDR assays. Oncogenic: The passage indicates that the variants are deleterious and influence RAD51C function, which is relevant to tumor development or progression, particularly in the context of HDR assays.
Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu
Genes: 5889 5892
Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu
RAD51C forms the BCDX2 and CX3 complexes that are involved in RAD51 recruitment to sites of DNA damage. To evaluate the influence of RAD51C variants on the integrity of these intrinsic complexes, coimmunoprecipitation of
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how various RAD51C variants affect the ability to form protein complexes involved in DNA damage repair, indicating that these variants alter molecular function. Oncogenic: The mention of deleterious variants that lose the ability to form complexes suggests a role in tumor development or progression, as these variants are associated with impaired DNA repair mechanisms.
Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile
Genes: 5889 5892
Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile
Because RAD51C participates in DNA damage signaling by regulating cell cycle progression, colony formation assays were performed to evaluate the influence of RAD51C variants on cell proliferation. U2OS RAD51C-/- landing
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how RAD51C variants alter cell proliferation and the formation of RAD51 foci in response to ionizing radiation, indicating changes in molecular function related to DNA damage signaling and repair. Oncogenic: The variants are implicated in a proliferation defect and disruption of homologous recombination (HR) repair, suggesting their role in tumor development or progression.
Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R
Genes: 5889
Variants: G130R G302V K131I L138F Q133E R168G T132R
In parallel, a recent study evaluated the influence of 36 RAD51C missense variants on HR activity of U2OS and 21 on HR activity of MCF10A cells. Importantly, 18 of 36 evaluated in U2OS and 13 of 21 evaluated in MCF10A ce
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the L138F variant alters HDR activity in different cell lines, indicating a change in molecular function. Predictive: The passage mentions the sensitivity of variants, including L138F, to cisplatin and olaparib, suggesting a correlation with response to these therapies.
Gene→Variant (gene-first): 5889:L138F
Genes: 5889
Variants: L138F
To confirm the functional effects of RAD51C variants in a human cell line, RAD51C WT and 7 deleterious or intermediate missense variants in the HDR assay (G130R, K131I, T132R, Q133E, L138F, R168G and G302V) were introduc
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the sensitivity of specific RAD51C variants (G130R, K131I, T132R, Q133E, and G302V) to olaparib, indicating a correlation with response to therapy. Functional: The passage describes the introduction of RAD51C variants into a cell line and assesses their effects on homologous recombination repair (HDR), indicating that these variants alter molecular function.
Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R
Genes: 5889
Variants: G130R G302V K131I L138F Q133E R168G T132R
An inability to form RAD51 foci at the sites of DNA DSBs is a key component of an HR deficient phenotype. Because disruption of RAD51C substantially decreases RAD51 foci formation the influence of RAD51C missense variant
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how RAD51C missense variants alter RAD51 foci formation in response to DNA damage, indicating a change in molecular function related to DNA repair mechanisms. Predictive: The mention of "drug response findings" suggests that the variants may correlate with sensitivity or resistance to a specific therapy, indicating predictive evidence.
Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu
Genes: 5889 5888
Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu
RAD51C loss promotes HR deficiency and sensitizes cells to cisplatin and olaparib PARP inhibitor. Thus, the influence of 60 RAD51C missense variants from the HDR assay (30 deleterious, 23 neutral, and 7 intermediate) on
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the influence of RAD51C missense variants on the response to cisplatin and olaparib, indicating a correlation between the variants and treatment sensitivity. Functional: The passage describes how the variants affect IC50 values in the HDR assay, suggesting that they alter molecular function related to drug response.
Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg
Genes: 5889
Variants: E94K G306R p.Glu94Lys p.Gly306Arg
A cell-based DR-GFP HDR colorimetric reporter assay was used to assess the influence of 173 missense mutations on RAD51C HR DNA repair activity (Supplementary Table S1). RAD51C deficient CL-V4B cells were reconstituted w
[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the influence of missense mutations on RAD51C HR DNA repair activity, indicating that the variants alter molecular function as assessed by HDR activity in a cell-based assay. Oncogenic: The mention of deleterious variants categorized based on their impact on HDR activity suggests that these somatic variants contribute to tumor development or progression through their effects on DNA repair mechanisms.
Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala
Genes: 5889
Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala
Firstly, the level of total STAT3 in two HCC patient samples appeared to be higher than that in corresponding adjacent normal tissues. Interestingly, treatment of ruxolitinib led to a significant reduction (50%) of the p
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the treatment of ruxolitinib and its effects on the phosphorylation level of STAT3 in tumors with the JAK1 S703I mutation, indicating a correlation with treatment response. Oncogenic: The mention of the JAK1 S703I mutation in the context of tumor models suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 3716:S703I
Genes: 3716
Variants: S703I
In vivo efficacy studies of JAK1/2 inhibitor, ruxolitinib, were conducted in these four JAK1-mutant models and a JAK1-WT PDX model as a control (Figure 3A). The results showed that, only in LI-03-0191 model bearing JAK1S
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutation to the JAK1/2 inhibitor ruxolitinib, indicating a correlation with treatment response. Oncogenic: The passage suggests that the JAK1S703I mutation may play a critical role in tumorigenesis, indicating its contribution to tumor development.
Gene→Variant (gene-first): 3716:S703I
Genes: 3716
Variants: S703I
Anti-tumor activity of ruxolitinib in JAK1S703I-mutant PDX model
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the anti-tumor activity of ruxolitinib in a model with the JAK1 S703I mutation, indicating a correlation with response to therapy. Oncogenic: The mention of the JAK1 S703I mutation in the context of a PDX model suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 3716:S703I
Genes: 3716
Variants: S703I
To further evaluate the transformation ability of these JAK1 mutations, Ba/F3 cells were stably infected with lentivirus expressing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703I, JAK1A1086S, and JAK1S729C, respec
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the transformation ability of JAK1 mutations, specifically noting that JAK1S703I and JAK1S729C are capable of continual proliferation in the absence of IL-3, indicating their contribution to tumor development or progression. Functional: The passage mentions that JAK1S703I activates the JAK-STAT signaling pathway, which indicates an alteration in molecular function related to the variant.
Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C
Genes: 3716
Variants: E483D S703I S729C
To explore the biological functions of JAK1 mutations in JAK-STAT signaling pathway, we introduced these mutations into pLVX-IRES-Neo-JAK1 plasmid. Plasmids containing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the introduction of JAK1 mutations, including E483D, S703I, and S729C, alters the expression levels of phosphorylated JAK1 and STAT proteins, indicating a change in molecular function. Oncogenic: The passage mentions that JAK1S729C is a known and recurrent activating mutation, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C
Genes: 3716
Variants: E483D S703I S729C
Specifically, S703I mutation was found in the pseudo-kinase domain of JAK1 protein, and could potentially cause the disruption of auto-inhibition of JAK1 kinase. Notably, S703I was previously identified in tumors of two
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage indicates that the S703I mutation is an activating mutation of the JAK1 gene and was found in tumors, suggesting it contributes to tumor development or progression. Functional: The S703I mutation is described as potentially causing disruption of auto-inhibition of the JAK1 kinase, indicating an alteration in molecular or biochemical function.
Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I
Genes: 3716 728378
Variants: A1086S E483D N451S S703I
More than 160 HCC PDX models were established at WuXi AppTec in the past three years, of which over 60 models were characterized by WES. Among them, four models (LI-03-0012, LI-03-0155, LI-03-0191, and LI-03-0257) were i
[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I
Genes: 3716 728378
Variants: A1086S E483D N451S S703I
To examine if upregulation of NRG1 is induced by hormone therapy, we treated freshly isolated primary CAFs from CWR22Pc tumors or pCAFs with CSS or Enz. CSS and Enz both induced NRG1 mRNA and protein expression after 7 d
[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how NRG1 levels increase after androgen deprivation therapy (ADT) and suggests that these elevated levels are sufficient to promote resistance to ADT, indicating a correlation with treatment response. Oncogenic: The mention of NRG1 promoting resistance to ADT implies a role in tumor development or progression, which aligns with the definition of an oncogenic variant.
Gene→Variant (gene-first): 8850:S7C
Genes: 8850
Variants: S7C
To gain insight into the potential clinical relevance of these findings, we examined NRG1 expression in a cohort of 43 patients with localized prostate cancer who underwent radical prostatectomy surgery, 23 of whom recei
[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21
Evidence Type(s): Diagnostic, Predictive
Justification: Diagnostic: The passage discusses the detection of NRG1 expression in patients with localized prostate cancer, indicating its potential role in classifying or defining the disease based on the presence or absence of NRG1 staining. Predictive: The analysis includes a comparison of NRG1 expression in patients who received neoadjuvant ADT versus those who were hormonally intact, suggesting a correlation with treatment response.
Gene→Variant (gene-first): 3084:S6 8850:S7
Genes: 3084 8850
Variants: S6 S7
Our earlier analysis of five canonical AR target genes suggested that NRG1 preserves tumor cell viability without restoring AR target gene expression (Figures 2G and 2H). To address this question more comprehensively, we
[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 1956:S2 3084:S6C
Genes: 1956 3084
Variants: S2 S6C
To carry out the purification, serum-free 22Pc-CAFCM was collected, concentrated, and applied to a Q-Superose anion exchange column, from which we eluted two protein peaks by using 30% and 100% high-salt buffer B (termed
[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses resistance-promoting activity and its correlation with HER3 phosphorylation, indicating a relationship with response or resistance to therapy. Functional: The passage describes how the variant affects HER3 phosphorylation activity, suggesting an alteration in molecular function related to resistance-promoting activity.
Gene→Variant (gene-first): 5979:Q8
Genes: 5979
Variants: Q8
B-cell lymphoma and melanoma harbor recurrent mutations in the gene encoding the EZH2 histone methyltransferase, but the carcinogenic role of these mutations is unclear. Here we describe a mouse model in which the most c
[Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage describes how the somatic mutations Y641F and Y646F in the EZH2 gene contribute to tumor development, specifically leading to high-penetrance lymphoma and melanoma in a mouse model. Functional: The variant Ezh2Y641F is shown to alter molecular function by increasing global H3K27 trimethylation and causing a redistribution of this mark, which affects transcription at various loci.
Gene→Variant (gene-first): 2146:Y641F 2146:Y646F
Genes: 2146
Variants: Y641F Y646F
Frequent genetic alterations discovered in FGFRs and evidence implicating some as drivers in diverse tumors has been accompanied by rapid progress in targeting FGFRs for anticancer treatments. Wider assessment of the imp
[Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the impact of FGFR3 kinase domain variants on drug responses and highlights the distinct changes in efficacy of inhibitors based on specific activating mutations, indicating a correlation with treatment response. Oncogenic: The mention of FGFR3 variants as drivers in diverse tumors suggests that these somatic mutations contribute to tumor development or progression.
Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G
Genes: 2261
Variants: K650E N540K R669G
In the cBioPortal database, variants of the MAP2K1 gene are reported at frequencies of 1.7% in CRC patients (Table 1) and correlated with worse disease/progression-free survival (Logrank Test P-Value: 1.815e-3), but not
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20
Evidence Type(s): Diagnostic, Prognostic, Predictive, Oncogenic
Justification: Diagnostic: The passage discusses the frequencies of MAP2K1 variants in CRC patients and their association with specific tumor characteristics, indicating their role in defining or classifying the disease. Prognostic: The variants are correlated with worse disease/progression-free survival, suggesting they have prognostic implications independent of therapy. Predictive: The passage mentions that MAP2K1 mutations are associated with de novo and acquired resistance to anti-EGFR MoAbs, indicating a predictive relationship with therapy response. Oncogenic: The variants are described as contributing to a gain of function of the MEK1 protein, which is indicative of their role in tumor development or progression.
Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu
Genes: 5604
Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu
The CNVs were much more frequent among patients with longer PFS. Within this cohort, patient P16 had a significant copy number gain of ERBB2 (78.99) that was confirmed by FISH analysis (data not shown). Patient P16 had a
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the response of patients to cetuximab-based first-line therapy, specifically noting that patient P4, who carries the FBXW7 variant c.1268G>T; p.Gly423Val, had a complete response to this therapy. Diagnostic: The mention of the FBXW7 variant in the context of patient P4's treatment response suggests that it may be used to classify or define the patient's disease or treatment outcome.
Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val
Genes: 55294
Variants: c.1268G>T p.Gly423Val
Of the three missense mutations detected in FBXW7, two were found in patients with a PFS shorter than median PFS. Patient P14 (PFS 8.07 months) carried the c.1798G>A variant (p.Asp600Asn) and patient P18 (PFS 1.73 months
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage indicates that two missense mutations are associated with patients having a shorter progression-free survival (PFS), suggesting a correlation with disease outcome. Oncogenic: The FBXW7 p.Arg505Cys mutation is reported to lead to loss of function of the protein and has been associated with several cancer types, indicating its contribution to tumor development or progression.
Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn
Genes: 55294 1956 673
Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn
Two patients (P20 and P21) had variants in NF1, a negative regulator of RAS, inactivated by mutation in various cancers. Specifically, we found an insertion (c.638_639insA; p.Asn214Lys fs*2) in the tumor from patient P20
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13
Evidence Type(s): Oncogenic, Prognostic
Justification: Oncogenic: The variants in NF1 are described as contributing to tumor development by leading to a loss of function and increased activation of the RAS signaling pathway, indicating their role in oncogenesis. Prognostic: The passage provides progression-free survival (PFS) times for the patients with the variants, suggesting a correlation between the variants and disease outcome.
Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter
Genes: 4763
Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter
Patient P3 (PFS 6.63 months) carried the variant c.169A>G in the MAP2K1 gene coding for the MEK1 protein. This variant has been already reported in the cBioPortal database. It results in the substitution of an amino acid
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The variant c.169A>G results in an amino acid substitution (p.Lys57Glu) that is associated with a gain of function of the MEK1 protein, indicating an alteration in molecular function. Oncogenic: The variant is discussed in the context of its role in the MAP2K1 gene, which is known to contribute to tumor development or progression, suggesting its oncogenic potential.
Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu
Genes: 5604
Variants: c.169A>G p.Lys57Glu
All variants were at an allelic frequency >5% with the exception of a KRAS variant (c.183A>T; p.Gln61His) that was identified in the tumor tissue from patient P7 (PFS 3.93 months) at an allelic frequency of 0.4%. This va
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses the KRAS variant (c.183A>T; p.Gln61His) identified in tumor tissue, indicating its role in tumor development or progression as it is associated with a specific patient's tumor.
Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His
Genes: 3845
Variants: c.183A>T p.Gln61His
Of the 54 SNVs and insertions/deletions (Indels) identified, 35% and 41% were APC and TP53 variants, respectively (Figure 1). Nineteen patients (90.47%) had at least one TP53 SNV or Indel, whereas 15/21 (71.43%) patients
[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the presence of specific variants in patients and their association with APC and TP53 mutations, indicating their role in defining or classifying the disease context. Oncogenic: The variants mentioned are associated with tumors, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.
Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG
Genes: 7157 324
Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG
Finally, we investigated genetic mutation status in biopsies of two patients who progressed on repotrectinib in clinical trial using targeted sequencing. Patient A, a 46-year-old male with a 20 pack-year smoking history,
[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses mutations identified in patients who progressed on repotrectinib treatment, suggesting a potential role of these variants in acquired resistance to the therapy. Functional: The passage indicates that further studies are necessary to investigate the functional role of the mutations, implying that these variants may alter molecular or biochemical functions related to resistance mechanisms.
Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q
Genes: 1050 7157 896 2064 5925
Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q
The clinical activity of repotrectinib against ROS1 SFM was seen in a 49-year-old female ROS1-rearranged patient who progressed after 44 months of crizotinib treatment with an identified CD74-ROS1 G2032R mutation. The pa
[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the clinical activity of repotrectinib in a patient with the G2032R mutation, indicating a response to therapy, which aligns with predictive evidence. Diagnostic: The G2032R mutation is identified in the context of a ROS1-rearranged patient, suggesting its role in defining the patient's disease subtype.
Gene→Variant (gene-first): 6098:G2032R
Genes: 6098
Variants: G2032R
We identified the ROS1-G2032R mutation in YU1079, which was serially established in the same patient as YU1078 but after progressing on crizotinib treatment. Based on recent studies examining lorlatinib and cabozantinib
[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the response of the ROS1-G2032R mutation to various therapies, specifically mentioning the effectiveness of cabozantinib and repotrectinib in inhibiting growth, which correlates with treatment response. Oncogenic: The ROS1-G2032R mutation is implicated in tumor growth, as indicated by the investigation of its effects in Ba/F3 cells and the context of progression on crizotinib treatment, suggesting its role in tumor development.
Gene→Variant (gene-first): 6098:G2032R
Genes: 6098
Variants: G2032R
Repotrectinib overcomes crizotinib-resistant ROS1 G2032R
[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive
Justification: Predictive: The passage indicates that repotrectinib is effective against crizotinib-resistant ROS1 G2032R, suggesting a correlation between the variant and response to therapy.
Gene→Variant (gene-first): 6098:G2032R
Genes: 6098
Variants: G2032R
DNMT3A exon 23 screening was performed on available samples coming from 288 AML patients aged from 18 to 65-year old and treated in Toulouse between 2000 and 2009. DNMT3A exon 23 mutations were detected in 39 patients (1
[Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the detection of DNMT3A exon 23 mutations in AML patients, indicating that these mutations are associated with the disease, which supports their use in defining or confirming the disease. Oncogenic: The mention of DNMT3A mutations in AML patients suggests that these somatic variants contribute to tumor development or progression, as they are identified in a cancer context.
Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S
Genes: 1788
Variants: R882 R882C R882H R882P W893 W893S
A total of 3 out of 42 GC patients were METex14del positive (Table 3). All GC cases were MET IHC 3+ and the only case in the series with MET amplification. For example, one case was a 27-year old male patient who present
[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 1956:T790M 673:V600E
Genes: 1956 673
Variants: T790M V600E
All 13 METex14del cases were further confirmed by qualitative RT-PCR using probes overlapping an exon 13-15 junction, a fusion transcript caused by exon 14 skipping. In all cases, although the absolute Ct (cycles to thre
[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 4
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage indicates that the variant c.3082+811A TTTTAACA > GGTTTGAT is found in all GI cancer samples, suggesting its association with the disease. Oncogenic: The presence of the variant in GI cancer samples implies a potential role in tumor development or progression, as it is discussed in the context of mutations in cancer.
Gene→Variant (gene-first): 7157:c.3082+811A TTTTAACA > GGTTTGAT
Genes: 7157
Variants: c.3082+811A TTTTAACA > GGTTTGAT
The patient cohort from the NEXT-1 trial (NCT02141152), which is an actively enrolling clinical trial for genomic profiling in cancer patients, was used (Figure 1). Of 428 patients enrolled and screened, sufficient RNAs
[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 4916:p.982_1028del47
Genes: 4916
Variants: p.982_1028del47
Based on our search criteria, a total of 41 studies, which enrolled 13,103 KRAS assessable patients with 18 percent (2,374) KRAS mutant positive cases, were eligible for inclusion in the present analyses. The process of
[Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the frequency of KRAS mutations, specifically mentioning that the majority occur in codon 12 with G12C being the most common, indicating its association with lung cancer subtypes. Oncogenic: The mention of KRAS mutations, including G12C, in the context of lung adenocarcinoma suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 3845:G12C
Genes: 3845
Variants: G12C
We report two inflammatory myofibroblastic tumor (IMT) patients with ALK fusions (RRBP-ALK and TNS1-ALK, respectively). They both received tumor resection surgery and treatment with ALK inhibitors crizotinib followed by
[Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The variant L1196Q is associated with the development of resistance to ALK inhibitors, and its identification guided the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Oncogenic: The passage indicates that the L1196Q mutation is a secondary mutation that developed in the context of drug resistance, suggesting it contributes to tumor progression and the development of resistance to therapy.
Gene→Variant (gene-first): 238:L1196Q
Genes: 238
Variants: L1196Q
Pediatric glioblastomas (GBM) including diffuse intrinsic pontine gliomas (DIPG) are devastating brain tumors with no effective therapy. Here, we investigated clinical and biological impacts of histone H3.3 mutations. Fo
[Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Diagnostic, Prognostic, Oncogenic
Justification: Diagnostic: K27M-H3.3 mutation defines clinically and biologically distinct subgroups in DIPG, indicating its use in classifying the disease. Prognostic: K27M-H3.3 is universally associated with short survival in DIPG, while patients wild-type for H3.3 show improved survival, indicating its correlation with disease outcome. Oncogenic: The K27M-H3.3 mutation contributes to tumor development or progression in pediatric glioblastomas, as indicated by its prevalence in DIPG and association with specific copy number changes.
Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M
Genes: 3021
Variants: G34V G34V/R K27M
Isocitrate dehydrogenases (IDHs) catalyse oxidative decarboxylation of isocitrate to alpha-ketoglutarate (alpha-KG). IDH1 functions in the cytosol and peroxisomes, whereas IDH2 and IDH3 are both localized in the mitochon
[Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses heterozygous somatic mutations in IDH1, specifically the R132H variant, and its association with tumorigenesis in gliomas, indicating that this variant contributes to tumor development or progression. Functional: The passage mentions that mutations in IDH1, including R132H, cause loss of normal enzyme function and gain-of-function, leading to the accumulation of D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.
Gene→Variant (gene-first): 3417:R132H
Genes: 3417
Variants: R132H
Recently, a rare activating mutation of AKT1 (E17K) has been reported in breast, ovarian, and colorectal cancers. However, analogous activating mutations in AKT2 or AKT3 have not been identified in any cancer lineage. To
[Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Diagnostic, Oncogenic, Functional
Justification: Diagnostic: The passage discusses the identification of the AKT1 (E17K) mutation in various cancer types, indicating its association with melanoma and suggesting its role in defining the presence of this mutation in cancer specimens. Oncogenic: The passage states that the AKT1 E17K mutation is an activating mutation that contributes to tumor development, as evidenced by its identification in melanoma specimens and cell lines, indicating its role in cancer progression. Functional: The passage mentions that the AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, demonstrating a change in molecular function related to the variant.
Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K
Genes: 207
Variants: AKT1 (E17K E17K
Diffuse midline gliomas (DMGs) including diffuse intrinsic pontine gliomas (DIPGs) bearing lysine-to-methionine mutations in histone H3 at lysine 27 (H3K27M) are lethal childhood brain cancers. These tumors harbor a glob
[Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the lysine-to-methionine mutation at lysine 27 (H3K27M) contributes to tumor development and progression in diffuse midline gliomas, indicating its role as a somatic variant in cancer. Functional: The variant alters molecular function by affecting the levels of proteins in the SWI/SNF complex and influencing chromatin modifications, demonstrating its impact on biochemical processes within the tumor cells.
Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine
Genes: 3021 55193
Variants: lysine 27 lysine-to-methionine
These teachers were also observed to use questioningas a formative assessment tool, variations in groupings to ensure that students werelearning at appropriate levels, and a wide range of instructional practices, such ascooperative grouping, centers, and inquiry methods, to ensure that all styles oflearning were accommodated in the classroom setting
It is fantastic that they were using the listed learning strategies, but were they using them effectively? From experience, I believe that transitions are among the hardest things to implement in education. Perhaps it was a product of throwing a bunch of ideas against the wall and seeing what sticks? Without the educator himself reflecting, only the students know the quality of the education they received.