For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600
7,426 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
-
Localization of the expressed recombinant protein in COS-1 cells
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
PCR amplification of rG cDNAs
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.
-
Headkidney
-
Theacetylcholineconcentrationinthetissueswasestimatedspectrophotometricallyat540nmbythemethodofHestrin(1949)usingformicacid-acetonemixture(0.15mformicacidacetone,3:17V/V)astheextractionmediumAchconcentrationwascalculatedintermsofnmolAch/mgtissue
-
Acetylcholine(Ach)
-
Immediatelyafterisolation,thetissueswereweighedandsubjectedtolipidextractionthatwascarriedoutinduplicateaccordingtoFolchetal.(1957)
-
Totallipids
-
Meancorpuscularhaemoglobinconcentration(MCHC)istheaverageHbconcentrationperunitvolume(100)ofpackedredcells(W/V).Henceitisexpresseding/1whichisthesameaspercent(%).ItiscalculatedbythefollowingformulaHbMCHC=—......x100(g/dl)PCV
-
MCHC
-
Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes
-
PackedCellVolume(PCV)orHaematocrit(Ht)
-
Theexperimentalsetup(Figure8and9)forthedeterminationofO2uptakesimultaneouslyfromairandwaterwassimilartothatusedearlierbyNatarajan(1972),Rani(1994)andVijayalakshmi(1996).Aclosedglassrespirometerof5litrecapacitywasfilledwith3.5litrefreshtapwater.Athermocolfloatwithasemicircularholeatitsperipherywasplacedoverthewater,whichseparatedtheair-waterinterphaseoftherespirometer.Theair-phaseoftherespirometerwasattachedtoafluidmanometer.Asthefishcomestothewatersurfaceandtakesair-gulp,thereisapressurechangeintheair-phasecausinganimbalanceinthemanometricfluid.AgraduatedsyringefilledwithpureO2(takenfrommedicalO2cylinder)isusedtorestoretheimbalanceofthemanometricfluid.TheamountthusneededshowstheaerialO2uptakeofthefish.TheexpiredCO2wasabsorbedbythepelletsofKOHinthepetridishoverthemanometricfluid.Theconcentrationofdissolvedoxygenoftheambientwaterwasestimatedbefore andaftertheexperimenttomeasuretheaquaticO2uptakebythefish.ThedifferenceintheDOandtheamountofwaterindicatestheactualaquaticO2uptake.Winkler’svolumetricmethod(Welch,1948)wasusedtoestimatetoDOofthewatersamples.Darkenedrespiratorychamberswereusedwithdimensionsthatwereclosetothoseofthefishinorderthatthefishshouldremaininmoreorlessthesamepositionbut havesufficientroomtomoveitsopercula.Theflowofwaterthroughtherespirometer wasregulatedandmeasuredbymeansofaflowmeter.APhilipsO2electrode(PI1056)waskeptinawaterjacketmaintainedatthesametemperatureastheclosedcirculation.SamplesoftheinflowandoverflowwatercouldalsobeledovertheO2electrode
-
Bimodalrespiration
-
Thefisheswerefedadlibitumwithboiledhen’seggsontwodaysinaweekandearthwormsontheremainingdays.Feedingwasstopped24hrpriortoexperimentation.Noprophylactictreatmentforanydiseaseproblemwasnecessaryatanytimeduring acclimationandtest
-
Feeding
Tags
- Method-3
- Method-19-Method-3
- Method-8-Method-3-detail
- Method-8-Method-3
- Method-3-detail
- Method-19-Method-3-detail
- Method-16-Method-3-detail
- Method-10-Method-6-Method-3-detail
- Method-10-Method-3-detail
- Method-10-Method-3
- Method-17-Method-3-detail
- Method-10-Method-6-Method-3
- Method-17-Method-3
- Method-16-Method-3
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
The PCR products were ligated with T-tailed vectors (pGEM-T Easy, pTARGE-TfM from Promega or pcDNA3.1 from Invitrogen). In general, the ligation was carried out at a vector: insert molar ratio of 1:3 or 1:4 in a 10pl reaction volume finally containing 1X T4 DNA ligase buffer (300mM Tris-HCl, pH 7.8, 100mM MgCh, 100mM DTT, lOmM dATP) and lU of T4 DNA ligase (Promega, U.S.A.). The reaction mix was incubated at 160C for 16 hrs (overnight). Following the reaction, the ligated DNA was transformed into Calcium Chloride treated E.coli-DH5a or XL-Blue1 competent cells with a high transformation efficiency. The transformed cells were plated on to Luria-Bertani-Agar plates containing 100p.g/ml of ampicillin. Additionally, for blue-white screening of the colonies, 20pl of SOmg/ml of X-Gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside) and 10pl of 0.1M IPTG (lsopropyl-J3-thiogalactopyranoside) (Promega, U.S.A.) was used. The plated cells were incubated at 370C for 8-10 hours
-
Ligation and Transformation:
-
The cell lines, HEK 293 (human embryonic kidney cells) and HepG2 (human hepatocellular carcinoma) cells were obtained from ATCC. APOBEC3G-HA-293 cell line was obtained from the National Institutes of Health (Bethesda, Maryland, USA) AIDS Repository and grown according to standard procedures. Ecoli strains DHSa or XL-Blue were used for DNA cloning
-
ell lines and Bacterial strains
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Cells growing in culture medium were harvested by trypsinization and washed twice with ice cold PBS. Cells were fixed by adding ice cold 70% ethanol and stored at 4°C. Before harvesting cells were washed twice with PBS and re-suspended in adequate amount of PBS containing Propidium Iodide (PI) to a final concentration of 50μg/ml and RNase to a final concentration of 10μg/ml. Thereby the cell suspension was incubated at 37°C for 30 minutes in dark. Analysis was done by running the samples in BD FACS Vantage System according to the standard procedures after calibration of instrument with Calibrite beads
-
Flow Cytometry
-
The plates were kept in incubator gently and the colony formation was monitored every week. Media (500μl) was added to the plates every 4th-5th day to avoid drying. Colonies formed in soft agar photographed were taken without staining, under a microscope in light field
-
Agar solution was prepared in a sterile 50ml Schott Duran Bottle and boiled in microwave until fully dissolved and kept at 55°C to 65°C. Master Mix with the rest of the components of bottom agar was made in a sterile corning 50ml tube prewarmed at 55°C and agar solution was added. The solution was once vortex briefly and then added (2ml) carefully to each well avoiding air bubbles. The plates were left undisturbed in laminar flow hood until the agar set fully. Two days before final assay, the bottom agar plates were kept in tissue culture incubator for equilibration. On the day of assay the following mix was prepared for Top Agar 4 dishes 5 dishes1.media with FBS, L-glutamine and Pen-Strep 4.8 ml 6 ml 2.fetal bovine serum 1.8 ml 2.5 ml 3.sterile water 1.8 ml 2.5 ml 4.agar 1.8% (1.8 g/100mLs) 1.8 ml 2.5 ml 5. cell suspension 1.0 X 105/ dish 100 to 350 μl 100 to 350 μl 6. Total 10.2 ml 13.5 ml Top agar mix without cells was first prepared and kept at 42°C. The cells were then trypsinized and re-suspended after counting in final volume of 100μl to 200 μl. Cells were then mixed with top agar and solution was quickly poured over the bottom agar.
-
For soft agar assays 2x104, (A549) or 1x105 cells (E-10) were used in 1.5ml top agar. For preparing bottom agar plates (0.64% final con. of agar), a following mix was prepared for five dishes. 1.2X media with FBS, L-glutamine and Pen-Strep 10 ml 2.fetal bovine serum 5 ml 3.sterile water 1 ml 4.noble agar 1.8% (1.8 g/100mLs) 9 ml 5.Total 25 m
-
Soft Agar Assay
-
For clonogenic assays, 1x103 (A549) or 2x103 (E-10) cells were seeded per well of a six well tissue culture plate and grown for 15 days. For identification of signaling pathways various inhibitors were used viz, PI3K inhibitor LY294002 (10μM), MEK inhibitor PD98059 (10μM) or p38 inhibitor SB203580 (10μM). Cells were grown in the presence of inhibitor for seven days following which fresh medium was added. For staining, cells were washed twice with PBS and fixed in 10% formalin for 10 minutes, washed extensively with water and stained with 0.25% crystal violet prepared in 25% methanol for 4hrs at 4°C. Plates were then washed with milli Q water and dried before scanning
-
Clonogenic Assay
-
and fixed with 100μl of fixative solution per well, for 10 minutes at room temperature. The cells were then washed twice with PBS and 100μl of staining solution was added to each well. The plate was kept at 37° C, until the color development.
-
4x103-5x103 cells were plated in 96 well plate, well. Cells were transfected with reporter plasmid 18 -24 hrs after plating. After 48 hrs, cells were washed once with PBS
-
Procedure:
-
ml 1X PBS
-
This protocol is for the detection of β-gal expression in fixed cells. It was performed on 96-well plates for initial screening of tTA transfected clone, and is a modification of Sanes et al., 1986
-
In situβ-gal staining of Transfected Cells
-
Procedure:
-
β- galactosidase assay was performed in a 96 well format. Briefly, 4000-5000 cells were plated in 96 well tissue culture coated plate. Cells were transfected with reporter plasmid after 18 -24 hrs and after 48 hrs the cells were washed once with D-PBS. 50μl of lysis buffer was added to the well and cells were lysed by freezing plate at -70°C and thawing at 37°C. Cells were pipette up and down and then the plate was centrifuged at 9000 X g for 5 minutes. The supernatant from each plate was transferred to clean eppendorf tube. Immediately prior to assay the ONPG cocktail was prepared as below: 47 μl 0.1 M sodium phosphate (pH 7.5)22 μl 4 mg/ml ONPG1 μl 100X Mg solution30μl of each well extract was added to microtitre well plate and70μl of ONPG cocktail was added to each well. The plate was kept on ice throughout the procedure. After addition of ONPG cocktail the plate was transferred to 37°C and the development of colour was monitored every 10 minutes for development of color. After development of yellow colour, the reaction was stopped by addition of 150μl of 1M sodium carbonate to each well
-
Lysis Buffer: 0.1% Triton X-100/0.1 M Tris-HCl (pH 8.0). 450 ml distilled water 50 ml 1M Tris-HCl (pH 8.0) 0.5 ml Triton X-100 detergent • 100X Mg++ solution: 0.1 M magnesium chloride 4.5 M 2-mercaptoethanol Stored at 4°C. • 0.1 M sodium phosphate (pH 7.5)41 ml 0.2 M Na2HPO4 9 ml 0.2 M Na H2PO4 50 ml distilled water • 4 mg/ml ONPG (o-nitrophenyl-β-D-galactopyranoside) in 0.1 M sodium phosphate (pH 7.5) containing 2 mM β-mercaptoethanol, Stored at –20°C. • 0.1 mg/ml β-gal standard: 0.1 mg/ml β-gal in 0.1 M sodium phosphate (pH 7.5) containing 2 mM 2-mercaptoethanol Stored at 4°C. • 1 M sodium carbonate in water
-
Solutions:
-
β-gal assay in transfected cells
-
normalized to the optical density at day 0 for the appropriate cell type. Growth curve was determined twice
-
Growth curves were prepared for various cell lines using the modified method adopted by Serrano et al, 1997. Briefly, 10, 000 cells were seeded in a 24 well plate in quadruples. At the indicated times, cells were washed once with PBS and fixed in 10% formalin for 20 minutes and rinsed with distilled water. Cells were stained with 0.05% crystal violet for 30 minutes, rinsed extensively and dried. Cell associated dye was extracted with 1.0ml acetic acid. Aliquots were diluted 1:4 with water and transferred to 96 well microtitre plates and the optical density at 590nm determined. Values were
-
Growth Curves:
-
After PCR, 1 μl of Dpn1 enzyme (10U/μl) was added to the amplification mix and incubated at 37°C for 6hours. After that, 10ml of the amplification mix was taken to transform Dh5a cells. Positive clones were selected after confirming the sequence of plasmid DNA
-
The PCR parameters were as follows
-
The reaction mix included 2ml of PSKll(39+) (50ng) containing wild type K-Ras cDNA , 5ml 10x buffer, 20pmoles of primers , 1ml of 10mM dNTP mix and 1ml of deep vent polymerase (NEB).
-
The following K-Ras-ras mutants were generated by site directed mutagenesis according to the protocol described in QuickChange site directed mutagenesis kit (Stratagene). The primers used are shown in the following table
-
appropriate secondary antibody (conjugated with horse-radish peroxidase) diluted in 5% fat free milk solution (in PBST) and incubated for 45 minutes at room temperature. After incubation the membrane was washed and processed for the detection of protein bands using ECL-plus detection reagent (Amersham Biosciences) followed by detection of signal on X-ray film (Hyperfilm-ECL, Amersham Biosciences)
-
Site Directed Mutagenesis
-
The proteins were resolved using denaturing SDS-PAGE gel and after completion of the run, the gel was over laid on a nitrocellulose paper cut to the size of gel and kept in the blotting cassette in the presence of blotting buffer. Finally the cassette was put in the mini transblot apparatus (Bio Rad) and blotting was done for 4 hours at a constant voltage of 60 V. Then the membrane was taken out and rinsed in PBS containing 0.1% Tween - 20 (PBST) for 5 minutes by gentle shaking. Later the membrane was immersed in 5% non-fat milk solution in PBST with gentle shaking for 1 hour at 37°C. The membrane was washed off from the traces of the fat free milk with PBST and the membrane was over laid with primary antibody diluted in PBST for 3 hours at 4°C with shaking. After incubation the membrane was washed with PBST and layered with
-
Immunobloting
-
For adherent cells from which lysates have to be prepared , culture medium was removed and cells were washed with ice cold 1X PBS twice and then scraped with cell scraper in Cell Lysis buffer. Cells were rotated at 4°C for 30min at cold room and centrifuged at 13000 rpm for 10min at 4°C. The supernatant was collected and protein concentration was estimated using BCA assay. For standard western, 50-70μg of protein was loaded on to the gel
-
Lysate Preparation for Immuno- blotting
-
DTT. Then contents were then mixed and 1μl (200 units) of M-MLV was added. The mixture was then incubated at 37°C for 50 minutes. The reaction was stopped by incubating the mixture at 70°C for 15 minutes. The cDNA thus prepared was then used as a template for PCR. The expression of the investigated genes was determined by normalizing their expression against the expression of actin or GAPDH gene
-
Semi-quantitative RT-PCR
-
μg of total RNA was reverse-transcribed using poly-T oligonucleotide and M-MLV reverse transcriptase (Invitrogen) according to manufacturer’s protocol. Briefly, a 20μl reaction volume was made for 1μg of RNA. In a microcentrifuge tube, 1μl oligo (dT)(500μg/ml) , 1μg total RNA, 1μl 10mM dNTP mix and sterile water was added to afinal volume of 13μl. The mixture was then incubated at 65°C for 5 minutes ad quickly chilled on ice. To this mixture were added 4μl of 5X first strand buffer and 2μl of 0.1M
1
-
Total RNA was isolated by TRIzol method using the manufacturer’s protocol. Briefly, medium was removed, from 35mm dish and 1ml to TRIzol was added directly to the dish and kept at room temperature for 5 minutes. The cells were harvested by pipetting up and down three four times and transferred to a 1.5ml microfuge tube. For each 1mlTRIzol, 200μl of chloroform was added and tubes were shaken vigorously for 10 seconds to completely dissociate the nucleoprotein complexes, followed by vortexing for about 30 seconds. The mixture was kept for 3-5 minutes at room temperature and then centrifuged at maximum speed for 10 minutes. The upper aqueous phase was transferred into a fresh microcentrifuge tube and 500 μl of isopropanol was added and this was incubated at -20°C for 1 hour. The RNA was pelleted by centrifugation at maximum speed for 30 minutes at 4°C. The supernatant was decanted and the pellet washed with 1ml of 70% ethanol followed by a second wash with 1ml of 90% ethanol and centrifugation at maximum speed for 10 minutes. The supernatant was removed and the pellet air-dried for about 5 minutes and re-solubilized in 30-50 μl RNase free deionized (DEPC-treated Milli-Q) water and aliquots were stored at -70°C
-
Total RNA isolation from cultured mammalian cells
-
Transient transfection of plasmid DNA in culture cells was performed using Lipofectamine 2000 according to manufacturer’s protocol. Briefly, forty million cells were seeded in a 35mm tissue culture dish, one day before transfection. Transfection was performed 18-24 hrs after seeding the cells. 4μg DNA was mixed in 50μl of Opti-MEM in one eppendorf tube. In another tube, 5μl of Lipofectamine 2000 was diluted in 50μl Opti-MEM and incubated at room temperature for 5 minutes. After five minutes, DNA and Lipofectamine 2000 were mixed together and complexes, incubated for 30 minutes at room temperature. Meanwhile, the adherent cells were washed twice with PBS and 1ml of Opti-MEM was added. 100μl of complexes were then added to each dish containing cells and medium. After 6hrs, the medium containing complexes was removed and complete medium was added and transgene expression was accessed 24-48 hrs after transfection
-
Transient transfections in adherent cells
-
The quantity and purity of nucleic acids was determined by measuring the absorbance at 260 and 280 nm. The concentration of nucleic acids was calculated by taking 1 OD 260= 50 μg/ml for DNA, 40 μg/ml for RNA and 33 μg/ml for single stranded oligonucleotides. The purity of nucleic acids was checked by their A260/A280 ratio
-
Spectro-photometric estimation of nucleic acids
-
ethanol has dried. The pellet was resuspended in 20 μl of milliQ water and 20 μg/ml RNase added. The tube was incubated at 50°C for 45 min. the tube was vortexed for few seconds. Quality of the plasmid DNA was then accessed by running 1% agarose gel.
-
stored. To prepare competent cells pre-inoculum was prepared. A single bacterial colony was picked from LB agar plate, inoculated into 3 ml LB medium, and incubated overnight at 37°C temperature with shaking at 200 rpm. 1% of this pre-inoculums was sub cultured in 100 ml LB-broth and incubated at 18°C with shaking until OD at 600nm reached 0.5 - 0.6 (approx.). Culture was kept on ice for 10 min. with constant shaking.Cells were pelleted by centrifugation at 2000 g at 4°C for 8 min. Pellet was resuspended in 40 ml of ice-cold TB buffer. Bacterial suspension was kept on ice for 30 min, re-spun at 2000 g at 4°C for 8 min. Pellet was resuspended in 8 ml of TB buffer in which final concentration of DMSO was 7% and left on ice for 10 min. 100 μl aliquots were made and snap frozen in liquid nitrogen and stored at -80°C
-
All the salts (10 mM PIPES, 15 mM CaCl2.2H2O, 250 mM KCl, 55 mM MnCl2.2H2O) except MnCl2 were dissolved in milliQ water and pH was adjusted to 6.7 with 1N KOH. MnCl2 was dissolved separately in mill Q water. MnCl2 was added drop wise while stirring (MnCl2 if added directly will give a brown color to the solution and precipitate out, hence it needs to be dissolved separately). Solution was then filter sterilized and
-
Overnight Grown culture was pelleted by centrifugation at 10,000g at 4°C for 3 min and the supernatant was discarded. Pellet was resuspended in 250 μl of ice-cold alkaline lysis solution 1. 300 μl of alkaline solution 2 was then added and the tube was inverted gently 3-4 times and incubated at room temperature for 5 min. 350 μl of ice cold solution 3 was added and mixed by inverting the tube rapidly for 3 or 5 times. Suspension was incubated on ice for 10 min. Bacterial lysate was spun at 10,000g for 12 min at 4°C. Supernatant was transferred to a fresh tube. 0.4 volume of phenol: chloroform was added to the supernatant and the contents mixed. It was then spun at 10,000g at 4°C for 12 min. Aqueous phase was taken out in a fresh tube and 0.6 volume of isopropanol was added, mixed properly and incubated at room temperature for half an hour followed by spinning at 10,000g at RT for 20 min. Supernatant was discarded. Pellet was washed with 70% ethanol. The tube was stored at room temperature until the
-
Ultra Competent Cells Preparation
-
Experimental Procedures
-
Human lung epithelial type II cells (HPLD) were a kind gift from Dr. T Takahashi, Japan. All the cell lines were maintained in 5% CO2 with the recommended media containing 10% FBS (3% FBS for HPLD) and following the standard guidelines.
-
A549 (human lung adenocarcinoma epithelial) and murine fibroblast cell line NIH3T3 was purchased from American Type Culture Collection. Murine lung epithelial cell line E-9 and E-10 were a kind gift from Dr. L.M.Anderson, (NCI-FCRDC, Frederick, Maryland)
-
Cell Lines
Tags
- Md-3-Md-5
- Md-3-Md-3
- Md-3-Md-12-Md-4
- Md-3-Md-11-Md-1
- Md-3-Md-12
- Md-3-Md-14
- Md-3-Md-12-Md-4-d
- Md-3-Md-11
- Md-3-Md-6-d
- Md-3-Md-5-d
- Md-3-Md-10-d
- Md-3
- Md-3-Md-13
- Md-3-Md-1
- Md-3-Md-12-d
- Mt-3
- Md-3-Md-4-d
- Md-3-Md-11-Md-1-d
- Md-3-Md-14-d
- Md-3-Md-9
- Md-3-Md-15-d
- Md-3-Md-10
- Md-3-Md-15
- Md-3-Md-9-d
- Md-3-Md-7-d
- Mt-3-d
- Md-3-Md-11-Md-2-d
- Md-3-Md-1-d
- Md-3-Md-8-d
- Md-3-Md-3-d
- Md-3-Md-2-d
- Md-3-Md-13-d
- Md-3-Md-11-Md-2
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
12% resolving gel (for 25 ml)Water = 8.2 ml 30% Acrylamide = 10.0 ml 1.5 mM Tris (pH 8.8) = 6.3 ml 10% SDS = 0.25 ml 10% APS = 0.25 ml TEMED = 0.01 ml 5% stacking gel (for 10 ml)Water = 6.8 ml 30% Acrylamide = 1.7 ml 1.5 mM Tris (pH 6.8) = 1.25 ml 10% SDS = 0.1 ml 10% APS = 0.1 ml TEMED = 0.01 ml
-
A double cylinder gradient former was used with 12% poly acrylamide gel mix in the inner cylinder and a 3% polyacrylamide gel mix in the outer cylinder that was stirred using a magnetic bead on a magnetic stirrer. A pump was connected to the flow tube and the flow rate adjusted at 5-8 to cast a 12-3% gradient gel. A 5% stacking gel was used. After the protein samples were run on the gradient gel, it was stained in instant blue over night under shaking. 3% resolving gel (for 25 ml)Water = 15.68 ml 30% Acrylamide = 2.5 ml 1.5 mM Tris (pH 8.8) = 6.3 ml 10% SDS = 0.25 ml 10% APS = 0.25 ml TEMED = 0.02 ml
-
Casting a gradient SDS-polyacrylamide gel
-
The DNA samples were mixed with the appropriate volumes of the 6X loading dye (0.25% bromophenol blue, 0.25% xylene cyanol and 30% glycerol in water) and subjected to electrophoresis through 1-1.5% agarose gel in either 1X TBE or 1X TAE buffer. The gel was stained in 1 μg/ml of ethidium bromide solution for 30 min at room temperature and the bands were visualized by fluorescence under UV-light
-
Agarose gel electrophoresis
-
The lacZ U118 is an amber nonsense mutation(Am) that confers Lac─phenotype and also polarity of the downstream lacYA genes in the operon due to premature Rho-dependent transcription termination within the untranslated region of lacZ. Melibiose is a sugar which can only be utilized in a lacZ (Am) strain at high temperature (39 ̊C, when the native melibiose permease is inactive) if the downstream gene lacY encoded permease is transcribed and translated. Therefore, in lacZ (Am) strains, growth on minimal melibiose plates (0.2%) at 39°C reflects transcriptional polarity relief at the lac locus, and the same was scored after streaking the relevant strains on such medium
-
lacZ (Am) assay
-
Strains were streaked on LBON agar plates and after an overnight incubation at 42°C growth was monitored (compared to that on LBON at 30°C as control). Absence of single colony growth was taken to reflect temperature sensitivity. Whenever needed the phenotype was also quantitatively assessed by plating dilutions of cultures on LBON agar plates and the drop in plating efficiency was scored after overnight incubation at 30°C and 42°C
-
LBON(Ts) phenotype
-
Plasmids constructed in this study
-
genome cloned in a ColEI-based replicon, and obtained from Dr. Manjula Reddy. pHYD2556 is spectinomycin resistant and carries the minimal nusA+ open-reading frame with its native ribosome-binding site between genomic nucleotide co-ordinates 3314061and 3315548 cloned downstream of the ara regulatory region in a pSC101-based replicon, and obtained from Dr. Ranjan Sen. pHYD2557 is chloramphenicol resistant and carries a 2.3-kb PCR-amplified region between genomic nucleotide co-ordinates 3314061 and 3316393 (containing yhbC nusA region with its own promoter) cloned in a pSC101-based Ts replicon, and obtained from Dr. Ranjan.Plasmid DNA preparations were routinely prepared from recA strains such as DH5αand were stored in 10mM Tris-Cl (pH 8.0) plus 1mM EDTA at ─20 ̊C
-
pWSK30 an Ampicillin resistant vector with pSC101 origin of replication and blue-white screening facility (Wang and Kushner, 1991). pHYD272 is a derivative of pMU575, an IncW-based single copy vector with Trimethoprim resistance marker carrying lacZYA reporter genes under proU promoter (Dattananda et al., 1991). pHYD751 a ColE1 replicon plasmid with ampicillin resistance marker and 2.1kb EcoRI-SalI fragment carrying nusG+cloned into EcoRI-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD763 is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying 3.8 kb BamHI-SacI fragment of nusG+ cloned into BamHI-SacI sites of pMAK705 (Harinarayanan and Gowrishankar, 2003). pHYD1201 a ColE1 replicon plasmid with ampicillin resistance marker and 3.3kb HindIII-SalI fragment carrying rho+cloned into HindIII-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD1622 is the derivative of pHYD1201 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD1623 is the derivative of pHYD751 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD2368 is a derivative of pBAD18 (AmpR) with 1.7 kb fragment encompassing RBS and coding region of uvsW from phage T4gt7 into SacI site of pBAD18 (K. Leela, unpublished). pHYD2554 is a derivative of pMBL18 with ampicillin resistance, carrying the 10-kb EcoRI-HindIII fragment between kilobase co-ordinates 3310.06 and 3320.08 of the E. coli
-
to CCT mutation leading to a Glutamic acid to Glycine change at the 53rd amino acid and a Threonine to Proline change at the 55th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-I119T is a derivative of pLG-H-NS plasmid with ATC to ACC mutation leading to a Isoleucine to Threonine change at the 119th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-P116S is a derivative of pLG-H-NS plasmid with CCA to TCA mutation leading to a Proline to Serine change at the 116th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-Y97C is a derivative of pLG-H-NS plasmid with TAT to TGT mutation leading to a Tyrosine to Cysteine change at the 97th amino acid in the H-NS protein (Willams et al., 1996). pPMrhoCam is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying PuvII-HindIII fragment containing trxArho+ cloned into PuvII-HindIII sites of pPM103 (Martinez et al., 1996). pTrc99A an expression vector with ColE1 origin of replication and ampicillin resistance marker. Provides IPTG dependent induction of the insert (Amann et al., 1988). pUC19 is a high-copy-number ColE1 based E.coli cloning vector (500-700 copies/cell) with an Ampr selectable marker. It is one of a series of related plasmids constructed by Messing and co-workers and contains portions of pBR322 and M13mp19 (Yanisch-Perron et al., 1985). It carries a multiple-cloning site (MCS) region in the lacZα fragment, and therefore allows for blue-white screening of recombinant clones
-
pAM34 is a pBR322-derived cloning vector with Ampr and Specr selectable markers. The replication of this plasmid is dependent on the presence of IPTG, the gratuitous inducer of the lac operon (Gil and Bouche, 1991). pBAD18 is an expression vector with a pBR322 derived origin of replication and allows for tightly regulated expression of the genes cloned under the PBAD promoter of the araBADoperon (Guzman et al., 1995). The vector also carries the araC gene, encoding the positive and negative regulator of this promoter. pBluescript II KS (pBKS) is also a high-copy-number ColE1 based cloning vector with Ampr selectable marker and blue-white screening facility (obtained from Stratagene). pCL1920 is a low-copy-number vector with pSC101 replicon (~ 5 copies/cell), that carries streptomycin (Str)/spectinomycin (Spec)-resistance marker (encoded by aadA) and also carries a MCS region within the lacZα that allows blue-white screening to detect recombinants (Lerner and Inouye, 1990). pCP20 pSC101-based Ts replicon, CmR AmpR, for in vivo expression of Flp recombinase (Datsenko and Wanner, 2000). pLG339 is a low-copy-number cloning vector with pSC101 replicon that has a Kanrselectable marker (Stoker et al., 1982). pLG-H-NS is a pLG339 derivative where the hns ORF had been cloned into the EcoRI-SalIsites of pLG339 vector (KanR, pSC101) (Willams et al., 1996). pLG-H-NSΔ64 is a derivative of pLG-H-NS plasmid with AT base pair deletion after codon 63 in the hns gene resulting in a frameshift (Willams et al., 1996). pLG-H-NS-L26P is a derivative of pLG-H-NS plasmid with CTG to CCG mutation leading to a Leucine to Proline change at the 26th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-E53G/T55P is a derivative of pLG-H-NS plasmid with GAG to GGG and ACT
-
pACYC184 is a medium-copy-number cloning vector (~ 20 copies/cell) with Cmr and Tetrselectable markers. It carries the origin of replication from plasmid p15A (Chang and Cohen, 1978), which is related to and yet is compatible with that of ColE1. This property enables pACYC184 to co-exist in cells with ColE1 plasmid vectors, including all the ones mentioned above
-
Plasmids that have been described elsewhere
-
Plasmids
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Cell surface membrane proteins were separated using a method by Snapp and Landfear (1997). 4 X 107live cells/mL were resuspended in MME buffer (10mM MPOS, 0.1mM EGTA, 1mM MgS04, 0.1%v/v Triton X-100 and protease cocktail) and incubated at 4°C for 1 hr. on an end to end rotor. This was followed by centrifugation at 3000 x g for 4°C for 10 min. The pellet obtained was washed with PBS and then lysed in 2X sample buffer and run on an SDS-PAGE followed by western blotting
-
Separation of cell surface proteins
-
1258 x g for 10 min at RT and washed 2X with PBS to remove all traces of media and FBS. D1e pellet was finally resuspended in 200p.L of resuspension solution provided in the kit. 20p.L of RNase A solution was added and incubated at RT for 2 min. 20p.L of Proteinase K and 200p.L of lysis solution were added and the cell suspension was vortexed for ~15s. This was followed by incubation at 70°C for 10 min. Pre-assembled GenElute MiniPrep Binding column was equilibrated with 500p.L of column preparation buffer by centrifugation at 12000 x g for 1min. Following incubation at 70°C, 200p.L of ethanol was added to the lysate and the vortexed for 5-10s. This lysate was then transferred to the equilibrated column and centrifuged at 6,500 x g for 1min. The column was washed 2X with 500p.L of wash buffer, by centrifugation at 6,500 x g for 3 min. To collect the genomic DNA, the column was incubated at RT with 200p.L of elution buffer for 5 min followed by centrifugation at 6,500 x g for 1 min. The genomic DNA was aliquoted and stored at -20°C for long term and 4°C for short term storage
-
Genomic DNA of Leishmania donovani was obtained using GenElute™ a mammalian genomic DNA Miniprep kit from Sigma Aldrich (St. Louis, MO). Briefly, 108 parasites were harvested by centrifugation at
-
Preparation of genomic DNA from Leishmania donovani culture
-
0% FBS and cultured as described above. The cells usually regain motility by 24 to 48 hrs and the culture is ready for use after splitting them once
-
For long term storage, Leishmania donovani were stored as Dimethyl Sulfoxide (DMSO) containing frozen stocks (freeze downs). Parasites in mid to late log phase were taken and dead and agglutinated cells removed by centrifugation at 129 x g for 10 min. The supernatant was centrifuged at 1258 x g for 10 min to pellet cells which were then washed 2X with plain medium followed by resuspension in FBS containing 10% DMSO as the cryoprotectant. These were transferred to a labelled cryogenic vial and immediately transferred to -20°C for a few hours, followed by incubation at -70°C overnight. The following day, the stocks were transferred to liquid nitrogen (liq N2). To revive a frozen stock, the stock was retrieved from liq N2 and transferred to a beaker containing water at ~37°C. Once the stock has thawed, the cells were immediately transferred to lOmL plain mDMEM and centrifuged at 217 x g for 10 min. The pellet was washed three to four times with plain medium followed by resuspension in mDMEM containing
-
Preparation and revival of frozen stocks of Leishmania donovani
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Automated DNA sequencing on plasmid templates or on PCR products was carried outwith dye terminator cycle sequencing kits from Perkin-Elmer on an automatedsequencer (model 377, Applied Biosystems), following the manufacturer’s instructions.Manual sequencing was achieved using the SequenaseVersion2.0 DNASequencing Kit from USB Corp. as described in manufacturer’s instructions and thesequencing reaction products were resolved by electrophoresis on a 6% sequencing gel
-
DNA sequencing
-
Native isoelectric focusing was done using Pharmacia Phast Gel Apparatus and precast IEF gel (pH 3-9) from GE healthcare. The samples were prepared in 50 mM sodium buffer (pH 8.0) and applied in the middle portion of the gel. Gels were run as previously described(Olsson et al., 1988) that is at 15°C, pre-focusing at 2000 V (75Vh), sample loading at 200V (15Vh) and run at 2000V (500Vh). Staining was done using Coomassie Blue G-250
-
Native Isoelectric Focusing
-
Gel-filtration chromatography was performed at room temperature on a BioLogic LP protein purification system (Biorad) with an in-house packed Sephadex G-100 column of size 1.5 X 43 cm; each protein sample was loaded in 0.8-ml volume, and the buffer used for chromatography was 20 mM Tris-Cl (pH 8) with 200 mM NaCl at a flow rate of 0.1 ml per min with 1.5-ml fractions being collected for analysis. Protein elution was detected by measurement of A295.The void volume, V0was determined using blue dextran (2X 106Daltons) and theelution parameter Kavfor each proteinwas calculated from elution volume Veand total bed volumeVtusing the equation:Kav= (Ve–V0)/(Vt–V0)Initially, acalibration curve was derived froma semilogarithmic plotof Kav of protein standardsalbumin (67 kDa), ovalbumin (43 kDa), chymotrypsinogen (25 kDa) and ribonuclease A (13 kDa) on the Y-axis against log10of their molecular masses on theX-axis. The Kavof the ArgPdproteins were calculated based on their elution volume and then the molecular masses were derived from the corresponding point on the calibration curve
-
Gel-filtration chromatography
-
directly from lysed cells, log and stationary phase cultures were spun down, samplebuffer (1 X final concentration) was added to the cell pellet and boiled for 10 min,cooled to room temperature, and after a second spin, the clear supernatant was loaded.The gel run was started at constant current of 20 mA. When the dye front crossed thestacking gel the current was increased to 40 mA
-
The method followed was as described in Sambrook and Russell (2001). Gels of 1.0mmthickness were casted in the commerciallyavailable small gel apparatus. Resolving gelof 12% (15 ml) and stacking gel (4 ml) was made. Gels were polymerised by theaddition of TEMED and APS (1 % v/v of the gel mix). Sample preparation for gelloading was done as follows. Cell lysate or pure protein fractions (around 30 μg) wasmixed with the sample buffer to 1 X and heated at 95ºC for 2-min. To check expression
-
Sodium dodecyl sulphate-polyacrlyamidegel electrophoresis (SDS-PAGE)
-
Protein concentrations were estimated by the method of Bradford (1976). The A595wasmeasured after complexation with Bradford reagent. Bovine serum albumin was usedas standard against whichthe unknown protein concentrations were estimated
-
Protein estimation
-
Overexpression and purification of ArgPand ArgPdproteins
-
argP+, argPd-S94L, argPd-P108S, argPd-P274Sfragment downstream of the phage T7-promoter, such that the encoded proteins beara C-terminal His6-tag provided by the vector DNA sequence. Theresultant plasmid was transformed into strain BL21(DE3) which has the T7 RNA Polymerase under the isopropyl thio-β-D-galactoside (IPTG) inducible lacUV5promoter.The resultant strains were grownin LB (500-1000 ml) to an A600of around 0.6and were then induced with 1 mM IPTG and harvested after 4-hrs of induction.Bacterial cells were recovered by centrifugation, resuspended in 20 ml of lysis buffer(20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mM DTT and 10 mM imidazole) containing20 μg/ml lysozyme, and lysed by sonication with 30-sec pulses for 10-min. Theprotocol for His6-ArgP(ArgPds)protein purification involved (i) passing the lysate through a 5ml Ni-NTA (Qiagen) chromatographic columnequilibrated with lysis buffer, (ii) washing thecolumn with 100 ml of washing buffer (20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mMDTT; 30 mM imidazole), and (iii) elution of His6-ArgP(ArgPds)from the column with elutionbuffer (20 mM Tris-Cl, pH-8;300 mM NaCl; 10 mM DTT and 250 mM imidazole) andcollection of 1.5 ml eluate fractions (10 fractions). The fractions were tested forprotein by Bradford method and the protein-carrying fractions (generally tubes 2 to 5)were pooled and dialysed in a 1:200 volume ratio against 20 mM Tris-Cl, pH-8 with 10mM DTT, 300 mMNaCl for 5 hrs followedby a change to buffer of composition 20 mM Tris-Cl, pH-8 with 10 mM DTT, 300 mM NaCl and 40% glycerol for 24 hrs. The proteins were concentrated by centrifugation toaround 1 mg/ml by using Amicon filter (pore size 10-KDa) and stored at −20ºC or −70ºC
-
For preparing ArgP and ArgPd-S94L, -P108S and -P274S proteins, derivatives(designated as pHYD1705, pHYD2678, pHYD2679 and pHYD2680 respectively) of the plasmidvector pET21b (Novagen) was constructed which carries the PCR-amplified
-
Biochemical techniques
-
TheDNA samples were mixed with appropriate volumes of 6 X loading dye (0.25%bromophenol blue and 0.25% xylene cyanol and 30% glycerol in water) and subjectedto electrophoresis through 0.8 to 1 % agarose gel in TAE buffer. The gel was stained in1 μg/ml ethidium bromide solution for 15-min at room temperature and visualised byfluorescence under UV-light in a UV-transilluminator
-
Agarose gel electrophoresis
-
Test for canavanine (CAN) sensitivity
-
CAN is a toxic analog of Arg and is an inhibitor of bacterial growth. Strains were tested for sensitivity/resistance to CAN by streaking them on minimal A-glucose platessupplemented withoutand with40 μg/ml CAN(or other concentrations as indicated) and 40 μg/ml uracil
-
Competent cells for high efficiency transformations were prepared by a method ofInoue et al. (1990) with few modifications. An overnight culture of the strain (routinelyDH5α) was sub-cultured into fresh sterile LB-brothin 1:100 dilutions and grown at 18ºC to an A600of 0.55. The cells were harvested by centrifugation at 2500 rpm for 10-min at 4ºC. This was re-suspended in 0.4 volumes of INOUE buffer and incubated inice for 10 min. The cells were recovered by centrifugation at 2500 rpm at 4ºC for 10-min and finally re-suspended in 0.01 volume of the same buffer. Sterile DMSO wasadded to a final concentration of 7%. After incubating for 10-min in ice, the cells werealiquoted in 100 μl volumes, snap frozen in liquid nitrogen and stored at –70ºC
-
Preparation of high efficiency competent cells
-
For routine plasmid transformations, following method which is modification of thatdescribed by Cohen et al. (1972) was used. An overnight culture of recipient strain wassub-cultured 1:100 in fresh LB medium and grown till mid-exponential phage. Theculture was chilled on ice for 15-min, and the steps thereafter were performed at 4ºC.20 ml of culture was centrifuged and pellet was re-suspended in 10 ml of 0.1 M CaCl2.After 15-min of incubation on ice, the cells were again centrifuged and re-suspended in2 ml of 0.1 M CaCl2. The suspension was incubated on ice for 30-min. To the 200 μl aliquot of the cell suspensionplasmid DNA (20 to 200 ng in less than 10 μl volume)was added, incubated for half an hron ice and given a heat shock for 90-sec at 41ºC.The cultures was rapidly chilled, mixed with 0.8 ml of LB-broth and incubated at 37ºCfor 1-hr, and plated on an appropriate selective medium at various dilutions. An aliquotof cell suspension to which plasmid DNA was not added served as a negative control
-
A. Calcium chloride method
-
Transformation
-
The primers used in this study are listed in Table 2.3.Table 2.3 Oligonucleotide primersa
-
Primers
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
For TEM, C. glabrata cells were digested with zymolyase 20T for 3 h at 30◦C, centrifuged at 1,000 g and washed with YPD medium. Cell fixation was performed as described for SEM and dehydrated samples were embedded in araldite 6005 resin. After complete polymerization at 80 ̊C for 72 h, ultra-thin (50-70 nm) sections were preparedwith a glass knife on Leica Ultra cut (UCT-GA-D/E-1/00)microtomeand mounted on copper grids. Aqueous uranyl acetate-stained and Reynolds lead citrate-counterstained samples were viewed under Hitachi H-7500 transmission electron microscope
-
Transmission electron microscopy
-
For SEM, C. glabratacells were fixed for 24 h in 2.5% glutaraldehyde in phosphate buffer (0.1 M, pH 7.2) at 4 ̊C, post-fixed in 2% aqueous osmium tetroxide for 4 h and dehydrated. After drying to critical point, mounted samples were coated with a thin layer of gold for 3 min using an automated sputter coater and visualized by SEM (JEOL-JSM 5600)
-
Scanning electron microscopy
-
Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were performed at the Electron Microscope Facility, RUSKA LABs, Acharya N. G. Ranga Agricultural University, Hyderabad
-
Electron Microscopy
-
Log-phase yeastcells were collected, washed and suspendedin 10 mM Tris-HCl (pH 7.5) containing 50 mg/ml zymolyase-20T. Cell suspension was incubated at room temperature and absorbance was monitored at 600 nm every10mininterval. Initial absorbance of the cultures at 0 minwas normalized to 100%and the graph was plottedas%decrease in the absorbance with respect to time
-
Zymolyasedigestion assay
-
Resultant precipitate was dissolved in 3 N HCl and reprecipitated in methanol:acetic acid (8:1) solution. Following 16 h incubation at room temperature, the precipitate was washed withmethanol:acetic acid (8:1) solution till green colour of the supernatant disappeared.Finally,pellet was washed thrice with methanol and air dried. Driedpellet was resuspended in 0.5 NHCl and total mannan content was quantified with phenol-sulphuric acid carbohydrate estimation method as described earlier.Commercially available purified glucose was used as the standard
-
Total mannan from 3% NaOH-extractable supernatant of cell wall was precipitated by Benedict’s solution.Reducing sugars(mostly mannan) from alkali-extractable supernatant reactwith copper(II) sulphate present in Benedict’s solution and forms red copper(I) oxide precipitate.Briefly, equal volume of Benedict’s solution was added to 3% NaOH-extractable cell wall supernatant fraction and heated at 99 ̊C for 10 min
-
Total mannan estimation
-
Cell wall β-glucan measurement was carried out as describedpreviously with some modifications(Kapteynet.al.,2001). Briefly, cell wall fractions were washed multiple times with 1 N NaCl. Washed cell walls were boiled twice in 50 mM Tris-HCl(pH 7.8) containing 2% SDS, 100 mM Na-EDTA and 40 mM β-mercaptoethanol for 5 min to remove non-covalently linked proteins and other contaminants. SDS-treated cell wall fraction was collected and rinsed thrice with water. For β-glucan isolation, cell wallswere extracted three times, each for 1 h, in 0.5 ml 3% NaOH at 75 ̊C and centrifuged at 1,200 g.All 3% NaOH supernatant fractions were saved for isolation of mannan as described below. 3% NaOH-extractable cell wall pelletwasneutralized twice in 100 mM Tris-HCl (pH 7.5) and once in 10 mM Tris-HCl (pH 7.5) and digested with 5 mg/ml zymolyase-20T in 10 mM Tris-HCl (pH 7.5) for 14-16 h at 37 ̊C. This treatment liberates approximately 90-95% glucose into the supernatant. Total glucan content in the cell wall was measured by estimating glucose from both the solubilised supernatant and zymolyase-20T insoluble pellet fractions with phenol-sulphuric acid carbohydrate estimation method using purified glucose as the standard
-
Total β-glucan estimation
-
min. Cells were normalized to equal OD600, resuspendedin 1 ml 50 mM Tris-HCl (pH 7.5) and transferred to 2 ml microcentrifuge tubes. Cells were lysed with glass beadsin a homogenizer (FastPrep®-24,MP Biomedicals)asdescribed earlier.Brokencells were washed from glass beadswith 500 μl Tris-HCl (50 mM, pH 7.5) and pelleteddown at 15,000 g for 10 minto obtainall cell wall and membrane content. Pellet was then boiled for 10 minin 1mlTris-HCl(50mM; pH 7.5)solutioncontaining 2%SDS. SDS-extractable material(mannoproteins)was savedand remaining pellet wasboiled again in 500 μl Tris-HCl(50 mM; pH 7.5)buffer containing 2%SDS. Cell wallwas collectedby centrifugation at 15,000 g for 10 min, washed twice with1 ml waterandresuspendedin 100 μl 67 mM potassium phosphatebuffer. This washed cell wall materialwas used for β-glucan estimation as described below
-
Yeast cell wall was isolatedas describedpreviously(De Groot et al., 2004). Briefly, cells grown underdifferent environmental conditions were harvested at 5,000 g for 5
-
Crude cell wall isolation
-
Cell wall isolation, zymolyasedigestion assay and β-glucan estimation
-
Cells grown to log-phase in YPD medium were spotted on CAAmedium and overlaid with a nitrocellulose filter. Cells were allowed to grow at 30 ̊C for 18-20 h. After incubation, the filter was washed with water to remove cells and membrane-bound CPY was detected by immunoblotting withpolyclonal anti-CPY antibody (Thermo Scientific) at a dilution of 1:15,000
-
Carboxypeptidase Ysecretion assay
-
CPY activity was measured as described previously (Jones,2002). A 2.5 mg/ml stock solution of CPY-specific substrate N-benzoyl-L-tyrosine p-nitroanilide(BTPNA, prepared in dimethyl formamide) was diluted 5 times with 0.1 M Tris-HCl (pH 7.5). 100 μl diluted substrate solution was added to a 96-well plate containing 25 μl cell suspension (5 x 107cells). After 18 h of incubation at 37 ̊C, plate contents were clarified by centrifugation and colour formation was quantified by absorbance at 405 nm. Background absorbance measured using BTPNA-free cell cultures was subtracted from BTPNA-loaded cell cultures and absorbancevalues were normalized to total number of viable cells to enumerate total cellular CPY activity
-
Carboxypeptidase Y(CPY) activity assay
-
ammonium molybdate, respectively, to the assay buffer.For specific inhibition of vacuolar membrane H+-ATPaseactivity, vacuolar membrane fractions were incubatedwith 1-2.5 μM bafilomycin for 5 minprior to the activity assay.ATPase activity was initiatedby adding ATP to the assay buffer to afinal concentration of 5 mM and incubating the reactionat 30 ̊C for 30-60 min.Reaction was stopped by adding an equal volumeof a stop-developing solution (1% (w/v)SDS, 0.6 M H2SO4, 1.2%(w/v)ammonium molybdate and 1.6%(w/v)ascorbic acid). Amount of inorganic phosphate (Pi) liberated was measured at A750nmafter 10 minincubation at room temperature. Standard curve prepared with 0-50 micromoles of KH2PO4 was used for the determination of total Pi. The ATPase activity of the vacuolarmembrane H+-ATPase was expressed in micromoles of Pireleased per milligram protein per min
-
Vacuolar membrane H+-ATPase activitywas measured inbothcrude membrane fraction and purifiedvacuolar membrane fraction asdescribed previously(Woolfordet al.,1990).Activity inthe crude membrane fractions was carried out with 2.5-10 μgprotein in 50 μl assay buffer (5 mM MgCl2, 25 mM MES/Tris-HCl(pH 6.9)and 25 mM KCl). For activity inthe purified vacuolar membrane fraction, a totalof300 μl reactionmix was setup with of 2.5-10 μgprotein samples.Residual activities from other ATPases such as mitochondrial ATPases, plasma membrane H+-ATPase and phosphataseswere inhibited by adding 2 mM NaN3, 200 μM NaVO4and 0.2 mM
-
Vacuolar H+-ATPase activity measurement
-
Vacuole membraneswere isolatedwith slight modifications of Cabrera’s method(Cabrera et.al.,2008). Log-phase, YPD medium-grown cells wereinoculated in 1 lt YPDmedium to an initialOD600of 0.1. Cells were incubated at 30 ̊C with shaking at 200 rpm till the cell density reached to OD600of 0.8-1.0.Cells were harvested by centrifugation at 5,000 g and washed once with 30 ml 2% ice-cold glucose solution. Cells were incubated in 15 ml solution containingglycine-NaOH(50 mM; pH10)andDTT(2 mM) at 30 ̊C for 10 min. After incubation, cells were normalized to adensity of1000OD600and resuspendedin 15 ml spheroplasting buffer containing 10-15mg of zymolyase20T.Cells were incubated at 30 ̊C for 45-60 minor till the spheroplasting was completed.Spheroplasts werecollected by centrifugation at 4,500 rpmfor 5 minat 4 ̊C, washed gently with15 ml 1.2 M sorbitol solutionandresuspendedin 3.5 ml 15%ficoll solution made in PS buffercontaining 1X protease inhibitor cocktail. This suspension was homogenized on ice with 20-25 strokes in a loose-fitting Dounce homogenizer. Homogenate was transferred to an ice-cold,ultra-clear Beckman ultracentrifuge tube, overlaid witha gradient of3 ml 8%ficoll solution, 2.5 ml 4%ficoll solutionand 2.5 ml PS buffer lacking ficoll and centrifuged at 1,10,000g(30,000 rpm)for 90 minat 4 ̊Cin a pre-cooled Beckman ultracentrifuge with SW41-Ti swinging bucket rotor.Centrifugation was carried out with slow acceleration and deceleration settings.White creamy vacuole membrane layer wascollected from the interfaceof 0and4% ficoll gradientwithout mixing the layers.Total protein concentration in thevacuole fraction was estimated using BCAprotein assay kit as described earlier
-
Purified vacuole membrane isolation
-
Crude fractionation of total membraneswas carried outviadifferential centrifugation asdescribed previously (Moranoand Klionsky,1994)with slight modifications. Cells grown tolog-phase in YPDmedium werecollected, washed,normalizedto 10 OD600and resuspendedin 1 ml spheroplast buffer containing 1-2mg of zymolyase20T (MP Biomedicals).Following incubation at 30 ̊Cfor 30-45 min,spherolplastswerecollected by centrifugation at 800 g for 3 minat 4 ̊C and resuspendedin 1 mlice-cold Tris-EDTA (pH 7.5). Spheroplastswere lysed with 100 μl 0.5mm glass beads on a vortex mixer with 10 secpulsegiven thricewith intermittent ice-breaks.Cellsuspension was centrifuged at 800 g for 5 minat 4 ̊C to pellet unbrokenspheroplastsdown andthesupernatant was centrifuged at 15,000 g for 5 minat 4 ̊C to obtainthemembrane fraction pellet.Pellet was washed once with ice-cold Tris-EDTA (pH 7.5), resuspendedin 50 μl of the samebuffer and stored at -20 ̊Ctill further use. Protein concentration of pellet fraction was estimated using BCAprotein assay kit with BSA as thestandard
-
Crude vacuolar membrane extraction
-
Vacuolar H+-ATPase activity measurement
-
A calibration curve of fluorescence intensity values versuspH was prepared for BCECF-AM-loaded wt cells by incubatingcellsin YPD medium containing 50 mM MES, 50 mM HEPES, 50 mM KCl, 50 mM NaCl, 0.2 M ammonium acetate, 10 mM NaN3, 10 mM 2-deoxyglucoseand5 μM carbonyl cyanide m-chlorophenylhydrazone, titrated to five different pH values in the range of 4.0-8.0. Fluorescence intensity values were measured by excitation at 440and 490 nm with emission at 535 nm and a graph was plotted between the ratio of intensity at 490 to 440 nm versuspH. Similar to pHi calibration curve, a polynomial distribution of fluorescent intensity signal and pH was observedfor BCECF-AMprobe
-
In vivovacuolar pH calibration curve
-
fluorescence by excitation at 440 (pH-independent) and 490 nm (pH-dependent) with emission at 535 nm. Ratio offluorescence intensity at 490 to440 nm was used tocalculatethe vacuolar pH. Background fluorescence was removed by subtracting the fluorescence intensity values of cells without BCECF-AM from the fluorescence intensity values of the probe-loaded cells
-
Vacuole pH inyeast cells was determined asdescribed previously (Padilla-López and Pearce, 2006). Briefly, log-phase,YPD medium-grown yeast cells were harvested and suspended in 200 μl YPD medium containing 50 μM 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein, acetoxymethyl ester (BCECF-AM; Invitrogen # B1150) to the final cell density of 4 x 107 cells. Cells were incubated at 30 ̊C for 30 min at room temperaturefollowed by three washeswith YPD medium. Washed cells were resuspended in 1 ml YPD medium and 200 μl cell suspension was used for recording
-
Measurement of vacuole pH
-
Vacuolar morphology of C. glabratacells was examinedby staining vacuoleswith FM4-64 (Molecular Probes, Invitrogen). FM4-64 is a lipophilic dye that exhibits long wavelength red fluorescence when boundto lipids. FM4-64 binds to the plasma membrane and follows the endocytic pathway to reach the vacuole(Vida and Emr, 1995).Log-phase,YPDmedium-grown cells were harvested and washed with 1X PBS. 1 ODcells were resuspendedin 50 μl YPDmedium containing 30 μM FM4-64 andincubated at 30 ̊C for 30-45 min. After incubation, cells were washed thricewith YPD mediumand resuspendedin 100 μl of the samemedium. Cells were observed under confocal laser scanning microscope(Zeiss LSM 510 Meta)with 63X objective lens,2.5X final zoom, pinhole set at 108 μm and emission filterset to LP 565nmto capture fluorescence image.Along with the fluorescenceimage, aphase contrastimage was alsocaptured for each sample
-
Staining of yeast vacuoleswith FM4-64
-
cellswere collected and washed with chilled sterile water.1 OD600cells were resuspendedin 20 μl chilled10%TCA solution containing 8 mM EDTA (pH 8.0) and incubated at room temperature for 15-20 min.Followingincubation, cellsuspension was centrifuged at 12,000 rpm for 5 minat 4 ̊Cand supernatant was transferred to a fresh 1.5 ml microcentrifuge tube. 10 μl of this supernatant fraction was diluted 75-foldwith ATPassay mix dilution buffer provided with the kit. 50 μl of diluted suspension was added to anequal volume of ATPassay mix (Sigma # FLAAM) which containedfirefly luciferase and luciferin with MgSO4, EDTA, DTT and BSA inTricine buffer.Luminescence was measured inluminometer (Varioskan flash-3001,Thermo Scientific). Total ATP was quantified usingpurified ATP as the standardand expressed in moles/OD cells
-
ATPconcentrationin yeast cells was measuredby luminometricluciferase-luciferinbased assayusingATPbioluminescent kit(Sigma # FLAA).Briefly, log-phase yeast
-
Determination of intracellular ATPlevels
-
Estimation of total glycogen in cells was performed asdescribed previously (Parrou et al., 1997) with slightmodifications.Briefly, YPD medium-grown C. glabratacells were harvested, washed once with 1 ml ice-cold waterandresuspendedin 250 μl sodium carbonate(0.25 M)solution. After incubation at95 ̊C for 4 hin water bath with occasional stirring, cell suspension was cooled and pH of the suspension was adjusted to 5.2 by adding 150 μl 1 M acetic acid. Tothis suspension,600 μl 0.2M sodium acetatewas added and cell suspension was incubated with 1-2 U/ml of α-amyloglucosidase from A.niger(Sigma #A7420)at 57 ̊C for overnight with constant agitation.Resultant glucose liberated by α-amyloglucosidase digestion was collected in the supernatant fraction and quantifiedby phenol-sulphuric acid methodof carbohydratedetermination.For quantification, commercially available purified glucose was used as a standard and total glycogen incells was expressed as μg/2 x 107cells tonormalizeagainstcell density
-
Estimation of glycogenlevels
-
Trehalose from C. glabratacells was extracted by trichloro acetic acid (TCA)solutionas described previously (Lillie et al.,1980). Cells grown in YPDmediumwere collected at different time pointsof growth and washed thrice with ice-cold sterile water. Cells were immediatelystored at-20 ̊Ctill further use.For trehalose isolation, 10-20 OD600cells were thawed in 500 μl TCA (0.5 M) solutionon ice and incubated at room temperaturefor 1 h.Supernatant fraction was collected by sedimenting cells at 14,000 rpm for 5 minat 4 ̊C.TCA extractionwas repeated withcells once more and the resultingsupernatant was mixed with the earlier fraction.Extractedtrehalose was measuredby phenol-sulphuric acid methodof carbohydratedeterminationwithcommercially available purified trehalose(Becton, Dickinson and Co.) as a standard.Total trehalosecontent was normalized to the cell densityand expressed as μg/2 x 107cells
-
Estimation of trehalosecontent
-
Estimation oftrehalose, glycogen and ATPlevels
-
Quantitative measurement of periplasmic acid phosphatase activity in phosphate-starved C. glabratacells was performedas mentioned previously (Orkwis et al., 2010). A total of 0.5 OD600YNB-grown and phosphate-starved cells were collected, washed thrice with cold water and oncewith cold 0.1 M sodium acetatebuffer (pH 4.2). Washed cells were resuspendedin 500 μl sodium acetate (0.1 M)and incubated at 30 ̊C with constant stirring. After 10 min incubation, 500 μl freshly-prepared solution of 20 mM p-nitrophenyl phosphate in 0.1 M sodium acetate(pH 4.2) was added to the cell suspension. Enzymatic activity was stopped after incubation at 25 ̊C for 20 min by addition of 250 μl sodium carbonate (1 M)tothe reaction mix. Resultant colour change was measured by monitoring absorbance at 400 nm. Acid phosphatase activity was expressed as a ratio of OD400to OD600 to normalize against cell density
-
Determination of acid phosphatase activity
-
Cells grown overnight in YNBmedium wereinoculated in fresh YNB mediumand incubated at 30 ̊C with shaking at 200 rpm. Cells were harvested when the cell density reached to an OD600of 0.6-0.8.Cells were consecutively washed with sterile MQ water and YNB without phosphate (YNB-Pi) medium. Washed cells were inoculated either in YNB orYNB-Pimediumto the initial OD600of 0.1. Cells were incubated at 30 ̊C for 3-4 h, harvested and resuspendedin 100 μlYNB-Pimedium. Radioactive P32-labelled o-phosphoric acid(Jonaki# LCP 32)was added to the cell suspension to a final concentration of 1 μCi/mlandcells were incubated for 30 min.For determining phosphate uptake, a10-12 μl cell suspensionaliquot,after every5 min,was removed and kept on ice.To this cell suspension, 500 μl ice-cold YNB-Pimediumwas addedand cells were harvested by centrifugation at 5,000 g for 5 minat 4 ̊C.These cells were washed with ice-cold YNB-Pimedium thrice and resuspendedin 100 μlPBS(1X). 10-20 μl of this cell suspension was added to5 ml scintillation fluid and β-decay counts were measured in ascintillation counter(Tri-Carb 2910 TR Liquid Scintillation Analyzer, PerkinElmer).Scintillation counts were normalized to total cell number and plotted with respect to time. Total phosphateuptake was expressed as P32c.p.m/OD600cellswhere c.p.m refers tocounts per min
-
Phosphate uptake assay
-
Total cellular polyphosphates were quantified viapolyacrylamide-Tris borate gel electrophoresis (PAGE-TBE).Briefly, PAGEwas performed with Tris-borate buffer (pH 8.3) todeterminethe quantityand the typeof polyphosphatesextracted fromyeaststrains. Equal amount of total RNA (20 to 100 μg) was loadedon 34%PAGE-TBE gel (22cm long, 16 cm wide and 0.8 mm thick) and electrophoresedat 500Voltsfor 20-24 hin cold-roomtill the marker dye bromophenol blue(BPB)had migrated 15-16 cm awayfrom the well.After electrophoresis, total polyphosphates werevisualizedby staining the gel with 0.05%toluidine blue staining solutionfollowed by destaining. Polyphosphates wereobserved both as asmearin the top most portion of the gel as well asdiscreet bands of long chain polyphosphatesand shortchain polyphosphatesin middle andbottom half of the gel,respectively.Polyphosphateband intensity in the gelwas quantified using ImageJ software (http://rsbweb.nih.gov/ij/)and relative amountsof long chain and short chain polyphosphatesin C. glabratacells werecalculated
-
Quantitative analysisof polyphosphates
-
Polyphosphates from yeast cells were extracted with phenol-chloroform solutionas described previously(Neefand Kladde,2003). Cells grown eitherovernight or to logarithmic phase in YPDmediumwere harvested by centrifugation at 1,700 rpm for 5 min. Cells were washed with 10 ml sterile MQ water and resuspendedin ice-cold 500 μl20%trichloro acetic acid (TCA) solution to the final cell densityof 100 OD. Cell suspension was transferred toa1.5 ml microcentrifuge tube. After incubation at room temperature for 5 min, cells were harvested by centrifugation at 12,000 g for 10 minat 4 ̊C and resuspendedin 250-350 μlpolyphosphate extraction buffer.Equal volume of phenol-chloroform (25:24) was addedtothe microcentrifuge tube and aqueous phase was extracted by centrifugation at 12,000 g for 8 minat room temperature. Top aqueous layer was collected with a 200 μl tip. Aqueous layer extraction was repeated once more after removal of DNA with chloroform.After centrifugation,aqueous phasecontaining RNA and polyphosphates wascollected,RNA was quantified at A260nmandstored at -20 ̊C
-
Polyphosphate extraction
-
were maintained in log-phase by continuous passaging in fresh YNB medium every 4 h
-
For phosphate starvation,yeastcells grown to log-phase in YNB medium were harvested,washed with water,transferred to either regular YNBor YNB medium lackingphosphate and were grown for 16 h at 30 ̊C. Cells cultured in YNB medium
-
Phosphate starvationof yeast cells
-
Plasma membrane H+-ATPase activitywas measured inthe total membrane fraction as described previously (Nakamura et al., 2001).5μg totalmembrane fraction was incubated at 30 ̊C in 120 μl reaction buffer containing 10 mM MgSO4and 50 mM KCl in 50 mM MES (pH 5.7) with 5mM adenosine tri-phosphate (ATP). To eliminate possible contribution of residual ATPases, viz.,vacuolar ATPases, mitochondrial ATPases or non-specific phosphatases, 50mM KNO3, 5mM NaN3and 0.2mM ammonium molybdate were used, respectively, in the assay mixture. Reaction was stoppedafter 30 minby adding 130μl stop-developing solution containing 1% (w/v) SDS, 0.6M H2SO4, 1.2%(w/v)ammonium molybdate and 1.6%(w/v) ascorbic acid. Amount of inorganic phosphate (Pi) liberated was measured at A750nmafter 10 minincubation at room temperature. A standard curve prepared with0-50 μmolesof KH2PO4 was used fordetermination of total Piamount.ATPase activity of the plasma membrane was expressed in micromoles of Pireleased per milligram protein per min. ATPase activity was also determined in the presence of plasma membrane H+-ATPase inhibitor diethylstilbestrol (DES,Sigma# D4628),wherein total membrane fraction was incubated with 0.2mM DES for 5 min, prior to the enzymatic measurement
-
Plasma membrane H+-ATPase activity assay
-
dithiothreitol and1X protease inhibitor cocktail. Cell suspension was rapidly frozen at -80 ̊C,thawed and lysed with 0.5mm acid-washed glass beadsin a homogenizer (FastPrep®-24,MP Biomedicals)at maximum speed of 60 secfive times. Homogenate wasdiluted with 5mlTris-HCl (0.1M; pH 8.0)solutioncontaining 0.33M sucrose, 5mM EDTAand 2mM dithiothreitoland centrifuged at 1,000g for 3 minat 4 ̊C. Supernatant was collected and centrifuged again at 3,000g for 5 minat 4 ̊C to remove unbrokencells. The resulting supernatant was centrifuged at 19,000g for 45 minat 4 ̊C to obtain total membrane fraction. Total membrane pellet was resuspendedin 100μl membrane suspension buffer and stored at -80 ̊Ctill further use. Total protein concentration in the membrane fraction was estimated using BCAprotein assay kit (Thermo Scientific, US) with bovine serum albumin (BSA) used as astandard
-
Isolation of total membrane fractions from C. glabratastrains were carried out as described previously (Fernandes et al., 1998). Cells grown to log-phase under different environmental conditionswere harvested, washed and suspended to afinal density of 20 OD600cells in 1 ml solution containing100mM Tris (pH 10.7),5mM EDTA,2mM
-
Total membrane preparation
-
To assess the activity of plasma membrane proton pump, CgPma1, in cells grown in differentexternal pH environment,whole cell acidification assaywas carried out.This assay is a measurement of glucose-responsive proton pump activityin live cellsand is based on a decrease inthe pH of a weakly-buffered solutionupon extrusion of H+ions from thecell. The amount of change in the pH of the medium represents a crude measurement of the activity of functional plasma membrane proton pump in live cells. Whole cell acidification assay was conductedwithcellsgrown in YNB pH 5.5 and YNB pH 2.0medium as described previously (Martinez-Munoz and Kane, 2008) with slight modifications.After growth at30 ̊C for 2 h, cells were harvested, washed and resuspended(1.5-3.0 mg wet weight/ml) in 15ml MES/TEA (1mM; pH 5.0) buffer. Cell suspension was kept at 25 ̊C with continuousagitation. Extracellular pH of the buffer solution was recorded at 1 mininterval for 20 minwith the help of a pH meter(BT-600, BoecoGermany). To activate plasma membrane proton pumping, glucose and KCl were added to a final concentration of 40mM after 3 and 8 minincubation, respectively. Plasma membrane proton pump activitywas plotted as a change in the pH of the extracellular solutionversustime
-
Whole cell acidification assay
-
Measurement of plasma membrane H+-ATPase activity
-
Log-phasecells grown in YPD medium containing or lacking CaCl2and FK506 were collected, PBS-washed and loaded with ratiometric, high affinity, membrane-permeable calcium indicator, Fura-2 AM (10 M; Sigma #47989). After 30 min incubation at 30◦C, labelled cells were washed thrice with cold PBS, suspended in PBS and fluorescence was recorded at 505 nm with dual excitation at 340 and 380 nm. The ratio of fluorescence intensities between 340 and 380 nm, representing Ca-bound and Ca-free Fura-2 molecules, respectively, reflected free intracellular calcium concentrations
-
Measurement of intracellular calciumlevels
-
Intracellular reactive oxygen species (ROS)levels in yeast cells weredetermined usingfluorescent probe 2',7'-dichlorofluorescein diacetate (DCFH-DA; Sigma# D6883). Cellular esterasesremove the diacetate groups ofthe DCFH-DAand produceDCFHwhich getsreadily oxidized to highly fluorescent product 2′,7′-dichlorofluorescein (DCF) by intracellular ROS. The fluorescent intensity of DCF corresponds to the amount ofintracellular ROSpresent in the cell.Cells grown under different environmental conditions were harvested,washed once with tissue-culture grade phosphate-buffered saline (PBS) and resuspendedin PBS to the final cell density of 1 OD. Freshly-prepared DCFH-DA (0.01M stock in DMSO) was added to the cell suspension toafinal concentration of 100 μM. Cell suspension was mixed and incubated at 30 ̊C for 30 min. After incubation,cells were washed 2-3 times with 1 ml PBS and then resuspendedin 200 μlPBS. Fluorescence intensity values wererecorded usingspectrofluorophotometer (Varioskan flash-3001, Thermo Scientific) with excitation and emission at 488and 530 nm,respectively.Fluorescenceintensityvalues obtained from probe-loaded cells were subtracted from the fluorescence intensity values obtainedfrom cells-alone samplesto remove background fluorescence
-
Determination of intracellular reactive oxygen species (ROS)levels
-
For determiningthe intracellular pH from fluorescence intensity values of CFDA-SE-loaded cells, anin vivocalibration curve was prepared between fluorescent intensity and pre-adjusted environmental pH values. Briefly,CFDA-SE-loaded wild-typeC. glabratacellswere incubatedwith 0.5 mM carbonyl cyanide m-chlorophenylhydrazone (CCCP; Sigma# C2759) at 30 ̊C for 10 min in 50 mM CP buffer adjusted to different pH values ranging from 4.0 to 7.5, with an interval of 0.5 unit.CCCP is an ionophore which dissipates the plasma membrane pH gradient, thus, rendering the intracellular pH similar to the extracellular pH. Fluorescent intensities were determinedand a calibration curvewas plotted between the ratio of intensity at 490 to430 nm versuspH.A polynomial distribution of fluorescent intensity signal and pH was observed for CFDA-SE probe(Figure2.1)and the graphequation was used todeterminethe intracellular pHof C. glabratacells
-
In vivointracellular pH calibration curve
-
OD600of 0.5and transferred to a 1.5 ml microcentrifuge tube. Probe loading was carried out by adding freshly-prepared CFDA-SE solution (0.01 M stock in DMSO) tocell suspension to a final concentration of 160 μM. Cell suspension was mixed on vortex mixerfor 10 secand incubated at 37 ̊C for 1 hwith shaking at 300 rpmon thermo mixer.Cells were harvested, washed twice with 1 ml 50 mM CP buffer to remove unloaded probe,resuspendedin 250 μl CP buffer andwereincubated at 30 ̊C for 30 minwith shaking to recover from the stress induced during probe loading. Afterincubation,fluorescent intensitywasdetermined with spectrofluorophotometer (Varioskan flash-3001, Thermo Scientific) by excitation at 430 nm (pH-independent) and 490 nm (pH-dependent) with emission at 525 nm. Background fluorescence of the probe was removed by subtracting the fluorescence intensity of the probe in CP buffer from the fluorescence intensity of the probe-loaded cells
Tags
- Md-3-Md-21-Md-3
- Md-3-Md-21-Md-3-d
- Md-3-Md-18-Md-3-d
- Md-3-Md-19-d
- Md-3-Md-14-Md-3
- Md-3-Md-22-d
- Md-3-Md-12
- Md-3-Md-14
- Md-3-Md-17
- Md-3-Md-6
- Md-3-Md-21-Md-4-d
- Md-3-Md-17-d
- Md-3-Md-18-Md-1
- Md-3-Md-14-Md-3-d
- Md-3-Md-8-Md-3
- Md-3-Md-22
- Md-3-Md-14-Md-1
- Md-3-Md-21-Md-1-d
- Md-3-Md-10
- Md-3-Md-21-Md-1
- Md-3-Md-21
- Md-3-Md-18-Md-2
- Md-3-Md-15
- Md-3-Md-11-d
- Md-3-Md-9-d
- Md-3-Md-8-Md-2
- Md-3-Md-8-Md-1
- Md-3-Md-7-d
- Md-3-Md-20-d
- Md-3-Md-13-d
- Md-3-Md-18-Md-3
- Md-3-Md-8-Md-3-d
- Md-3-Md-8-Md-1-d
- Md-3-Md-5
- Md-3-Md-22-Md-2
- Md-3-Md-21-Md-4
- Md-3-Md-22-Md-1-d
- Md-3-Md-16-d
- Md-3-Md-18-Md-2-d
- Md-3-Md-18
- Md-3-Md-8-Md-2-d
- Md-3-Md-11
- Md-3-Md-22-Md-1
- Md-3-Md-6-d
- Md-3-Md-10-d
- Md-3-Md-5-d
- Md-3-Md-22-Md-2-d
- Md-3-Md-12-d
- Md-3-Md-14-Md-2
- Md-3-Md-18-Md-1-d
- Md-3-Md-21-Md-2-d
- Md-3-Md-20
- Md-3-Md-14-Md-2-d
- Md-3-Md-9
- Md-3-Md-15-d
- Md-3-Md-8
- Md-3-Md-7
- Md-3-Md-16
- Md-3-Md-19
- Md-3-Md-21-Md-2
- Md-3-Md-14-Md-1-d
- Md-3-Md-4-d
Annotators
URL
-