On 2013 Nov 15, Nikolaos Kokras commented:
Relates to Kokras N, 2012
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
On 2013 Nov 15, Nikolaos Kokras commented:
Relates to Kokras N, 2012
On 2015 Sep 17, Tom Kindlon commented:
Although they don't make it very clear, this study used the Reeves et al. (2005) criteria(1) for defining Chronic Fatigue Syndrome (CFS) (sometimes described by the CDC as an operationalization of the Fukuda et al. (1994) criteria (2)). This can be seen by examining the Reeves et al. (2005) paper which shows that 43 people from the two-day study satisfied the Reeves et al. (2005) operationalization of the criteria which the number satisfying how they operationalized the Fukuda et al. criteria was considering less(1,2).
These (Reeves) criteria greatly increased the prevalence of CFS. The "empirical" definition gives a prevalence rate of 2.54% of the adult population(3) compared to 0.235% (95% confidence interval, 0.142%-0.327%) and 0.422% (95% confidence interval, 0.29%-0.56%) when the Fukuda definition was used in previous population studies in the US(4,5).
The definition lacks specificity. For example, one research study(6) found that 38% of those with a diagnosis of a Major Depressive Disorder were misclassified as having CFS using the empirical/Reeves definition. A letter of mine discussed my concerns in more detail(7).
Due to the problems with the criteria, these criteria have not been used by researchers outside those contracted to analyse CDC data (apart from Leonard Jason's research team who studied it and showed problems with it (6)).
References:
1 Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic fatigue syndrome – a clinically empirical approach to its definition and study. BMC Med. 2005;3:19.
2 Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.
3 Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.
4 Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N, Minden S, Reeves WC: Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Int Med 2003, 163:1530-1536.
5 Jason LA, Richman JA, Rademaker AW, Jordan KM, Plioplys AV, Taylor RR, McCready W, Huang CF, Plioplys S. A community-based study of chronic fatigue syndrome. Arch Intern Med. 1999 Oct 11;159(18):2129-37.
6 Jason, LA, Najar N, Porter N, Reh C. Evaluating the Centers for Disease Control's empirical chronic fatigue syndrome case definition. Journal of Disability Policy Studies 2008, doi:10.1177/1044207308325995.
7 Kindlon T. Criteria used to define chronic fatigue syndrome questioned. Psychosom Med. 2010 Jun;72(5):506-7
On 2016 May 03, Gregory Stupp commented:
It seems the authors have referred to the wrong GEO data set (GDS2642: colonoscopic biopsies from CD or UC patients), when the data in fact looks to have come from GDS1615: peripheral blood mononuclear cells from CD or UC patients).
As an example. The gene with the highest fold change in Table S1 is SERPINB2. This fold change can be seen in the GEO profile graph for GDS1615: http://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS1615:204614_at but not from GDS2642: http://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS2642:37185_at
I verified the rest of the genes using the data from the SOFT files and also using geo2r: https://www.ncbi.nlm.nih.gov/geo/geo2r/?acc=GSE3365 https://www.ncbi.nlm.nih.gov/geo/geo2r/?acc=GSE6731
On 2013 Jun 17, Jessie Tenenbaum commented:
With the disclaimer that this came out of my PhD lab (4 years after I left), I really like this paper. I remember seeing a naysayer comment (on GenomeWeb maybe?) questioning whether this belonged in STM, but this is exactly what big data mining approaches is meant to do- yes, it's about hypothesis generation, but if those hypotheses can then be validated in a model system, trimming years off the drug discovery process, that is truly impactful.
On 2017 Jan 20, Andy Collings commented:
A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.06847) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.17044).
On 2014 Jul 17, Adam Jacobs commented:
There are a number of problems with this study, and I fail to see how the authors conclusions of "no major problems of feasibility or acceptability of randomisation were found" can be supported.
First, there is the question of feasibility. This study attempted to use 6 breast screening units. These units apparently volunteered for the study, so might be considered to be less likely to have feasibility problems than sites in general. Despite that, 1 of the 6 sites was unable to participate.
There were clearly also resource implications in managing the study, but only an informal description was given of increases in workload. With no attempt made by the authors to quantify the increased workload, it is hard to judge how it might impact on feasibility.
As for acceptability, it is not surprising that the authors found no problems, as they did not look for them. I could not find any mention of the study participants having been asked questions about acceptability.
While women who were invited to screening could have spontaneously reported concerns about acceptability if they felt sufficiently strongly (though it is hardly realistic to expect that more than a tiny minority would do so if not specifically asked), women who were not invited, who would still be included in the study in the control group in the main age extension trial, were given no such opportunity.
This study has therefore told us nothing about how acceptable the study participants found it to be included in a randomised trial without their consent.
On 2014 Mar 02, Joshua Gray commented:
The article doesn't mention whether the patient's blister was deroofed or whether dermabrasion/debridement was performed. (The article does mention that blisters larger than 2 cm in diameter should be debrided on page 72.) Can you please provide a little more detail about how the blister was treated?
Joshua Gray, Associate Professor of Chemistry, U.S. Coast Guard Academy
On 2016 Feb 16, Gary Goldman commented:
None
On 2016 Feb 16, Gary Goldman commented:
In this second study published 8 months following the first, Moro et al. noted 121 spontaneous abortion (SAB) and 19 stillbirth (SB) reports or a total of 140 fetal-loss reports to VAERS during the first 5 months of the 2009/2010 influenza season. This equates to greater than 57 reports per million (>140/2,437,113) vaccinated pregnant women. The ratio of the 140 fetal-loss reports during the incomplete 2009/2010 season to the 1.21 reports/year representing the mean of the 19 prior seasons, yields a 116-fold (140/1.21) increase in fetal-loss reports (SAB and SB) in the VAERS database. Moro et al. attributed this dramatic increase, in part, to reporting bias, citing a "Weber-like effect." The Weber effect is a temporal reporting pattern whereby the number of reported adverse events (AEs) for a new drug increases during the first 2 years of marketing and then subsequently declines, presumably reflecting decreased enthusiasm for reporting as AEs become well known.
Despite the statistically significant rate ratio (RR) of 29.4 (95% confidence interval (CI): 19.0–45.8) for 2009/2010 fetal-loss report rate (57 reports/1 million) to the mean rate of 1.9 reports/1 million (over the previous 19 influenza seasons), the second Moro et al. study concluded, "… H1N1 vaccination in pregnant women did not identify any concerning patterns of maternal or fetal outcomes."
That this large spike in fetal death case reports to VAERS during the 2009/2010 influenza season was unlikely a mere "Weber Effect" and indeed a concerning pattern among pregnant women is addressed in the Goldman GS study titled, Comparison of VAERS fetal-loss reports during three consecutive influenza seasons: Was there a synergistic fetal toxicity associated with the two-vaccine 2009/2010 season? Hum Exp Toxicol. 2013 May;32(5):464-75. doi: 10.1177/0960327112455067. Epub 2012 Sep 27. Goldman GS, 2013
A study using a different methodology by Brown and Austin was published in Toxicological & Environmental Chemistry 2012 Sept;94(8):1610-27. Maternal transfer of mercury to the developing embryo/fetus: is there a safe level? DOI:10.1080/02772248.2012.724574 http://www.tandfonline.com/doi/abs/10.1080/02772248.2012.724574 It concluded: "It is, therefore, critical that regulatory advisories around maximum safe Hg exposures account for pregnant women and secondary exposure that children in utero experience. This study focused on standardized embryonic and fetal Hg exposures via primary exposure to the pregnant mother of two common Hg sources (dietary fish and parenteral vaccines). Data demonstrated that Hg exposures, particularly during the first trimester of pregnancy, at well-established dose/weight ratios produced severe damage to humans including death. In light of research suggestive of a mercuric risk factor for childhood conditions such as tic disorders, cerebral palsy, and autism, it is essential that Hg advisories account for secondary prenatal human exposures."
On 2014 Mar 09, Gyanshankar Mishra commented:
We have also done a study on Tuberculosis management In India: Mishra G, Mulani J. Tuberculosis Prescription Practices In Private And Public Sector In India. NJIRM. 2013; 4(2): 71-78. Available online at http://www.scopemed.org/?mno=36915
Our other study highlights the fact of how drug resistant TB is created under programmatic management of TB in India: Gyanshankar Mishra, S V Ghorpade, Jasmin Mulani (2014) XDR-TB: An outcome of programmatic management of TB in India. Indian Journal of Medical Ethics 11: 1. 47-52 Jan-Mar.Available online at http://216.12.194.36/~ijmein/index.php/ijme/article/download/932/2179
Full text article Available online at http://www.ijme.in/index.php/ijme/article/view/932
On 2016 Nov 15, John Roger Andersen commented:
Read publishers pdf version in ReaderCube for free: click here.
On 2014 Jan 29, Amanda Capes-Davis commented:
I found this a very helpful review of breast cancer cell lines and their appropriate use in research.
On 2013 Nov 15, Nikolaos Kokras commented:
Relates to Kokras N, 2011
On 2017 May 02, Peter Lorenz commented:
Though the figures and the tables in the supplement contain the (probably correct) label TIF1B for an interaction partner of the HP1 proteins, the text says "TIF1alpha"! TIF1B_HUMAN in Uniprot is TIF1beta/TRIM28. This discrepancy is confusing things since TIF1alpha/TRIM24 can also interact with HP1 proteins.
On 2017 Jan 20, Andy Collings commented:
A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.07072) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.21253).
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2017 Aug 06, Fernando Castro-Chavez commented:
Dear Reader, in this work I was able to discover that the methodological linkers are able to self-anneal, escaping in such a way the enzymatic digestion while contaminating thousands of sequences in the Genbank with their undigested fragments while binding together two independent and separate segments of genetic sequence; the most common linkers or adaptors and their annealing, are presented as well as advice on how to recognize and eliminate such false sequences produced by the methodological technologies in use to multiply in vectors the genetic sequences. Sincerely, Fernando Castro-Chavez.
On 2016 Jan 11, Brian Wasko commented:
Cholesterol levels are a major risk factor for cardiovascular disease, which is the number one cause of death in the USA. The most commonly prescribed cholesterol lowering drugs are known as statins (e.g., Lipitor), which work by inhibiting cholesterol biosynthesis. Despite their success, statins have many side-effects that are likely due to the fact that statins inhibit not only cholesterol biosynthesis, but also synthesis of other important non-sterol compounds (e.g., Coenzyme Q10, Heme A, and prenylated proteins). By adding an inhibitor of squalene synthase in combination with either a statin or a nitrogenous bisphosphonate, I found that this appears to inhibit cholesterol synthesis more specifically than statins, and prevents the depletion of non-sterol compounds (the undesired effect of statins). This work was a proof of principle, and provides rationale to further develop these inhibitor combinations in order to create drugs superior to statins.
On 2013 Oct 28, Konrad U Förstner commented:
Unfortunately the content of the zip file which can be downloaded from the given URL (http://www.mediafire.com/FengLi/2DGelsoftware) is password protected.
On 2013 Dec 09, John Cannell commented:
The authors report that immune system dysregulation is common in autism spectrum disorder (ASD). The question is why does this immune dysregulation occur and what has caused such dysregulation to skyrocket in recent decades?
Vitamin D deficiency produces very similar immune dysregulation to what the authors reported.
Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.
There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely affect brain development.
Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.
70% of American toddlers do not take the American Pediatric Association's recommended vitamin D supplement of 400 IU/day and few toddlers or pregnant women get any sunshine due to the sun scare. As vitamin D fortified milk consumption and sun exposure has declined, so have toddlers and pregnant women’s vitamin D levels. The dramatic increase in the incidence of ASD occurred during the same time vitamin D levels were falling in toddlers and pregnant women.
Some autism researchers seem cognizant of the entire body of autism research. For example, a group of well-known European ASD researchers, including Professor Christopher Gillberg of the Gillberg Neuropsychiatric Institute, have recently called for the need for “urgent research” into the vitamin D deficiency theory of ASD.
As the authors point out, immune dysregulation is common in ASD. The question is why now and what is causing it?
John J Cannell, MD
Vitamin D Council
http://www.vitamindcouncil.org
On 2014 Nov 14, Christopher Southan commented:
A 2014 abstract from Novartis http://www.alzheimersanddementia.com/article/S1552-5260(14)01380-6/fulltext quotes "Bace1/2 inhibition does not regulate TMEM27 cleavage and has no impact on pancreatic β-cell function and mass in diabetic mice". Lets hope new PubMed results can resolve this controversy.
On 2015 Aug 12, Jim Woodgett commented:
A direct quote from reference 9 (referring to the source of the GIN inhibitor used here):
"A similar assay measuring inhibition of GSK3-alpha was also routinely run, but 7-12 showed no significant ability to discriminate between the two isoforms of GSK3 (data not shown). To the best of our knowledge, no isoform specific inhibitors of GSK3 have been reported, probably due to their high sequence homology (vida supra)."
This inhibitor (GIN) acts equally on both isoforms of GSK-3 (alpha and beta) and should not be referred to as a GSK-3beta selective inhibitor. This makes sense given that inhibition of GSK-3beta alone is insufficient for deregulation of beta-catenin (PMID: 17543867).
On 2015 Aug 12, Tom Kindlon commented:
This study used the Reeves et al. (2005) criteria(1) for defining Chronic Fatigue Syndrome (CFS) (sometimes described by the CDC as an operationalization of the Fukuda et al. (1994) criteria (2)).
These (Reeves) criteria greatly increased the prevalence of CFS. The "empirical" definition gives a prevalence rate of 2.54% of the adult population(3) compared to 0.235% (95% confidence interval, 0.142%-0.327%) and 0.422% (95% confidence interval, 0.29%-0.56%) when the Fukuda definition was used in previous population studies in the US(4,5).
The definition lacks specificity. For example, one research study(6) found that 38% of those with a diagnosis of a Major Depressive Disorder were misclassified as having CFS using the empirical/Reeves definition. A letter of mine discussed my concerns in more detail(7).
Due to the problems with the criteria, these criteria have not been used by researchers outside those contracted to analyse CDC data (apart from Leonard Jason's research team who studied it and showed problems with it (6)).
References:
1 Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic fatigue syndrome – a clinically empirical approach to its definition and study. BMC Med. 2005;3:19.
2 Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.
3 Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.
4 Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N, Minden S, Reeves WC: Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Int Med 2003, 163:1530-1536.
5 Jason LA, Richman JA, Rademaker AW, Jordan KM, Plioplys AV, Taylor RR, McCready W, Huang CF, Plioplys S. A community-based study of chronic fatigue syndrome. Arch Intern Med. 1999 Oct 11;159(18):2129-37.
6 Jason, LA, Najar N, Porter N, Reh C. Evaluating the Centers for Disease Control's empirical chronic fatigue syndrome case definition. Journal of Disability Policy Studies 2008, doi:10.1177/1044207308325995.
7 Kindlon T. Criteria used to define chronic fatigue syndrome questioned. Psychosom Med. 2010 Jun;72(5):506-7
On 2017 Apr 02, Christine Carson commented:
There was a follow-up to this article. The full text of the response (in Swedish) is available free from Lakartidningen website http://www.lakartidningen.se/07engine.php?articleId=18503
The full text of the response (in English) is available free from ResearchGate website at https://www.researchgate.net/publication/315738411_Carson_et_al_2012_Lakartidningen_English_20130626
On 2014 Jan 08, Tom Kindlon commented:
The authors appear to do a reasonable job, given the limits of the data available to them, in calculating the productivity costs before Chronic Fatigue Syndrome (CFS) patients reach the services in the UK. However, the reader is left with the impression that the productivity costs will drop dramatically once the patient reaches the services: "We had no data with which to assess the rate at which people with CFS/ME recover and return to work, either with or without specialized treatment. According to a systematic review of the literature, the proportion of adults in employment increased following interventions for CFS/ME (individualised rehabilitation, cognitive behavioural therapy and exercise therapy) and decreased in observational studies with no intervention [1]. Evidence from a recent evidence trial of cognitive behavioural therapy and graded exercise therapy indicated a recovery rate of 30-40% one year after treatment [2]."
However it may not be the case that the therapy offered in UK clinics (or in similar clinics elsewhere) will reduce the productivity costs by much if anything.
It is interesting to consider what happened in Belgium where rehabilitation clinics for patients satisfying the same CFS criteria [3] were treated using cognitive behavioural therapy (CBT) and graded exercise therapy (GET), the same therapies recommended for use in the UK [4]. Extensive external audits were performed there on these (Belgian) clinics. The main reports are in French and Dutch [5,6]; however, for those who can't understand either of those languages, a five-page summary is available in English [7]. It says, "Employment status decreased at the end of the therapy, from an average of 18.3% of a 38h- working week, to 14.9% [...] The percentage of patients living from a sickness allowance increased slightly from 54 to 57%."
Collin and colleagues claim, "Evidence from a recent evidence trial of cognitive behavioural therapy and graded exercise therapy indicated a recovery rate of 30-40% one year after treatment [9]." However, although a recovery measure was included in the trial's protocol[8], the authors have made clear [10] that no recovery rate was reported in the Lancet paper [9]: "[i]t is important to clarify that our paper did not report on recovery; we will address this in a future publication."
Collin and colleagues also say, "[a]ccording to a systematic review of the literature, the proportion of adults in employment increased following interventions for CFS/ME (individualised rehabilitation, cognitive behavioural therapy and exercise therapy) and decreased in observational studies with no intervention [1]." This is indeed mentioned in the abstract of the review. However, when one reads the paper, the data on which this is based is very limited: 2 longitudinal studies reported employment at both times with no interventions[10,11], 2 rehabilitation programs [12,13], one trial of GET [14] and one trial of CBT[15].
The figures for the GET study are for everyone (n=66) who was in the trial so include the people who were in the other arm of the trial (flexibility exercises and relaxation therapy) who then chose to do GET. So not those who had GET alone. This trial used the Oxford criteria [16] to define CFS, criteria which only requires the symptom of fatigue rather than the other symptoms required in the Fukuda criteria [3]. A study of those with fatigue has shown that satisfying the Fukuda CFS criteria [3] was the most powerful predictor of poor response to either GET or CBT [17]. So one cannot be extrapolate from such studies that those satisfying the Fukuda criteria, who are the group that Collin studied (and the group who used the Belgian clinics), will have the same improvements in employment measures.
Similarly, the trial of CBT [15] didn't use the Fukuda criteria - patients either satisfied the Oxford criteria [16] or else criteria for F48.0 (Neurasthenia) [18] i.e. they didn't all satisfy CFS criteria at all. Employment data was only available for 51 of the 80 individuals who started CBT (64%).
Finally, in one of the rehabilitation trials quoted [12], only two individuals took part it (at baseline neither was in employment but at follow-up, one of the two was). All in all, the evidence that CBT, GET and similar interventions will increase productivity is not strong. If governments, and those involve in providing health services, want to decrease the costs associated with CFS, throwing more and more money at CBT/GET services may not be the answer; other methods of treating the condition should be investigated. As the authors have shown, costs associated with the condition per individual are substantial, so more expensive therapeutic strategies can be justified on cost grounds alone.
On 2014 Mar 26, Wei-An (Andy) Lee commented:
In the safety-net clinic in Los Angeles, I find that premix insulin can be a great way to start patients. It reduces the initial burden of insulin initiation.
On 2013 Nov 16, M Mangan commented:
An attempt to replicate the claims in this paper has been published here: Dickinson B, 2013. The researchers were unable to make the same observations.
There's also an interesting backstory to the publication of the replication paper which you can find here: Anonymous, 2013.
On 2013 Dec 24, Kenneth Witwer commented:
As of April, 2014, published studies of dietary xenomiR transfer include the following (excluding reviews, in order of publication, and with public availability of high-throughput sequencing data noted if applicable):
This study: High-throughput sequencing (HTS) mapped up to tens of thousands of reads per million of specific plant microRNAs in human circulation; similar results in bovines; functional consequences for cholesterol metabolism in mice; public data availability not reported.
Zhang Y, 2012: analysis of >80 public HTS datasets; found uptake of few microRNAs; suggested contamination or other artifact(s) as explanation of miR168a detection; publicly available datasets identified in article.
Wang K, 2012: HTS, single digit reads per million of MIR168 in human circulation; public data availability not reported.
Wang K, 2013: HTS, fractional reads per million of MIR168 in murine circulation; public data availability not reported.
Snow JW, 2013: qPCR, little or no measurable uptake of dietary plant and/or animal microRNAs by humans, mice, and adult bees.
Witwer KW, 2013: qPCR, no response to dietary intake in a small primate feeding study; reportedly non-specific low-level amplification.
Dickinson B, 2013: HTS and qPCR; as mentioned by M Mangan, mouse replication study with negative results; data submitted to NCBI SRA as SRP028401.
Tosar JP, 2014: analysis of data and datasets; interpreted correlation between plant RNAs in original study findings and in a study of Amphioxus by the same group as evidence of contamination and "non-dietary" origin.
On 2017 Aug 07, Randi Pechacek commented:
Jonathan Eisen used this paper as inspiration to write a blog post on microBEnet discussing the microbiomes of dishwashers.
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2014 Oct 23, Toby Gibson commented:
LATS protein kinases function in the Hippo signalling system. They are basophilic kinases known to phosphorylate sites that match Hx[Rk]xx[ST] motifs. The requirement for a His residue marks out LATS from other AGC group basophilic kinases. LATS substrate proteins usually have multiple matches to these motifs, as for example YAP1 (human) and SSD1 (yeast). In these proteins the LATS P-sites are in regions of natively disordered polypeptide.
The LATS substrate reported here, Snail1 does have two matches to the LATS site as shown in Fig. 3
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3252572/figure/f3/
But these lie within DNA-binding zinc finger domains. The His residues are part of the zinc coordinating residues that hold the domain in a folded conformation. So long as the zinc fingers are folded, these His sidechains are unavailable to access a kinase active site cleft. Indeed all the residues in the proposed site(s) are in alpha helices when the zinc fingers are folded. The H, R and T residues are conserved in many other zinc finger proteins. If Snail1 zinc fingers can be phosphorylated by LATS then many other zinc finger proteins should also be targets. Because of the restricted focus of the HIPPO signalling pathway and the limited number of known LATS substrates in fly, yeast and mammal systems, this might be unlikely.
In the absence of biophysical data showing that the Snail1 sites can become accessible under plausible phosphorylation conditions, they are considered to be false positive sites in our ELM resource entry for LATS kinases
http://elm.eu.org/elms/elmPages/MOD_LATS_1.html
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0016012. We believe the correct ID, which we have found by hand searching, is NCT00160121.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2017 Jun 27, Andy Collings commented:
A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.08997) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.25306).
On 2014 Feb 07, Dale D O Martin commented:
We have since shown that caspase-cleavage of HTT releases an autophagy-inducing domain that requires its post-translational myristoylation. http://www.ncbi.nlm.nih.gov/pubmed/24459296
Videos can be seen here: http://hmg.oxfordjournals.org/content/early/2014/01/22/hmg.ddu027/suppl/DC1
On 2014 Sep 30, Dale D O Martin commented:
Several of the proteins identified in this paper, including MACF and CD-IC2 have recently been confirmed endogenously in Thinon et al found here http://www.ncbi.nlm.nih.gov/pubmed/25255805
On 2014 Jan 31, Huiqi Qu commented:
Adiponectin/leptin ratio is suggested as a useful biomarker for metabolic syndrome by this study.
On 2014 Sep 02, M Mangan commented:
I used this data to build a 3D-printable version of the structure: http://3dprint.nih.gov/discover/3dpx-000579 .
On 2013 Jun 15, Steven Salzberg commented:
A very important study looking at long-term use of supplements, which revealed the surprising finding that risk of death increases with regular use of vitamin supplements. Bad news for supplement manufacturers, but important news for anyone who has been taking multivitamins thinking it can't hurt.
On 2015 Jul 10, Egon Willighagen commented:
Because Google Code is closing down [0], the source code repository is now available from GitHub: https://github.com/semanticchemistry/semanticchemistry
0.http://google-opensource.blogspot.jp/2015/03/farewell-to-google-code.html
On 2016 Dec 02, Aurélie Névéol commented:
The annotated data sets are now available at https://perso.limsi.fr/neveol/DepositionDataSets.zip
On 2014 Mar 21, Pedro Reche commented:
In this manuscript, we predicted that the MHCI-like protein MR1 will have an empty groove.However, a recent report have shown that MR1 binds vitamin B metabolites (PUBMED: 23051753). Therefore, we have updated our models including that information and repeated the manuscript predictions. With the exception of MR1, all of the predictions remain the same. Prediction of the ligand-type specificity of classical and non-classical MCH I molecules with the updates models is available for free public use at http://imed.med.ucm.es/MHCLIG/
On 2016 Apr 05, Leigh Jackson commented:
The authors state (I have omitted text references):
"Four commonly held tenets among acupuncturists regarding electrodermal activity (EDA) at acupuncture points are: (1) acupuncture points have lower electrical resistance than surrounding skin; (2) pathology-related acupuncture points are distinguishable from non-pathology-related acupuncture points; (3) changes in electrical skin resistance or conductance at acupuncture points correlate with acupuncture treatments and with the persistence of, or recovery from, disease; and (4) changes in EDA at acupuncture points occur when substances that are either therapeutically beneficial or toxic to an individual are placed in the electrical circuit with that individual.For more than 50 years these widely-held assumptions have formed the basis for the use of electrodermal devices in clinical practice, yet scientific studies to support these beliefs are sparse and methodologically diverse. The first tenet was comprehensively evaluated by Ahn et al in a recent systematic review. This review found preliminary evidence to suggest that acupuncture points and meridians may be electrically distinguishable from non-acupuncture point and non-meridian tissue. The latter three tenets, however, have yet to be rigorously examined."
If (1) could be scientifically shown to be true, then the other tenets would become a credible prospect. Is (1) scientifically credible? What might explain such a state of affairs? The safest bet as regards the data examined by Colbert et al. is the null hypothesis. Without powerful evidence to support (1) and with no scientific explanation as to why (1) should be true, the other three tenets will require extraordinarily powerful evidence to convince sceptics.
The first tenet must be scientifically established before the others have a chance to run. Otherwise it is piling weak evidence on top of weak evidence, conjecture on top of conjecture. A house of cards is being built on a pre-scientific foundation.
On 2013 Oct 31, John Cannell commented:
The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.
Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>
Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.
Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013
Also, supplemental vitamin D significantly reduces oxidative stress in humans.
Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014
Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013
Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.
Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014
Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010
Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012
There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.
Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009
DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013
Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013
Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.
Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010
Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008
70% of American toddlers do not take
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2014 Nov 08, Dirk Wetzel commented:
Basic epidemiological terms should be used correctly
I respectfully disagree with the methods and conclusions of this publication. The article suggests that an incidence of flupirtine-related hepatobiliary adverse events of “1:100,000 …or 0.8 in 10,000” has been calculated. In fact, this "incidence" is based on reported cases only. The estimated number of unreported cases might be as high as 90 to 95%, because considerable under-reporting is a well-known phenomenon of spontaneous reporting. Incidence rate is clearly defined as the number of new cases of a certain condition in relation to the population at risk within a specified period of time. As the authors used the number of reported cases as numerator (“new cases”), this method probably leads to a dramatic under-estimation of the potential risks associated with flupirtine. This could be interpreted as downplaying the risks of flupirtine.
On 2014 Nov 17, Raphael Levy commented:
The existence and cell penetrating properties of "striped" nanoparticles have been challenged by Cesbron Y, 2012.
A detailed analysis of this body of work is published today in PloS One by Stirling et al; from the abstract: “through a combination of an exhaustive re-analysis of the original data with new experimental measurements of a simple control sample comprising entirely unfunctionalised particles, we conclusively show that all of the STM evidence for striped nanoparticles published to date can instead be explained by a combination of well-known instrumental artefacts, strong observer bias, and/or improper data acquisition/analysis protocols.”
On 2013 Jul 05, Richard Simon commented:
This is an interesting and important paper but some have misinterpreted it’s findings. The authors addressed the prognostic significance of published gene expression signatures for breast cancer (mostly for non-metastatic disease). They demonstrated that prognostic signatures can be developed over 90% of the time from random sets of >100 genes and that the signatures generated from sets of random genes are often as prognostic as published gene expression signatures. The reason is that there are an enormous number of genes that are correlated with cell proliferation and cell proliferation is strongly correlated with prognosis (estrogen receptor expression is strongly associated with outcome and prognosis and there are thousands of estrogen receptor target genes). Most published gene expression signatures are no longer prognostic after adjustment for the proliferation meta-gene. The take home message is that authors of biological mechanism papers should not claim that the genes they discovered in an experimental model system have relevance for the human breast cancer by showing that a signature based on their genes are prognostic in human breast cancer. That claim is common in cancer biology. The paper should not be misinterpreted to mean that claims of the prognostic accuracy of gene expression signatures are erroneous or that such signatures are not potentially useful for medical decision making. In fact, there are well documented pitfalls in the evaluation of predictive accuracy of prognostic signatures (e.g. using the same dataset to develop the signature and to evaluate it without using complete cross-validation). Predictive signatures which identify patients most likely to benefit from a specific treatment tend to be more useful than prognostic signatures derived based on a heterogeneous collection of cases. Nevertheless, prognostic signatures can be therapeutically relevant. This paper is well done however and it’s conclusions are carefully drawn.
On 2015 Aug 08, Karl Broman commented:
The paper describing the JavaScript library D3.js, which has had an enormous impact toward popularizing web-based interactive data visualizations, because it's totally awesome.
On 2014 Jan 08, Tom Kindlon commented:
The SF-36 subscale scores in this paper are norm-based scores. This was confirmed by the authors following a question by me on the PLoS one site: http://www.plosone.org/annotation/listThread.action?root=21433.
On 2013 Jul 09, Joshua L Cherry commented:
This work develops metabolic models for six E. coli strains, performs relevant experiments with these strains, and compares model predictions to observations. The authors state that they have demonstrated that "quantitative models of different strains of E. coli can accurately predict strain-specific phenotypes." The results, however, do not support this conclusion. In fact, they point to the opposite conclusion: the models had little or no value for predicting differences between strains.
The authors predicted and experimentally determined the abilities of the strains to use various carbon sources under aerobic and anaerobic conditions. Most individual predictions agree with observations, but this fact alone means little; all strains were able to utilize the vast majority of substrates, so that simply "predicting" all positives would yield 95% agreement. For the data in Table 5, results are statistically significant under aerobic conditions for only one strain (Fisher's exact test). Under anaerobic conditions the predictions fare better: 5 of 6 cases are statistically significant. However, none of this tells us whether the predictions capture differences between strains. To address this question requires more information than counts of the sort found in Table 5.
Additional file 7 of the article provides the necessary kind of data: predicted and observed utilization capabilities for individual substrates. For reasons not clear to me, it contains predictions for only 68 substrates, rather than the 76 reported in Table 5. I have searched this data for correct predictions of differences between strains. These would be cases where one strain utilizes a substrate, another fails to do so under the same conditions, and this is correctly predicted. Across all 68 substrates and all pairings of the 6 strains, there is just one such case. This involves aerobic utilization of phenylethylamine. Even this cannot be considered a success because predictions for the other four strains are all incorrect, and all four possible combinations of predictions and observations occur. All the other differences between strains are missed, and there are several predicted differences that are shown to be false by experiment.
The authors also predict and measure growth rate and yield for growth on glucose (actually, the flux balance analysis itself predicts only yield; conversion to rate relies on measured rates of glucose uptake). When the aerobic and anaerobic data are combined, correlations between prediction and experiment are strong and significant. However, these high correlations have nothing to do with differences between strains. Rather, they reflect the difference between aerobic growth and anaerobic growth. Simply assuming that the growth rate (or yield) is higher under aerobic conditions than anaerobic conditions, and that there are no strain differences, results in similar high correlations. So does randomly permuting the predictions among strains. As the authors note, correlations disappear when strains are considered under a single condition, so there is no evidence for correct prediction of differences among strains.
Thus, it appears that the predictions contain little or no information about phenotypic differences between strains. Reconciling the models and experimental results may aid our understanding of metabolism and help improve future predictions.
On 2013 Oct 23, M Mangan commented:
Actually I found out about this new NCBI commenting system from BioStar. And I wanted to give it a try.
Here's the discussion at Biostar: http://www.biostars.org/p/84222/.
It will be interesting to see if this is much different than forum-style discussions and other sites with comments. I like the idea of a place that's not unique to one publisher. But I expect it could be difficult to build community in the same way forums and blogs do, and manage the comments.
On 2013 Nov 01, Gerard Ridgway commented:
There is new version of this work (somewhat confusingly with an unchanged abstract) "Updated April, 18, 2013", Weiner MW, 2013
On 2014 Mar 20, Anders von Heijne commented:
Reviewing the MR images in this case report there is clearly an older lesion in the right medial temporal lobe with atrophy. This is not commented on by the authors. One might speculate that the patient has had an earlier episode of HSE. Additional information would be valuable.
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0139171. We believe the correct ID, which we have found by hand searching, is NCT01393171.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2013 Oct 11, Hilda Bastian commented:
This review could not take into account lifestyle factors that often accompany healthier diets and lower risk of cancer, such as not smoking. Studies like those analyzed here probably aren't enough to establish that a nutrient can prevent disease: Moorthy D, 2013. In the case of fiber and colorectal cancer, a systematic review of randomized trials (Asano T, 2002) did not find a reduction of colorectal cancer either from fiber supplements or dietary intake as in, for example, the large National Cancer Institute trial: Schatzkin A, 2000. This trial evidence is not discussed in this review by Aune and colleagues. Anyone interested in this subject would be better off starting with the systematic review of trials and trials on fiber and resistant starch published since then: Ishikawa H, 2005, Burn J, 2011. Further discussion here.
On 2014 Mar 17, Gaetano Santulli commented:
Mega et al. report that in patients across the spectrum of acute coronary syndrome (ACS) low doses of the oral anticoagulant rivaroxaban reduced the risk of death from cardiovascular causes, myocardial infarction or stroke (1). Unfortunately, a large percentage of the enrolled patients was not at high cardiovascular risk. Thus, these results may be not applicable to subjects with an ACS who are commonly treated in routine practice (2). Moreover, patients with atrial fibrillation (AF), which represent up to 22% of subjects with ACS(3), were excluded from the study. Of interest, the Authors report that more than 1% of patients experienced AF, as ‘adverse event’, after rivaroxaban or placebo treatment. Although this is a small number of subjects, it would be of interest to see the data for this group presented separately. Indeed, this population represent the best category that may benefit from combined antiplatelet and anticoagulant therapy and these data could be noteworthy especially after the recent caveats stated by the Food and Drug Administration concerning this issue (4).
Disclosures: None.
References 1. Mega JL, Braunwald E, Wiviott SD, et al. Rivaroxaban in Patients with a Recent Acute Coronary Syndrome. N Engl J Med 2011. 2. Roe MT, Messenger JC, Weintraub WS, et al. Treatments, trends, and outcomes of acute myocardial infarction and percutaneous coronary intervention. J Am Coll Cardiol 2010;56:254-63. 3. Jabre P, Roger VL, Murad MH, et al. Mortality associated with atrial fibrillation in patients with myocardial infarction: a systematic review and meta-analysis. Circulation 2011;123:1587-93. 4. Mitka M. FDA advisory decision highlights some problems inherent in pragmatic trials. JAMA 2011;306:1851-2.
Gaetano Santulli, MD, PhD Columbia University gs2620@columbia.edu
On 2015 Sep 10, Lydia Maniatis commented:
The authors claim that their data “characterize the luminance-to-lightness mapping in high-dynamic-range images that lack cues indicating the presence of multiple regions of illumination.” The assumption is that their checkerboards do not produce differential illumination or transparency effects, but a look at their stimuli proves otherwise. That checkerboards can produce impressions of differential illumination is acknowledged by Allred, Radonjic, Gilchrist & Brainard (2012) albeit non-commitally. The stimuli may lack known cues, but self-evidently they do not lack cues.
The authors conclusions are also complicated by the fact that in higher-range stimuli, the highest luminance was reported as glowing “on most trials.” They dismiss these results as being due to the presentation of stimuli on an “emissive display” but this doesn't explain why glow wasn't reported in the lower-range stimuli for targets of the same luminance.
On 2013 Sep 26, Pedro Beltrao commented:
In this paper the authors showed to what extent it is possible to predict growth phenotypes for different "individuals" (i.e. strains) of S. cerevisiae from their genome sequences.They used single knock-out fitness information under different conditions from the S. cerevisiae lab strain to interpret the consequences of likely deleterious mutations within open reading frames for the different strains. This study attacks the problem of genotype-to-phenotype predictions from a new angle as opposed to the GWAS field and marks a potentially interesting new research direction.
On 2016 Jan 07, M Felix Freshwater commented:
A toll-free link to Goldschmidt's comment on the original research letter and my response is here.
On 2014 Apr 11, Ivan Oransky commented:
This study has been subjected to an Expression of Concern: http://retractionwatch.com/2014/04/11/harvard-brigham-heart-researcher-under-investigation-earns-lancet-expression-of-concern/
On 2015 Jun 17, Pierre Lindenbaum commented:
http://nar.oxfordjournals.org/content/42/D1/D358 : "Recently, the MINT and IntAct databases decided to merge their separate efforts to make optimal use of limited developer resources and maximize the curation output. All data manually curated by the MINT curators have been moved into the IntAct database at EMBL-EBI and are merged with the existing IntAct dataset" http://www.ebi.ac.uk/intact
On 2014 Sep 29, Preben Berthelsen commented:
Before accepting the authors’ results it must be realized that the conclusions are based on a non-randomised, unplanned post hoc subgroup analysis of a larger study on remote ischaemic preconditioning in CABG surgery (ClinicalTrials NCT01406678). The results of the primary study were published in the Lancet (August 17, 2013). In the Lancet paper there is illuminating information on the present paper. The authors state that “After use in some patients, however, we became aware of apparent interference of propofol with remote ischaemic preconditioning and discontinued its use in the remainder of the study”. In my opinion this indicates that this is a case of betting after the race.
The authors have not statistically compared the difference in troponin release between the propofol and the isoflurane group. Their conclusions are instead solely based on within group statistical analyses. And as Bland & Altman lucidly put it “this approach is biased and invalid, producing conclusions which are potentially highly misleading” (Trials 2011,12:264).
Taken in all, I feel it justified to view the results of this paper with some scepticism. P.G.Berthelsen, Charlottenlund, Denmark.
On 2014 Mar 09, Gyanshankar Mishra commented:
We have also done a study on Tuberculosis management In India: Mishra G, Mulani J. Tuberculosis Prescription Practices In Private And Public Sector In India. NJIRM. 2013; 4(2): 71-78. Available online at http://www.scopemed.org/?mno=36915
Our other study highlights the fact of how drug resistant TB is created under programmatic management of TB in India: Gyanshankar Mishra, S V Ghorpade, Jasmin Mulani (2014) XDR-TB: An outcome of programmatic management of TB in India. Indian Journal of Medical Ethics 11: 1. 47-52 Jan-Mar.Available online at http://216.12.194.36/~ijmein/index.php/ijme/article/download/932/2179
Full text article Available online at http://www.ijme.in/index.php/ijme/article/view/932
On 2015 Jul 20, Bill Cayley commented:
A good example of when "less" is "more": https://lessismoreebm.wordpress.com/2015/07/20/perinatal-and-maternal-outcomes-by-planned-place-of-birth-for-healthy-women-with-low-risk-pregnancies-the-birthplace-in-england-national-prospective-cohort-study/
On 2014 Jul 06, David Reardon commented:
The Munk-Olsen team’s study of antidepressant use and psychological treatments before, during, and after childbirth<sup>1</sup> unfortunately omits any control for the effects of prior pregnancies and any comparison to other pregnancy outcomes.
A history of pregnancy loss (including induced abortion or miscarriage) can be a stressor that may arouse unresolved feelings during and following subsequent pregnancies.<sup>2,3,4</sup> This is also evidenced by findings that women with a history of abortion are significantly more likely to self-medicate with drugs or alcohol during a subsequent pregnancy than women without a history of this pregnancy loss.<sup>5</sup>
The Munk-Olsen study would have been much more informative if it had included (a) controls for prior pregnancy outcomes, and (b) parallel analyses showing the treatment rates a year before and after other pregnancy outcomes, including abortion, miscarriage, and other natural losses. The failure to provide this additional analysis is most striking given the fact that Munk-Olsen has used the same data to publish a much more nuanced comparison of psychiatric treatment rates among women who have abortions and women who carry to terms.
Both the American Psychological Task Force on Abortion and Mental Health and the Royal College of Psychiatry have called for more research regarding abortion and mental health.
In a broad sense, efforts to study the interactions between reproductive health and mental health will never be reliable as long as researchers ignore or suppress analyses which fail to encompass the full reproductive history of women, including both voluntary and involuntary pregnancy losses. Journal editors and peer reviewers should be alert to this problem and should heed the call for better research by demanding that every study regarding reproductive outcomes and mental health should include segregated results allowing for direct comparison of outcome variables relative to the entire range of pregnancy outcomes: live birth, abortion, miscarriage, and other natural losses. By pressing researchers to address and report on these related pregnancy issues, reviewers and editors will helping to advance more rigorous investigation of all of these issues. Without such requests for more detailed analyses, study designs can easily be fashioned to avoid or minimize the investigation of controversial issues.
It is my hope that Munk-Olsen will address the research imperatives raised herein by expanding the study design presented in the present paper.<sup>1</sup>
Reanalysis should include segregated results allowing comparisons between: (a) delivering women with no history of pregnancy loss, (b) delivering women with a history of one abortion, (c) delivering women with a history of two or more abortions, (d) delivering women with a history of one miscarriages, (e) delivering women with a history of two or more miscarriages, and treatment rates for (f) women with no prior pregnancy whose first pregnancy is aborted, and (g) women with no prior live birth who have two or more abortions or other losses.
References
(1) Munk-Olsen T, Gasse C, Laursen TM. Prevalence of antidepressant use and contacts with psychiatrists and psychologists in pregnant and postpartum women. Acta Psychiatr Scand. 2011 Nov 25. doi: 10.1111/j.1600-0447.2011.01784.x. [Epub ahead of print]
(2) Reardon DC, Cougle JR, Rue VM, Shuping MW, Coleman PK, Ney PG. Psychiatric admissions of low income women following abortion and childbirth. Can Med Assoc J. 2003; 168(10):1253-7.
(3) Burke T, Reardon DC. Forbidden Grief. The Unspoken Pain of Abortion. Springfield, IL: Acorn Books; 2002.
(4) Stotland NL. Abortion: social context, psychodynamic implications. Am J Psychiatry. 1998 Jul;155(7):964-7.
(5) Coleman PK, Reardon DC, Cougle JR. Substance use among pregnant women in the context of previous reproductive loss and desire for current pregnancy. Br J Health Psychol. 2005 May;10(Pt 2):255-68.
On 2016 Feb 27, K Lee commented:
None
On 2016 Mar 05, Andrey Alexeyenko commented:
None
On 2016 Sep 10, Md. Shahidul Islam commented:
The readers may wish to know information released by the Karolinska Instutute where the works reported in this paper were performed. Click here
On 2017 Jan 31, Morten Oksvold commented:
With an expression of concern since April 2016, concerns from the Royal Swedish Academy of Sciences regarding the patient handling, a declaration from the Swedish Research Council that the authors failed to apply for the legally required ethics permit to perform this operation, and three co-authors who no longer wish to be associated with this paper, and no further action, I am astonished by the editorial policy in Lancet.
On 2017 Oct 31, Morten Oksvold commented:
Time is overdue to retract this article now. The central ethical review board in Sweden found research misconduct in six articles by Macchiarini, including this one. What more do you need Lancet?
Please see the report from the central ethical review board in Sweden: http://www.epn.se/media/2516/pressmeddelande-o-12-2016eng.pdf https://drive.google.com/file/d/0By2HqPi4t2RbYzZweVRieVVMajhJQUM0cmFMekwyRVJTUFVr/view
This information was provided by Leonid Schneider (forbetterscience.com).
On 2015 Dec 02, Benjamin Schuster-Boeckler commented:
Unfortunately it seems that this resource is now offline.
On 2014 Jan 20, Dylmitr Rittoo commented:
A very important study. The mechanisms explaining the differences between cTnI and cTnT assays are getting clearer. I congratulate the authors on their excellent work.
On 2013 Oct 24, Robert Tibshirani commented:
This paper presents a robust, nonparametric approach to inference from RNAseq data.
For a related paper and discussion of the nonparametric vs parametric approach, see
http://www.ncbi.nlm.nih.gov/pubmed/20979621/#cm20979621_226
On 2013 Oct 31, John Cannell commented:
The authors found markers oxidative stress is present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.
Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>
Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.
Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013
Also, supplemental vitamin D significantly reduces oxidative stress in humans.
Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014
Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013
Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.
Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014
Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010
Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012
There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.
Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009
DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013
Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013
Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.
Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010
Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008
70% of American toddlers do not take the Ameri
On 2016 Jan 17, M Felix Freshwater commented:
The author is William L. White
On 2013 Dec 19, Scott Federhen commented:
I am Scott Federhen, head of the GenBank taxonomy group, and author of his article. Since this article appeared, we have added a significant new feature to the taxonomy database - we have started to curate type material, and are using these data to flag sequence from type in Entrez. Sequence from type material is an important subset because the species identification is virtually certain to be correct (by definition) - but see Buddruhs N, 2013 for a rare cautionary example.
When a new species of prokaryote is described, the authors are required to designate a type strain and deposit it in at least two different culture collections. These are usually widely distributed between other culture collections and sold to researchers, so we have lots of sequence from type strains of prokaryotes, including many of our complete genomes.
When a new species of eukaryote is described, the authors are required to designate a type specimen and deposit it in a museum (or herbarium) where it is generally not available for subsequent sequence analysis (unless living cultures can be derived from the specimen, as with some of the fungi). We currently have very little sequence from type in the plants and animals, though it is becoming more common to include a little sequence with the description of new species - see Stoev P, 2013 for an extreme example.
See Salmonella enterica and Cercopithecus lomamiensis for examples of type material annotation in the taxonomy database.
The Entrez query sequence from type [filter] can be used to retrieve these sequence entries, and can be used in combination with other queries, e.g.: sequence from type [filter] AND metazoa[orgn].
sequence from type [filter] is also a very useful as an Entrez query to limit your BLAST searches to reliably identified sequences (particularly in the prokaryotes).
On 2013 Oct 31, John Cannell commented:
The authors found markers oxidative stress is present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.
Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>
Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.
Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013
Also, supplemental vitamin D significantly reduces oxidative stress in humans.
Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014
Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013
Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.
Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014
Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010
Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012
There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.
Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009
DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013
Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013
Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.
Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010
Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008
70% of American toddlers do not take the Ameri
On 2014 Sep 01, Graham Coop commented:
A blog post I wrote on Yaniv and my paper back in 2011: http://gcbias.org/2011/12/23/scrambing-eggs-toasts-meiotic-drive/
On 2014 Mar 05, David Reardon commented:
BiPolar Disorder Study Neglects Prior Research and Adequate Controls
The Munk-Olsen team’s study of elevated risk of bipolar affective disorder following psychiatric illness in the first month after a delivery is potentially important.<sup>1</sup> Unfortunately, the study neglected to control for the effects of prior pregnancy outcomes on bipolarity.
This omission is striking given the fact that Munk-Olsen has used the same data to publish two studies on abortion and subsequent psychiatric treatment.<sup>2,3</sup> She is also familiar with the three similar record linkage studies we have published in regard to a population of 56,751 low income women in California. <sup>4,5,6</sup>
One of these latter studies revealed that women with a history of abortion were three times more likely (OR 3.0, 95% CI 1.5-6.0) to be hospitalized for bipolar disorder than women who carried to term during the four years following pregnancy outcome.<sup>4</sup> Our study also found that women who had abortions were 2.6 times more likely to be hospitalized for psychiatric treatment than were women delivered. <sup>4</sup> Similarly, Munk-Olsen has also found higher rates of psychiatric contact for each of the first 12 months following an abortion compared to delivery.<sup>2</sup> All of these facts have a direct bearing on the present study<sup>1</sup> and should have been addressed in the study design.
It is therefore tremendously baffling . . . if not suspicious . . . that the present study<sup>1</sup> did not include additional analyses relative to other pregnancy outcomes: abortion, miscarriage, and other pregnancy losses. Clearly, a history of pregnancy loss may impact the rates of postpartum depression following a live birth.<sup>7,8</sup> The failure to consider and control for pregnancy loss history is a major methodological weakness in this new study.
Both the American Psychological Task Force on Abortion and Mental Health and the Royal College of Psychiatry have called for more research regarding abortion and mental health. Yet studies such as this one continue to be published without information about the effects of pregnancy loss on the outcome, even when the researchers have access to complete reproductive histories. Whether investigation of these effects is being neglected due to lack of insight, or whether results are being redacted for ideological reasons, is unclear.
Journal editors and peer reviewers should heed the call for more research on associations between abortion and mental health by requesting that every study regarding reproductive outcomes and mental health should include segregated results allowing for comparisons relative to pregnancy outcome: live birth, miscarriage, abortion, and other losses.
While I communicated my hope that Munk-Olsen would correct this oversight in a reanalysis of the data shortly after this study was first published, no such results have yet been reported. To the contrary, the author has indicated there is no interest in addressing any of the issues I have raised. Despite this rebuff, it is important that reanalyses should be conducted to include segregated results allowing comparisons between delivering women with no history of pregnancy loss, women with a history of one abortion, women with a history of two or more abortions, and women with a history of one or more miscarriages.
References
(1) Munk-Olsen T, Laursen TM, Meltzer-Brody S, Mortensen PB, Jones I. Psychiatric disorders with postpartum onset: possible early manifestations of bipolar affective disorders. Arch Gen Psychiatry. 2011 Dec 5. [Epub ahead of print]
(2) Munk-Olsen T, Laursen TM, Pedersen CB, Lidegaard O, Mortensen PB. First-time first-trimester induced abortion and risk of readmission to a psychiatric hospital in women with a history of treated mental disorder. Arch Gen Psychiatry. 2012 Feb;69(2):159-65.
(3) Munk-Olsen T, Laursen TM, Pedersen CB, Lidegaard Ø, Mortensen PB. Induced first-trimester abortion and risk of mental disorder. N Engl J Med. 2011 Jan 27;364(4):332-9.
(4) Reardon DC, Cougle JR, Rue VM, Shuping MW, Coleman PK, Ney PG. Psychiatric admissions of low income women following abortion and childbirth. Can Med Assoc J. 2003; 168(10):1253-7.
(5) Coleman PK, Reardon DC, Rue VM, Cougle JR.State-funded abortions vs. deliveries: A comparison of outpatient mental health claims over five years. American Journal of Orthopsychiatry, 2002; 72(1):141–52.
(6) Reardon DC, Coleman PK. Relative treatment rates for sleep disorders and sleep disturbances following abortion and childbirth: a prospective record-based study. Sleep. 2006 Jan;29(1):105-6.
(7) Burke T, Reardon DC. Forbidden Grief. The Unspoken Pain of Abortion. Springfield, IL: Acorn Books; 2002.
(8) Stotland NL. Abortion: social context, psychodynamic implications. Am J Psychiatry. 1998 Jul;155(7):964-7.
On 2015 Dec 18, David Reardon commented:
Oversight of Bipolar Disorder Link to Abortion Demonstrated by Subsequent 2015 Study
Munk-Olsen's failure to account for prior abortion history in this study is underscored by a new study in the Journal of Affective Disorders, in which researchers found that 42.4 percent of the women with bipolar disorders had a history of abortion compared to only 13.5 percent of the control group.<sup>1</sup>
These findings are consistent with a 2003 record linkage study of 56,741 low income women in California that I conducted with my colleagues. In that study we found that the rate of first-time psychiatric admissions for bipolar disorders was three times higher after abortion compared to childbirth during the four years following the pregnancy.<sup>2</sup>
References
Marengo E, Martino DJ, Igoa A, Scápola M, Fassi G, Baamonde MU, Strejilevich SA.Unplanned pregnancies and reproductive health among women with bipolar disorder. J Affect Disord. 2015 Jun 1;178:201-5.
Reardon DC, Cougle JR, Rue VM, Shuping MW, Coleman PK, Ney PG. Psychiatric admissions of low income women following abortion and childbirth. Can Med Assoc J. 2003; 168(10):1253-7.
On 2013 Nov 10, Robert Tibshirani commented:
This paper studies serum mesothelin as a biomarker for pancreatic and biliary cancers. The teen prodigy Jack Andraka http://en.wikipedia.org/wiki/Jack_Andraka developed a cheap test for mesothelin that won him the Intel Science prize. From the abstract, this paper concludes that mesothelin is not useful for detecting pancreatic and biliary cancers.
Unfortunately I have not yet read this paper- it is not open access and costs $42. This is not right! The authors work at the NCI, clearly supported by our taxes. I hope that others knowledgeable in this area will comment on this work.
On 2014 Jan 08, Brett Snodgrass commented:
Dear Authors,
Thank you for the excellent article.
Might Figure 1C depict an arteriosinusoidal vessel of Wearn? This particular vessel of Wearn is presumably unusually prominent and may be clinically classified as a fistula.
For an annotated image related to that particular aspect (figure 1c) of your more comprehensive paper, please see. https://twitter.com/BrettSnodgrass1/status/418011483524431872
Comments and suggestions are welcome.
Thank you kindly.
On 2017 Jun 04, Misha Koksharov commented:
For those interested to investigate this loop further, I suggest to also check the substitution D475P. More details are here: https://www.ncbi.nlm.nih.gov/pubmed/25448017#cm25448017_69289
On 2014 Mar 26, Tom Kindlon commented:
I wrote an e-letter with the above title, in reply to this paper, which can be read here: http://bmjopen.bmj.com/content/1/2/e000252.abstract/reply#bmjopen_el_156
On 2013 Dec 16, Gregory Francis commented:
A slightly longer version of the following text was submitted as a comment to the journal Psychological Research. The editor declined to publish the comment even though two reviewers agreed that the analysis was accurate.
Doerrfeld, Sebanz and Shiffrar (2012) tested whether anticipated effort alters perceptual experience by having individuals judge the weight of a filled basket when they intended to lift the basket either alone or with another person. Four experiments consistently rejected the null hypothesis that the weight judgments were the same across the two intention conditions. The experimental results were interpreted as strong evidence for the validity of the result and confirmation of a theoretical hypothesis that perception is shaped by what can be accomplished with other people.
However, experiments should only reject the null hypothesis at a rate that reflects the power of the experiments. When experiments have low or moderate experimental power, random sampling means that some experiments should not reject the null hypothesis even if the reported effect is true. The absence of expected null findings indicates publication bias, which makes it impossible to judge whether the reported experiments are valid. As shown below, such is the case for the findings in Doerrfeld et al. (2012).
The four experiments used very similar methods and measures, so it is appropriate to pool the effect sizes across the experiments. This produces a Hedges' g value of 0.865, which is the best estimate of the effect size for this phenomenon. Using that pooled effect size gives power values of 0.791, 0.364, 0.449 and 0.637 for the four experiments. The probability that four out of four experiments like these would reject the null hypothesis is the product of the power values, which is 0.082. If they were run properly and reported fully, the experimental outcomes in Doerrfeld et al. (2012) are quite unusual for the reported effect sizes and sample sizes. The low probability of the experiment set is below a 0.1 criterion commonly used to establish publication bias.
This observation is not intended as an accusation against Doerrfeld et al. (2012), who I suspect operated with the best of intentions in designing and reporting their studies. Seemingly minor decisions throughout a research project can lead to a biased experiment set. Ultimately, it does not much matter exactly how bias was introduced; the main observation is that the set of experimental results reported by Doerrfeld et al. (2012) as evidence for their thesis would be quite rare if they were generated without some form of bias. Since there is no way to know the extent of the bias, readers should be skeptical about the findings and conclusions of the study.
The full submitted text and an Excel file detailing the power analyses can be downloaded from:
http://www1.psych.purdue.edu/~gfrancis/Publications/DoerrfeldSebanzShiffrar2012.zip
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00412551. We believe the correct ID, which we have found by hand searching, is NCT00421551.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2014 Feb 19, Paul Brookes commented:
This paper was the subject of a comment on the PLoS Biology website on July 23rd 2013, with concerns raised about the reliability of the western blot loading controls in Figures 6 and 8. In short, the control blots contained a different number of lanes than the protein-of-interest blots... something that should have been caught during peer review. In addition one of the control blots appeared to have been duplicated between two figures representing different experimental conditions and samples.
Recently I examined this paper (having been contacted by the person who posted the original comment). I prepared a series of images to illustrate the points raised, and posted them as follows: http://i.imgur.com/JvSuSn9.jpg http://i.imgur.com/bgOmUak.jpg http://i.imgur.com/nf60fQi.jpg http://i.imgur.com/F7PfovR.jpg
In addition, while examining the paper I came across three additional problems, in which western blot images appear to have been duplicated between pairs of figures representing different experimental conditions and samples: http://i.imgur.com/4DmR4it.jpg http://i.imgur.com/1Z42k5g.jpg http://i.imgur.com/wjEmuW0.jpg
It is rather troubling that the original concerns about this paper were raised over 7 months ago, but nothing appears to have been done about it. Perhaps the high level of publicity afforded the paper (it was picked up widely as a news story suggesting that obesity may be a contagious disease) has reduced the enthusiasm of the journal editors to act appropriately? In addition despite being asked for feedback in the original PLoS website comment, the authors have not yet offered any response.
On 2013 Jun 13, Robert Tibshirani commented:
Although this is an interesting proposal, its power can be very low compared to competing methods. Details can be found in our published comment in Science (web version), also available at
http://www-stat.stanford.edu/~tibs/reshef/comment.pdf
In my opinion, a better measure of non-linear dependence is "distance correlation":
https://en.wikipedia.org/wiki/Distance_correlation
Rob Tibshirani
On 2013 Jun 28, Robert Tibshirani commented:
None
On 2016 Nov 02, Arturo MartÃ-Carvajal commented:
This abstract has omitted two very important issues: I-squared and quality of evidence.
On 2017 Sep 18, Francisco Fernandez commented:
Hi, I've reached this article with interest due to an a priori similar case. Nevertheless, it doesn't seem correct to apply 'Sudden Death' diagnosis to a patient that was hospitalized with "severe toxicities"(sic) and "the condition of the patient quickly deteriorated with a fatal outcome on day 12"(sic). I believe that the selected title is misleading.
On 2015 Feb 03, Ivan Oransky commented:
The first author of this retracted paper has published a rebuttal of this retraction, 25 years later: http://retractionwatch.com/2015/02/03/25-years-aids-fraud-comes-back-swinging/
On 2013 Dec 07, Gary Ward commented:
This is a descriptive study of the ultrastructure of the residual body (RB) formed during T. gondii replication, highlighting the continuity between the parasite cytosol and RB as well as the intravacuolar connections between parasites. The authors argue that the dense granule protein GRA2 plays a role in maintaining these connections.
The EM images confirm the presence of previously observed structures and organelles within the RB, including portions of the nucleus. It is unclear what is meant by the author’s statement that “Antibodies against SAG1, the parasite major surface protein, labelled the plasma membrane of proliferating parasites but not the RB membrane; probably the availability of the RB membrane was limited by the binding of the tachyzoites”. We were left wondering why the RB doesn't stain for SAG1 even though there is clearly membrane present.
Posted by Gary Ward on behalf of the University of Vermont Toxoplasma Journal Club (UVM ToxoJC); members include Jenna Foderaro, Anne Kelsen, Shruthi Krishnamurthy, Jacqueline Leung, Pramod Rompikuntal, Luke Tilley & Gary Ward
On 2016 May 02, Riccardo Polosa commented:
The assessment of pulmonary function and airway inflammation in healthy smokers before and after e-cigarette use by Vardavas and colleagues[1], is a perfect example of what clinical researchers should do to expand the current knowledge base of these products. Good quality research on e-cigarettes must be conducted in order to ensure that the decisions of regulators, healthcare providers and consumers are based on science. Unfortunately, the work illustrated by Vardavas and colleagues are not conclusive due to the small number of subjects studied, the choice of study outcomes of unclear clinical relevance, together with the lack of appropriate controls.
The authors state that the e-cigarettes tested in their study <have immediate adverse physiologic effects after short term use that are similar to some of the effects seen with tobacco smoking>. The reported 16% decrease in FeNO (i.e. 2.1ppb in absolute term!) and 11% increase in peripheral flow resistance (IOS) (i.e. 0.025kPa/L/s in absolute term!) after e-cigarette use from baseline are so small and well within tests variability[2,3] that it is highly unlikely to have meaningful adverse effects. Of note, no changes were detected by canonical pulmonary function testing after e-cigarette use. Toxicology characterization demonstrates that their primary components (i.e. water, propylene glycol, and nicotine) are not harmful, and this is in agreement with the detailed analysis of e-cigarette toxicology by Cahn and Siegel[4]. Moreover, clinical safety assessment of one such product showed only minor side effects (e.g. oral irritation and dry cough) in the initial few weeks of use[5] and switching to e-cigarette use led to a near-normalization of exhaled carbon monoxide levels[5]. Thus, authors’ conclusions are not fully supported by the data, and the accumulating evidence rather supports a good safety profile for these products.
The small changes in FeNO and IOS may be non specific. The mist generated by the e-cigarette per se might have contributed to these changes. In a series of pilot studies we have noted that nebulization of saline can reduce FeNO up to 25% from baseline (personal observation). Consequently, authors should have included a more pertinent control (e.g. saline mist generated by an ultrasonic nebulizer) in their study. Also, another reasonable comparator that should have been used as control could have been the participants’ own brand cigarette.
We agree that large and carefully conducted long-term prospective studies will be required before a definite answer about safety of these products can be formulated[6]. Nevertheless, it is not in the best interests of public health to halt marketing of e-cigarettes until these long-term studies are completed. Obviously, other valid options for tackling nicotine dependence in smokers exist, but it is still a personal choice how to reduce or eliminate his or her own smoking. Switching to an e-cigarette is a far better option than smoking.
References
On 2014 Mar 10, Daniel Haft commented:
We noted in this paper that only some genomes with type II secretion systems (T2SS) have rhombosortase and a matching collection of GlyGly-CTERM proteins, but essentially all genomes with rhombosortase have T2SS. This comment discusses proteins from the cholera pathogen that are both T2SS targets and GlyGly-CTERM proteins. In Vibrio cholerae, cholera toxin and at least 20 other proteins depend on T2SS for export, including 16 found by Sikora, et al. (PMID:21385872) in 2011. Three targets found in that study, the related trypsin-like serine proteases VCA0803 (VesA), VC1200 (VesB), and VC1649 (VesC), are three of V. cholerae's six GlyGly-CTERM proteins (the others are VCA0065, VC2621, and VC1485). VesA, in particular, may be highly relevant to pathogenesis, since "...analysis of single, double, and triple protease knock-out strains indicated that VesA is the primary protease responsible for processing the A subunit of cholera toxin during in vitro growth of the V. cholerae strain N16961."
The GlyGly-CTERM domain appears only at a protein's C-terminus, and consists of a signature motif, a highly hydrophobic stretch likely to represent a transmembrane helix, and then a cluster of basic residues. Such a region could serve as a C-terminal transmembrane anchor, but perhaps only temporarily. In Gram-positive bacteria, sortases remove C-terminal regions from with similar structure, but with the signature motif LPXTG. In halophilic archaea, archaeosortases remove a similar region (PGF-CTERM) from the S-layer-forming major cell surface glycoprotein (see PMID:22037399 and PMID:23651326). But while archaeosortases (probably) and sortases both are transpeptidases, rhombosortase may be simply a hydrolase.
The reasons a bacterium would anchor multiple T2SS targets with a GlyGly-CTERM domain, then release them with rhombosortase, are unclear and would be interesting to know. Possibilities include delaying secretion until other steps in protein maturation have completed, apportioning proteins encoded by a single gene to two different destinations, and regulating protein destinations via signals that alter rhombosortase's expression or activity. It would also be interesting to know if every GlyGly-CTERM protein can be a T2SS target.
On 2014 Feb 27, George W Hinkal commented:
The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the twelve nanoparticles related to this publication have been added to the database and can be found at:
The left navigation links on these pages provide information about each sample (under Navigation Tree).
For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp
On 2014 Mar 12, George W Hinkal commented:
None
On 2016 May 23, Jonathan Heald commented:
Posted on behalf of the American Academy of Sleep Medicine:
The recommendations for the use of adaptive servo-ventilation for the treatment of congestive heart failure related central sleep apnea have been updated, and can be found in the following publication:
On 2014 Feb 26, Preben Berthelsen commented:
NEJM: Not a First Born but a Worthy Sibling. In “A Reader’s guide to 200 Years of the New England Journal of Medicine” by Allan M. Brandt it is postulated that NEJM “remains the longest continuously published medical periodical in the world”. This is not accurate. The Danish journal - BIBLIOTEK for LÆGER (A Library for Physicians) - has been published continuously since the first issue in 1809. The Danish medical periodical thus antedates the Journal by three years. In science, priority has always been an issue of great interest. With this letter I do not claim priority for Bibliotek for Læger as the oldest still existing medical journal. It is, however, quite likely the case. Today, the main focus of the journal is on medical history, culture, philosophy and scientific methodology. Published papers are in Danish with summaries in English.
P.G.Berthelsen, MD. Charlottenlund, Denmark. Feb. 25, 2014
On 2016 Jun 25, James Tsung commented:
Link to case video: https://youtu.be/7FoNygMX__U?list=PLHg2xyua_Kjt2c69_3vGbciHwmlBIgI6R
On 2016 Apr 09, Morten Oksvold commented:
This article has been retracted due to numerous examples of unindicated splicing of gel lanes and of duplications and inversions of gel images, as described in the published retraction note:
http://www.jneurosci.org/content/36/14/4138?etoc
The problematic issues were known for the Editor of J Neurosci in fall 2012, but ignored. After massive correspondence by Paul Brookes (see link below), the journal has finally retracted the article.
The article should not be cited in the future.
On 2017 Dec 07, Martine Crasnier-Mednansky commented:
In the discussion, the author questions whether Vibrio cholerae chitin-induced natural competence and transformation would ever occur in nature because of two seemingly irreconcilable posits: (1) transport of the PTS-sugar GlcNAc causes dephosphorylation of Enzyme IIAGlc thus preventing cAMP synthesis, and (2) chitin-induced natural competence and transformation requires cAMP for transcriptional activation of TfoX-regulated genes.
To solve this issue, the author claims "GlcNAc might not be abundant next to the chitin surface". This is probably the case as cells reaching the chitin surface are most likely limited in carbon sources, a condition in Escherichia coli leading to a marked increase in cAMP (Botsford JL, 1978). Under starving conditions, the cells are probably actively synthesizing chitinases and, in its natural chitin-rich habitat, chitin colonization and degradation are most likely not subject to catabolite repression, particularly at limiting concentrations of (GlcNAc)2 for growth.
As regards natural competence and transformation, the negative effect of GlcNAc transport is far from being established by the author’s data. According to figure 4, addition of 2 mM GlcNAc does not significantly affect transformation frequency with (GlcNAc)6 as inducer of natural transformation. Furthermore, it appears the effect of GlcNAc on transformation frequency is independent of GlcNAc transport (figure 2, third panel).
Meibom KL, 2005 proposed three controlling factors for natural transformation, "the presence of chitin; increasing cell density; and nutrient limitation, growth deceleration or stress". As regards cell density, the quorum-sensing master regulator HapR is essential for natural competence, and considering utilization of GlcNAc upon growth deceleration causes an increase in cAMP, GlcNAc may actually be a good carbon source in vitro for natural transformation in the presence of chitin.
On 2016 Mar 15, Kristina Hanspers commented:
The schematic in Fig 3 is represented as a pathway in the Open Access Publication Collection at WikiPathways: http://wikipathways.org/index.php/Pathway:WP2406. These pathways are available for download in multiple formats and can be used for data analysis and visualization in tools like PathVisio and Cytoscape.
On 2016 Mar 18, ZHONGMING ZHAO commented:
My lab recently moved to the University of Texas Health Science Center at Houston. The software is now available at https://bioinfo.uth.edu/GenRev.html.
On 2015 Oct 05, Jan Egger commented:
Videos demonstrating the virtual stenting can be found here: https://www.youtube.com/c/JanEgger/videos
Best wishes, Jan
On 2014 Mar 16, Alican Dalkilic commented:
Hoping to see more interdisciplinary research regarding psychiatric implications of medical and dermatological problems and also impact on quality of life in teh literature. Thanks, A. Dalkilic, MD, MPH
On 2014 Dec 08, Alberto Halabe Bucay commented:
In this article the authors commented my work regarding treatment of cancer with citric acid (citrate).
On 2015 Oct 31, David Keller commented:
Marijuana smokers were compared with tobacco smokers who smoked 40 times more cigarettes per day
Pletcher and colleagues compare the long-term effects on pulmonary function of smoking marijuana versus smoking tobacco. They conclude that tobacco smokers suffer worse degrees of pulmonary function impairment, as measured by spirometry, than do marijuana smokers for comparable amounts of use of each substance. However, their formula for defining equivalent levels of tobacco versus marijuana smoking is heavily biased and seems designed to yield a comparison which is highly favorable to marijuana use.
In each defined level of use, the tobacco smokers at that level inhale far more hot smoke and combustion products per day than do the marijuana smokers to whom they are compared. For example, in Table 2, the heaviest category of tobacco smokers is defined as those with a lifetime smoking history exceeding 20 pack-years (146,000 cigarettes), while the highest category of marijuana smokers is defined as those with a history of greater than 10 joint-years (3650 marijuana joints). Thus, the tobacco user smokes 40 times as many cigarettes, over the same period of time, as a marijuana smoker with whom he is compared.
However, it seems far more reasonable to suppose that the damage due to smoking any dried plant is proportional to the amount of hot combustion products inhaled. Since each tobacco cigarette contains roughly the same weight (if not more) of combustible plant matter as each marijuana joint, it is completely unreasonable to compare the pulmonary effects of smoking 40 tobacco cigarettes per day with the effects of smoking just one marijuana joint (cigarette) per day. Further, it is dangerously misleading to imply, based on such a biased comparison, that smoking marijuana is in any way less damaging to the lungs than smoking tobacco. To convince me of that, the investigators should compare smokers of tobacco cigarettes with marijuana smokers who inhale the hot smoke and combustion products from an equal number of marijuana cigarettes per day.
The worst potential harm from smoking any burning dried plant matter is lung cancer, an outcome not reported or compared in this study. Furthermore, even if marijuana smokers do suffer less loss of pulmonary function than do tobacco smokers (at equal numbers of cigarettes per day), all smokers would be better off if they did not smoke at all, even if they continued to use tobacco or marijuana by some less harmful route of delivery; tobacco smokers should switch to the nicotine patch, gum or spray, and marijuana users can ingest it orally and obtain the same psychogenic effects.
On 2014 Mar 17, Gaetano Santulli commented:
Healey et al. report that subclinical atrial fibrillation (AF) is associated with an increased risk of ischemic stroke or systemic embolism (1). This finding is really intriguing, but the interpretation is problematic in that the Authors did not mention in their analysis some widely recognized independent risk factors for ischemic stroke, such as smoking status and left atrial size (2, 3). These factors clearly partake in the pathophysiology of AF-associated stroke, which is indeed mainly due to embolism of thrombus formed during stasis of blood in the left atrial appendage (2). Furthermore, there is a well-known connection between atrial dimensions and new-onset AF (4). Thus, subclinical episodes of AF could be simply a marker of stroke risk, indicating another underlying disease (2). In this trial (1), the risk of stroke was improperly assessed using the CHADS2 score (5), which was instead specifically designed just for patients with overt AF. To better understand the prognostic clinical implications of asymptomatic AF, it would be of interest to validate the significancy of provided results after correction for the omitted risk factors.
Disclosures: None.
References 1. Healey JS, Connolly SJ, Gold MR, et al. Subclinical atrial fibrillation and the risk of stroke. N Engl J Med 2012;366:120-9. 2. Sacco RL, Benjamin EJ, Broderick JP, et al. American Heart Association Prevention Conference. IV. Prevention and Rehabilitation of Stroke. Risk factors. Stroke 1997;28:1507-17. 3. Benjamin EJ, D’Agostino RB, Belanger AJ, Wolf PA, Levy D. Left atrial size and the risk of stroke and death. The Framingham Heart Study. Circulation 1995;92:835-41. 4. Tsang TS, Barnes ME, Bailey KR, et al. Left atrial volume: important risk marker of incident atrial fibrillation in 1655 older men and women. Mayo Clin Proc 2001;76:467-75. 5. Gage BF, Waterman AD, Shannon W, Boechler M, Rich MW, Radford MJ. Validation of clinical classification schemes for predicting stroke: results from the National Registry of Atrial Fibrillation. JAMA 2001;285:2864-70.
Gaetano Santulli, MD, PhD Columbia University Medical Center New York, NY - USA
On 2014 Jan 07, Brett Snodgrass commented:
Dear Author,
Thank you for the excellent work. Unfortunately, the article does not illustrate the arteriosinusoidal vessels described by Wearn. In addition, the arterioluminal vessels do not connect to the myocardial sinusoids. Please see the following modified image.
https://twitter.com/BrettSnodgrass1/status/417945453498335232
Comments and suggestions are welcome.
Thank you kindly.
On 2016 Sep 12, Morten Oksvold commented:
In this review article three references (ref. 12, 13 and 29) cite articles which have been retracted due to research misconduct;
Please note that reference no 29 is actually identical to reference no 13.
On 2017 Nov 07, Victoria MacBean commented:
Plain English Summary
Cystic Fibrosis (CF) is a genetic disorder in which the genes that control the movement of salt and water in and out of cells are affected, this leads to a build up of mucus mostly in the lungs but also in the liver, pancreas and intestine. The aim of the study was to determine whether high intensity exercise tasks lead to fatigue (where the muscles become briefly less able to generate force) in the abdominal muscles or the diaphragm in patients with CF.
Two groups of people were tested, one group with 10 patients with CF and the other group with 10 healthy subjects. On two different occasions the test subjects went to the lab to carry out tests. On the first occasion the subjects performed an exercise test to characterise the subjects in terms of their exercise performance and to also calculate a work rate, which was used in the second test. The second occasion involved a cycling endurance test, lung function and respiratory muscle strength testing taken on all subjects. Before and after the exercise tests, subjects underwent magnetic stimulation of their diaphragm and abdominal muscles to assess how much force the muscles could generate.
Average exercise time was similar in the healthy subjects and those with cystic fibrosis, as was the intensity of exercise they performed during the test. The measurements taken show that there were not any significant changes in the responses to magnetic stimulation after exercise in both the healthy subjects and those with CF. A decrease the response to magnetic stimulation of greater than 15% is thought to be indicative of fatigue in respiratory muscles, however, none of the subjects saw a decrease larger than 15%, thus leading to the conclusion that fatigue did not occur in any of the subjects.
The fact that that fatigue did not occur in the diaphragm or abdominal muscles after exercise in the patients with CF suggests that feelings of breathlessness and weakness in leg muscles may be more important in limiting exercise performance in those with CF. Further studies are needed in order to exactly understand the factors that hinder exercise performance of those with CF such as muscle function in non-respiratory muscles.
This summary was produced by Amazing Grace Lawal, Year 13 student from Harris Academy South Norwood, London as part of the authors' departmental educational outreach programme.
On 2014 Jun 17, Serge Ahmed commented:
Imagine that a rat has come to expect a limited daily access time to a desired good and that it has no way to save it for future consumption. Intuitively, you might think that the shorter the expected access time to the good, the faster the rat will consume it. In other words, the rate of consumption should be inversely related to the daily access time to the good (at least within a certain range of time values).
In this elegant study, the authors report the opposite outcome in rats self-administering cocaine. Rats did not self-administer cocaine at a lower rate but instead at a higher rate when they expected a long (6h) versus short (1h) daily access time to the drug. Importantly, when rats had no way to predict whether access time to the drug will be short or long, they self-administered cocaine as if they were expecting a short access time!
How to make sense of these rather unexpected findings? To address this question, we will probably have to address first the following other questions: Is the positive relationship between rate of consumption and access time reported in this study TYPICALLY observed with other goods or is it specific to cocaine self-administration? What does this relationship tell us about how and what do rats exactly learn in this sort of differential access time setting? Does it imply that rats have a longer future time horizon than previously thought (i.e., hours instead of minutes)? I hope that future research will shed some light on these different questions.
On 2016 Mar 27, Bruno Ramalho Carvalho commented:
I would say that under a certain point of view, receiving a diagnosis of infertility is similar to being diagnosed with a terminal illness. Far from me to compare the severity of a cancer to infertility on the physical health of the individual, but both diagnoses break the ideal continuity of the human being. It may be the continuity of life itself. It may be the perpetuation of his memory, his legacy through their descendants. So, from the perspective of the end of the line, both diagnoses at least tangent each other, and hence the devastating impact that infertility can leave on the psyche of those who have to live with it.
On 2013 Oct 28, Jamie Horder commented:
An excellent short paper in which the authors warn about the use of 'narrative' reviews of clinical evidence as a kind of poor-man's meta-analysis.
In reference to the novel antidepressant agomelatine, they point out that (at the time of writing) the PubMed search "agomelatine" + "depression", reveals 73 hits, of which no fewer than 34 were review papers. Of these reviews, 80% claimed efficacy for the drug.
Rigorous meta-analyses paint a much less positive picture of agomelatine's efficacy, they argue, and unsystematic reviews act as "a modern Trojan horse for reintroducing the brave old world of narrative-based medicine into medical journals."
On 2016 Jun 28, Andrey Fedorov commented:
The atlas produced as a result of this work is available here: http://www.nitrc.org/projects/vervet_atlas/
On 2017 Apr 11, Atanas G. Atanasov commented:
This research area is opening possibilities for some really interesting therapeutic interventions… I have featured the manuscript at: http://healthandscienceportal.blogspot.com/2017/04/inflammation-regulation-by-short-chain.html
On 2015 Sep 16, F Morceau commented:
Results concerning VPA-induced PU.1 and CD11b increased expression in K562 and HL60 cells notably, were previously reported (Chateauvieux et al., Biochemical Pharmacology, Volume 81, Issue 4, 15 February 2011, Pages 498–509). This reference has been forgotten here!
On 2016 Nov 18, Morten Oksvold commented:
An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.
This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:
http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/
This article should therefore no longer be cited.
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00738170. We believe the correct ID, which we have found by hand searching, is NCT00738179.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 Dec 29, Rebecca Holman commented:
A clinical researcher asked me for help in using the Additional file 1: Meta-analyses and forest plots in MS Excel provided by the authors of this paper. The file had produced a strange result for this researcher's meta analysis. My concern is around step 8 of "Steps in analyzing data and producing a forest plot". The authors definition of I<sup>2</sup> is slightly different to that presented previously (see for example Higgins JP, 2003). The authors of the current manuscript do not place a lower bound of 0% on the value of I<sup>2</sup> . Hence, in some meta-analysis data sets, the additional file can result in a value of I<sup>2</sup> of less than 0%. In addition, the authors have not placed a lower bound of 0 on the value of Q-(k-1) when calculating v in step 9B "Random effects model". In some meta-analysis data sets, this can lead to negative values of v (cell M16 in the additional file). This can lead to incorrect results for a random effects based meta-analysis. When viewed in conjunction with previous comments on this paper, I feel that researchers should exercise caution when using the formulas in or additional Excel file to this paper to perform calculations or obtain figures for a meta-analysis.
On 2013 Jul 01, Roger Peng commented:
This is a wonderful paper that introduces principal stratification for air pollution "accountability" analysis. Most studies in this area look for natural experiment type of analyses. The application of principal stratification has the potential for opening up a new methodological avenue for evaluating air pollution interventions.
On 2017 Sep 12, Eric Vallabh Minikel commented:
A full text pre-print of this article is now available on Zenodo thanks to dissemin.
On 2014 Mar 05, David Reardon commented:
The authors describe the objective of this review<sup>1</sup> "is to provide an updated assessment of the safety of abortion relative to delivery." But those familiar with the literature should be immediately struck by the fact that they fail to cite, much less discuss, the large record linkage studies which contradict their conclusions.
For example, our study of 173,279 low income women in California, linking medicaid records for pregnancy treatments with death certificates, revealed significantly higher rates of death associated with abortion compared to childbirth.<sup>2</sup> Specifically, we found an elevated relative risk of death associated with abortion for all causes (RR=1.62), suicide (2.54), natural causes (1.44), circulatory diseases (2.87), and cardiovascular disease (5.46). Moreover, these effects persisted over several years.
Even more striking was the authors' failure to note or discuss six or more even better known studies by Gissler et al examining the entire population of women in Finland<sup>3-8</sup>. They, too, used centralized records to link death certificates with treatments for pregnancy, and they, too, found significantly higher rates of mortality associated with abortion compared to childbirth.
The Finland studies are especially important in that the authors have conclusively demonstrated that the methodology used by Raymond and Grimes, a simple comparison of reported mortality rates, is unreliable.<sup>5</sup> Without record linkage, 94% percent of deaths associated with abortion (in the first year alone) could not be identified. <sup>4</sup>
Moreover, the methods used to collect data on deaths associated with abortion and childbirth in the United States are inconsistent and incomparable in their own right.
Indeed, in response to an inquiry about the appropriateness of comparisons of the kind used by Raymond and Grimes in this review, Dr. Julie Louise Gerberding, director of the CDC, wrote in July of 2004 that maternal mortality rates and abortion mortality rates ”are conceptually different and are used by the CDC for different public health purposes.”<sup>9</sup>
The problems with the Raymond/Grimes approach, and a more complete discussion of the findings of record linkage studies in regard to abortion mortality rates are found in 2004 review of the literature<sup>10</sup>. The bottom line is that Raymond and Grimes have chosen to ignore all the research which challenges their conclusion that abortion is safer than childbirth, and they are basing their conclusions on data sets which are not truly comparable.
It is also notable that while it is customary for review papers to consult previously published reviews to address issues raised by previous reviewers of the topic, Raymond and Grimes chose not only to ignored our review<sup>10</sup> but also a second major review published in Obstetrical & Gynecological Survey<sup>11</sup> which also had conclusions contrary to theirs.
This should lead readers to be skeptical of the authors claim that: "We systematically reviewed the past decade of PubMed publications for relevant data." Indeed, in light of the body of literature which is out there, and easily found, and has often been raised in the court cases which Dr. Grimes serves as an expert witness, it is patently clear to those of us who have published in this field that the Raymond/Grimes "systematic review criteria" were carefully and precisely constructed to exclude consideration of studies published our California study (published in 2002, examining data through 1997) and those of the population of Finland.
Despite this artifice, it is an indisputable fact that every study which has employ record linkage has found that mortality rates associated with childbirth are significantly lower than those associated with abortion.<sup>2-8</sup>
Finally, while the authors can be excused for not being aware of additional record linkage studies in press at the time their "review" was published, it is noteworthy that two studies of the entire population of childbearing women in Denmark between 1998 and 2005 have also higher death rates associated with abortion compared to childbirth.
The first of these Denmark studies found that compared women who deliver a first pregnancy, women who abort a first pregnancy have a significantly elevated risk of death within the first 180 days and this elevated risk of death persists for at least ten years<sup>12</sup>. The second revealed that there is also a dose effect associated with abortion, with each exposure of abortion contributing an additional 50% (approximately) increased risk of death over the period examined.<sup>13</sup>
I sincerely hope these authors will use PubMed Commons to publish a thoughtful defense of why they excluded record linkage studies from their review. And secondly, in light of the studies mentioned here, to explain if and how they can persist in their conclusion that the best medical evidence indicates that abortion is 14 times safer than childbirth.
Citations
(1) Raymond, Elizabeth G.; Grimes, David A. The Comparative Safety of Legal Induced Abortion and Childbirth in the United States. Obstetrics & Gynecology. 119(2, Part 1):215-219, February 2012. PMID: 22270271
(2) Reardon DC, Ney PG , Scheuren FJ, Cougle JR, Coleman, PK, Strahan T. Deaths associated with pregnancy outcome: a record linkage study of low income women. Southern Medical Journal, August 2002, 95(8):834-841. PMID: 12190217
(3) Gissler M, Berg C, Bouvier-Colle MH, Buekens P. Pregnancy-associated mortality after birth, spontaneous abortion, or induced abortion in Finland, 1987-2000. Am J Obstet Gynecol. 2004 Feb;190(2):422-7. PMID: 14981384
(4) Gissler M, Berg C, Bouvier-Colle MH, Buekens P.Methods for identifying pregnancy-associated deaths: population-based data from Finland 1987-2000. Paediatr Perinat Epidemiol. 2004 Nov;18(6):448-55. PMID:
(5) Gissler M, Kauppila R, Meriläinen J, Toukomaa H, Hemminki E. Pregnancy-associated deaths in Finland 1987-1994--definition problems and benefits of record linkage. Acta Obstet Gynecol Scand. 1997 Aug;76(7):651-7. Review. PMID:
(6) Gissler M, Hemminki E. Pregnancy-related violent deaths. Scand J Public Health. 1999 Mar;27(1):54-5. PMID:
(7) Gissler M, Berg C, Bouvier-Colle MH, Buekens P. Injury deaths, suicides and homicides associated with pregnancy, Finland 1987-2000. Eur J Public Health. 2005 Oct;15(5):459-63. PMID:
(8) Gissler M, Hemminki E, Lönnqvist J. Suicides after pregnancy in Finland, 1987-94: register linkage study. BMJ. 1996 Dec 7;313(7070):1431-4.
(9) Letter from Julie Louise Gerberding to Walter Weber, July 20, 2004. http://afterabortion.org/pdf/CDCResponsetoWeberReAbortionStats-Gerberding Reply.pdf responding to Weber's April 30, 2004 request for a reassessment of pertinent statistical measures of mortality rates associated with pregnancy outcome. http://afterabortion.org/pdf/WeberLettertoThompson&CDCReAbortionStats.pdf
(10) Reardon DC, Strahan TW, Thorp JM, Shuping MW. Deaths associated with abortion compared to childbirth: a review of new and old data and the medical and legal implications. The Journal of Contemporary Health Law & Policy 2004; 20(2):279-327. PMID: 15239361 http://www.afterabortion.org/pdf/DeathsAssocWithAbortionJCHLP.pdf
(11) Shadigian EM; Bauer ST. Pregnancy-Associated Death: A Qualitative Systematic Review of Homicide and Suicide Obstetrical & Gynecological Survey. 2005. 60:183-190.
(12) Reardon DC, Coleman PK. Short and long term mortality rates associated with first pregnancy outcome: population register based study for Denmark 1980-2004. Med Sci Monit. 2012 Sep;18(9):PH71-6. PMID: 22936199
(13) Coleman PK1, Reardon DC, Calhoun BC. Reproductive history patterns and long-term mortality rates: a Danish, population-based record linkage study. Eur J Public Health. 2013 Aug;23(4):569-74. doi: 10.1093/eurpub/cks107. Epub 2012 Sep 5. PMID: 22954474
On 2014 Jul 02, Balázs Győrffy commented:
This paper is also our reference for identifying the best cutoff by computing all percentiles between the lower and upper quartiles of gene expression. Some features like multivariate analysis are described in our latest publication regarding the KM-plot analysis tool (http://www.ncbi.nlm.nih.gov/pubmed/?term=24367507).
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00209795. We believe the correct ID, which we have found by hand searching, is NCT00209794.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 Aug 11, Hugues BEDOUELLE commented:
The GenBank accession numbers for the nucleotide sequence of Fab 4E11 are AJ131288 for the heavy chain and AJ131289 for the light chain (see Thullier P, 1999). The structures of the four complexes between scFv 4E11 and its target (domain 3) in the envelope protein of the dengue virus, one for each serotype, are further analyzed in Lisova O, 2014
On 2014 Jul 06, Francisco Xavier Castellanos commented:
There seems to be an error in this otherwise excellent paper contrasting boys with Attention-Deficit/Hyperactivity Disorder (ADHD) and Autism Spectrum Disorder (ASD). Near the bottom of page 241, left column, the authors wrote “For ADHD boys, precuneus activation was significantly negatively correlated with premature errors (r = -0.4, P < 0.05). No correlations were significant in ASD.” This suggests that increased precuneus activation, although abnormal in this context, was associated with fewer errors. However, the discussion (pg. 242, near bottom, left column) assumes a positive correlation, which would seem to make more sense: “This is further supported by the negative correlation in controls between DLPFC activation and response variability, and by the POSITIVE correlation between premature response errors in ADHD patients and precuneus activation…” [EMPHASIS ADDED]. Would the authors please clarify?
On 2013 Jun 18, Martin Fenner commented:
This study reports the long-term results of a trial first published in 2007 Lorch A, 2007, confirming that in patients with relapsed or refractory germ cell tumors overall survival and progression-free survival after sequential high-dose chemotherapy are comparable to single high-dose chemotherapy, but with fewer early deaths.
This paper is important because it not only shows a high cure rate with high-dose chemotherapy for patients with relapsed or refractory germ cell tumors, but also because it is one of the few successful prospective randomized trials of high-dose chemotherapy in this patient population. Two randomized trials looking at first-line high-dose chemotherapy in IGCCCG poor risk patients (Motzer RJ, 2007 and PMCID: PMC3082158) were underpowered because of recruitment problems, leading to the inclusion of IGCCCG intermediate risk patients (a patient group with very different prognosis) in Motzer RJ, 2007 and premature trial closure in PMCID: PMC3082158.
Prospective randomized trials continue to be a challenge in patients with relapsed/refractory testicular cancer and in patients in the IGCCCG poor prognosis group for a variety of reasons (small number of patients, lack of funding for conventional chemotherapy, good existing treatment options), but are critically important.
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT003257540. We believe the correct ID, which we have found by hand searching, is NCT00325754.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2016 Dec 26, induprabha yadev commented:
use of vesssel sealing system expedites the whole operation and results in a clean field. however introduction of this technology in a resource poor setting like india is debatable. the same results achieved with the use of vessel sealing system could be achieved with normal bipolar diathermy as practised in our institution
On 2017 Aug 15, Andrea Messori commented:
Pearl-I trial: incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo
Andrea Messori, HTA Unit, Regional Health Service, 50100 Firenze, Italy
In the Pearl-I trial [1], women with symptomatic fibroids, excessive uterine bleeding (PBAC score>100) and anemia were randomized to receive oral ulipristal (dose: 5 mg/day for 13 weeks) or placebo (48 women). A third arm received 10 mg/day of ulipristal. In the comparison between ulipristal 5 mg/day and placebo, the end point of controlled uterine bleeding (PBAC score<75) was achieved by 91% of the patients in the treatment group vs 19% in the controls receiving placebo. Figure 2 (Panel A) of the article by Donnez et al.[1] shows the time-to-event curve for treated patients and controls. Nagy et al.[2] have estimated that the value of utility is around 0.83 for patients with mild-to-moderate bleeding vs 0.72 for patients with severe bleeding (see Table 3 of Nagy’s article). We have carried out an analysis of the results of the Pearl-I trial in order to estimate the magnitude of the incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo by expressing this benefit in quality-adjusted life years (QALYs). For this purpose, we employed a statistical tool (WebPlotDigitizer program) with which we analyzed the time-to-event curves reported in Figure 2 Panel A of the Pearl-I trial (time interval: from 0 to 100 days). As regards the ulipristal group, this statistical program estimated an average of 77.38 days per patient after achievement of the end-point vs 22.62 days per patient without achievement of the end-point. Likewise, in the control group there were on average 13.30 days per patient after achievement of the end-point vs 86.70 days per patient without achievement of the end-point. Using the two values of utility previously mentioned, these figures generated the following estimates of quality-adjusted survival: 80.51 quality adjusted days per patient in the treatment group (i.e. 0.22058 QALYs) and 73.46 quality adjusted days per patient in the control group (i.e. 0.20127 QALYs). The difference between these two QALY values yields 0.01931 QALYs per patient (around 7 quality-adjusted days per patient), which represents the incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo.
References
[1] Donnez J, Tatarchuk TF, Bouchard P, Puscasiu L, Zakharenko NF, Ivanova T, Ugocsai G, Mara M, Jilla MP, Bestel E, Terrill P, Osterloh I, Loumaye E; PEARL I Study Group. Ulipristal acetate versus placebo for fibroid treatment before surgery. N Engl J Med. 2012 Feb 2;366(5):409-20.
[2] Nagy B, Timár G, Józwiak-Hagymásy J, Kovács G, Merész G, Vámossy I, Ágh T, László Á, Vokó Z, Kaló Z. The cost-effectiveness of ulipristal acetate tablets in treating patients with moderate to severe symptoms of uterine fibroids. Eur J Obstet Gynecol Reprod Biol. 2014 Apr;175:75-81.
[3] Rohatgi A. WebPlotDigitizer, Version: 3.12, Austin, Texas, available at http://arohatgi.info/WebPlotDigitizer, last accessed 15 August 2017
On 2014 Jan 22, Tom Kindlon commented:
The abstract states "altogether 184 of 377 (49%) patients had alternative diagnoses to CFS [chronic fatigue syndrome]." However, this is an underestimate as not everyone had a full assessment. Looking at the figures, 113 did have a confirmed CFS diagnosis with another 3 people not meeting fatigue criteria for CFS, 2 people recovered from CFS and 1 person with no conclusive diagnosis following assessment. However, this leaves 74 others. If they were ever assessed individually (which may eventually have happened, either at the St Bartholomew's Hospital CFS service or at a service closer to them), some of them presumably would have been found to have had an alternative diagnosis.
The following sentences are interesting: "There were 67 (35%) reasons in referrals that were declined due to likely alternative medical diagnoses. The majority of these were due to chronic pain being the primary problem (32, 16%)." This suggests that the service uses a model akin to the Oxford criteria for CFS[1]: "a syndrome characterized by fatigue as the principal symptom." However other criteria do not use such a requirement, something which is implicitly expressed in a paper which had the same corresponding author as this paper: "The PACE findings can be generalised to patients who also meet alternative diagnostic criteria for chronic fatigue syndrome[3] and myalgic encephalomyelitis [ME] but only if fatigue is their main symptom [2]." Also, the NICE guidelines for "CFS/ME"[4] does not appear to make such a requirement. Indeed, if one looks at the full version of the NICE guidelines, they investigate situations where "the individual's primary symptom is pain".
The ME Association in the UK published in 2010 possibly the largest ever patient survey[5]. Three thousand five hundred and ninety four people responded to a question asking about their most severe symptom (page 6): "Muscle fatigue (1730), Cognitive Dysfunction (548), Pain (esp in muscles & joints) 504, Sleep Problems (461), Mobility Problems (197), None of these apply (18)". Such data suggests that, among those referred to the St Bartholomew's Hospital CFS service who were said to have alternative diagnoses, some might be considered as having "CFS/ME" by other professionals.
References:
[1]. Sharpe MC, Archard LC, Banatvala JE, et al. A report--chronic fatigue syndrome. J Roy Soc Med 1991; 84: 118-21.
[2]. White PD, Goldsmith KA, Johnson AL, et al on behalf of the PACE trial management group. Comparison of adaptive pacing therapy, cognitive behaviour therapy, graded exercise therapy, and specialist medical care for chronic fatigue syndrome (PACE): a randomised trial. Lancet 2011; 377:823-836.
[3]. Reeves WC, Lloyd A, Vernon SD, et al. The international chronic fatigue syndrome study group identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution. BMC Health Serv Res 2003, 3: 2.
[4]. National Institute for Health and Clinical Excellence. Chronic fatigue syndrome/myalgic encephalomyelitis (or encephalopathy). Diagnosis and management of CFS/ME in adults and children. London: NICE, 2007 http://www.nice.org.uk/nicemedia/live/11824/36191/36191.pdf Accessed February 3, 2012.
[5]. Managing my M.E. - What people with ME/CFS and their carers want from the UK's health and social services. Gawcott, England: ME Association; May 2010. Available at: http://www.meassociation.org.uk/wp-content/uploads/2010/09/2010-survey-report-lo-res10.pdf Accessed February 3, 2012.
Conflict of Interest: I am the Assistant Chairperson and Information Officer of the Irish ME/CFS Association. All my work for the Association is unpaid
On 2015 Sep 17, Tom Kindlon commented:
This study used the Reeves et al. (2005) criteria(1) for defining Chronic Fatigue Syndrome (CFS) (sometimes described by the CDC as an operationalization of the Fukuda et al. (1994) criteria (2)).
These (Reeves) criteria greatly increased the prevalence of CFS. The "empirical" definition gives a prevalence rate of 2.54% of the adult population(3) compared to 0.235% (95% confidence interval, 0.142%-0.327%) and 0.422% (95% confidence interval, 0.29%-0.56%) when the Fukuda definition was used in previous population studies in the US(4,5).
The definition lacks specificity. For example, one research study(6) found that 38% of those with a diagnosis of a Major Depressive Disorder were misclassified as having CFS using the empirical/Reeves definition. A letter of mine discussed my concerns in more detail(7).
Due to the problems with the criteria, these criteria have not been used by researchers outside those contracted to analyse CDC data (apart from Leonard Jason's research team who studied it and showed problems with it (6)).
References:
1 Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic fatigue syndrome – a clinically empirical approach to its definition and study. BMC Med. 2005;3:19.
2 Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.
3 Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.
4 Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N, Minden S, Reeves WC: Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Int Med 2003, 163:1530-1536.
5 Jason LA, Richman JA, Rademaker AW, Jordan KM, Plioplys AV, Taylor RR, McCready W, Huang CF, Plioplys S. A community-based study of chronic fatigue syndrome. Arch Intern Med. 1999 Oct 11;159(18):2129-37.
6 Jason, LA, Najar N, Porter N, Reh C. Evaluating the Centers for Disease Control's empirical chronic fatigue syndrome case definition. Journal of Disability Policy Studies 2008, doi:10.1177/1044207308325995.
7 Kindlon T. Criteria used to define chronic fatigue syndrome questioned. Psychosom Med. 2010 Jun;72(5):506-7
On 2014 Sep 10, David J Volkman commented:
Despite the isolation of borrelia in two tick vectors throughout the Southeast, the CDC stubbornly insists there is no borreliosis there. A letter to the NEJM addressing the CDC’s flawed diagnostic criteria was rejected in ’12.
The Emperor’s Rash
Reports that Lyme disease (LD) is concentrated in two areas in the US (1) promulgate a myth. As in the “Emperor’s New Clothes” fairy tale people ignore contradictory evidence-based observations. Many individuals nationally remain undiagnosed with LD, a treatable bacterial infection. Several rationales have been proposed to deny the presence of LD in areas like the South, e.g., bactericidal lizard complement, I. scapularis ticks don’t bite Southerners, positive tests must be false positives because LD doesn’t occur there, idiopathic Southern Tick Associated Rash Illness with a characteristic LD rash is not LD, because borrelia cannot be cultured. Opinions have been substituted for evidence-based studies. Notwithstanding the observation of seronegative Lyme disease published in this journal in 1988 (2) seronegative LD is dismissed by claims that there is “no scientific evidence” that there can be infection without anti-borrelia antibodies (3). Similarly, despite molecular and microbiological evidence to the contrary (4) there are still published denials that persistent borreliosis exists (3). The CDC only acknowledges LD cases from areas in which LD has been previously reported and requires that a positive antibody test react in a Western Blot with 5-10 borrelia proteins (so called 2-tier test). Using these revised criteria LD cases in Georgia plummeted from 715 cases in 1989 to only 10 in 2010. The 5 weeks it often takes for antibody production to be detectable further impede diagnosis. Different borrelia strains elicit antibodies that may react poorly with the single Long Island B31 tested. Whole Cell Sonicate (WCS) used in most commercial assays. A new assay (C6) is based on two small peptides that has few B31 antigenic determinants and is less sensitive than WCS. Positive blood tests or PCR assays are dismissed as “false positives” if they are not from designated LD areas although the incidence of predicted false positive IgG antibody or nested PCR assays is <1%. The distinction between the surveillance classification and clinical diagnosis has become blurred. A caveat I inserted in the CDC’s “Surveillance Definition” of LD in 1989 explicitly cautioned that this restrictive definition was only to be used for surveillance and was “NOT appropriate for clinical diagnosis” (4) (CDC’s emphasis); this caution was inexplicably removed in 2008. Even employing imperfect technology based on antibodies binding to the single LI strain and requiring Western Blot confirmation, >70% of cases are currently detected. By simply abjuring unsupported geographic requirements we can diagnose >90% of infections with an ELISA WCS assay; thousands of additional patients can be treated by abandoning unsupported assumptions about false positives, geographic prerequisites, and 2-tier confirmation.
Diuk-Wasser MA, Hoen AG, Cislo P, Brinkerhoff R, Hamer SA, Rowland M, Cortinas R, Vourc’h G, Melton F, Hickling GJ, Tsao JI, Bunikis J, Barbour AG, Kitron U, Piesman J, Fish D. Am J Trop Med Hyg, 86, 2012, pp. 320–327.
Dattwyler RJ, Volkman,DJ, Luft,BJ, Halperin JJ, Thomas J, and Golightly MG. Seronegative late Lyme borreliosis: Dissociation of Borrelia burgdorferi specific T and B lymphocyte responses following early antibiotic therapy. N Engl J Med, 319: 1441-1446, 1988.
Feder HM Jr, Johnson BJ, O'Connell S, Shapiro ED, Steere AC, Wormser GP; A critical appraisal of "chronic Lyme disease". N Engl J Med. 2007;357:1422-30. Letters: 2008;358:1084.
Hodzic E, Feng S, Holden K, Freet KJ, Barthold SW. Persistence of Borrelia burgdorferi following antibiotic treatment in mice. Antimicrob Agents Chemother 2008; 52:1728-36.
Centers for Disease Control and Prevention. Case Definitions for Infectious Conditions Under Public Health Surveillance. MMWR, 1997;46(RR-10):1-55.
On 2018 Jan 17, Fernando Castro-Chavez commented:
My dear reader,
The article that you have in front of you is an effort to develop square representations of the Genetic Code that are meaningful biologically, the basic findings were that the most used codons per amino acid (AA) and their hydrogen bonds (H-bonds) in humans: The first eight correspond to the codons that end in G; the amino acids that have only one codon correspond to this category: M: AUG and W: UGG; then we have the next twelve codons that end in C, and finally, we have the two most used codons that end in A, one corresponds to the stop (*) function: UGA; while the first most used codons in humans in their genome, in percent per averaged sequences of 1,000 nucleotides (1K) in length are: 1) L, Leu: CUG equally sharing its position with E, Glu: GAG; 2) G, Gly: GGC; M, Met: AUG; D and Asp: GAU; 3) P, Pro: CCC; L, Leu: CUC; S, Ser: AGC...
Attentively,
Fernando Castro-Chavez From Baylor College of Medicine
Zapotlán el Grande, Jalisco, MX
01/17/2018
On 2014 Feb 27, George W Hinkal commented:
The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the twenty-five nanoparticles related to this publication have been added to the database and can be found at:
The left navigation links on these pages provide information about each sample (under Navigation Tree).
For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp
On 2014 Mar 12, George W Hinkal commented:
None
On 2014 Mar 20, Patrice Brassard commented:
We have posted this comment also on the Journal website (http://bja.oxfordjournals.org/content/108/4/623/reply).
Editor - We read with interest the manuscript published by Tang et al. regarding the possible correlation between cerebral oxygen desaturations during single lung ventilation and postoperative cognitive dysfunction in patients undergoing thoracic surgery. The authors reported cerebral oxygen desaturations in an important number of patients during single lung ventilation in thoracic surgery. One-third of patients showed impairment of early postoperative cognitive function, with 90% of these patients normalizing their cognitive function at 24 hour after surgery. These results are potentially clinically important. However, we would like to highlight important missing information and one methodological issue that need to be discussed to fully appreciate the conclusion of this study.
The first issue relates to the use of vasopressors during thoracic surgery. Did the investigators keep blood pressure within a given range with vasopressors during surgery? Administration of local anesthetics through a peridural catheter is frequently associated with perioperative hypotension. Looking at Fig 3, mean arterial pressure was relatively constant throughout surgery. It would be surprising that vasopressors were not used to maintain or restore mean arterial pressure when using peridural analgesia during general anesthesia. This is of importance since recent evidence suggests that the use of phenylephrine (1-3) and norepinephrine (4) is associated with reduced cerebral oxygenation. Cerebral oxygen desaturations reported in this study during thoracic surgery could thus be partly explained by the administration of vasopressor agents used to restore or maintain blood pressure during the procedure.
The other issue pertains to the baseline cerebral oxygenation measure. Why was baseline cerebral oxygenation only monitored with patients breathing 100% oxygen and not also room air? Evidence suggests that patients can respond to supplemental oxygen (i.e. cerebral oxygenation will increase) while others will not respond (5). Breathing 100% oxygen could have increased baseline cerebral oxygenation in responder subjects and thus, artificially widen the difference between baseline cerebral oxygenation and the lowest cerebral oxygenation value monitored during the surgical procedure. Future studies interested in relative changes in cerebral oxygenation during surgical procedure in relation to postoperative cognitive function should present baseline cerebral oxygenation with patients breathing room air and hyperoxic gas.
Jean S. Bussieres, MD, FRCPC (1,3), Philippe Desjardins, R5 (1), Patrice Brassard, PhD (2,3)
(1) Department of Anesthesiology, Faculty of Medicine, Laval University, Quebec, Canada, (2) Department of Kinesiology, Faculty of Medicine, Laval University, Quebec, Canada, (3) Institut universitaire de cardiologie et de pneumologie de Quebec, Canada.
References
1.Brassard P, Seifert T, Wissenberg M, Jensen PM, Hansen CK, Secher NH. Phenylephrine decreases frontal lobe oxygenation at rest but not during moderately intense exercise. J Appl Physiol. 2010;108:1472-1478
2.Meng L, Cannesson M, Alexander BS, Yu Z, Kain ZN, Cerussi AE, Tromberg BJ, Mantulin WW. Effect of phenylephrine and ephedrine bolus treatment on cerebral oxygenation in anaesthetized patients. Br J Anaesth. 2011;107:209-217
3.Nissen P, Brassard P, Jorgensen TB, Secher NH. Phenylephrine but not ephedrine reduces frontal lobe oxygenation following anesthesia- induced hypotension. Neurocrit Care. 2010;12:17-23
4.Brassard P, Seifert T, Secher NH. Is cerebral oxygenation negatively affected by infusion of norepinephrine in healthy subjects? Br J Anaesth. 2009;102:800-805
5.Heringlake M, Garbers C, Kabler JH, Anderson I, Heinze H, Schon J, Berger KU, Dibbelt L, Sievers HH, Hanke T. Preoperative cerebral oxygen saturation and clinical outcomes in cardiac surgery. Anesthesiology. 2011;114:58-69
On 2014 Nov 24, Guillaume Filion commented:
For a retrospective of the ideas behind BALST together with some comments by David Lipman, you can check out the blog post "Once upon a BLAST" at the following link. http://blog.thegrandlocus.com/2014/06/once-upon-a-blast
On 2015 May 22, Dan Bolser commented:
You can grab the manuscript from here: https://www.scribd.com/doc/266260951/Basic-local-alignment-search-tool
On 2013 Jun 15, Steven Salzberg commented:
This is a very cool result. All of our techniques for sequencing transcripts and then assembling them into genes assume the result should be a linear molecule. By relaxing this assumption, Salzman and colleagues found large numbers of RNAs that appear to be circular. It's a whole new model that raises several intriguing new questions: are these translated, and if so how easily? Do they survive longer due to their circularity?
On 2015 Sep 10, Lydia Maniatis commented:
None
On 2015 Sep 11, Lydia Maniatis commented:
The authors describe this study as having measured “the effect of context on the mapping between luminance and lightness.” This description unacceptably vague, though not uncommon in lightness research. “Context” is always varied in any experiment in any field, and can mean a million things. Without a clear rationale for the particular choices made, the statement lacks relevant content; but such a rationale is lacking in this study, where the authors justify their choice of stimuli by saying that “we follow in the tradition that uses checkerboard scenes as a model system for studying perceived lightness...” This may not be the best tradition to follow; very poor use of it is made here.
The authors apparently didn't exploit their own visual system to assess the effects of their stimuli, which clearly produce illumination/transparency/luminosity effects of varying ambiguity. When, therefore, in the introduction to their study, they state that their stimuli “are missing the geometric factors that, in natural scenes, are associated with a strong impression of different fields of illumination...” and that their study allows them to investigate “the extent to which photometric manipulation in the absence of such geometric cues affects perceived lightness,” it is unclear whether they mean to imply that the themselves effects are absent, or only that known cues are absent. Since the effects are obviously present, and since they are necessarily contingent on the surface luminance structure – the geometry – of the stimuli, the latter do, in fact, contain unanalyzed “geometric cues” to differential illumination/transparency.
On the basis of an exceptionally crude data-set – observers are asked to rate only the central square while the remaining 24 are varied semi-randomly, the authors, after extended and strenuous mathematical engagement with their data, do, indeed, come to the conclusion that “... observers' lightness matches are consistent with the visual system treating the photometric variation in checkerboard context as spatial variation in the illumination." This was probably the most roundabout way possible to come to a self-evident conclusion (though it should be noted that the apparent illumination changes in their stimuli are not limited to the groups of squares the investigators lightened or darkened as a block – the stimuli are also full of accidental effects.)
In general, the results are “broadly consistent” with what was already known. Where they are supposed to be “novel,” they are so only if scission is treated as not occurring: “Other features of our data are novel. First is the manner in which the shape of the CTFs varies with context. Early proposals about how context affects lightness focused on the notion that lightness is computed via a ratio to some reference luminance (Land, 1986; Wallach, 1948, see Brainard & Wandell, 1986) or as a fixed function of contrast. These models predict that the CTFs will plot as lines of slope 1 in the type of log–log representation we employ and are clearly contradicted by the data.” Obviously, a simple or even not so simple ratio rule or contrast concept is a straw man given the self-evident and semi-acknowledged scission effects. Perhaps this is the reason for the implausible hedging on the question of whether these illumination/transparency effects did, in fact, arise: “However, inferences about how the visual system parsed the stimuli into separately illuminated regions must remain speculative, since our stimuli were not constructed as simulations of illuminated surfaces nor did we measure either the observers' estimates of the illumination or the perceived lightness at locations in the checkerboard context other than the central target patch.” It is very difficult to see what was the point of all this trouble, except to obscure the obvious.
A blind eye is also turned toward luminosity effects. Radonjic et al (2011) had unconvincingly explained away the perception of luminosity in high range stimuli by attributing it to the use of an emissive display, without, however, explaining why the same did not occur for targets of similar luminance in low-range displays. In the present study, the problem of potential luminosity is dealt with by discounting very high reports because they “did not correspond to a palette paper.” Thus, the data are not allowed to show luminosity effects.
It would have been interesting and worthwhile if the authors had made better use of the checkerboard tradition and attempted to analyze the why scission effects occur in stimuli without penumbras or apparent overlap of figural boundaries.
On 2013 Oct 29, Tom Kindlon commented:
I would like to thank the authors for taking the time to write up this case report, as well as thanking the patient for giving permission for the use of her story.
I thought it was worth pointing out that the symptoms described by the authors and the patient would be quite similar to the symptoms patients with myalgic encephalomyelitis (ME) or chronic fatigue syndrome (CFS) would report.<sup>1-7</sup> I don't believe patients with an ME or CFS diagnosis are often assessed for a mitochondrial myopathy using the tests mentioned although a novel test did find evidence for mitochondrial dysfunction.<sup>8</sup> At least two studies have found carnitine supplementation to be of benefit in patients diagnosed with CFS.<sup>9,10</sup>
Excessive acidosis on exercise has been found in patients.<sup>11,12</sup> One study, looking for an association with enterovirus infection, found that 58% of CFS patients had an abnormal lactate response to subanaerobic threshold exercise test.<sup>13</sup>
CFS is increasingly recoognized as being heterogeneous.<sup>14</sup> Despite its name, more symptoms than fatigue are generally associated with it.<sup>15</sup> Mitochondrial problems could relevant for some patients even if they may not be relevant for all patients.
References:
(1) Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome: A comprehensive approach to its definition and study. Annals of Internal Medicine. 1994;121:953-959.
(2) Sharpe MC, Archard LC, Banatvala JE, et al. A report--chronic fatigue syndrome: guidelines for research. J R Soc Med. 1991 Feb;84(2):118-21.
(3) Carruthers B, Jain A, de Meirleir K, Peterson D, Klimas N, Lemer A, et al.: Myalgic encephalomyelitis/chronic fatigue syndrome: clinical working case definition, diagnostic and treatment protocols. J Chronic Fatigue Syndrome 2003;11(1):7-33
(4) Holmes GP, Kaplan JE, Gantz NM, et al. Chronic fatigue syndrome: a working case definition. Ann Intern Med. 1988 Mar;108(3):387-9.
(5) Jason LA, Evans M, Porter N, et al. The development of a revised Canadian Myalgic Encephalomyelitis-Chronic Fatigue Syndrome case definition. American Journal of Biochemistry and Biotechnology. 2010:6;120–135. Retrieved from http://www.scipub.org/fulltext/ajbb/ajbb62120-135.pdf
(6) Carruthers BM, van de Sande MI, De Meirleir KL, et al. Myalgic Encephalomyelitis: International Consensus Criteria. J Intern Med. 2011 Jul 20. doi: 10.1111/j.1365- 2796.2011.02428.x. [Epub ahead of print]
(7) Goudsmit EM, Shepherd C, Dancey CP, Howes S. ME: Chronic fatigue syndrome or a distinct clinical entity? Health Psychology Update, 2009, 18, 1, 26-33.
(8) Myhill S, Booth NE, McLaren-Howard J. Chronic fatigue syndrome and mitochondrial dysfunction. Int J Clin Exp Med. 2009;2(1):1-16. Epub 2009 Jan 15.
(9) Vermeulen RC, Scholte HR. Exploratory open label, randomized study of acetyl- and propionylcarnitine in chronic fatigue syndrome. Psychosom Med. 2004 Mar-Apr;66(2):276-82.
(10) Plioplys AV, Plioplys S. Amantadine and L-carnitine treatment of Chronic Fatigue Syndrome. Neuropsychobiology. 1997;35(1):16-23.
(11) Arnold DL, Bore PJ, Radda GK, Styles P, Taylor DJ. Excessive intracellular acidosis of skeletal muscle on exercise in a patient with a post-viral exhaustion/fatigue syndrome. A 31P nuclear magnetic resonance study. Lancet. 1984 Jun 23;1(8391):1367-9.
(12) Jones DE, Hollingsworth KG, Jakovljevic DG, Fattakhova G, Pairman J, Blamire AM, Trenell MI, Newton JL. Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study. Eur J Clin Invest. 2012 Feb;42(2):186-94.
(13) Lane RJ, Soteriou BA, Zhang H, Archard LC. Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry. 2003 Oct;74(10):1382-6.
(14) Jason, L.A., Corradi, K., Torres-Harding, S., Tay
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT01043113. We believe the correct ID, which we have found by hand searching, is NCT01043133.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 Jan 09, Larry Parnell commented:
Please see our more current catalog of cardiometabolic GxEs, with its more in-depth and more thorough analysis. This is available in BioData Mining 7:21 at http://www.biodatamining.org/content/7/1/21 or PMID 25368670. This would be a better citation than the above.
On 2017 Jan 06, Melissa Rethlefsen commented:
Though the authors clearly recognize a need to search multiple databases to gather as many relevant references as possible, a major concern is that the information sources listed as searched in this article are largely not databases, but database platforms.
The authors searched "Scopus, EBSCOhost, Ovid, and Web of Science platforms." Of those four, only Scopus is a unique database. EBSCOhost is a platform that contains many different databases. I counted 71 beginning with the letter "A" on their title list: https://www.ebscohost.com/title-lists Ovid is similarly a platform with many different database options, though not quite as many as on EBSCOhost. Ovid has "over 100" different database options: http://www.ovid.com/site/catalog/databases/index.jsp Web of Science similarly is a platform with multiple database offerings (22 of them, with different date range options available): http://thomsonreuters.com/en/products-services/scholarly-scientific-research/scholarly-search-and-discovery/web-of-science.html
Unfortunately, this article does not include a replicable search strategy in the text or in a supplementary document, so it is not possible to guess what databases might have been used, or what search strategies were used to search them. Because this is a mixed methods review and did not have an established protocol, it may be unreasonable to expect the authors to report their search methods as stringently as in a "true" systematic review, but since the authors claim a systematic review, it would have been appropriate to document and report the search methods according to known standards (i.e., PRISMA, MOOSE).
This study might have benefited from the inclusion of a librarian or information specialist on the team to improve documentation and reporting of the key methodology used to conduct this work. Additional peer review from librarians and information specialists may help identify reporting concerns, including lack of search detail and details about information sources utilized.
On 2015 Jan 19, Martin Hofmeister commented:
With regard to the interesting study by Mazloumi et al. concerning work ability among employees in one of the Iranian petrochemical industries, allow me to add one aspect. As opposed to numerous findings by other research groups [1-4], exercise activity does not constitute a key factor affecting work ability in the Iranian study. However, the high values relating to exercise activity suggest that the employees’ subjective assessments may have to be considered unrealistic. Studies specifying a degree of criteria for exercise behaviour (in terms of frequency, scope and intensity) that can be expected to produce health benefits, describe considerably lower rates of exercise activity. This implies that a classification of physical exercise activity based on energy consumption can be considered more significant than single pieces of information on exercise activity [5]. Regarding future studies on work ability in Iran, it is thus worth considering whether subjective data on the exercise activity of individuals could be corroborated by objective testing techniques, such as sports motorics and accelerometer testing [6-8].
References
1 van den Berg TI, Elders LA, de Zwart BC, Burdorf A. The effects of work-related and individual factors on the Work Ability Index: a systematic review. Occup Environ Med. 2009;66(4):211-20. van den Berg TI, 2009
2 Airila A, Hakanen J, Punakallio A, Lusa S, Luukkonen R. Is work engagement related to work ability beyond working conditions and lifestyle factors? Int Arch Occup Environ Health 2012;85(8):915-25. Airila A, 2012
3 Kettunen O, Vuorimaa T, Vasankari T. 12-mo intervention of physical exercise improved work ability, especially in subjects with low baseline work ability. Int J Environ Res Public Health. 2014;11(4):3859-69.Kettunen O, 2014
4 Rutanen R, Luoto R, Raitanen J, Mansikkamäki K, Tomás E, Nygård CH. Short- and Long-term Effects of a Physical Exercise Intervention on Work Ability and Work Strain in Symptomatic Menopausal Women. Saf Health Work. 2014;5(4):186-90. Rutanen R, 2014
5 Macera CA, Ham SA, Jones DA, Kimsey CD, Ainsworth BE, Neff LJ. Limitations on the use of a single screening question to measure sedentary behavior. Am J Public Health. 2001;91(12):2010-2.Macera CA, 2001
6 Kaleta D, Makowiec-Dabrowska T, Jegier A. Leisure-time physical activity, cardiorespiratory fitness and work ability: a study in randomly selected residents of Lódź. Int J Occup Med Environ Health 2004;17(4):457-64. Kaleta D, 2004
7 Sörensen L, Honkalehto S, Kallinen M, Pekkonen M, Louhevaara V, Smolander J, Alén M. Are cardiorespiratory fitness and walking performance associated with self-reported quality of life and work ability? Int J Occup Med Environ Health. 2007;20(3):257-64. Sörensen L, 2007
8 Sörensen LE, Pekkonen MM, Männikkö KH, Louhevaara VA, Smolander J, Alén MJ. Associations between work ability, health-related quality of life, physical activity and fitness among middle-aged men. Appl Ergon. 2008;39(6):786-91. Sörensen LE, 2008
On 2017 Oct 05, ROBERT HURST commented:
Although 253JB-V are bladder cancer cells unfortunately, KU-7 is not bladder cancer but is, instead, HeLa cells. PMC3805942
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2015 Oct 06, Bill Cayley commented:
This is one of many instances showing that for some aspects of wound care, "less" is "more": https://lessismoreebm.wordpress.com/?s=wound
On 2014 Sep 15, Casey M Bergman commented:
We have released an implementation of the approach described in this paper to detect non-reference TE insertions using next-generation whole-genome resequencing data here: https://github.com/bergmanlab/ngs_te_mapper
On 2014 Sep 15, Casey M Bergman commented:
In follow-up work estimating allele frequencies of the TE insertion site data in this paper, we identified a small error in the data processing underlying the S1, S2, S3, and S4 supplementary files. These files provided incorrect read support counts based only on the first strain in which the TE insertion was identified, rather than the total number of read counts from all strains merged across the entire dataset.
For 461 TE insertions that are present in more than one strain identified using 454 sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported. For 1,606 TE insertions that are present in more than one strain identified using Illumina sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported.
The location, strand and TE family for 3,379 out of 3,386 TE insertion sites identified using 454 sequencing in Linheiro & Bergman 2012 is unchanged. For 7 out of the 3,386 TE insertions identified using 454 sequencing, properly merging reads across strains led to differences in location, strand or TE family. The location, strand and TE family for all 8,024 TE insertion sites identified using Illumina sequencing in Linheiro & Bergman 2012 is unchanged.
None of the main conclusions of Linheiro & Bergman 2012 are affected by this error, since the Illumina data set formed the basis of the target site duplication and motif analyses. However, four values in the first paragraph of the results should be corrected to read as follows (original --> corrected):
"For the 454 data, we processed 209,979,997 reads from a total of 34 strains and retained 44,254-->53,940 reads (0.021%-->0.026% of the total) across 34 strains that included a TE start/end for a TIR or LTR element that could be mapped to the reference genome. For the Illumina data we processed 7,835,189,604 reads from a total of 176 strains and retained 65,488 --> 97,854 reads (0.00084% --> 0.00124% of the total) across 166 strains that uniquely matched a start or end of a TE for a TIR and LTR element that could be mapped to the reference genome."
Revised versions of Files S1, S2, S3, and S4 that correct this error can be found here:
Revised version of File S1 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170046
Revised version of File S2 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170047
Revised version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683836
Revised version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683834
In addition to making these revised files, we have also generated alternate versions of the S3 and S4 .bed files that encode the number of DGRP strains in which the TE insertion is found (rather than the read support count) in the score field. These alternate versions allow estimation of the allele frequency of TE insertions in the DGRP population, and can be found here:
Alternate version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168882
Alternate version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168883
Finally, to allow determination of which DGRP strain each TE insertion was detected in, we have generated .zip archives of strain-specific .bed files (with read support count in the score field). These datasets can be found here:
Strain-specific annotation files for data in File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168885
Strain-specific annotation files for data in File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168884
The new alternate and strain-specific files correspond to data in the revised S1, S2, S3, and S4 files.
We apologize for any inconvenience this error could have caused.
On 2016 Nov 20, Morten Oksvold commented:
An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.
This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:
http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/
This article should therefore no longer be cited.
On 2014 Jan 15, Hirotaka Shoji commented:
"ImageLD/EP/TM/FZ", image analysis application softwares used for behavioral analysis in this article, are now freely available from http://www.mouse-phenotype.org/software.html.
On 2014 May 08, Ivan Oransky commented:
This paper has been retracted: http://retractionwatch.com/2014/05/07/near-word-to-word-similarities-topple-microflora-paper/
On 2016 Feb 18, Kristina Hanspers commented:
The schematic in figure 1 is available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2851. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.
On 2016 Oct 21, David Reardon commented:
While the authors are harsh in their criticism of Coleman's reliance on the lifetime diagnosis variable in examining each disorder, it appears from their own analysis (Table 1) that the 30-day and 12-month diagnoses showed significantly higher rates after abortion for diagnoses of PTSD, agoraphobia, alcohol dependence, drug dependence, and bipolar 1 at 12 months. Since they do not show the confidence intervals, it's quite possible that there is not enough sample power in the study for these findings to be statistically significant. Yet even in that case, the elevated rates are consistent with what has been reported in record linkage studies showing higher rates of treatment for psychiatric problems following abortion after controlling for one year prior admissions. Reardon DC, 2003Coleman PK, 2002
More importantly, a recent study Abortion, substance abuse and mental health in early adulthood: Thirteen-year longitudinal evidence from the United States provides results using a larger and more detailed data set.
On 2014 Jul 23, Gwinyai Masukume commented:
Here are additional terms:
Coffee bean nuclei of ovarian Brenner tumor Ahr A, 1997
Grape-like vesicles of placental mesenchymal dysplasia Taga S, 2013
Raisin-like nuclei on pap smear of koilocytes Histology Blog
Watered-down fat-free milk – scanty thick white female ejaculate Rubio-Casillas A, 2011
On 2016 Aug 30, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00123456. This trial ID does not appear in ClinicalTrials.gov.
We have contacted the corresponding author on the study to ask them for the correct trial ID on 18/08/2016, but received no reply. We have also searched manually for this trial on ClinicalTrials.gov and found no matching study. We therefore believe that this trial may not have been registered on ClinicalTrials.gov.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2014 Jan 25, Jeffrey Beall commented:
This 2012 article contains the following text:
Such a mild heat shock elicited a heat shock response, characterized by the synthesis of new heat shock proteins normally almost absent in tissues of adult animals and by an increased synthesis of constitutively present or cognate heat shock proteins. This event was followed by a transient increased tolerance to high, normally lethal temperatures (thermotolerance). Later it was found that not only the tolerance to enhanced temperature increases, but also the resistance toward other events like hypoxia, ischemia, inflammation, and exposure to such cellular toxins as heavy metals, endotoxins, and reactive oxygen species (cross-tolerance), all imposing serious stress upon tissues and their composing cells [29].
The text does not occur within quotation marks. The reference number 29 appears as an endnote like this: [29] Tissières A et al. J Mol Biol. 1974 84: 389[PMID: 4219221].
However, the above text is matches exactly the text from this 2001 source: http://physrev.physiology.org/content/81/4/1461.full?related-urls=yes&legid=physrev;81/4/1461. The matching text makes up about the second half of the first paragraph in the introduction. The source is a completely different article from the given footnote.
I think this unattributed copying is common in the journal Bioinformation, and question whether the journal should continue to be included in PMC. Thank you.
On 2016 Dec 16, Claudiu Bandea commented:
Cell death by glutamine repeats: a revealing paradigm
(This comment was originally posted in Science on 4/4/2012: http://comments.sciencemag.org/content/10.1126/science.1219834)
In their perspective “Cell Death by Glutamine Repeats?,” Link and Saldi (1) expand on the suggestion made by Blum et al. (2) that the role of the polyglutamine-repeat protein PQN-41 in C. elegans nonapoptotic developmental cell death might be relevant for understanding the pathogenic mechanisms associated with Huntington’s disease (HD), Creutzfeldt-Jakob Disease (CJD) and other neurodegenerative diseases (NDs). HD is a progressive ND associated with an expansion of glutamine residues in the huntingtin protein (Htt), and CJD is one of the many fatal NDs associated with the prion protein (PrP), which has a domain rich in glutamine and asparagine (Q/N).
More remarkable, though, Link and Saldi bring forward a heretical concept: “glutamine-rich proteins could have a “natural role” in inducing cell death” (italics added). In other words, as recently proposed (3), the folding and assembly of these proteins into toxic agents that lead to cellular death and NDs are not inadvertent, protein misfolding events as they have been regarded for many decades, but evolutionarily selected properties and mechanisms associated with their biological function. Certainly, this is a radical departure from the current dogma that HD, CJD and many other NDs, including Alzheimer’s, Parkinson’s and ALS are protein misfolding diseases. If correct, as the current evidence indicates (3), this new hypothesis would lead to a major paradigm shift in understanding the etiology of these devastating diseases, which affect tens of millions of people worldwide, and the development of new preventive, diagnostic and therapeutic approaches.
Interestingly, similar to PQN-41, Htt is vital for embryonic development, and there is compelling evidence that it regulates the balance between cellular survival and death (4). There is also strong evidence that PrP, as well as other proteins implicated in NDs, such as Aβ, tau, and α-synuclein, can interfere with the life cycle of microbial and viral pathogens by various immune pathways, including apoptotic and nonapoptotic mechanisms for killing the host cells, which block their life cycle and limit the spread of infection (3). As suggested by Link and Saldi, PQN-4, Htt, PrP, TIA-1 and other Q/N-rich proteins (e.g. TDP-43 and FUS proteins, which are implicated in ALS and FTLD) can affect cellular viability by participating in the formation of cellular stress granules and bodies (5), which similar to other intrinsic cellular and developmental processes, such as RNA interference, might have been selected primarily as innate immune mechanisms (3).
References
(1) Link CD, Saldi TK. 2012. Cell death by glutamine repeats? Science 335:926; Link CD, 2012
(2) Blum ES et al. 2012. Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein. Science 335:970-3; Blum ES, 2012
(3) Bandea CI. 2013. Aβ, tau, α-synuclein, huntingtin, TDP-43, PrP and AA are members of the innate immune system: a unifying hypothesis on the etiology of AD, PD, HD, ALS, CJD and RSA as innate immunity disorders. bioRxiv. doi: 10.1101/000604; http://biorxiv.org/content/biorxiv/early/2013/11/18/000604.full.pdf
(4) Zuccato C, Valenza M, Cattaneo E. 2010. Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiol. Rev. 90:905-81; Zuccato C, 2010
(5) Beckham CJ, Parker R. 2008. P bodies, stress granules, and viral life cycles. Cell Host Microbe 3:206-12; Beckham CJ, 2008
On 2017 Apr 12, Yi-nong NIU commented:
So it is still inconclusive.
On 2014 Apr 17, Ivan Oransky commented:
This paper has been retracted: http://retractionwatch.com/2014/04/16/integrity-of-data-undisputed-in-paper-pulled-for-plagiarism/
On 2014 Apr 15, Ivan Oransky commented:
This paper has been retracted: http://retractionwatch.com/2014/04/15/nihharvard-team-loses-aging-study-to-manipulated-data/
On 2014 May 09, Michael Franklin commented:
The editor of J Physiol Sci has published a letter concerning this article.
J Physiol Sci. 2014 May;64(3):159. doi: 10.1007/s12576-014-0308-9. Expression of concern. Ishikawa Y.
On 2013 Dec 05, Etienne P Lebel commented:
Provocative findings, but note that we were unable to replicate Slepian et al.’s Study 1 finding in two extremely high-powered, preregistered studies that were very faithful to all procedural and methodological details of the original study (i.e., same cover story, study title, manipulation, measures, item order, scale anchors, task instructions, sampling frame, population, and statistical analyses). See LeBel EP, 2014 for full details (see here for pre-publication manuscript).
Though Slepian et al. reported three other studies supporting the secret burdensomeness phenomenon, we advise that these three other findings need to be independently corroborated before the general phenomenon informs theory or health interventions.
On 2014 Apr 02, Daniel Schwartz commented:
Liraglutide-induced kidney injury is a phenomenon that is being noted clinically more and more often. At our centre, we have occasionally seen a more subacute decline in GFR that seems to improve spontaneously after liraglutide is discontinued.
Full text/mobile access: http://qxmd.com/r/22392833
On 2016 May 10, Morten Oksvold commented:
Please pay attention to the following report by ORI (Office of Research Integrity) before reading this article:
https://ori.hhs.gov/content/case-summary-pastorino-john-g
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2013 Dec 28, Tsuyoshi Miyakawa commented:
"ImageTM", an image analysis appilcation software shown in this video article, is now freely availble from http://www.mouse-phenotype.org/software.html.
On 2015 Jun 15, thomas samaras commented:
There's no doubt that increased stress is related to short height. And this stress is created through the propagation of a false premise based on social bias and not science. If we view human body height and its associated weight in terms of health and survival of our race, shorter height has a number of advantages. In the absence of health factors causing reduced height, shorter people tend to be healthier and have a longer functional life span. In addition, a worldwide population of smaller people reduces demand for energy, food, water and various resources. In addition, air, water and land pollution is sharply reduced if we do not increase the number of people on earth. For example, since the 1900s Americans have increased in height and weight (about 45 lb for males). A CDC researcher found that a 10 lb increase in the weight of the average American would require an increase in airline fuel consumption of 350 million gallons per year. This added fuel consumption would also generate 4 billion tons of air pollution.
Our society also gives short shrift to shorter athletes. A report from Finland found that the average military recruit was taller than boxers, long-distance runners, cross-country skiers, wrestlers and weight lifters. Cantu and others also reported that being shorter was an advantage in gymnastics, diving, ballet, figure skating, long distance running and certain skiing events.
We need to change our scenario from "taller is better" to "shorter is better." Otherwise, we face a bleak future; e.g., extinction or a sharp reduction in our standard of living. Several articles are identified below. The website: www.humanbodysize.com also provides more information on the benefits of smaller human body size and a list of over 45 papers, book chapters and books.
Samaras Thomas, T. Why smaller humans are in our future. Policy Innovations, 10/20/2014 (available from internet)
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
Samaras TT. The Truth About Your Height, Tecolete Pub., San Diego 1994.(see Amazon Books)
On 2017 Oct 31, Morten Oksvold commented:
Please note that this article contains unreliable data, and should not be cited. The Central ethical review board in Sweden found research misconduct in six articles by Macchiarini, including this one.
Please see the reports from the Central ethical review board in Sweden here: http://www.epn.se/media/2516/pressmeddelande-o-12-2016eng.pdf https://drive.google.com/file/d/0By2HqPi4t2RbYzZweVRieVVMajhJQUM0cmFMekwyRVJTUFVr/view
This information was provided by Leonid Schneider (forbetterscience.com).
On 2014 Nov 25, Harri Hemila commented:
This paper was retracted, see Hemilä H, 2012.
The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html
On 2016 Aug 21, Morten Oksvold commented:
Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:
https://ori.hhs.gov/content/case-summary-dasmahapatra-girija
This article should therefor not be cited.
On 2013 Jul 11, Joshua L Cherry commented:
This article reports very interesting observations about the contributions of different types of sequence positions to the negative correlation between expression level and protein evolutionary rate (the E-R anticorrelation). However, the case for the assertion that is the title of the article is far from convincing. Much of the argument relies on predictions of protein stability made with I-Mutant2.0. The developers of that software report a correlation of only 0.62 between predicted and observed effects of mutations on stability (Capriotti E, 2005), and other assessments report even lower correlations (Potapov V, 2009). This would seem to leave much opportunity for incorrect classification of sequence positions as unimportant for stability. Furthermore, in seeking to explain their results the authors somewhat glibly discard the possibility of selection for protein function as a cause of E-R anticorrelation (in fact they seem to take it as established fact that toxic effects of misfolded proteins are a major, if incomplete, explanation). Surface residues are certainly involved in protein function, and selection for function should not be ruled out as an explanation of the negative correlation of their rate of evolution with expression level.
On 2015 Jun 25, Donald Forsdyke commented:
In the light of new reviews (Zhang J, 2015 and Forsdyke DR, 2015), the following email to the senior author (May 27 2012) may be of interest:
'Thank you for a very interesting paper in PNAS Early Edition. The "potentially toxic" effect of protein-protein misinteractions forms the basis of our hypothesis of intracellular self/not-self discrimination, which is now receiving support from studies of the predisposition of females to autoimmune disease (J of Autoimmunity 38, J129-J134). Our earlier studies were influenced by the 1982 paper of E. H. McConkey on the "quinary structure" of proteins (PNAS 79, 3236-40). I have added a reference to your new paper as an "end-note" to the web version of a 2001 paper (see http://post.queensu.ca/~forsdyke/theorimm2.htm). I look forward to your future paper on the effect of interaction avoidance on the usage of synonymous codons.'
On 2014 Sep 02, M Felix Freshwater commented:
The abstract went MIA so here it is: • Introduction: Denis Keegan is a forgotten pioneer of plastic surgery. He performed over 50 nasal reconstructions in India, published a book and papers in leading medical journals on nasal reconstruction and was even credited by Gillies as being the first surgeon to discover the necessity of providing lining for flaps. Yet, now he remains largely unknown. • Methods: Search engines, journals and texts from the late 19th and early 20th centuries were used to determine Keegan’s place in the history of plastic surgery. • Key results: Keegan first described his technique of lined forehead flaps in The Lancet in 1891. He documented his results with photographs, as opposed to the usual 19th century method of artists’ illustrations. Contemporary journals and textbooks note Keegan’s “superior” or “excellent” results. In 1900, after he retired from the Indian Medical Service, Keegan’s book Rhinoplasty was published in London. He expanded upon his prior publications, credited his colleague Smith with improving his technique, and discussed the social implications of spousal abuse that caused his patients’ injuries. Twenty years later both Gillies in England and Davis in America wrote favorably about the Keegan-Smith method of nasal reconstruction. • Conclusion: Keegan should be remembered for his surgical advances, his modesty and for highlighting the social implications of spousal abuse.
On 2014 Nov 25, Harri Hemila commented:
The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html
On 2017 Feb 23, Michael Hoffman commented:
Correction: In Online Methods, subsection "Training Parameters": "each segment label q ∈ [1, n] to 1/n" should be "each segment label q ∈ [1, m] to 1/m". (Thanks to Sharmi Banerjee.)
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
On 2013 Oct 31, John Cannell commented:
The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.
Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>
Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.
Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013
Also, supplemental vitamin D significantly reduces oxidative stress in humans.
Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014
Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013
Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.
Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014
Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010
Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012
There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.
Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009
DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013
Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013
Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.
Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010
Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008
70% of American toddlers do not take
On 2015 Jun 12, Bill Cayley commented:
A great example of when Less is More: https://lessismoreebm.wordpress.com/2015/05/08/management-of-asymptomatic-inguinal-hernia-a-systematic-review-of-the-evidence/
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0023968. We believe the correct ID, which we have found by hand searching, is NCT00239681.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2014 Feb 20, Egon Willighagen commented:
Figure 3 is available as WikiPathway at http://www.wikipathways.org/index.php/Pathway:WP2359
On 2016 Aug 30, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT200811021020. This trial ID is, in fact, a sponsor ID for the correct trial, but on the EU Clinical Trials Register. We believe that this trial may not have been registered on ClinicalTrials.gov, as we have searched for it in this register without success.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2016 Aug 24, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT88597077. We believe the correct ID, which we have found by hand searching, is NCT00597077.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2014 Jun 19, Robert Badgett commented:
This meta-analysis is updated as a living meta-analysis at https://github.com/openMetaAnalysis/Colchicine-for-Pericarditis.
On 2016 Feb 05, Kristina Hanspers commented:
The network in figure 7 is available as a pathway in the "Open Access Publication" collection at WikiPathways: http://wikipathways.org/index.php/Pathway:WP2290. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.
On 2016 Mar 22, M Mangan commented:
This paper, like others associated with the Infascelli group, has been retracted. Visit the journal's link for further details. The crux of this matter is:
"The University of Naples concluded that multiple heterogeneities were likely attributable to digital manipulation, raising serious doubts on the reliability of the findings."
On 2015 Jun 28, Erick H Turner commented:
Below is a list of DOIs and links to the FDA review documents used in the writing of this article (of which I was lead author):
doi:10.6083/M4R2102M Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/1 doi:10.6083/M4M907BW Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/2 doi:10.6083/M4GH9GN2 Aripiprazole statistical review http://digitalcommons.ohsu.edu/fdadrug/3
doi:10.6083/M4BV7F9M Iloperidone administrative correspondence http://digitalcommons.ohsu.edu/fdadrug/4 doi:10.6083/M4736PMN Iloperidone approval letter http://digitalcommons.ohsu.edu/fdadrug/5 doi:10.6083/M43B5XVG Iloperidone medical review http://digitalcommons.ohsu.edu/fdadrug/6 doi:10.6083/M4ZK5FCK Iloperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/7 doi:10.6083/M4TT4PNV Iloperidone summary review (Division Director) http://digitalcommons.ohsu.edu/fdadrug/8 doi:10.6083/M4Q23XXF Iloperidone not approvable letter http://digitalcommons.ohsu.edu/fdadrug/9 doi:10.6083/M4K9367Z Iloperidone Office Director memo http://digitalcommons.ohsu.edu/fdadrug/10
doi:10.6083/M4FN14W3 Olanzapine complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/11
doi:10.6083/M49W0D67 Paliperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/12 doi:10.6083/M4639NFT Paliperidone medical review http://digitalcommons.ohsu.edu/fdadrug/13
doi:10.6083/M42B8WQ3 Quetiapine statistical review http://digitalcommons.ohsu.edu/fdadrug/14 doi:10.6083/M4XK8D76 Quetiapine medical review http://digitalcommons.ohsu.edu/fdadrug/15
doi:10.6083/M4ST7NHG Risperidone Consta complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/16 doi:10.6083/M4DN43RQ Risperidone immediate release complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/19
doi:10.6083/M4P26WTH Ziprasidone statistical review http://digitalcommons.ohsu.edu/fdadrug/17 doi:10.6083/M4JD4VG2 Ziprasidone medical review http://digitalcommons.ohsu.edu/fdadrug/18
On 2014 Feb 10, David Keller commented:
Mingrone and colleagues report that morbidly obese patients with poorly-controlled type 2 diabetes were able to achieve glycated hemoglobin levels of 4.95 +/- 0.49% after biliopancreatic-diversion bariatric surgery. Fasting glucose levels for these patients are reported in Table 2 as 3.89 mm/L +/- 0.67, which corresponds to 70 mg/dL +/- 12. This remarkable result raises the question of whether any of these patients were troubled by episodes of hypoglycemia, particularly those with fasting blood sugar levels of 58 mg/dL, at the low end of the range. Hypoglycemia is widely defined for diabetic patients as a blood sugar level of less than 70 mg/dL, and diabetic patients accustomed to hyperglycemia may not initially tolerate these lower blood sugar levels. Were there any reported episodes of severe or symptomatic hypoglycemia among the patients treated with bariatric surgery?
On 2017 Jan 20, Andy Collings commented:
A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.04586) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.18173).
On 2014 May 07, Conrad Schoch commented:
The PCR protocols published as Table S1 in this paper has 2 errors:
The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.
The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
On 2017 Apr 21, EDUARDO FRANCO commented:
Please see PMID: 28417747. It is the same item
On 2014 Nov 25, David Mage commented:
The authors mention "Mortality rate ratios for PM2.5 fluctuated over time, but without clear trends despite a substantial drop in the sulfate fraction," which led to the prior published comment "Is ambient PM2.5 sulfate harmful?" Perhaps they all have forgotten the historic work of Mary Amdur (PMID 679907, 2667973) who wrote "The irritant potency of the sulfate species varies so widely that the term 'suspended sulfate' is toxicologically meaningless," and "Sulfate is an unsatisfactory surrogate in existing epidemiological studies."
On 2018 Jan 09, Andy Collings commented:
A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (https://doi.org/10.7554/eLife.13620) and the results of the experiments were published in a Replication Study (https://doi.org/10.7554/eLife.29747).
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0137868. We believe the correct ID, which we have found by hand searching, is NCT01037868.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2017 Nov 22, Adam VanWert commented:
Do you think this could be a transporter, such as DRA (SLC26A3)?