7,486 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
immunoglobulins-FITC conjugates were obtained from Pierce, Rockford, IL, USA. Anti-. rabies monoclonal antibody conjugated to FITC was purchased from Centocor Inc, Malvern, P A, USA. Others: Sodium chloride was purchased from S. D. fine-chem. Ltd., Mumbai, India, Lipofectamine and Trizol were obtained from Gibco-BRL, Rockville, MD, USA. UM-449 cell line was a kind gift by Prof. Nirbhay Kumar (TheW. Harry Feinstone Department of Molecular Microbiology and Immunology, John Hopkins University-School of Public Health, N. Wolfe Street, Baltimore, MD 21205, USA), COS-7 cell line was kindly provided by Dr. Chetan Chitnis (Malaria Research Group, International Center for Genetic Engineering and Biotechnology, New Delhi, India), MNA cell line, CVS-11 rabies virus and Standard Rabies Immune Globulin were kindly gifted by Dr. Charles E. Rupprecht (Rabies section, Division of Viral and Rickettsial Diseases, Centres for Disease Control and Prevention, Atlanta, Georgia 30333, USA), Nickel-nitrilotriacetic acid (Ni-NTA) was procured from QIAGEN, ultrafiltration assembly and YM30 membrane from Amicon Corp., Lexington, MA, USA. Bicinchoninic acid (BCA) was purchased from Pierce. Complete and incomplete Freund's adjuvants were procured from Difco laboratories. Nitrocellulose membrane, Tefzel tubing, gold microcarriers and Helios gene gun assembly were obtained from Bio-Rad. T -25, T -75 tissue culture flasks, 6-well tissue culture plates, 8-well tissue culture chamber slide and 96-well microtitration plates were procured from Nunc a/s, Rosakilde, Denmark. The 24-well tissue culture plates were procured from Corning glass works, Corning, NY, USA. The 96-well tissue culture plates were purchased from Becton Dickinson and Co.,
-
Bacterial strains and plasmids: DH5a and BL2l(DE3)pLysS strains of E. coli were purchased from Stratagene, La Jolla, CA, USA. SG13009[pREP4] E. coli strain was obtained from QIAGEN GmbH, Hilden, Germany. Expression vector, VRI 020 was a kind gift from VICAL Incorp., San Diego, CA, USA, pKB3-JE-13 clone was procured from ATCC, Rockville, MD, USA, pQE30 vector was procured from QIAGEN and pRSET-A vector was acquired from Invitrogen Corp., Carlsbad, California, USA. Kits: PCR-Script™ Amp cloning kit was obtained from Stratagene. Plasmid DNA purification mega kit was purchased from QIAGEN. The pGEM-T Easy cloning kit was purchased from Promega, Madison, WI, USA. Primers and Enzymes: Various oligonucleotide primers were custom made by Rama Biotechnologies, India Pvt. Ltd., Secundrabad, AP, India, Sigma-Genosys Ltd, New Delhi, India and Microsynth GmbH, Hilden, Germany. Restriction enzymes were obtained from New England BioLabs (NEB), Beverly, MA, USA and Promega, Taq DNA polymerase and T4 DNA ligase were bought from Promega. Shrimp Alkaline Phosphatase was bought from Amersham. Molecular weight markers: pGEM DNA markers were procured from Promega, /..DNA-Hind III digest and 1 kb DNA ladder were purchased from NEB. Prestained SDS-PAGE standards were obtained from Bio-Rad, Hercules, CA, USA. Antibodies and Conjugates: Rabbit anti-mouse IgG (whole molecule) conjugated to horseradish peroxidase (HRPO) was procured from Dako A/S, Glostrup, Denmark. Goat anti-mouse IgG-FITC conjugate was procured from Sigma. Mouse monoclonal antibody isotyping kit was also purchased from Sigma. Goat anti-mouse immunoglobulins-HRPO, goat anti-rabbit immunoglobulins-HRPO, rabbit anti-goat IgG-HRPO and goat anti-rabbit
-
Chemicals: Tris, glycine, acrylamide, N, N'-Methylene-bisacrylamide, sodium dodecyl sulfate (SDS), P-mercaptoethanol, N, N, N', N'-Tetramethylethylenediamine (TEMED), phenol, ethidium bromide, ethylenediaminetetraacetic acid (EDTA), agarose, Bromophenol blue, Coomassie brilliant blue-R250, calcium chloride, sodium acetate, glucose, lysozyme, glycerol, chloroform, lithium chloride, phenylmethyl sulphonyl fluoride (PMSF), spermidine, saponin, paraformaldehyde were procured from Sigma Chemical Co., St. Louis, MO, USA. Low melting point (LMP) agarose, isoamyl alcohol, sodium deoxycholate, oxidized glutathione, reduced glutathione, dimethyl sulfoxide (DMSO), 4-chloro-1-naphthol, isopropyl-P-D-thiogalactopyranoside (IPTG) and 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal), were purchased from Amresco, Solon, Ohio, USA. Ammonium persulfate and guanidine hydrochloride were purchased from Amersham, Cleveland, Ohio, USA. Alum was procured from Superfos Biosector, Elsenbakken, Frederikssund, Denmark. Reagents for Enzyme Immunoassay: Bovine serum albumin (BSA) and orthophenylene diamine (OPD) were purchased from Sigma. Tween-20 (polyoxyethylene-20-sorbitan monolaurate) was obtained from Amresco. Media and Antibiotics: Bacto tryptone, bacto yeast extract and bacto agar were obtained from Difco laboratories, Detroit, USA, Dulbecco's Modified Eagle's Medium (DMEM) and RPMI-1640 media were purchased from Sigma. Antibiotics such as gentamycin sulfate, ampicillin (sodium salt) and kanamycin were also obtained from Sigma. Fetal calf serum (FCS) was procured from Biological Industries, Hibbutz Beit, Haemek, Israel.
-
REAGENTS
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters
-
Collectionofplasma
-
ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)
-
Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%
-
Ionconcentrations
-
Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg
-
Plasmaosmolality
-
Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
-
Plasmaseparation
-
0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes
-
Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof
-
Collectionoftissues
-
TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard
-
Totalproteins
-
MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC
-
MCV
-
BloodwastakenbyheartpunctureusingMS222astheanaesthetic.Nofishwasusedmorethanonce.
-
CollectionofBlood
-
Theeffectof2%,5%and7%effluentexposureontheoxygenuptakewasmeasuredatexperimentalconditions,viz.,(a)whenaccesstoairwasprevented(aquaticconsumption),(b)whenitwasallowed(bimodalrespiration)and(c)underaerialconditions(aerialrespiration)
-
Effectofeffluentexposureontheoxygenconsumption
-
Channapunctata(Family:Channidae)(15-20g;10-15cm)usedinthisinvestigationwerewildcaughtandbroughttothelaboratoryinplasticbuckets.
-
Collectionoffish
Tags
- Method-8-Method-1-detail
- Method-19-Method-1
- Method-16-Method-1-detail
- Method-1-detail
- Method-10-Method-6-Method-1
- Method-10-Method-6-Method-1-detail
- Method-10-Method-1-detail
- Method-18-Method-1-Method-1
- Method-18-Method-1
- Method-17-Method-1
- Method-18-Method-1-Method-2
- Method-16-Method-1
- Method-1
- Method-18-Method-1-Method-2-detail
- Method-19-Method-1-detail
- Method-17-Method-1-detail
- Method-18-Method-1-Method-1-detail
- Method-18-Method-1-detail
- Method-10-Method-1
- Method-8-Method-1
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-
until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
-
Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
-
Capture-C
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
Percentage lethality was calculated as:100×((number of non-CyO/ number CyO)×100)
-
Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}
-
Fly Stocks and Crosses
-
Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).
-
Molecular Biology Protocols
-
Experimental Methods
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
CR conditions for amplification of vif gene of HIV -1 1. Denaturation-940C-5min 2. Denaturation-940C-30sec 3. Annealing-630C-30sec 4. Extension-720C-45sec 5. Final extension-720C-5min
-
The polymerase chain reaction (PCR) was carried out using the PCR Core System I (Promega, U.S.A.). 200ng of template DNA/oligonucleotide and 1 pM terminal primers were combined in 2Spl reaction volume finally containing 1X Mg free reaction buffer (500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% Triton X-100), dNTP mix with 0.2mM of each, 1.5mM MgCh and 0.62SU of Taq DNA Polymerase. 30 thermal reaction cycles from steps 2-4 were repeatedly carried out, in GeneAmp PCR 2400 machine (Perkin Elmer, USA). PCR amplification was analyzed by 1-2% agarose gel electrophoresis using a 100 bp ladder or A Hind ill marker (Promega, USA). PCR conditions for amplification of HBx gene of HBV 1. Denaturation-94oC-5min 2. Denaturation-94oC-1min 3. Annealing-42oC-2min 4. Extension-72oC-2min 5. Final extension-72oC-5min PCR conditions for amplification of hammerhead-Rz 1. Denaturation-94oC-5min 2. Denaturation-94oC-30sec 3. Annealing-42oC-1min 4. Extension-72oC-15sec 5. Final extension-72oC-2min
-
olymerase chain reaction
-
Agarose, ampicillin, ammonium acetate, Tris Base, EDTA, SDS, sodium-acetate, potassium-acetate, boric acid, disodium-hydrogen-phosphate, sodium-dihydrogen-phosphate, sodium chloride ethidium bromide, urea, ammonium persulphate, MOPS, glycerol, sodium bicarbonate, Triton X-100, dithiothreitol, magnesium chloride, BSA, IPTG, Orange G, DEPC, Tween-20, acrylamide, calcium chloride, trypsin, EDTA, sodium citrate, bromophenol blue, xylene cyanol FF, were obtained from Sigma-Aldrich Co. (Missouri, U.S.A.). X-gal, NTP and dNTP, sodium chloride, bis-acrylamide, TEMED, PCR buffer and Magnesium chloride for PCR, DNA markers, were from Promega Biotech Co. (Madison, U.S.A.). All other chemicals were at least of analytical grade and were from Qualigens laboratories (Bombay, India) or Merck (New Jersey, U.S.A.) Trizol reagents, DMEM, lipofectin, lipofectamine 2000, antimycotic-antibiotic, gentamicin, RNase-DNase free water were obtained from Invitrogen-GffiCO/BRL (Maryland, U.S.A.). Fetal bovine serum was obtained from Biological Industries (Beit Haemek, Israel). Luria Bertini medium and Luria Miller agar for bacterial culture were obtained from Difco Laboratories (Detroit, U.S.A.). Pre-stained rainbow protein markers, nylon and nitro-cellulose membranes, ECL reagent, all were obtained from Amersham Biosciences (Buckinghamshire, U.K.).
-
Chemicals
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
20 mg/ml X-gal in dimethylformamide Solution A as 40 mM potassium ferricyanide. Solution B as 40 mM potassium ferrocyanide. Solution C as 200mM magnesium chloride. 10X fixative (20% formaldehyde; 2% glutaraldehyde in 10X PBS) 10X PBS as 0.017 M KH2PO4, 0.05 M Na2HPO4, 1.5 M NaCl, pH 7
.4
-
Stock Solutions:
-
Lysis Buffer: 0.1% Triton X-100/0.1 M Tris-HCl (pH 8.0). 450 ml distilled water 50 ml 1M Tris-HCl (pH 8.0) 0.5 ml Triton X-100 detergent • 100X Mg++ solution: 0.1 M magnesium chloride 4.5 M 2-mercaptoethanol Stored at 4°C. • 0.1 M sodium phosphate (pH 7.5)41 ml 0.2 M Na2HPO4 9 ml 0.2 M Na H2PO4 50 ml distilled water • 4 mg/ml ONPG (o-nitrophenyl-β-D-galactopyranoside) in 0.1 M sodium phosphate (pH 7.5) containing 2 mM β-mercaptoethanol, Stored at –20°C. • 0.1 mg/ml β-gal standard: 0.1 mg/ml β-gal in 0.1 M sodium phosphate (pH 7.5) containing 2 mM 2-mercaptoethanol Stored at 4°C. • 1 M sodium carbonate in water
-
Solutions:
-
stored. To prepare competent cells pre-inoculum was prepared. A single bacterial colony was picked from LB agar plate, inoculated into 3 ml LB medium, and incubated overnight at 37°C temperature with shaking at 200 rpm. 1% of this pre-inoculums was sub cultured in 100 ml LB-broth and incubated at 18°C with shaking until OD at 600nm reached 0.5 - 0.6 (approx.). Culture was kept on ice for 10 min. with constant shaking.Cells were pelleted by centrifugation at 2000 g at 4°C for 8 min. Pellet was resuspended in 40 ml of ice-cold TB buffer. Bacterial suspension was kept on ice for 30 min, re-spun at 2000 g at 4°C for 8 min. Pellet was resuspended in 8 ml of TB buffer in which final concentration of DMSO was 7% and left on ice for 10 min. 100 μl aliquots were made and snap frozen in liquid nitrogen and stored at -80°C
-
All the salts (10 mM PIPES, 15 mM CaCl2.2H2O, 250 mM KCl, 55 mM MnCl2.2H2O) except MnCl2 were dissolved in milliQ water and pH was adjusted to 6.7 with 1N KOH. MnCl2 was dissolved separately in mill Q water. MnCl2 was added drop wise while stirring (MnCl2 if added directly will give a brown color to the solution and precipitate out, hence it needs to be dissolved separately). Solution was then filter sterilized and
-
Ultra Competent Cells Preparation
-
All the chemicals used for routine molecular biology work were procured from Sigma-Aldrich Chemicals (St Louis, MO, USA) unless otherwise mentioned. Taq polymerase for PCR and standard DNA markers and protein markers were purchased from MBI Fermentas. Tissue Culture materials like DMEM medium (for A549), Ham’s F-12 medium (for HPLD), Opti-MEM medium, 0.5% trypsin-EDTA, 100X antibiotic-antimycotic, freezing medium, fungizone, 200mM L-glutamine, fetal bovine serum (FBS), Lipofectamin-2000 and TRIzol were obtained from GIBCO BRL (Gaithersburg, Maryland, USA). CMRL medium was purchased from ICN laboratories. M-MLV reverse transcriptase, RNase inhibitor, dNTPs and MgCl2 were obtained from Invitrogen Corporation (Carlsbad, CA). ECL western detection kit and HybondTM- P were purchased from Amersham biosciences (GE Healthcare, UK).
-
Chemicals and Reagents
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
microfuge tubes and snap frozen in liquid nitrogen and were stored at ─80 ̊C. Protein estimation was performed simultaneously with one of these aliquots
-
The strains were grown to stationary phase in 500 ml LB supplemented with ampicillin (100 μg/ml) overnight. Cells were pelleted at 2100g for 30 min at 4 ̊C and dissolved in 5 ml of 1X PBS with 2X protease inhibitor and 3 mM DTT. Cells were lysed using French Press at 1500 psi for three cycles. The lysed cells were pelleted at 20,000g for 45 min at 4 ̊C. Clear supernatant was collected in sterile 2 ml
-
Preparation of cell extracts
-
For routine plasmid transformations, where high efficiency is not required, the following method which is a modification of that described by Sambrook and Russell (2001) was used. An overnight culture of the recipient strain was subcultured in fresh LB and grown till mid-exponential phase. The culture was chilled on ice for 15 min, and the steps hereafter were done on ice or at 4°C. The culture was centrifuged, and the pellet was resuspended in one third volume of cold 0.1 M CaCl2. After 15 min incubation on ice, the cells were again recovered by centrifugation, and resuspended in one tenth volume of cold 0.1 M CaCl2. The suspension (0.1 ml) was incubated on ice for 1 h after which DNA was added (~10-100 ng of DNA in less than 10 μl volume). The mixture was again incubated on ice for 30 min, and then heat shocked for 90 seconds at 42°C. Immediately 0.9 ml of LB broth was added to the tube and incubated at 37°C for 45 min for phenotypic expression of the antibiotic marker before being plated on selective medium at various dilutions. A negative control tube (with no plasmid DNA addition) was also routinely included in each of the experiments
-
Calcium chloride method
-
and the aqueous phase transferred to a fresh tube. The aqueous phase was further extracted successively, first with phenol:chloroform:isoamyl alcohol (25:24:1) and then with chloroform:isoamyl alcohol (24:1). DNA was precipitated from the clear supernatant by the addition of 0.6 volumes of isopropanol. The chromosomal DNA was either spooled out or pelleted at this stage, washed with 70% ethanol, air-dried, and dissolved in suitable volume of TE buffer
-
The method as described in the manual Current Protocols in Molecular Biology was followed for preparation of chromosomal DNA. Cells from 1.5 ml stationary phase culture were recovered by centrifugation and resuspended in 567 μl of TE buffer. To this, 30 μl of 10% SDS, and 3 μl of proteinase K (20 mg/ml) were added in that order and the cell suspension mixed and incubated at 37°C for 1 h. Next, when the suspension looked cleared, 100 μl of 5 M NaCl was added, thoroughly mixed, followed by the addition of 80 μl of CTAB/NaCl (10% cetyltrimethylammonium bromide in 7 M NaCl) and vigorous mixing (by inverting the microfuge tube). The suspension was incubated at 65°C for 10 min, brought to room temperature, extracted with an equal volume of chloroform-isoamyl alcohol (24:1 v/v)
-
Extraction of chromosomal DNA from bacterial cells
-
high osmolarity conditions (Gowrishankar, 1989; Csonka, 1989) for β-galactosidase assay
-
Assays for determination of β-galactosidase enzyme activity in cultures were performed as described by Miller (1992) after permeabilizing the cells with SDS/chloroform, and the activity values were calculated in Miller units, as defined therein. For determination of proU activity from a proU::lac fusion that contains the proUpromoter cloned upstream of the lacZYA genes (as in plasmid pHYD272), cultures used were grown in LBON or K-medium (low osmolarity medium) since proU is also induced under
-
β-Galactosidase assay
-
The galEp3 (galE490∗)mutation represents a 1.3 kb IS2 insertion in the gal leader region (between the promoter and structural genes of the galETKM operon). The mutation causes transcriptional polarity on the structural genes due to rho dependent transcription termination within IS2. In this assay, the gal operon expression in a galEp3mutant or its derivatives was monitored by one of two means. In the first, MacConkey galactose indicator plates (with 1% galactose) were used, where Gal+ colonies are red, and Gal− colonies are white. Therefore, the depth of color serves as an indicator of relative levels of gal expression. In the second method, growth of strains on minimal-galactose (0.2%) was used as a test for Gal+ phenotype
-
galEp3 assay
-
Lac+ colonies were distinguished from Lac− on MacConkey-lactose plates or on Xgal indicator plates. Xgal is a non-inducing colourless substrate of β-galactosidase enzyme which upon hydrolysis yields dark blue indolyl moieties and hence, the Lac+ colonies on Xgal indicator plates are seen as dark blue colonies. Xgal was prepared as a stock solution of 5 mg/ml in dimethyl formamide and used at a final concentration of 25 μg/ml. On MacConkey-lactose medium (pH around 7.1) on the other hand, Lac+ strains can utilize the lactose sugar present in the medium to lower the pH of the medium to 6.8, resulting in a pink coloured colony while Lac─ strains are unable to utilize lactose to give a white colour
-
Lac phenotype
-
A single plaque of λ contains approximately 105-106 pfu/ml. The method of propagation of λ from a single plaque was as follows. The contents of a single isolated plaque were drawn into a 1-ml pipette tip and dispensed into 0.2 ml of LB broth. After addition of a drop of chloroform, the contents were vortexed and centrifuged. The clear supernatant was mixed with 50 μl of λ-sensitive cells and incubated for 20 min at room temperature for adsorption. 10 ml of Z-broth supplemented with 5 mM MgSO4 was then added to the infection mixture, and incubated at 37°C with shaking until lysis. The lysate thus obtained usually contained 109pfu/ml
-
Preparation of λ lysate by propagation from a single isolated plaque
-
To quantitate the P1 phage lysate preparations, titration was done using a P1-sensitive indicator strain such as MG1655. 100 μl each of serial dilutions of the phage (typically 10−5, 10−6) were mixed with 0.1 ml of the fresh culture grown in Z-broth. After 15 min adsorption at 37°C without shaking, each mixture was added in a soft agar overlay to Z agar plates, and incubated overnight at 37°C. The phage titre was calculated from the number of plaques obtained on the plates
-
To 0.3 ml of infection mixture, 10 ml of Z-broth was added and incubated at 37°C with slow shaking until growth followed by the visible lysis of the culture occurred (in ~ 4-6 h). The lysate was treated with 1 ml of chloroform, centrifuged and the clear lysate was stored at 4°C with chloroform
-
Broth method
-
genome cloned in a ColEI-based replicon, and obtained from Dr. Manjula Reddy. pHYD2556 is spectinomycin resistant and carries the minimal nusA+ open-reading frame with its native ribosome-binding site between genomic nucleotide co-ordinates 3314061and 3315548 cloned downstream of the ara regulatory region in a pSC101-based replicon, and obtained from Dr. Ranjan Sen. pHYD2557 is chloramphenicol resistant and carries a 2.3-kb PCR-amplified region between genomic nucleotide co-ordinates 3314061 and 3316393 (containing yhbC nusA region with its own promoter) cloned in a pSC101-based Ts replicon, and obtained from Dr. Ranjan.Plasmid DNA preparations were routinely prepared from recA strains such as DH5αand were stored in 10mM Tris-Cl (pH 8.0) plus 1mM EDTA at ─20 ̊C
-
pWSK30 an Ampicillin resistant vector with pSC101 origin of replication and blue-white screening facility (Wang and Kushner, 1991). pHYD272 is a derivative of pMU575, an IncW-based single copy vector with Trimethoprim resistance marker carrying lacZYA reporter genes under proU promoter (Dattananda et al., 1991). pHYD751 a ColE1 replicon plasmid with ampicillin resistance marker and 2.1kb EcoRI-SalI fragment carrying nusG+cloned into EcoRI-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD763 is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying 3.8 kb BamHI-SacI fragment of nusG+ cloned into BamHI-SacI sites of pMAK705 (Harinarayanan and Gowrishankar, 2003). pHYD1201 a ColE1 replicon plasmid with ampicillin resistance marker and 3.3kb HindIII-SalI fragment carrying rho+cloned into HindIII-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD1622 is the derivative of pHYD1201 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD1623 is the derivative of pHYD751 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD2368 is a derivative of pBAD18 (AmpR) with 1.7 kb fragment encompassing RBS and coding region of uvsW from phage T4gt7 into SacI site of pBAD18 (K. Leela, unpublished). pHYD2554 is a derivative of pMBL18 with ampicillin resistance, carrying the 10-kb EcoRI-HindIII fragment between kilobase co-ordinates 3310.06 and 3320.08 of the E. coli
-
to CCT mutation leading to a Glutamic acid to Glycine change at the 53rd amino acid and a Threonine to Proline change at the 55th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-I119T is a derivative of pLG-H-NS plasmid with ATC to ACC mutation leading to a Isoleucine to Threonine change at the 119th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-P116S is a derivative of pLG-H-NS plasmid with CCA to TCA mutation leading to a Proline to Serine change at the 116th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-Y97C is a derivative of pLG-H-NS plasmid with TAT to TGT mutation leading to a Tyrosine to Cysteine change at the 97th amino acid in the H-NS protein (Willams et al., 1996). pPMrhoCam is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying PuvII-HindIII fragment containing trxArho+ cloned into PuvII-HindIII sites of pPM103 (Martinez et al., 1996). pTrc99A an expression vector with ColE1 origin of replication and ampicillin resistance marker. Provides IPTG dependent induction of the insert (Amann et al., 1988). pUC19 is a high-copy-number ColE1 based E.coli cloning vector (500-700 copies/cell) with an Ampr selectable marker. It is one of a series of related plasmids constructed by Messing and co-workers and contains portions of pBR322 and M13mp19 (Yanisch-Perron et al., 1985). It carries a multiple-cloning site (MCS) region in the lacZα fragment, and therefore allows for blue-white screening of recombinant clones
-
pAM34 is a pBR322-derived cloning vector with Ampr and Specr selectable markers. The replication of this plasmid is dependent on the presence of IPTG, the gratuitous inducer of the lac operon (Gil and Bouche, 1991). pBAD18 is an expression vector with a pBR322 derived origin of replication and allows for tightly regulated expression of the genes cloned under the PBAD promoter of the araBADoperon (Guzman et al., 1995). The vector also carries the araC gene, encoding the positive and negative regulator of this promoter. pBluescript II KS (pBKS) is also a high-copy-number ColE1 based cloning vector with Ampr selectable marker and blue-white screening facility (obtained from Stratagene). pCL1920 is a low-copy-number vector with pSC101 replicon (~ 5 copies/cell), that carries streptomycin (Str)/spectinomycin (Spec)-resistance marker (encoded by aadA) and also carries a MCS region within the lacZα that allows blue-white screening to detect recombinants (Lerner and Inouye, 1990). pCP20 pSC101-based Ts replicon, CmR AmpR, for in vivo expression of Flp recombinase (Datsenko and Wanner, 2000). pLG339 is a low-copy-number cloning vector with pSC101 replicon that has a Kanrselectable marker (Stoker et al., 1982). pLG-H-NS is a pLG339 derivative where the hns ORF had been cloned into the EcoRI-SalIsites of pLG339 vector (KanR, pSC101) (Willams et al., 1996). pLG-H-NSΔ64 is a derivative of pLG-H-NS plasmid with AT base pair deletion after codon 63 in the hns gene resulting in a frameshift (Willams et al., 1996). pLG-H-NS-L26P is a derivative of pLG-H-NS plasmid with CTG to CCG mutation leading to a Leucine to Proline change at the 26th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-E53G/T55P is a derivative of pLG-H-NS plasmid with GAG to GGG and ACT
-
pACYC184 is a medium-copy-number cloning vector (~ 20 copies/cell) with Cmr and Tetrselectable markers. It carries the origin of replication from plasmid p15A (Chang and Cohen, 1978), which is related to and yet is compatible with that of ColE1. This property enables pACYC184 to co-exist in cells with ColE1 plasmid vectors, including all the ones mentioned above
-
Plasmids that have been described elsewhere
-
Bacterial strains
-
All the bacterial strains that were used in this study are derivatives of Escherichia coliand their genotypes have been listed in Table 2.1 Bacterial strains were routinely stored on solid agar plates at 4°C and also as thick suspensions in 40% glycerol either at −20°C or at −70°C. Plasmid harboring strains, were reconstructed whenever necessary by fresh transformations
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
For experiments, cells in the logarithmic phase were taken from slant or liquid medium and dead cells removed by centrifugation at 129 x g for 5 min at RT. The supernatant was centrifuged at 1258 x g for 10 min at RT to pellet the live cells which were then resuspended in fresh medium to a cells count of 107 cells per mL. Treatment with PAT (stock solution of 10mg/mL prepared freshly in medium) was carried out at 100, 200 and 300 Jig/mL; with miltefosine (800Jig/mL stock solution prepared in DMSO) at 10, 20, 40, 60 and 80 JIM, and with H202 at 100, 200 and 300 JIM. Ketoconazole (10mM, prepared in absolute ethanol) and clotrimazole (10mM, prepared in DMSO) were used at 10 and 30 JIM. Ergosterol (3mg/ mL prepared in chloroform or absolute ethanol) was added to culture medium at a final concentration of 5-10Jig/ mL.
-
Drug treatments
-
debris, polysaccharides, and high molecular weight DNA The supernatant was gently decanted into a fresh microcentrifuge tube and 200!!L of chloroform/ mL of TRizol was added and the tube was shaken vigorously for 15s. The mixture was incubated at room temperature for 2-3 min before centrifugation at 12000 x g for 15 min at 4 °C. This resulted in the separation of the mixture into a lower organic phase and an upper aqueous phase. The aqueous phase containing the RNA was gently aspirated and transferred into a fresh microcentrifuge tube and 500!!L of isopropanol/ mL of TRizol reagent was added and incubated at RT for 10min. The mixture was centrifuged at 12000 x g for 10 min at 4 °C to isolate the RNA as a pellet. The supernatant was discarded and the pellet was washed once with 70% ethanol, centrifuged and the pellet was air-dried and re-dissolved in approximate quantity of nuclease free (DEPC-treated) water. The purity (A2so/ A260 >1.8) and concentration (A2soX dilution factor X 40) of the obtained RNA was determined by measuring the absorbance at 260nm (A26o) and 280nm (A2so). For storage, the RNA was resuspended in 1mL of absolute ethanol and stored at -70°C. Subsequently before use, the RNA was pelleted at 12000 x g for 10 min at 4°C, washed with 70% ethanol and redissolved in DEPC-treated water.
-
Total RNA was isolated from cells using TRizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Briefly 2X108 cells were harvested by centrifugation at 1258 x g for 10 min, and washed 1X with PBS. The cell pellet was lysed with 2 mL ice-cold TRizol reagent. The lysate was centrifuged at 12000 x g for 10 min at 4 °C to pellet down cellular
-
Total RNA isolation
-
Long-term axenic amastigotes were generated by subjecting promastigotes to pH and temperature modulations as described elsewhere (Debrabant et al., 2004). Briefly, live metacyclic promastigotes were harvested by centrifugation and resuspended in DMEM containing 20% FBS and a pH of 5.5 and sub-cultured at 23°C after 72 h three times. Following this, the cells were then transferred to 37°C, 5% C02 for 3 passages after 72 h each. Axenic amastigotes obtained after the last subculture was stained with Giemsa stain and checked under the microscope. They were then maintained at 37°C in a humidified atmosphere containing 5% C02 in air
-
Leishmania donovani promastigotes (MHOM/IN/80/DD8) were obtained from Dr. R Vishwakarma from the National Institute of Immunology, New Delhi, India. These were grown routinely on blood agar slants containing 1% glucose, 5.2% brain heart infusion agar extract, 6%(v jv) of rabbit blood and 1mg/mL of gentamycin as antibiotic (Sudhandiran and Shaha, 2003) at 23°C. After three days of culture on slants, fresh slants were streaked using a loop for regular maintenance. For liquid cultures, cells were transferred from a slant to modified DMEM (3. 7 g Sodium bicarbonate, 5. 96g HE PES, 5mg Hemin, 1mg Biotin, 13.36mg Adenine, 7.6mg Xanthine, 0.5rnl Triethanolamine, 40mg Tween 80) with 10 % foetal bovine serum (FBS). Before experiments, the cells were centrifuged at 129 x g for 10 min to remove dead and agglutinated parasites; the supernatant was centrifuged at 1258 x g for 10 min to pellet the live cells which were then resuspended in appropriate amounts of media for experiments
-
In vitro Leishmania donovani culture
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
require high fidelity,Taq DNA Polymerase from MBI Fermentas was used. However,for precise amplifications either Herculase Fusion or PfuDNA polymerasefrom Stratagene was used. Approximately, 10-20ng of plasmid or 100 to 200 ng ofchromosomal DNA was used as a template in a 50 μl reaction volume containing 200μM of each dNTP, 20 picomoleeach of forward and reverse primer and 1.5 units of DNA polymerase.In the case of colony PCR performed to examine multiple colonies for presence of the plasmid clones, E. coli cells from afreshly grown plate wereresuspended in 50 μl of sterile Milli-Q water to get a cell suspension (~109cells/ml)and 4 μl from this was usedas the source of DNA template. To verify various pMU575 clonesdescribed in this study, by colony PCR,the vector specific primer pairs JGJpMUF and JGJgalK were used. The expected amplicon for pMU575 alone is ~300-bp, while that carrying the cloned fragment would be >300-bp.For each PCR reaction, the samples were subjected to 30-cycles of amplification and the typical conditions were as follows (although there were slight alterations from one set of template/primerto another):The initial denaturation was carried out at 95°C for 4-min and the cycle conditionswere as given below:Annealing 45ºC to 50°C 1-minExtension 68°C (1-min/kb of DNA template to be amplified)Denaturation 95°C 1-minAfter 30 cycles of PCR, the final extension step was carried out again for 10-min at68°C
-
For amplification of short length (100-200-bp)DNA fragmentsor that do not
-
Polymerase chain reaction (PCR)
-
Overexpression and purification of ArgPand ArgPdproteins
-
argP+, argPd-S94L, argPd-P108S, argPd-P274Sfragment downstream of the phage T7-promoter, such that the encoded proteins beara C-terminal His6-tag provided by the vector DNA sequence. Theresultant plasmid was transformed into strain BL21(DE3) which has the T7 RNA Polymerase under the isopropyl thio-β-D-galactoside (IPTG) inducible lacUV5promoter.The resultant strains were grownin LB (500-1000 ml) to an A600of around 0.6and were then induced with 1 mM IPTG and harvested after 4-hrs of induction.Bacterial cells were recovered by centrifugation, resuspended in 20 ml of lysis buffer(20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mM DTT and 10 mM imidazole) containing20 μg/ml lysozyme, and lysed by sonication with 30-sec pulses for 10-min. Theprotocol for His6-ArgP(ArgPds)protein purification involved (i) passing the lysate through a 5ml Ni-NTA (Qiagen) chromatographic columnequilibrated with lysis buffer, (ii) washing thecolumn with 100 ml of washing buffer (20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mMDTT; 30 mM imidazole), and (iii) elution of His6-ArgP(ArgPds)from the column with elutionbuffer (20 mM Tris-Cl, pH-8;300 mM NaCl; 10 mM DTT and 250 mM imidazole) andcollection of 1.5 ml eluate fractions (10 fractions). The fractions were tested forprotein by Bradford method and the protein-carrying fractions (generally tubes 2 to 5)were pooled and dialysed in a 1:200 volume ratio against 20 mM Tris-Cl, pH-8 with 10mM DTT, 300 mMNaCl for 5 hrs followedby a change to buffer of composition 20 mM Tris-Cl, pH-8 with 10 mM DTT, 300 mM NaCl and 40% glycerol for 24 hrs. The proteins were concentrated by centrifugation toaround 1 mg/ml by using Amicon filter (pore size 10-KDa) and stored at −20ºC or −70ºC
-
For preparing ArgP and ArgPd-S94L, -P108S and -P274S proteins, derivatives(designated as pHYD1705, pHYD2678, pHYD2679 and pHYD2680 respectively) of the plasmidvector pET21b (Novagen) was constructed which carries the PCR-amplified
-
werethen recovered by centrifugation at 12,000 rpm for 30-min. The pellet was washed oncewith 70% ethanol, air-dried and re-suspended in 100 μl of TE-buffer. It was treatedwith RNase at a concentration of 20 μg/ml by incubating at 37ºC for 1-hr. It was furtherextracted with an equal volume of phenol:chloroform mixture followed bychloroform:isoamyl alcohol (24:1) mixture. After centrifugation, the clear supernatantwas used for recovering the nucleic acids. The nucleic acids were precipitated with 200μl of alcohol in presence of 0.3 M sodium acetate (Sambrook and Russell, 2001). In casewhere high purity plasmid preparations are required (DNA sequencing) the plasmidisolation was carried out with the commercially available kits following themanufacturer’s instruction. Plasmids were observed on 1% agarose gel
-
1.5 ml of cells from an overnight culture waspelleted by centrifuging in cold (4ºC) for10-min at 6000 rpm. The cells were re-suspended in 200 μl solution I (50 mM glucose; 25 mM Tris-Cl, pH-8; 10 mM EDTA, pH-8) with vortexing. 400 μl of freshly preparedsolution II (0.2% NaOH, 1% SDS) was added and mixed by gently inverting the tubes.Subsequently, 300 μl of solution III (prepared by mixing 60 ml of 5 M CH3COOK,11.5 ml glacial acetic acid, 28 ml water) was added and the tubes were invertedrepeatedly and gently for homogeneous mixing followed by incubation for 5-min onice. After centrifuging at 12,000 rpm for 15-min, supernatant wasdecanted into a freshtube, an equal volume of iso-propanol was added, the precipitated nucleic acids
-
Isolation of plasmid DNA
-
A differential gene expression microarray with respect to argP was performed by Genotypic Technology Pvt.Ltd., Bengaluru. The experiment was performed on an oligonucleotide microarray having 10828 probes for coding region(on average three probes were designed for each 4294 coding regions) and 4380 probes for non-coding region (on average two probes were designed for 2240 non-coding regions). The RNA was labelled using Cy3 and single channel detection was used. Data was analysed using GeneSpring GX Version 7.3
-
Microarray details
-
supplemented with amino acids and appropriate antibiotic and grown at 37ºC to an A600of 0.5-0.6. Around 0.1-0.5 ml of culture was made up to 1 ml with Z-buffer and lysedwith addition of one drop of chloroform and 1-2 drops of 1% SDS solution. 0.2 ml offreshly prepared 4 mg/ml ONPG was added to start the reaction and incubated at roomtemperature till the color of the reaction mixture turned yellow. 0.5 ml of 1 M Na2CO3was added to stop the reaction and the time duration from initial addition of ONPG tothe stopping of reaction was noted.The absorbance of reaction mix was taken at 420nm and 550 nm. The A600of the culture used was also noted. The enzyme specificactivity (in Miller units) was calculated using following equation:β-galactosidase specific activity = [1000 X A420-(1.75 X A550)] / t X v X A600Where t isthe time period in minsand v the volume of culture used in ml.Each value reported is the average of at least three independent experiments, and the standard error was <10% ofthe mean in all cases
-
β-galactosidase assay was performed according to Miller (1992). An overnight grownculture of the bacterial strain was sub-cultured in glucose Minimal A medium
-
β-galactosidase assay
-
Thialysine or thiosine (S-Aminoethyl-L-cysteine)is a toxic analog of Lys. Strains were testedfor sensitivity/resistance to thialysine by streaking them on minimal A-glucose platessupplemented without and with100-200 μg/ml thialysine(Steffes et al., 1992)
-
Test for thialysine resistance
-
For testing ArgR+/–phenotype, the colonies werestreaked on minimal A-glucose plates containing uracil (40 μg/ml) and CAN(65 μg/ml). Uracil wasadded to the medium to sensitize an argR+strain to CAN. An argR+strain is inhibited at65 μg/ml CANon a uracil-containing plate, whereas on a plate without uracil, argR+would grow even at 700-800 μg/ml CAN. Uracil represses the carAB transcription, whichencodes the carbamoyl phosphate synthase enzyme (CarAB). This results in reducedamounts of carbamoyl phosphate, which is the common intermediate between pyrimidineand Arg biosynthetic pathways. Reduced carbamoyl phosphate levels would result indecreased flux through the Arg biosynthetic pathways. This in turn would result indecrease in Arg pools inside the cell. An argR mutant would be derepressed for the Argbiosynthetic pathway and is resistant even to 300 μg/ml CANin a uracil-containing plate
-
Test for ArgR+/–phenotype
-
Test for canavanine (CAN) sensitivity
-
CAN is a toxic analog of Arg and is an inhibitor of bacterial growth. Strains were tested for sensitivity/resistance to CAN by streaking them on minimal A-glucose platessupplemented withoutand with40 μg/ml CAN(or other concentrations as indicated) and 40 μg/ml uracil
-
The colonies to be tested were streaked on the surface of minimal A-glucose plates containing either 0.4-0.7 M NaCl with 1 mM glycine betaine, and incubated at 37oC. NaCl-tolerant strains grew toform single colonies in 36-60 hrs whereas NaCl-sensitive ones did not. As controls, MC4100 (WT) and other previously identified NaCl sensitive mutants were streakedfor comparison
-
NaCl-sensitivity testing
-
agar platesLac+colonies will appear dark pink colonies whereas Lac–will remain colourless
-
A. lacphenotype
-
Scoring for phenotypes
-
Competent cells for high efficiency transformations were prepared by a method ofInoue et al. (1990) with few modifications. An overnight culture of the strain (routinelyDH5α) was sub-cultured into fresh sterile LB-brothin 1:100 dilutions and grown at 18ºC to an A600of 0.55. The cells were harvested by centrifugation at 2500 rpm for 10-min at 4ºC. This was re-suspended in 0.4 volumes of INOUE buffer and incubated inice for 10 min. The cells were recovered by centrifugation at 2500 rpm at 4ºC for 10-min and finally re-suspended in 0.01 volume of the same buffer. Sterile DMSO wasadded to a final concentration of 7%. After incubating for 10-min in ice, the cells werealiquoted in 100 μl volumes, snap frozen in liquid nitrogen and stored at –70ºC
-
Preparation of high efficiency competent cells
-
For routine plasmid transformations, following method which is modification of thatdescribed by Cohen et al. (1972) was used. An overnight culture of recipient strain wassub-cultured 1:100 in fresh LB medium and grown till mid-exponential phage. Theculture was chilled on ice for 15-min, and the steps thereafter were performed at 4ºC.20 ml of culture was centrifuged and pellet was re-suspended in 10 ml of 0.1 M CaCl2.After 15-min of incubation on ice, the cells were again centrifuged and re-suspended in2 ml of 0.1 M CaCl2. The suspension was incubated on ice for 30-min. To the 200 μl aliquot of the cell suspensionplasmid DNA (20 to 200 ng in less than 10 μl volume)was added, incubated for half an hron ice and given a heat shock for 90-sec at 41ºC.The cultures was rapidly chilled, mixed with 0.8 ml of LB-broth and incubated at 37ºCfor 1-hr, and plated on an appropriate selective medium at various dilutions. An aliquotof cell suspension to which plasmid DNA was not added served as a negative control
-
A. Calcium chloride method
-
Transformation
-
the infection mixture was centrifuged, washed in 5 ml of citratebuffer and plated without phenotypic expression
-
To 2 ml of fresh overnight culture of recipient strain, 108pfu equivalent of phage lysatewas added and incubated at 37ºC without shaking for 15-min to facilitate phageadsorption. The un-adsorbed phage particles were removed by centrifugation at 4000rpm for 5-min and pellet of bacterial cells was re-suspended in 5 ml of LB-brothcontaining 20 mM sodium citrate to prevent further phage adsorption. This wasincubated for 30-min at 37ºC without shaking to allow the phenotypic expression of theantibiotic resistance gene. The mixture was then centrifuged, and the pellet was resuspendedin 0.3 ml citrate buffer. 100 μl aliquots were plated on appropriate antibioticcontaining plates supplemented with 2.5 mM sodium citrate. A control tube withoutaddition of P1 lysate was also processed in the same way. In the case of selection ofnutritional requirement,
-
Phage P1 transduction
-
0.3 ml of overnight culture of the donor strain in Z-broth was mixed with 107plaqueforming units (pfu) of a stock P1 lysate prepared on strain MG1655. Adsorption wasallowed to occur at 37ºC for 20-mins. To 0.3 ml of infectionmixture, 10 ml of Z-broth was added and incubated at 37ºC withslow shaking until the visible lysis of the culture occurred (in 4-6 hrs). The lysate wastreated with 0.3 ml of chloroform, centrifuged and the clear lysate was stored at 4ºCwith chloroform.Preparation of P1 lysates on recA mutant strains were also donesimilarly, but with a higher multiplicity of infection (i.e. 108starter P1 phage).To quantitate the P1 phage lysate preparation, titration was done using P1 phagesensitive indicator strainsuch as MG1655. 100 μl each of dilution of phage (typically10–5, 10–6) were mixed with 0.1 ml of fresh culture grown in Z-broth. After 15-min ofadsorption at 37ºC without shaking, each mixture was added on a soft agar overlay ofZ-agar plates and incubated overnight at 37ºC. The phage titer was calculated from thenumber of plaques obtained on the plates
-
Phage P1 lysate preparation by broth method
-
Genetic techniques
-
TheE. coli strains used in this study with their genotypes are shown in Table 2.1. All strains other than BL21 (DE3) employed in protein overexpression experiments are derivatives of E. coli K12. Bacterial strains were routinely stored on solid agar plates at 4ºC and also as thick suspensions in 40% glycerol at –70ºC. Plasmid harboring strains were freshly prepared by transformation of the required plasmid. The bacteriophage P1kc from the laboratory collectionwas used for routine transduction tomove a locus from one strain to anotherand is referred to as P1 throughout this thesis.Table 2.1 E. coli strains used in this study
-
Strains and bacteriophages
Tags
- Md-1-Md-4-Md-3-d
- Md-1-Md-2
- Md-1-Md-4-Md-3
- Md-1-Md-3
- Md-1-Md-2-d
- Mt-1-d
- Md-1-Md-3-Md-1-d
- Md-1
- Md-3-Md-1-d
- Md-1-Md-6
- Md-4-Md-1-d
- Md-1-Md-4-Md-1-d
- Mt-1
- Md-1-Md-3-Md-2-d
- Md-1-Md-6-d
- Md-1-Md-4-Md-5
- Md-1-Md-1-d
- Md-1-Md-1
- Md-2-Md-1-d
- Md-1-Md-5
- Md-1-Md-4-Md-4
- Md-1-Md-4-Md-5-d
- Md-1-Md-4-Md-2-d
- Md-3-Md-1
- Md-2-Md-1
- Md-1-Md-4-Md-1-
- Md-1-Md-4-Md-4-d
- Md-1-Md-4
- Md-1-Md-5-d
- Md-1-Md-3-Md-2
- Md-1-Md-3-Md-1
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
For SEM, C. glabratacells were fixed for 24 h in 2.5% glutaraldehyde in phosphate buffer (0.1 M, pH 7.2) at 4 ̊C, post-fixed in 2% aqueous osmium tetroxide for 4 h and dehydrated. After drying to critical point, mounted samples were coated with a thin layer of gold for 3 min using an automated sputter coater and visualized by SEM (JEOL-JSM 5600)
-
Scanning electron microscopy
-
min. Cells were normalized to equal OD600, resuspendedin 1 ml 50 mM Tris-HCl (pH 7.5) and transferred to 2 ml microcentrifuge tubes. Cells were lysed with glass beadsin a homogenizer (FastPrep®-24,MP Biomedicals)asdescribed earlier.Brokencells were washed from glass beadswith 500 μl Tris-HCl (50 mM, pH 7.5) and pelleteddown at 15,000 g for 10 minto obtainall cell wall and membrane content. Pellet was then boiled for 10 minin 1mlTris-HCl(50mM; pH 7.5)solutioncontaining 2%SDS. SDS-extractable material(mannoproteins)was savedand remaining pellet wasboiled again in 500 μl Tris-HCl(50 mM; pH 7.5)buffer containing 2%SDS. Cell wallwas collectedby centrifugation at 15,000 g for 10 min, washed twice with1 ml waterandresuspendedin 100 μl 67 mM potassium phosphatebuffer. This washed cell wall materialwas used for β-glucan estimation as described below
-
Yeast cell wall was isolatedas describedpreviously(De Groot et al., 2004). Briefly, cells grown underdifferent environmental conditions were harvested at 5,000 g for 5
-
Crude cell wall isolation
-
Crude fractionation of total membraneswas carried outviadifferential centrifugation asdescribed previously (Moranoand Klionsky,1994)with slight modifications. Cells grown tolog-phase in YPDmedium werecollected, washed,normalizedto 10 OD600and resuspendedin 1 ml spheroplast buffer containing 1-2mg of zymolyase20T (MP Biomedicals).Following incubation at 30 ̊Cfor 30-45 min,spherolplastswerecollected by centrifugation at 800 g for 3 minat 4 ̊C and resuspendedin 1 mlice-cold Tris-EDTA (pH 7.5). Spheroplastswere lysed with 100 μl 0.5mm glass beads on a vortex mixer with 10 secpulsegiven thricewith intermittent ice-breaks.Cellsuspension was centrifuged at 800 g for 5 minat 4 ̊C to pellet unbrokenspheroplastsdown andthesupernatant was centrifuged at 15,000 g for 5 minat 4 ̊C to obtainthemembrane fraction pellet.Pellet was washed once with ice-cold Tris-EDTA (pH 7.5), resuspendedin 50 μl of the samebuffer and stored at -20 ̊Ctill further use. Protein concentration of pellet fraction was estimated using BCAprotein assay kit with BSA as thestandard
-
Crude vacuolar membrane extraction
-
Trehalose from C. glabratacells was extracted by trichloro acetic acid (TCA)solutionas described previously (Lillie et al.,1980). Cells grown in YPDmediumwere collected at different time pointsof growth and washed thrice with ice-cold sterile water. Cells were immediatelystored at-20 ̊Ctill further use.For trehalose isolation, 10-20 OD600cells were thawed in 500 μl TCA (0.5 M) solutionon ice and incubated at room temperaturefor 1 h.Supernatant fraction was collected by sedimenting cells at 14,000 rpm for 5 minat 4 ̊C.TCA extractionwas repeated withcells once more and the resultingsupernatant was mixed with the earlier fraction.Extractedtrehalose was measuredby phenol-sulphuric acid methodof carbohydratedeterminationwithcommercially available purified trehalose(Becton, Dickinson and Co.) as a standard.Total trehalosecontent was normalized to the cell densityand expressed as μg/2 x 107cells
-
Estimation of trehalosecontent
-
To assess the activity of plasma membrane proton pump, CgPma1, in cells grown in differentexternal pH environment,whole cell acidification assaywas carried out.This assay is a measurement of glucose-responsive proton pump activityin live cellsand is based on a decrease inthe pH of a weakly-buffered solutionupon extrusion of H+ions from thecell. The amount of change in the pH of the medium represents a crude measurement of the activity of functional plasma membrane proton pump in live cells. Whole cell acidification assay was conductedwithcellsgrown in YNB pH 5.5 and YNB pH 2.0medium as described previously (Martinez-Munoz and Kane, 2008) with slight modifications.After growth at30 ̊C for 2 h, cells were harvested, washed and resuspended(1.5-3.0 mg wet weight/ml) in 15ml MES/TEA (1mM; pH 5.0) buffer. Cell suspension was kept at 25 ̊C with continuousagitation. Extracellular pH of the buffer solution was recorded at 1 mininterval for 20 minwith the help of a pH meter(BT-600, BoecoGermany). To activate plasma membrane proton pumping, glucose and KCl were added to a final concentration of 40mM after 3 and 8 minincubation, respectively. Plasma membrane proton pump activitywas plotted as a change in the pH of the extracellular solutionversustime
-
Whole cell acidification assay
-
Log-phase yeast cell cultures were harvested and total protein was extracted by lysingyeast cells using glass beads. Briefly,10 mllog-phase yeast culturesgrownin appropriate medium were harvested,washed once with ice-cold water and suspended in 250 μl homogenizing buffer containing 1 mM phenylmethylsulfonylfluoride(inhibitsserine proteases), 10 mM sodium fluoride(inhibit Ser/Thr and acid phosphatases), 1 mM sodium orthovanadate (inhibits Tyr and alkaline phosphatases) and 1X concentration of protease inhibitor cocktail(RocheCat # 04693159001). Cells were lysedwith glass beads by vortexing five times at high speed for 1 min with intermittent 1 min ice breaks. Unbroken cells and cell debris were removed by centrifugation at 1,000 g for 5 min at 4 ̊C. Cell lysate was collected and protein was quantified using bicinchoninic acid (BCA)protein assay kit (Thermo Scientific # 23227) as per supplier’s instructions
-
Protein extraction
-
Themethod was used for isolation of good quality genomic DNA that wasused to map Tn7insertionin C. glabratamutants.Briefly,10 mlsaturated yeast culturewasharvested, resuspendedin 1 ml sterile water and transferred toa2 ml microcentrifuge tube. Cells were pelleteddown by centrifugation at 4,000 rpm for 5 min. Supernatant was discarded and the pellet was resuspendedin 500 μl freshly prepared solutioncontaining100mM EDTAand 5% β-mercaptoethanol andincubated at 42 ̊C for 10 min. After incubation,cells were spun down at 5,000 rpm for 1 minand resuspendedin 500μl freshly-prepared BufferB. One tip full of lyticase(Sigma # L4025) was added and cellsuspension was incubated at 37 ̊C for 1 h. Following incubation,cell suspension was spun down at 6,000 rpm to recover spheroplasts.Spheroplasts weregently resuspendedin 500μl BufferCand DNA was twice extracted with 500μl phenol:chloroform:isoamyl alcohol (25:24:1)solution.Aqueous layer was collected in a new 2ml microcentrifuge tube and DNA was precipitated with 1ml ethanol and 1/10thvolume of 3M sodium acetate (pH 5.2)by centrifugation at 13,000 rpm for 5 min. Pellet was resuspendedin 200 μl TE containing 0.3 μl of RNase Cocktail™and incubated at 37 ̊C for 30 min.After incubation, 300 μl additional TE was added and DNAwas re-precipitated withethanol and 3 M sodium acetateas described above. Pellet was washed with 70% ethanol anddried under air. DNA pellet was finally suspended in 100 μl TE and stored at -20 ̊C
-
Protocol III(Spheroplast lysis method
-
phenol:chloroform:isoamyl alcohol (25:24:1)was added to the tube and mixed thoroughly.Aqueous phase was collected after centrifugationat 12,000 rpm for 3 minand was transferred toanew 2 ml microcentrifuge tube.1 ml absoluteethanol was added to the aqueous phase and DNA was precipitated by centrifugation at 12,000 rpm for 8 minat 4 ̊C.DNA pellet was washed with chilled 70%ethanol and dried under air. DNA pellet was resuspendedin 50 μl TE containing 0.3 μl of RNase Cocktail™(Ambion®# AM2286)and incubated at 50 ̊C for 20 min. 200 μl additional TE was added to the above suspension and DNA was stored at -20 ̊C
-
In this method of genomic DNA extraction,yeast cells werelysed by mechanical disruption with glass beads. Briefly, yeast cells were harvested after overnight growth in YPD medium, resuspendedin 500 μl waterand transferred toa2 ml microcentrifuge tube.Cells were pelleteddown at 10,000rpm for 1 min. Resulting supernatant was discarded and the pellet was resuspendedin 500 μl Buffer A. The tube was incubated at 65 ̊C for 15 min. After incubation, 500 μl ofphenol:chloroform:isoamyl alcohol (25:24:1) and 0.5 gm of acid-washed glass beads (Sigma # G8772) were addedto the tube. Cells were lysed by three cycles of high speed vortexing withintermittent ice breaksfor 45 secand pelleteddown at 12,000 rpm for 3 minat 4 ̊C.Uppermost aqueous phase was transferred to a 2 ml microcentrifuge tube,500 μl of
-
Protocol II (Glass bead lysis method)
-
This quick extraction method was used to isolate genomic DNA which was used as templateto amplify gene of interestor toverify the knock-out. C. glabratacells were grownovernight to saturation in 10 mlYPD medium at 30 ̊C.Cells were harvested at 4,000 rpm for 5 min, resuspendedin 400 μl Buffer Acontaining 50 mM Tris-HCl, 10 mM EDTA, 150 mM NaCl, 1%Triton X-100 and 1%SDSand weretransferred to a2 ml microcentrifuge tube. Equal volume ofphenol-chloroform solution was added to the abovesuspensionfollowed byvortexingfor 2-3 minand incubationat 42 ̊C for 30 minwithcontinuous agitation at 800 rpm on thermomixer (Eppendorf). Cell debris was removed bycentrifugation at 12,000 rpm for 5 minand aqueous fraction(~ 350 μl)was transferred to a new 2 ml microcentrifuge tube.0.3 μl RNaseCocktail™(Ambion® # AM2286) containing RNase A (500 U⁄ml) and RNase T1 (20,000 U⁄ml) was added and tubes were incubated at 37 ̊C for 30 min. DNA was precipitated with 2.5 volumesof chilled ethanol and 1/10thvolume of 3 M sodium acetate (pH 5.2).DNA pellet was washed with chilled 70%ethanol and semi-dried under air.Pellet was suspendedin 100μlTE (10 mM Tris-HCland 1 mM EDTA; pH 8.0)and stored at -20 ̊C.DNA concentration was determined by recordingabsorbance at 280 nmin Nanodrop (Nanodrop ND-1000, Thermo Scientific).
-
Protocol
I (Quick genomic DNA isolation)
-
Based on the subsequent use, DNA from C. glabratacells was extracted using three different methodologie
s
-
Yeast genomic DNA isolation
-
C. glabratayeast cells were grown overnight in 5 ml YPD medium at 30 ̊C. An aliquot from the overnight culture was inoculated in 10 ml fresh YPD medium to an initial OD of 0.1. Cells were incubated at 30 ̊C till the cultureOD600was between 0.4 and 0.6. Cells were harvested in a sterile 50 ml centrifuge tube and washed twice with sterile Milli-Q(MQ)water. Washed cells were suspended in 100 μl of 100 mM LiOAc, mixed thoroughly and transferred to a sterile 1.5 ml microcentrifuge tube. A transformation mix containing 240 μlpolyethylene glycol(PEG) (50% (w/v)), 36 μl LiOAc(1 M), 25μl ultrapure single-stranded salmon sperm DNA (2 mg/ml) (Clonetech) was added to 50 μl cell suspension. 50 μltransforming DNA (1μg circular plasmid DNA) was added to the above suspension. Whole mixture was vortexed gently and incubated at 30 ̊C for 45 min. 43 μl DMSO was added to the tubeand incubated at 42 ̊C for 15 min. Cells were collected after centrifugation at 5,000 rpm for 1 min and suspended in minimal medium containing 0.6% Bacto-Casamino acid. Transformation mixture was plated on CAA plates and transformants were selected for uracil prototrophy
-
Yeast transformation usinglithium acetate (LiOAc) strategy
-
5-10 ml saturated bacterial culture harboring the desired plasmid was harvested at 5,000 g for 3 min. Plasmid DNAwas isolated using QIAprep Spin Miniprep Kit (Qiagen, USA) or GenElute™ HP Plasmid Miniprep kit (Sigma-Aldrich, USA) as per manufacturer’s instructions
-
Bacterial plasmid isolation
-
E. coli DH5α ultra-competent cells were transformed with plasmid DNA by heat shock at 42 ̊C for 90 sec as described previously in Molecular Cloning-A Laboratory Manual (Sambrook and Russell,2001). Bacterial transformants were selected on LB agarmediumcontaining appropriate antibiotics. Transformants obtainedwere colony purified on LB plates containing antibiotics.Presence of the desired insertwas first verified by colony PCR followed by PCRusing extracted plasmid DNA as template
-
Bacterial transformation
-
suspension was kept on ice for 10 min and 50 μl volume was aliquoted to chilled sterile microcentrifuge tubes. Cellswere immediately snap-frozen in liquid nitrogen and stored at -80 ̊C
-
A single colony of E.coli DH5-α strain was inoculated in 10ml LB medium and incubated at37 ̊C for overnight. 4 ml of thisovernight culture was inoculated in 2 lt SOB medium and incubated at 18 ̊C till theOD600reaches to 0.5. Cells were harvested by centrifugation at 2,500 g for 10 min at 4 ̊C and washed gently in 80 ml ice-cold Inoue transformation buffer. Cells were collectedby centrifugation at 2,500 g for 10 min at 4 ̊C and gently resuspended in 20 mlice-cold Inoue transformation buffer. To this cell suspension, 1.5 ml sterile DMSO was added and swirled gently. Cell
-
E. coli DH5α ultra-competent cells preparation
-
All experiments in this studywere performed with log-phase cellsunless otherwise mentioned. For obtaining log-phase cells, overnight YNB-or YPD medium-grown yeast cellswerere-inoculated in fresh YNB or YPD medium to an initial OD600of 0.1-0.2.Cells were incubated at 30 ̊C with shaking at 200 rpmtill the OD600reached to 0.4-0.6 OD. After incubation, log-phase cellswere collected bycentrifugation at 4,000 rpm for 3 min,washed once with the same medium and usedforfurtheranalysis
-
Cultivation of logarithmic-phase cell culture
-
C. glabratastrains were grown overnighteither in YPDor YNBliquid mediumat 30 ̊C with shaking at 200 rpm. Cells were harvested and suspended in 1X PBS to a final OD600of 1.0.Five 10-fold serial dilutions of cell suspension wereprepared in PBS and3-4μlwasspotted on YPD/YNBplates containing various test compoundsusing a multi-channel pipette.Plates were incubated at 30 ̊C and growth profileswererecorded after2-4days
-
Serial dilution spot assay
-
Yeast cell viability was measured by plating appropriate dilutions of cell cultureonYPD plates at various time intervalsduringgrowth.Cell suspension was diluted in1X PBS. YPD plates were incubated at 30 ̊C for 2-3 daysand total colony forming units(CFUs)were calculated by counting the number of coloniesthat appeared onYPDplatesand dividing that number by anappropriate dilution factor
-
Yeast cell viability assessment viacolony forming unit (CFU) assay
-
preparedin appropriate solvents, sterilizedby autoclaving or filtrationand stored at appropriate temperature
-
For growth analysisof C. glabratastrains, a single colony from YPD or YNBagar mediumwas inoculated in appropriate liquid medium and incubated at 30 ̊C with shaking at 200 rpmfor 14-16 h. This overnight grown culture was used toinoculatetest medium to an initial OD600of 0.1to 0.3.Optical density/Absorbance of the cell suspensionwas measured using Ultraspec 2100 pro UV/visible spectrophotometer (Amersham Biosciences) at600nmat regular time-intervals up to a period of 96 h.Absorbance values were plotted with respect to time. Generation time of yeast strains wascalculated fromthe logarithmic (log) phase of cellgrowth. Growth profilesbetween 4 (t1)and 8 h(t2)time interval wereconsideredfor calculationof generation time usingfollowing formula. Generationtime(G)= (t2-t1) x {log (2)/ [log (Bf/Bi)]}G= Generation time in ht1=Initial timepoint taken for analysist2 = Final timepoint taken for analysisBf= Number of cells at time t2(calculated on the basis of OD600values, wherein1 OD600of C. glabratacorresponds to 2 X 107cells.)Bi= Number of cells at time t1(calculatedas mentioned above)Severalyeast strains used in this study were analysed for their susceptibility to variouschemical compounds,drugsand metal ions. For this purpose, stock solutions were
-
Growth assayand measurementof generation time
-
mM final concentration) and pH was adjustedto the desired valueby addition of HCl or NaOH. Medium was sterilized by autoclaving.YNBagar plates ofdifferent pHwereprepared by mixing equal volume of separately autoclaved 4% bacto-agar solution and2X varied pH-adjusted-YNB liquidmedium.All routine sterilization of mediumand solutionswas either carried outby autoclaving at 121 ̊C for 15-20 minat highpressure condition(15 psi)or filtration with 0.2 μmpolyvinylidene fluoride(PVDF) membranefilter unit (Millex®-GV, Millipore).Both yeast and bacterial strains were stored as frozen 15% glycerol stock at -80 ̊Cfor extendedlifetime
-
C.glabratastrains were maintainedeither on rich YPDor synthetically-defined YNB medium. C.glabratacells were routinely culturedat 30 ̊Cwith shaking at 200 revolutions per min(rpm)unless otherwise mentioned. Forgrowthexperiments, C. glabratastrains were freshly revived on YPDmediumfrom glycerol stocks.Escherichia coliDH5α bacterial strainwasused for plasmid transformation and propagationpurposes and maintained on LB medium.E.coliBW23473 bacterialstrainwas used to rescue Tn7transposon cassette from C. glabrataTn7insertion mutantsand maintained on LB medium. Bacterial strainsharboring plasmids were maintained on LBagar plates supplemented withappropriate antibiotics.For plasmid isolationpurpose,bacterial strains were grown overnight in liquid LB brothcontainingappropriate antibiotics at 37 ̊C with shaking at 200 rpm. Forpreparation of the solid medium, 2%bacto-agar was added to the mediumand autoclaved. To prepare medium of different pH, YNB mediumwas either buffered with citrateor HEPESbuffer (100
-
Strainsand culture conditions
-
Microbiological techniques
-
10 mM Tris-HCl (pH 8.0)1 mM EDTA Tris-Acetic acid EDTA (TAE) buffer:40 mM Tris base 0.5 M EDTApH was adjusted to 8.5 with glacial acetic acid.This was prepared as a 50 X stock solution and used at a 1 X concentration. Tris-Borate EDTA (TBE) buffer:90 mM Tris-borate 2 mM EDTA (pH 8.0) pH was adjusted to 8.3withHCl.This was prepared as a 10 X stock solution and used at a 1 X concentration.Both TAE and TBE were used asstandard gel electrophoresis buffers.HEPES buffer:This was used to prepare YNB medium of different pH.1M HEPESpH was adjusted to 7.5withNaOH.Bufferwas filter-sterilized and stored in an amber-coloured bottle. Citrate buffer(0.1M, pH 5.5):4.7 volume of 0.1 M Citric acid 15.4 volume of 0.1 M Sodium citrate
-
Phosphate-Buffered Saline (PBS):137 mM NaCl 2.7 mM KCl10 mM Na2HPO42 mM KH2PO4pH was adjusted to 7.3.This was prepared as a 10 X stock solution andused at a 1 X concentration.Tris-HCl buffer:0.5 M TrizmaBase pH was adjusted to7.6 using concentrated HCl.This was prepared as a 10 X stock solution andused at a 1 X concentration.Tris-EDTA (TE)buffer:
-
Common buffers
-
Luria Bertani (LB):0.5% Yeast Extract1% Tryptone 1% NaCl LB-ampicillinand LB-kanamycin plates:LB medium50 μg/ml ampicillin30 μg/ml kanamycinSuper Optimal Broth (SOB): 0.5% Yeast extract2% Peptone 10 mM NaCl2.5 mM KCl10 mM MgCl210 mM MgSO4
-
Bacterial medium
-
All C. glabratastrains and plasmids used in this study are listed in Tables 2.1 and 2.2, respectively.Table 2.1: List of yeast and bacterial strains used in this study
-
Strains and plasmids
Tags
- Md-1-Md-7-d
- Md-1-Md-3
- Mt-4-Mt-1-d
- Mt-1-d
- Md-1-Md-9-d
- Md-1
- Md-1-Md-7
- Md-2-Md-1-Md-2
- Md-2-Md-1-Md-3
- Md-1-Md-8-d
- Md-3-Md-22-Md-1
- Md-3-Md-21-Md-1
- Md-3-Md-21-Md-1-d
- Md-2-Md-1-d
- Md-1-Md-5
- Md-2-Md-1-Md-1
- Md-3-Md-1
- Md-3-Md-18-Md-1-d
- Md-1-Md-9
- Md-3-Md-14-Md-1-d
- Md-3-Md-8-Md-1
- Md-3-Md-22-Md-1-d
- Md-3-Md-8-Md-1-d
- Md-2-Md-1-Md-3-d
- Md-3-Md-14-Md-1
- Md-1-Md-4-d
- Md-1-Md-2
- Md-1-Md-8
- Md-1-Md-2-d
- Md-2-Md-1-Md-1-d
- Md-3-Md-1-d
- Md-1-Md-6
- Md-3-Md-18-Md-1
- Mt-1
- Md-1-Md-6-d
- Md-1-Md-1-d
- Md-2-Md-1-Md-2-d
- Md-1-Md-1
- Md-1-Md-3-d
- Md-2-Md-1
- Mt-4-Mt-1
- Md-1-Md-4
- Md-1-Md-5-d
- Mt-3-Mt-1-d
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.inChapter 220
-
A single colonyof desired C. glabratastrainwas inoculated in YPD-liquid mediumand grown for 14-16 h. 50 μl overnight culture was inoculated inYPD-liquid mediumfor 4 h. Log-phase-grownyeast cells were harvested,washedwith PBSandwereinoculated atinitial OD600of 2 and 4,into YNB-dextrose and YNB-sodium acetate liquid medium,respectively.After 4 hincubation,yeast cells were harvested by centrifugation at 2,500g for 5 minand treated with 1.2 M zymolyasefor 1 hto obtain spheroplasts.Post zymolyase treatment, spheroplasts were resuspended in 100 μl resuspension bufferandanequal amount of 0.25 mm glass beadswasadded to lyse the spheroplasts. Using bead beater apparatus, spheroplasts were lysed and protein concentration in spheroplast lysateswas determined usingbicinchoninic acid assay (BCA) method and samples were stored at -20ºC till further use
-
Preparation of cell lysate
-
Experiments involving mice were conducted at VIMTA Labs Limited, Hyderabad in strict accordance withguidelines of The Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India. The protocol was approved by the Institutional Animal Ethics Committee (IAEC) of the Vimta Labs Ltd. (IAEC protocol approval number: PCD/OS/05). Procedures used in this protocol were designed to minimizeanimalsuffering
-
Ethics statement
-
E. colistrains carrying plasmids were inoculated and grown overnight at 37ºC and 200 rpm in LB-liquid medium supplemented with either 50 μg/ml ampicillinor 30 μg/ml kanamycin. Cells were harvested by centrifugation at 2,500g for 5 min. Plasmids were extracted using Qiagen plasmid miniprep kit following the manufacturer’s instructions. Concentration of the extracted plasmid DNAs was measured using spectrophotometerat 280 nmandstored at -20ºC
-
Plasmid DNA purification
-
Bacterial strainEscherichia coli DH5αused for cloning purposewas revived on LB medium and grown at 37°C withcontinuous shaking at 200 rpm. LB medium was supplemented with appropriate antibiotics to growbacterial strains carrying plasmids. AnotherE. coli strain,BW23473,was used to rescue the Tn7transposon cassette from C. glabrataTn7insertion mutants. For plasmid DNA purification, bacterial strains were grown overnight in LB broth medium containingsuitable antibiotics
-
C. glabratastrains were routinely grown either in rich YPD medium or synthetically-defined YNB medium at 30°C withcontinuous shaking at 200 rpm unless otherwise stated. In general, C. glabratafrozen glycerol stocks wererevivedonYPD medium by streaking and allowed to grow for 1-2 days. C. glabratastrainsharboringthe plasmid with URA3as selectable marker were revived onCAA medium.To prepare liquid cell culture, single colony of eachC. glabratastrainwasinoculated either in YPD or YNB broth mediumand grown for 14-16 h. C. glabratastrains streaked on plates were storedat 4°C fora maximum period of2 weeks
-
Strains and culture conditions
-
To collectmacrophage-internalized yeast cellsfor RNA and protein extraction, 107THP-1 monocytes were seeded in 100 mm cell culture dishes and treated with PMA. PMA-differentiated THP-1 macrophages were infected with appropriateC. glabratastrainsto a MOIof 1:1. Equal numberof C. glabratacells wasinoculated inRPMI medium as control. Two hourspost infection,non-phagocytosed yeast cells were removed by washing THP-1 macrophages thrice with PBS. At different time points, culture dishes were washed twice with chilled PBS and 2 mlchilled sterile water was added toeach dish to lyse the macrophages. Corresponding cultures grown in RPMI medium were transferred to50 ml polypropylene tubesand transferred on ice. Lysates were collected by scrapping the macrophage monolayer and transferred to50 ml polypropylene tubes.RPMI-grown and macrophage-internalized C. glabratacells were harvested by centrifugation at 2,500g for 8 min. Macrophage cell debris were removed frommacrophage-internalized cells by repeated washing with chilled sterile water. Harvested C. glabratacells were stored at -20ºC till further use
-
Harvesting of macrophage-internalized C. glabratacellsfor RNA and protein extraction
-
undertissueculture conditionsfor 45-60min andfixed in 3.7% formaldehydeas described earlier.For DAPI staining, Vectashield mounting medium containing DAPI was used and slides were visualized under confocal microscope.For heat killing, yeast cells were harvested from 1 ml culture, washed, resuspended inPBS andwere incubated at 95°C for 5 min
-
PMA-treated THP-1 macrophages were infected with C. glabratacells to a MOIof 1:1 in four-chambered slides and incubated at 37°C and 5%CO2. After 1 hcoincubation, each chamber was washed thrice with PBS to eliminate extracellular yeast cellsand medium was replaced with fresh prewarmed RPMI medium containing100 nM Lysotracker Red DND-99.Infected THP-1 macrophageswere incubated
-
Lysotracker staining
-
For confocal microscopyanalysis, 5X105THP-1 cells were seeded and treatedwithPMA in 4-chambered slides. Differentiated THP-1 macrophageswere infected either with FITC-labeled or GFP-expressingC.glabratastrains to a MOIof 1:1. At different time intervals, medium was aspirated out from each chamber of 4-chambered slides and chamberes were washed twice with PBS. To fixthe infected macrophages,500 μlformaldehyde(3.7%) was added gently toeach chamber andincubated for 15 minat room temperature. Each chamber of the slide was washed twice withPBS to remove formaldehyde solution completely. To permeabilize the fixed cells, 500 μl Triton-X (0.7%) was dispensed toeach chamber and slide wasincubated at room temperature for 5 min. Chambers of the slide werewashed twice with PBS, separated from the slideusing a chamber removal device andwere air dried. Coverslips were placed onslides using Vectashield mounting mediumand bordersweresealed withnail paint. Slides werestored at 4°C until used forfluorescence imaging
-
Fixing of PMA-treated THP-1 macrophages
-
THP-1 cells were seeded ina 24-well tissue culture plate to a celldensity of 1 million cells per well,treated with PMA and were infected with yeast cells to a MOIof 10:1. Two hours post infection, cells were washed thrice with PBS and medium was replacedwith fresh prewarmed RPMI medium.Plates wereincubatedat 37ºCfor 24 h. Supernatants were collected,centrifuged at 3,000 rpm for 5 minto get rid of particulate matter,if any, andwerestored at -20°C until use. Estimation of different cytokines wasperformed using BD OptEA ELISA kits as per the supplier’s instructions
-
Cytokines measurement
-
Forinfection of THP-1 cells with single C. glabratastrain, PMA-treatedTHP-1 monocytes were seeded in 24 wellcell culture plate toa seeding density of 1 million cells per well. To prepare C. glabratacells for macrophage infection, single colony of the desiredstrain wasinoculated in YPD medium and allowed to grow for 14-16 hat 30°C. C. glabratacellsfrom 1ml overnight culture were harvested, washed with PBS andcell density was adjustedto 2X107cells/ml.50 μl of thisC. glabratacell suspension wasinfectedto macrophages to a MOIof 10:1. Two hours post infection, infected THP-1 macrophages were washed thrice with PBS to removenon-phagocytosed yeast cells and medium was replacedwith fresh prewarmed medium. Atdifferent time points post infection,infected THP-1 macrophages were washed with PBS three timesandlysed in 1 mlsterilewater. Lysates were collected by scrapping the wells with a micropipette tip, diluted in PBS and appropriatelysatedilutions were platedon YPD agar medium. Plates wereincubated at 30°C and colony forming units (CFU) were counted after 1-2 days. Final CFUs per ml were determined by
-
multiplying CFUs with dilution factor and fold-replication was determined by dividing the CFUs obtained at 24 h time-point by 2 h CFUs
-