On 2017 Mar 07, Atanas G. Atanasov commented:
Nicely summarized information, which is of interest both for researchers and for consumers. I have highlighted this review at: http://healthandscienceportal.blogspot.com/2017/03/functional-components-and-medicinal.html
On 2015 Aug 31, Respirology and Sleep Journal Club commented:
This article was reviewed by the University of Toronto, Division of Respirology journal club as well as online using twitter. The author and others worldwide joined in for the discussion.
On 2015 Sep 20, Eythor Kristjansson commented:
The paper (Meisingset et al. BMC Musculoskeletal Disorders (2015) 16:56 DOI 10.1186/s12891-015-0517-2) reports the findings of a cross-sectional study, which examined set of tests to investigate cervical motor control. One of the tests that were used was the Fly Test©, which Meisingset et al cited “as described by Kristjansson et al., 2010” [1]. When I read the abovementioned article by Meisingset et al., [1] I found out that their article does not replicate the study by Kristjansson & Oddsdottir 2010, at all [2]. There are two main crucial differences in Meisingset et al. study and the original study by Kristjansson & Oddsdottir, 2010 [2], which make these 2 studies incomparable. First, there are several inbuilt parameters in the patterns in the original Fly Test©, and it is impossible for Meisingset et al., to know what inbuilt parameters were used and how we used these parameters. Meisingset et al. just copied the geometry of 2 patterns without permission from the publisher. Second, Meisingset et al. methodology is completely different from ours. Research results using different inbuilt variables within the patterns and completely different methodology can never be comparable. It is therefore not surprising that Meisingset et al. study found no difference in the performances between controls and neck pain group, besides that the controls performed worse in one sequence of what Meisingset et al., misleadingly call “the Fly Test”. Following are the main differences in methodology of the 2 studies: 1. Set-up: Our original study used a seated position, 1m from the screen whereas Meisingset et al. used standing position, 2.5m from the screen. It can be easily proven mathematically that different angles are produced on the screen depending on the patients distance from the screen. This alone will generate different results as longer distance (2.5 m) will produce narrower angle on the screen i.e. lesser ROM than a distance of 1m, as we used in our original paper. 2. Number of patterns and repetitions: Our original study used three patterns, easy-medium-difficult of uniform size and three repetitions for each pattern in random order, altogether 9 trials. Meisingset et al. used two patterns, easy and medium with 2 trajectory sizes; on smaller and one bigger. Furthermore, the control group in Meisingset et al study just performed the patterns once, while the neck pain group performed the patterns twice, not in random order. 3. Duration of patterns: Our original study used 25, 40, and 50 seconds for the easy-medium-difficult patterns, respectively whereas Meisingset et al. used 30 seconds for both patterns; easy and medium. Here, Meisingset et al. wrongly cited our original paper; see Table 1 in their study [1]. The velocity in Meisingset et al. study for the medium pattern must therefore be faster than in the easy pattern as longer distance is traveled in the medium pattern. I have one more serious concern about Mesingset et al. conclusion regarding what they misleadingly call “the Fly Test” in their study: In the Discussion section, Meisingset et al. cited Oddsdottir et al. 2013, regarding gender difference. Meisingset et al. write on p. 11 under the heading Trajectory movement control: “In the HC group (Healthy Control) we found that females had a consistently larger deviation in the Fly test compared to men in the HC group suggesting that the group differences in Kristjansson & Oddsdottir study, 2010 may be influenced by the different gender distribution in the groups”. Meisingset et al. continue: “However, Oddsdottir et al. found similar results between healthy females and men for the same Fly test [3]”. “This discrepancy between the studies requires further investigation before this test can be implemented in clinical practice.” Meisingset et al. are making reference to our database study [3]. The result section on p. 3 in our database study starts on the following statement: “The multivariate analysis of variance indicated a statistically significant effect for age (p < 0.001), but not for gender (p > 0.05). Therefore normative data were only distributed according to age”. It is impossible for us to understand how Meisingset et al. can cite our work in such a wrong way. References [1] Meisingset I, Woodhouse A, Stensdottir A-K, Stavdahl Ö, Lorås H, Gismervik S, Andersen H, Austreim K, Vasseljen O, Evidence for a general stiffening motor control pattern in neck pain: a cross sectional study. BMC Musculoskeletal Disorders (2015) 16:56 DOI 10.1186/s12891-015-0517-2 [2] Kristjansson E, Oddsdottir G."The Fly" - A new clinical assessment and treatment method for deficits of movement control in the cervical spine: reliability and validity. Spine 2010; 35: E1298–E1305 [3] Oddsdottir G, Kristjansson E, Gislason M. Database of movement control of the cervical spine: Reference normal of 182 asymptomatic people. Manual Therapy 2013; 18: 206–210.
Competing interests: EK is the founder of NeckCare Ltd, a start-up innovation company developing the Fly Method©, and other innovative methods, for diagnostic and treatment purposes. The tasks created in the new Fly Method© are protected by patent rights.
Meisingset I, 2015 http://www.nih.gov NIH Home
On 2016 Jan 12, Elaine Beller commented:
This is a topic that has been debated on my Facebook feed recently. This group has performed a RCT, but reports within-group changes throughout, and not the between-group results. Some of the within-group results have P-values less than 0.05, and these are the ones that been reported in the abstract. This approach implies that there were no changes in the control group, and that both groups had similar baseline values (which is not so). I suggest the authors should give the results for the comparison between groups on final value, adjusted for baseline (ANCOVA).
Bland and Altman have written several excellent artcles explaining why the within-groups approach should not be used. In one which is open-access, they say: "This approach is biased and invalid, producing conclusions which are, potentially, highly misleading. The actual alpha level of this procedure can be as high as 0.50 for two groups...",
Comparisons against baseline within randomised groups are often used and can be highly misleading. Trials 2011, 12:264 doi:10.1186/1745-6215-12-264
On 2016 Dec 15, Morten Oksvold commented:
This article has been retracted due to several problematic issues with data duplications.
This case represents an excellent example for how an editorial and review process should NOT be performed:
Please see the full discussion at PubPeer:
https://pubpeer.com/publications/B74CF2D21C4A180A5685A30DC06D29#fb113276
On 2015 Sep 04, Bill Cayley commented:
A good example of when LESS may be MORE for treating radiculopathy: https://lessismoreebm.wordpress.com/?s=radicular
On 2015 Jul 17, Christopher Southan commented:
The authors should please make the specific molecular structures for the inhibitors in table 2 available (SMILES, InChI or PubMed CIDs). A figshare sheet would be an option.
On 2016 May 27, ALAN HOWE commented:
There appears to have been an 'autocorrect'-style error with this citation & paper, as 'c-MET' (aka the hepatocyte growth factor receptor) was erroneously changed into 'c-mesenchymal-epithelial transition' in several places.
On 2016 Mar 23, Laila Poisson commented:
Egon, you are correct, we used the Human Metabolome Database (HMDB) number to map identified metabolites into pathways. Thank you for pointing out this typo.
On 2015 Dec 25, Egon Willighagen commented:
Can the authors confirm that they used the Human Metabolome Database, or provide a website or reference for the "Human Metabolon Database" cited in the paper, please?
On 2015 Jun 26, Torsten Seemann commented:
The latest version of this software is available as a Github repository at https://github.com/aakrosh/indelMINER
On 2016 Mar 03, Farrel Buchinsky commented:
An interesting article about 21 children noting that there was a correlation between the number of surgeries and the preceding delay between symptoms developing and a diagnosis being made. This finding would be compatible with the possibility that the longer one delays the more a child is likely to need more surgeries. If that is true then that should encourage us to make the diagnosis as soon as possible so that we can operate as soon as possible and so that the child could undergo fewer surgeries rather than more surgeries. Given that this was not a randomized trial would the data also be compatible with another possibility? Could it be that children with the least delay may have gone into spontaneous remission had their delay continued and they had undergone no surgery?
Two other observations struck me when I looked at the data. There was a statistically significant association between the age of symptom onset and the time between symptom onset and diagnosis. Children whose symptoms began before they were 5.5 y (66 months) had a median delay of 33 months and the children who were older than 5.5 y when their symptoms began had a median delay of 3.5 months. Many case series have demonstrated an association between younger age being associated with a more aggressive clinical course presumably resulting in greater number of surgeries. That was not seen in this group of 21 patients.
Can you please check the statement, "The average time from symptom onset to diagnosis was 52.3 months". I calculate it to be 20.3 months. I used the following values: 1 3 24 7 33 36 48 3 4 4 54 7 21 26 38 3 43 59 1 1 10
On 2015 Jun 18, Elsamma Chacko commented:
This talks about how very intense exercise can increase glucose levels. Light to moderate exercise is better for lowering glucose peaks.
On 2015 May 31, Amanda Capes-Davis commented:
Delighted to see that the STR profiles produced in this study are now available through the NCBI BioSample database (http://www.ncbi.nlm.nih.gov/biosample/). BioSample users can browse human cell line STR profiles and also look for known misidentified cell lines. At the time of writing there are 2992 STR profiles entered into BioSample, meaning that a wide variety of cell lines now have STR profile information available.
Many thanks to NCBI staff for their work in providing this resource!
On 2015 Jun 22, Khaled Saad commented:
I want to know any feedback about the dose of vitamin D in autism spectrum disorders. We used 300 IU/kg with maximum 5000 IU/day.
On 2015 Jun 26, James Tsung commented:
Link to video: https://www.youtube.com/playlist?list=PLHg2xyua_KjsrTUVjr7HqW5LBEO5hal2M
On 2015 Apr 23, Christopher Southan commented:
This is a valuable commentary but overlooks the importance of, as an adjunct to improved general transparency, also openly declaring the molecular structures of new therapeutic agents used in these trials. This aspect is detailed in "Challenges and recommendations for obtaining chemical structures of industry-provided repurposing candidates" http://www.ncbi.nlm.nih.gov/pubmed/23159359
On 2015 Apr 16, Ivan Oransky commented:
This is the fifth retraction by last author Frank Sauer: http://retractionwatch.com/2015/04/16/nature-retracts-epigenetics-paper-by-author-who-lost-two-science-papers-last-year/
On 2015 Jun 15, Arthur Yin Fan commented:
The protocol does not say why they use 450 patients and the calculation method.
On 2015 Jun 15, Arthur Yin Fan commented:
This sham is still not a real sham, because it is a real acupuncture-only shallow inserting with lowest dose, and "wrong" point (but how can you say this is really wrong? only an uncommon-used point) . So, it would induce the bio-reaction beyound the body's original healing status.
On 2016 Aug 30, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0984021. We believe the correct ID, which we found in the text in an embedded link, is NCT01984021.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 Apr 21, Andrew Brown commented:
This letter refers to issues we raised with respect to Sichieri R, 2014. The authors' response is here: Sichieri R, 2015; and the journal editor's comments here: Hauner H, 2015.
On 2015 May 07, Ryan Radecki commented:
Over 200,000 physicians belong to the American Medical Association. The Journal, therefore, of this Association has a significant audience and a long tradition. Continuing Medical Education inserts in JAMA may represent the basic education of many new developments for general practitioners.
These authors perform a systematic review on “acute stroke intervention”. They identify and review 145 abstracts utilizing multiple combinations of MeSH terms and synonyms for “brain ischemia/drug therapy, stroke drug/therapy, tissue plasminogen activator, fibrinolytic agents, endovascular procedures, thrombectomy, time factors, emergency service, treatment outcome, multicenter study, and randomized controlled trial”. A massive undertaking, to be sure – considering these authors are also including intra-arterial and mechanical therapy in their review.
Yet, as indicated in their evidence review chart in the supplement, these authors' strategy managed to identify only 17 RCTs – in the whole of systemic and endovascular therapy....
http://www.emlitofnote.com/2015/04/a-laughable-tpa-systematic-review.html
On 2015 Apr 29, L. Miguel Martins commented:
Interesting but puzzling. Schneeberger and colleagues (PubMed ID 24074867) also perform quantitative analysis of mito-ER contacts in vivo, in neurons, and reach the opposite conclusion: Loss of Mfn2 decreases mito-ER contacts (see Fig.6G). What is the explanation for this discrepancy?
On 2015 Jul 08, Radboudumc Psycho-Oncology Journal Club commented:
This is a very interesting and clearly reported study that identifies which patients are more or less likely to participate in mindfulness-based stress reduction (MBSR), and the relationship between presence of and search for meaning and willingness to participate in MBSR. After discussing this paper in during our journal club meeting, the following points were raised:
On 2017 May 20, Jonathan Lalsiamthara commented:
Dear Jean-Jacques Letesson,
Thank you for your concerns on this manuscript. We could have replied to you sooner if the queries were forwarded to the given corresponding author and also updates regarding this topic could have been promptly relayed to you.
1 Our interest was to generate O-PS shortened S19 strain. Interestingly, this particular strain (IVRIGEBJ7) which has putative perosamine synthetase gene knocked-out has shown truncated O-PS profile. We also reported that it is rough intermediate (by comparing it with smooth and complete-rough strains) and proved that it is on the surface rather than inside cytoplasm. While we could have communicated with the strain name IVRIGEBJ7, to make it more meaningful we go by the target gene name 'per'. It can still be useful to report a potential vaccine candidate without knowing the actual genetic makeup, because historically S19 and RB51 have many unknown mutations when they were reported. Nevertheless, the whole-genome sequence (http://genomea.asm.org/content/3/6/e01336-15.full.pdf) of the mutant strain is now available on GenBank and complementation eventually confirmed the veracity of the mutation.
2 Indeed there are two enzymes encoding perosamine synthetase. This manuscript reported knock-out of a putative one (which some workers may annotate it as wbkB). This might explain your concerns regarding “so called "per" mutant”, only that the enzymes are not exclusive to S19, but both are present across Brucella spp.
3 It was discussed that similar “OPS profiles” i.e truncated OPS in PAGE- silver or -western blots were also observed in two given studies, delta pgm and RB51. The discussion did not claim anything about their phenotypes but related to their OPS properties. The typographical error should be “.. RB51 strain with wboA gene complemented”.
On 2017 Mar 23, Jean-Jacques Letesson commented:
The basic scientific requirement to characterize a mutant is to prove that the phenotype characterized can be reverted to the WT phenotype by bringing in trans the WT gene.
This has not be done in this study as no complementation was even evoked. Therefore the phenotype observed cannot be claimed as caused by the "per" deletion.
There are in addition several fact in this paper that were either omitted, overinterpreted or even mistaken.
1- Concerning the roughness of the so called "per" mutant
-the O-PS of Brucella is an homopolymer of N-formylperosamine (meaning that the sole an unique sugar used to build the O-chain is this one) and that N-formylperosamine is the biosynthetic result of three sequential reactions catalyzed by enzymes (Gmd, per, Wbkc) encoded by three unique genes.
-without "per" it is impossible to build a "bona fide" perosamine and thus an O-PS chain. In none of the Brucella species in which the "per" mutation has been tested, has a partial/shortened or whatsoever modified O-chain been described.
-Considering that the S19 per mutant described in this paper is "mid-smooth" will thus need another gene encoding the "same" enzymatic activity that would only exist or be expressed in B. abortus S19 and not in any other Brucella species.
-the epitopic composition of the O-PS should have been explored with a panel of MoAbs specific for Brucella O-PS and not with an uncharacterized polyclonal antibody that give a VERY POOR immunoreactivity on the O-PS of the WT S19
2- To explain the (mid-smooth phenotype) and the truncated O-PS observed in the S19 per mutant, the authors evoke, in the discussion, that a similar observation was made for delta pgm of B. abortus S2308 and also for the B. abortus RB51 strain with wboA gene deletion mutation. THIS CLAIM IS ABSOLUTELY FALSE
-the pgm mutant is completely ROUGH (but has an O-chain in the cytoplasm and is unable to link it to the core)
-the wboA is completely ROUGH and in the reference they cite the strain is a complemented one that is still ROUGH but produce an O-chain in the cytoplasm. (Vemulapalli R, He Y, Buccolo LS, Boyle SM, Sriranganathan N, Schurig GG. Com-plementation of Brucella abortus RB51 with a Functional wboA Gene Results inO-Antigen Synthesis and Enhanced Vaccine Efficacy but No Change in RoughPhenotype and Attenuation. Infect Immun 2000;68:3927–32.)
On 2015 May 31, Amanda Capes-Davis commented:
Please be aware that the KB cell line and any derivatives do NOT come from oral carcinoma. KB is known to be misidentified and is actually HeLa, from cervical carcinoma. It is important to test for misidentified cell lines; this can be done using authentication testing. Short tandem repeat (STR) profiling is a consensus test method that allows you to check for misidentification of human cell lines.
KB is widely used in the scientific literature as an oral cancer cell line. It would be impossible to manually add comments to all abstracts that use the cell line as an oral cancer model. Journals such as Nature now require authors to check against published lists of known misidentified cell lines, and report on authentication testing. This approach will help to address the problem.
The International Cell Line Authentication Committee (ICLAC) maintains a list of known misidentified cell lines at http://iclac.org/databases/cross-contaminations/.
On 2015 Apr 20, TIM MCCAFFREY commented:
The title refers to TGF-B, but the abstract refers to TNF-B. I assume they are talking about the lymphotoxin alpha (LTA) SNP which is also known as TNF-B.
On 2015 Apr 15, Gerard Ridgway commented:
There is a helpful AlzForum news item on this article.
On 2015 Apr 24, Pertti Hakkinen commented:
Readers may also want to look at (but it is not in indexed in PubMed): Curry, K. K., D. J. Brookman, G. K. Whitmyre, J. H. Driver, R. J. Hackman, P. J. Hakkinen, and M. E. Ginevan. (1994) "Personal Exposures to Toluene During Use of Nail Lacquers in Residences -- Results of a Preliminary Study." JOURNAL OF EXPOSURE ANALYSIS AND ENVIRONMENTAL EPIDEMIOLOGY 4: 443-456.
On 2015 Nov 12, RUBEN ABAGYAN commented:
Additional disclosure. One of the authors, R.A., has an equity interest in Molsoft, LLC. The terms of this arrangement have been reviewed and approved by the University of California, San Diego in accordance with its conflict of interest policies.
On 2015 Apr 22, Martine Crasnier-Mednansky commented:
A diauxie was observed for the pair glucose-succinate (Lazzarini RA, 1971) therefore glucose and succinate most likely are not used simultaneously. Thus in keeping with the questionable reasoning by the authors, the growth rate on the glucose-succinate pair (Table 1) should not be higher than the growth rate on either glucose or succinate.
The physiological relevance of the preceding article by You C, 2013, on which this report is based, was commented on in PubMed Commons.
On 2015 Apr 30, Nursing Innovation Journal Club commented:
My junior honors class reviewed this paper as one the assignments. I thought I would engage the authors in a couple of questions raised during our discussions of your paper. 1- This is important work, particularly as there are many patient safety issues identified during the transition from hospital-to-home. Have the authors considered financial outcomes associated with interprofessional collaborative practice? What types of financial outcome variables would you like to see in future research? 2-The AHA recently posted new guidelines for treating patients with heart failure in long-term care facilities. paper 1-http://circheartfailure.ahajournals.org/content/8/2/384.short?rss=1&ssource=mfr paper 2-http://circheartfailure.ahajournals.org/content/early/2015/04/07/HHF.0000000000000005 How can your work in this paper be expanded to include outside organizations like long-term care, home health, etc.?
On 2016 Aug 10, Sander Houten commented:
In our paper, we described the molecular basis of alpha-aminoadipic and alpha-ketoadipic aciduria by sequencing DHTKD1 in 10 cases. Case 6 was compound heterozygous for c.1364G>A and c.1159+5G>A. The c.1159+5G>A mutation is likely to affect splicing because it changes a conserved position in the splice donor site of intron 6. In follow up studies, we have now addressed the consequences of the c.1159+5G>A mutation on splicing. For this, we generated cDNA from peripheral blood mononuclear cells and characterized the DHTKD1 transcripts. Our results revealed two different DHTKD1 transcripts in this individual. One transcript had the c.1364G>A mutation and a second transcript lacked exon 6. From this we conclude that as predicted, the c.1159+5G>A mutation leads to skipping of exon 6.
On 2015 Oct 12, Simon Young commented:
There are a number of problems in this paper in the interpretation of the results, and in the discussion of the previous research on which this study was based. 1. The paper does not mention that tryptophan is taken up into brain by a transport system that is active towards all the large neutral amino acids (LNAA). The other LNAA compete with tryptophan for uptake into brain. When protein is ingested the plasma level of tryptophan increase, but so do plasma levels of the other LNAA. As a result, ingesting normal dietary proteins, or increasing the protein content of the diet, will not raise brain tryptophan or serotonin synthesis, as discussed in many reviews, e.g. Fernstrom JD, 1994. This has been confirmed in a human study involving CSF measures as an approximation of what happens in the brain Teff KL, 1989. While the paper by Lindseth at al does not describe the diets used, it mentions “A variety of foods containing tryptophan were served, including mozzarella cheese, soy products, pumpkin seeds, and egg whites.” This implies that the variation of the tryptophan content of the two diets was manipulated by altering the protein levels in the diet. Therefore the high tryptophan diet would not have raised brain tryptophan and serotonin synthesis relative to the low tryptophan diet. 2. The authors did not consider what factors other than tryptophan might be responsible for the effects on mood that they report. Given that the low tryptophan diet provided <5 mg/kg body weight/d and the high tryptophan diet provided >10 mg/kg body weight/d presumably the protein content of the diet for the high tryptophan group was at least double that for the low tryptophan group. There is some evidence that protein has a greater satiating effect than the other macronutrients Pesta DH, 2014, so it is possible that the participants were more hungry on the low protein diet causing a lowering of mood. This could explain the better mood during the hight tryptophan diet phase. The researchers make no mention of measuring the hunger of the participants or possible preferences for the different diets. Furthermore, various amino acids are converted to psychoactive compounds including phenylalanine and tyrosine (catecholamines), methionine (S-adenosylmethionine), histidine (histamine) and leucine (glutamate), but the authors considered only the effect of tryptophan. 3. The section of the paper on Implications for Practice mentions that “the benefits of a diet for patients susceptible to affective disorders seem important since tryptophan-dense diets also improved mood and decreased symptoms of depression among depressed individuals in other studies (Badrasawi et al., 2013; Markus et al., 2008; Neumeister et al., 1998)”. The Badrasawi et al study Badrasawi MM, 2013 looked at the effect of a dietary supplement on mood. A comment on that article in PubMed (accessed by the previous link) explains why any effect on mood could not have been due to tryptophan. The Markus et al study Markus CR, 2008 looked at the acute effects of a high tryptophan hydrolyzed protein supplement on mood, and is therefore not relevant to how alterations in habitual food intake might alter mood. The Neumeister et al study Neumeister A, 1998 looked at the effect of acute tryptophan depletion (ATD) on mood in recovered depressed patients. Information on the ATD technique as used by Neumeister et al is available Young SN, 2013. In the control condition participants are given an amino acid mixture that is similar to the amino acid content of human milk, a source that is presumably optimum for human consumption. Because there are more LNAAs in this mixture than tryptophan, it will lower brain tryptophan slightly, but presumably within, or close to, the normal physiological range. The active treatment is the same as the control mixture except that tryptophan is omitted. The mixture induces protein synthesis and as tryptophan is incorporated into protein its level in blood and tissues falls dramatically, e.g. 80% or more decrease. This lowers brain tryptophan and serotonin synthesis greatly. In the Neumeister et al study ATD lowered mood relative to the control condition. However, the relevance of a lowering of mood caused by a large and unphysiological decrease in tryptophan, relative to control treatment that caused a small and probably physiologically relevant decline of tryptophan is not relevant to the possible effects of “tryptophan-dense diets”. Tryptophan in purified form is an antidepressant Shaw K, 2002 and under some circumstances tryptophan in purified form can improve mood in healthy people Young SN, 2013, Young SN, 2002. Markus et al Markus CR, 2008 and others have shown similar effects using proteins that contain unusually high amounts of tryptophan but are present in very small amounts in the diet, such as alpha-lactalbumin. However, as discussed above real foods will not raise brain tryptophan and serotonin even if the intake of tryptophan is elevated. Thus, the rationale for the study is not sound.
On 2015 Apr 27, Torgil Vangberg commented:
We are working on making the script compatible with SPM12, and it will certainly be of interest to see if T1- and T2-weighted inputs will offer any further improvement in accuracy. Actually we did not expect much improvement using multi-spectral inputs since the T2 scans had 4 mm slices, but still it improved the agreement with manual tracing. The algorithm has also been tested with good results on a separate datasets that had 1mm isotropic T1- and T2-weighted images.
On 2015 Apr 15, Gerard Ridgway commented:
It's interesting to see that multi-spectral data improves agreement with manual tracings (even though the tracing used only T1-weighted images). I think this is complementary to our work showing improvements in SPM12 over older versions (Malone IB, 2015), since SPM12 can also handle multi-spectral data. For example, considering the standard deviation of the differences with respect to manual, this paper's best (lowest) single-modality result is 41.64 mL for a method based on SPM8's New Segment toolbox. We obtained a value of 35.4 mL with SPM12. With T1- and T2-weighted data, this new paper obtains an impressively low 26.7 mL, also with lower mean difference (bias) than we found. It would be interesting to know whether SPM12 can further improve results using T1-weighted and T2-weighted data.
On 2015 Jul 13, CREBP Journal Club commented:
This article offers an example of a high quality cohort study. Our discussion centred on grading the risk of bias of this study. We agreed that the risk of bias for this study was low; thus, the results can be considered valid. The findings also corroborate those reported in previous similar cohort studies.<sup>1</sup> This study provides an example of how to appropriately conduct a cohort study and we plan to use it as an example for teaching. The study findings could be used to inform the content of motivational messages to encourage smoking cessation. We noted that most of the participants started smoking in adolescence or early adulthood and we believed these age groups could be an ideal target for smoking cessation interventions.
1.Doll R et al. Mortality in relation to smoking: 50 years’ observations on male British doctors. Br Med J. 2004; 328: 1519–28.
On 2016 Mar 07, Joe Newton commented:
The axon connections (in space-time) limit the range of interactions between different regions. Also, the action potential conduction velocities, (in a space-time frame) are expected the major determinants of where-when they are summed i.e. integrated at downstream neurons. Conduction velocity has been hypothesized (Med Hypotheses. 1999 Jan;52(1):77-83) and the first postulate is being confirmed by large consortium studies for normal and multiple diagnostic anomalies. Example (Mol Psychiatry. 2016 Feb 9. Subcortical volumetric abnormalities in bipolar disorder. Hibar DP et. al.) The results are unusually interesting and support the 1999 space-time event network. Feedback, i.e. "reciprocal" connections, are, for simplicity, not illustrated in the 1999 hypothesis . Action potential events are physically expected to heavily influence the coordination of the simultaneous dynamic control system network events.
Critique is important to us.
Congratulations, Joe Ray Newton
On 2015 Dec 11, Mark Johnston commented:
Interactive protocols from this article are freely available at protocols.io.
On 2016 Nov 07, Anne Niknejad commented:
'survinin' for 'survivin' BCR5
On 2017 Jul 14, Randi Pechacek commented:
Stephen Nayfach, first author of this paper, wrote a blog post on microBEnet providing some background.
On 2015 Jun 03, thomas samaras commented:
A number of studies have shown shorter people have lower blood pressure, TG, insulin, and higher HDL. All these are related to lighter weight in addition to shorter height. In addition,lower mTOR and higher adiponectin are related to smaller body size and lower CHD/CVD. Thus, many biological parameters appear to favor shorter, lighter body builds in terms of lower risk for coronary artery disease.
See entry by Samaras below for an explanation of why shorter people do not have a genetic tendency toward CHD but actually are inherently protected from CHD. When compared to tall people of the same body proportions, the biological advantages of shorter, lighter bodies include lower blood pressure, lower BMI, lower left ventricular mass, longer telomeres due to lower attrition, higher sex hormone binding globulin, greater heart pumping efficiency,lower pulse wave velocity, lower DNA damage, and lower work load.
Several references that expand on the relation of smaller body size to lower CHD and greater longevity are given in my comment below.
On 2015 Apr 14, thomas samaras commented:
I have studied the relationship between height, chronic diseases, and longevity for almost 40 years. One of my papers appeared in the Indian Heart Journal (2013) that summarized worldwide findings showing shorter people have inherently lower heart disease. In 2014, I had a paper published in the Journal of Scientific Research & Reports that summarized key findings showing shorter people live longer. If tall people had inherently better hearts, then why do today's taller Americans have more coronary heart disease (CHD) compared to the early 1900s when we were a few inches shorter? Also women are shorter than men and have less CHD.
Studies from the 20th C found that many populations were free of CHD and stroke. Yet, these people ranged from less than 5 feet to about 5 feet, 4 inches. These populations included Solomon Islands, Papua New Guinea, Kalahari Bushmen and the Congo pygmies. I know of no modern population that is free of CHD.(Major food changes and increased height have occurred over the last few decades).
In 2007, The World Cancer Research Fund reported that until recently, CHD was rare. However, in parallel with industrial development, we have seen increases in height, weight and chronic disease (which includes CHD).
Of course, both tall and short people can reach advanced ages without CHD. Many other factors are involved, such as genetics, diet, exercise, smoking, weight in relation to height, income level, etc. I found that height represents about 10% of the total longevity picture.
Unfortunately, when it comes to human health and mortality, conflicting studies abound. However, confidence in a study's findings should be based on support from different types of studies (e.g., ecological, longitudinal, cross-sectional) that provide consistent results and include populations from different parts of the world and different ethnic groups.
I have reported scores of examples showing that non-Western shorter people have less CHD than taller Westerners. See www.humanbodysize.com for a listing of over 45 papers, book chapters and books expanding on what is discussed here. Some papers and a book related to height and CHD are listed below.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance,Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
Bartke A. Healthy Aging: Is smaller better?-A mini-review. Gerontology 2012; 58: 337-43.
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT01362107. We believe the correct ID, which we have found by hand searching, is NCT01368107.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 May 02, David Keller commented:
A question of publishing ethics: how much financial conflict of interest is too much?
Authors are required to include a list of their financial conflicts of interest at the end of each publication in most medical journals today. The monetary value of such conflicts can range from minor (such as accepting a free meal valued at $100 from a pharmaceutical sales representative) to major investments or income streams. Obviously, the latter case is of greater concern to the reader than the former, yet no information is currently provided with each publication to quantify financial conflicts. The readers, therefore, cannot distinguish between trivial conflicts versus enormous life-altering ones.
I request Dr. Caplan to provide his views on the following question: should authors be required to declare the dollar amount of each financial conflict of interest at the end of each publication, in order to help readers distinguish between trivial and major conflicts? I invite him to exercise his ethical judgement on the conflicts of interest I discussed in my comments on an article published last month, at the following link:
http://www.ncbi.nlm.nih.gov/pubmed/25636998#cm25636998_10015
with reference to the $82,000 conflict of one author. How much credibility is lost by a paper affected by a conflict of this amount?
On 2015 Apr 09, Mike Mather commented:
Correct title is: Genetic Investigation of Tricarboxylic Acid Metabolism during the Plasmodium falciparum Life Cycle. Publisher has corrected the title on their website.
On 2015 Apr 13, Joe Newton commented:
Major depression diagnosis in the absence of preexisting biomarkers is uncertain and a dilemma of psychiatry. However, measurable biomarkers of intracranial volumes are suggested by the large genetic and imaging consortium studies. (Stein JL, et al. 2012 Nat Genet. Apr 15;44(5):552-61). Nevertheless your paper is unusually interesting in suggesting ECT induced hippocampal volumes.<br> I have wondered for decades about how ECT improves nervous system coordination in a broad spectrum of abnormal behavioral responses.<br> Best wishes, Joe Ray Newton
On 2015 Apr 29, Andrew Brown commented:
This letter discusses our concerns with Kiecolt-Glaser JK, 2015.
On 2017 Jul 13, Randi Pechacek commented:
Elisabeth Bik mentions and describes this paper on microBEnet while comparing soil microbes to cockroaches in their resilience after extreme radiation exposure.
On 2015 Apr 17, Alexis Maizel commented:
Great article. Nicely confirms the results of Martinez et al. showing that decapping prevents the entry of endogenous mRNAs to the PTGS pathway and therefore the production of rogue siRNAs (http://nar.oxfordjournals.org/content/43/5/2902.long).
On 2016 Jun 16, thomas samaras commented:
Low BMI may be a reflection of lower socioeconomic status, smoking, or poor nutrition in the developed world. However, low BMI is not a problem according to a recent study by Aune et al. (2016) that found the best BMI was 20-22 for long-term mortality of life long non-smokers. This study involved a review of 230 studies, 30 million participants, and almost 4 million deaths. In addition, many pre-western people have BMIs of 19-22 and have virtually no CHD or stroke. Examples include 20th C populations in the Solomon Islands, Papua New Guinea and Kitava. In addition, the Kalahari bushmen and Congo pymies had no CHD or stroke around the middle of the 20th C. All these people were short and had low BMIs by today's standards. When these people adopt a Western diet, their BMIs and heights increase along with CHD and other chronic diseases.
On 2015 Jun 12, thomas samaras commented:
If we look at non-Western populations, they tend to have low BMS's compared to developed countries and also have very low CHD. In many cases, short, low weight populations have no evidence of CHD or stroke; e.g., Solomon Islanders, Papua New Guinea, Kalahari Bushmen, Congo Pygmies, Yanomami Indians, and Kitavan Islanders. Their low CHD was evident in the mid 20th C and subsequent changes in nutrition and lifestyle have affected their current health. Studies summarizing these and other findings are discussed in two papers below. A paper on the relation of smaller body size to longevity is also listed.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
On 2015 Apr 09, Peter Hajek commented:
The simplest bit of information to give to smokers is that vaping is at least 95% less risky than smoking and that if they cannot or do not want to stop smoking, they should try several e-cig products until they find one that helps them cut out cigarette use altogether.
On 2015 Jun 18, Elsamma Chacko commented:
This is a simple healthy lifestyle. Please give your comments. Link to full-text, http://figshare.com/preview/_preview/1463365
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0038. We believe the correct ID, which we have found by hand searching, is NCT00380562.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2017 Jul 13, Randi Pechacek commented:
Elisabeth Bik gives a brief description of this paper as part of a microBEnet blog post discussing the microbiomes of the houses of asthmatic children.
On 2016 Apr 26, Jean-Luc Margot commented:
This article includes the following claims: 1) the timing of peak pollination in Ephedra foeminea coincides with the full moon in July, 2) the plant can detect the full moon through light or gravity, 3) the full-moon detection trait is an evolutionary adaptation that aids the navigation by pollinating insects.
These extraordinary claims are made on the basis of 3 data points. There is no warning or acknowledgment about the possibility that the approximate coincidence between the 3 observed pollination peaks and the full moon could be entirely fortuitous. A chance alignment at the level observed by the authors is expected in about 0.5% of similarly constructed studies. Because the phenological record is extensive, it is straightforward to identify multiple instances of seemingly striking coincidences between plant development phases and the full moon. When a sufficiently long record is examined, however, the apparent association with the full moon reliably disappears. It is likely that additional observations of pollination in E. foeminea will invalidate the claims described in the article.
The authors invoked the detection of lunar tides by E. foeminea as a possible mechanism for the observed coincidence. Because of the form of the gravity potential, the gravity signals at new moon and full moon are roughly equivalent, and one would not expect a gravity trigger at full moon that does not also act at new moon, when pollination peaks were not observed. In addition, the lunar tidal signal is about 50,000 times weaker than the tides raised by a botanist making observations in the field.
The journal Biology Letters declined to publish a comment that describes the limitations of the data and interpretation and that proposes an alternate hypothesis (chance). This comment was later published in the Journal of Biological Rhythms (J. L. Margot 2015).
Regrettably, a review article on the Gnetales (S. M. Ickert-Bond and S. S. Renner 2016) states the poorly supported claim of a lunar influence on E. foeminea as fact, without describing the limitations of the data and interpretation, and without mentioning the alternate hypothesis.
On 2015 Apr 02, Jacob H. Hanna commented:
We have republished a corrected version of our JCI 2004 paper on bioRxiv: http://biorxiv.org/content/early/2015/03/30/016816
We will not seek to republish it elsewhere in any peer-reviewed journal, as it has been 10-12 years since publication, and the study lacks any novelty at this point in time.
On 2015 Apr 04, Arnaud Chiolero MD PhD commented:
Aging, population growth and a decrease in age-specific death are rather good news, aren't they?
On 2016 Nov 22, DP Zhou commented:
After patients spend all their savings for medicines not covered by health insurance, they extort the doctors and the hospitals as the last option to recover some cost of medicines. This is seen most often in cancer patients, who must pay cash to buy additional length of survival.
The medical education in China was established in close collaboration with the United States, especially Rockefeller Foundation and Yale University (1). The medical professionalism was particularly stressed, and private practice of medical graduates were strongly discouraged by Yen Fuqing (2), the founder of Shanghai Medical College and first Minister of Public Health of Republic of China.
1, Bridie andrews and Mary Brown Bullock. Medical transitions in twentieth-century china, 2014, Indiana University Press.
2, Yimin Qian and Zhiyuan Yan. Yan Fuqing. 2007, Fudan University Press.
On 2015 Nov 26, S A Ostroumov commented:
I think it is a very interesting important study. This research project is useful to control malaria. My recommendation is to include the word 'malaria' and /or 'malaria control' to the list of key words.
On 2015 Jul 22, NephJC - Nephrology Journal Club commented:
This editorial, along with the entire special issue, was discussed on June 16 and 17 2015 in the open online nephrology journal club, #NephJC, on twitter. Introductory comments are available at the NephJC website.
The discussion was scintillating with more than a 100 participants, including most of the authors. A transcript and a curated (i.e. Storified) version of the tweetchat are available from the NephJC website. Some of the themes (amongst many) discussed were
the role of work in social media and recognition (or lack thereof) in academia
social media as a path for continuing lifelong learning
the use of social media for research in medical education
Interested individuals can track and join in the conversation by following @NephJC or #NephJC, or visit the webpage at NephJC.com.
On 2015 Jun 01, UFRJ Neurobiology and Reproducibility Journal Club commented:
Although the findings of the study are interesting, we would like to point out that, due to differences in the interpretation of the term “spontaneous recovery”, the comparison between these results and previous results from the literature (Monfils et al., 2009, Clem et al., 2010) performed by the authors is not warranted. Spontaneous recovery is an intrinsic characteristic of the extinction process, and has been defined as a recovery of responding to the conditioned stimulus with the passage of time following the conclusion of extinction. (Bouton et al., 2002). However, one should observe that, since the decay of fear within an extinction session involves different mechanisms than those involved in extinction from one session to the next (Plendl & Wotjak, 2010, Almeida-Corrêa et al., 2015), a difference between the end of an extinction session and the beginning of the next test session is actually to be expected, and does not constitute evidence of spontaneous recovery, as the freezing epochs are not comparable (Plendl & Wotjak, 2010). Thus, the adequate way to evaluate spontaneous recovery is to compare freezing between two test sessions of similar duration, spaced apart and happening after the extinction session (such as in Monfils et al., 2009 and Flavell et al. 2011). Furthermore, it is worth highlighting that the training-test interval in this article and in the ones cited in Table 1 are clearly not the same. In Monfils et al., 2009 and Clem et al., 2010, the return of fear is prevented in the retrieval-extinction group 1 month and 1 week after extinction, respectively, but neither show a return of fear 24h after the extinction session. Chan et al. 2010 also don’t see a return of fear in either experimental group when they are tested in the extinction context, while in Stafford et al. 2013, freezing during the extinction session is not shown. Thus, rather than contradicting the previous findings, as discussed by the authors, the current results actually confirm those of Monfils et al. (2009) and others – namely, that a retrieval session before extinction does not alter freezing in a session 24 h later. It is surprising that the authors discuss many variables that might have influenced the “contradictory” results between this and the abovementioned papers, but don’t consider the different definitions of spontaneous recovery and the different delays between extinction and testing used in the articles. To clear up these misunderstandings in future studies, we propose, as others have done (Plendl & Wotjak, 2010), that the term “spontaneous recovery”, irrespectively of the time interval, should be based on comparisons between test sessions of similar duration happening after extinction, which is not the case when the end of a long extinction session is compared to a short test session. As has been discussed in Riebe et al 2012, the increasing number in studies being published in fear extinction don’t follow harmonic experimental designs, nomenclature or data analysis, therefore making it difficult to compare studies among themselves. The newly explored sub-field of post-retrieval extinction seems to be repeating this pattern, and we would like to reinforce the importance of avoiding such repetition.
On 2016 Jul 03, Dorothy V M Bishop commented:
This paper does not appear to have been peer-reviewed: it was accepted for publication three days after it was received by the journal.
On 2017 Mar 05, thomas samaras commented:
This results of this study are consistent with a similar study by Elsayed, et al. This study is also consistent with many longevity and mortality studies published over the last 40 years. For example, a short list is presented next.
He, et al. Japanese-Hawaiian: shorter elderly have lower mortality and live longer Chmeilewski: Based on 800,000 deceased Polish men and women, shorter people live longer Samaras: Eight difference types of studies support the greater longevity of smaller people Samaras: shorter men lived longer based on a study of deceased San Diego veterans Mueller: shorter elderly West Point graduates had a lower mortality after 60 years of age Salaris: shorter deceased men in Sardinia lived longer Miller: shorter men and women who died in Ohio lived longer Willcox: short Okinawans have highest percentage of centenarians Wilhelmsen: men who were shorter at 67 years of age were more likely to reach 90 years of age Bartke: smaller body size promotes greater longevity
On 2016 Aug 14, Leigh Jackson commented:
A very good overview. My personal conclusion:
Consistent results of systematic reviews show that acupuncture is no better than sham for acute/subacute LBP, either for short term pain relief or functional improvement.
Conflicting results of systematic reviews mean it is unclear whether acupuncture is effective for short term pain relief for chronic LBP; however, consistent results show no functional benefit.
On 2016 Nov 15, John Roger Andersen commented:
Authors version is available as green open access: click here.
On 2016 Jun 20, Darya Vanichkina commented:
UCSC genome browser in-silico PCR on hg19 UCSC genes predicts that a different lincRNA (on a different chromosome; chr10:102,133,333-102,148,116 vs chr21) will be amplified using the primers reported to target linc00320. How was this off-target PCR controlled for? Was the PCR product sequenced to confirm correct template was being amplified?
>uc001kra.4__LINC00263:555+727 173bp GACTCCTTTGGGAGACCAGTG AGGTCACAGGGGATTTGATGG GACTCCTTTGGGAGACCAGTGccctgttgtcgccctcactccgtgaggag atccacctatgatctcaggtcctcagaccaaccagcccaaggaacatctt gccaatttcaaatcggaagataggagtgtcaggcctctgagtccaagcta agCCATCAAATCCCCTGTGACCT
>uc001kqz.4__LINC00263:555+724 170bp GACTCCTTTGGGAGACCAGTG AGGTCACAGGGGATTTGATGG GACTCCTTTGGGAGACCAGTGccctgttgtcgccctcactccgtgaggag atccacctatgatctcaggtcctcagaccaaccagcccaaggaacatctt gccaatttcaaatcggataggagtgtcaggcctctgagtccaagctaagC CATCAAATCCCCTGTGACCT
On 2015 Jun 02, Thomas Perls, MD, MPH commented:
An important conclusion of this work is that the genetic basis of surviving to age 90 years (the 5th and 15th percentiles of survival for men and women belonging to the 1900 birth cohort) is weaker and different from the genetic basis of surviving to the top one percentile, which in turn is different for those surviving to the top 0.1 percentile of survival.
The authors of a meta-analysis of largely nonagenarians (Deelen J, 2014) indicate that they were unable to reproduce the associations of the 281 SNPs in Sebastiani P, 2012 and used their negative result to assert that the findings were false positive associations. However, what this analysis of sibling relative risk of extreme longevity (Sebastiani P, 2016) indicates is that one should not be surprised by the lack of consistent results between these studies of people surviving to markedly different percentiles of survival and therefore having substantially different degrees of statistical power to discover variants associated with extreme survival. Reinforcing this point, when studies are similar in terms of a rare percentile of survival, a large number of the associated SNPs are actually replicated (Sebastiani P, 2013).
On 2015 Mar 27, Peter Hajek commented:
This is a highly misleading conclusion from studies with little relevance for human health. There are clear data from long-term NRT use and population data from users of snus which show that long-term use of nicotine itself, outside pregnancy, carries minimal or no health risks. (There are also data that showing nicotine use prevents Parkinson's disease and lowers BMI, and in smokers switching to alternative nicotine delivery systems, it alleviates a host of negative effects). It makes no sense to demand that nicotine products with minimal or no health risk which can benefit smokers greatly are sold under medical supervision while tobacco products are purchased freely. Such demands just serve to protect tobacco sales.
On 2015 Jun 05, BSH Cancer Screening, Help-Seeking and Prevention Journal Club commented:
This article was selected for the HBRC journal club held on June 2nd, 2015. The topic of ‘don’t know responses’ in perceived risk items is of particular relevance to our group and raised several useful discussion points. We thank the authors for taking this work forward, and encourage further study in the area.
The general consensus of the journal club was that the use of two samples was a strength of the research. However, we noted differences in the availability of perceived risk items, the use of different predictors between the datasets, and perhaps most importantly, the availability of explicit ‘don’t know’ response options in one survey but not the other. This made comparisons between the samples and interpretation of the findings difficult. The authors should be credited with making use of available data, but it seems clear that their interesting findings warrant further investigation using study designs that explicitly set out to investigate this phenomenon. Following this, the journal club discussed the research team’s recent research endeavours in this area, presented at the Society of Behavioral Medicine Conference.1
Conversation turned to the meaning of a ‘don’t know’ response. We felt this was important because observational studies do not allow us to disentangle true ‘don’t know’ responses from those who lack the motivation to complete all survey items. Hay and colleagues addressed this limitation by excluding participants with multiple ‘don’t know’ responses elsewhere in the questionnaire; a decision we agreed with. Suggestions for future research investigating the meaning of a ‘don’t know’ response included using semi-structured interviews purposively sampling participants who selected a ‘don’t know’ response, or verbal protocol (think-aloud) studies encouraging subjects to vocalize their thoughts when completing perceived risk items. While these methods have limitations of their own, the consensus was that they would be worthwhile approaches. We also recommend that future research should include a range of perceived risk items, including ‘feelings of vulnerability’ also known as ‘risk as feelings’; an item not available to Hay and colleagues.
In sum, the HBRC journal club enjoyed reading this article, and encourages others to take note of their findings. These data have clear implications for scientists who use survey methodology, as well as those making policy level decisions based on their findings.
References
On 2015 Mar 27, Alberto Carbonell commented:
Please visit http://p-sams.carringtonlab.org/ for using P-SAMS, the Plant Small RNA Maker Suite, to design artificial microRNAs. P-SAMS also outputs the sequence of the oligonucleotides needed to clone the corresponding amiRNA(s) in BsaI/ccdB-based "B/c" vectors.
On 2016 Dec 18, Laura Williams commented:
Our online journal club discussed this paper on April 28, 2015. https://www.youtube.com/watch?v=wmRy3iuVQu0
On 2016 Jan 29, Martin Pusic commented:
Thank you for this insightful review - we're glad that the article created such a rich discussion. Here are a couple of other thoughts:
. "different tracks for different learners" - what a learning curve makes manifest is the time component of an assessment. As a medical educators, we have the privilege of teaching highly motivated learners who almost always get over whatever bar we set for them. If we grade ourselves as teachers by counting how many learners get over the bar, it is easy to perceive ourselves as successful; however, if instead we grade ourselves on the SLOPE of the learning curve, now we have a metric that challenges us to grade our efforts in terms of learning efficiency, which is amount of learning per unit of learning effort expended. This does three good things: 1) it orients us towards maximizing the most precious student commodity - time; 2) it prompts educators to consider more closely the PROCESS of learning as that's how you improve the slope and 3) it allows us to use the variability in paths/slopes to learn the best ways of teaching and learning. So it may be that we do not need customized learner development charts, as well as those work for pediatrics, but rather to learn from those outliers who fall away from the average curve so as to feed that back into the system to improve the learning for everyone.
.in the "life-cycle of clinical education" we would also encourage you consider the asymptote. The asymptote defines the "potential" of a learning system. "How good can we possibly be, if we used this system an infinite number of times?" Improving the slope means we get people up to competence more efficiently. Improving the asymptote means we get even better competence. In some cases we only need "x" amount of minimum competence and we're fine (think hand washing); but in most areas of medicine, we can always do better. The path to competence is all-important, but our learning systems would do well to also map out the path from competence to excellence, defined as being the very best any of us can be. The asymptote, along with the very shallow slope of the learning curve as it approaches it, gives us an idea of what excellence takes.
On 2016 Jan 28, Clinton K Pong commented:
Journal club review from a conference for Educators in Health Professions:
Pusic et al present a useful argument for the development and application of Learning Curves in Clinical Education. The learning curve graphs a mathematically modelled relationship between effort and competence. The authors suggest applications to practice citing work in radiological interpretation learning and the limitations of the work to date. At our journal club, we further considered learning curve application in the life-cycle of clinical education.
Theme 1: Undergraduate Education - the Steep Learning Curve of Med Ed
Learning curves may follow & identify the learner throughout their learning from undergraduate time onwards. Early engagement with validated learning curves, if available, across multiple domains, may have the potential to inform the learner and assist in his/her application to education early in their career. Learning curves may become a useful tool in assisting the learner-in-difficulty but challenges us to consider if there is long-term benefit of remediation in medical training.
Theme 2: Graduate Professional Training - Trainees falling off the "Growth Chart"
We considered how generalizable learning curves would be in the specialties where complex communication/perception is the competence required – eg the learning of elderly medicine rather than the more measurable accuracy/time-taken per task.
Does deliberate observation of practice confound performance in learning curves versus real-time learning in the clinically chaotic environment?
The evidence presented (Fig 7) suggested to us that a competency-based curriculum could result in different tracks for different learners – would it be ethical to continue with a time-based curriculum with the cost implications thereof if the majority of learners reach competency in a shorter than prescribed time or the corollary. Are there opportunity costs in overtraining the accelerated learner? How would programs and health systems respond/accommodate and support the learners who requires more/less than standard time to complete?
The curve may have a greater relevance in self-assessment metrics than formal assessment. Its creation informs reflective practice/analysis/germane learning and ideally would be used early in the training cycle. There may be risk in adding to the burden of extraneous cognitive load if performance anxiety mitigates the safety of the learning environment.
The authors acknowledge that there is variation in the starting point and slope of the learning curve that mostly cannot be controlled. In time, there may be evidence to describe if a less steep slope implies a perpetual shift in the curve to the right compared to peers or whether performance may suddenly shift the curve to the mode or even to the left as learning breakthroughs occur? The cohort is too small to usefully study these variations in this domain of learning.
Prediction models would be useful especially if wider work supports wide variations in trajectories of learning in complex clinical tasks.
What is happening in the area under the curve above the standard competence – Do these learners use and practice transferable skills that keep them ahead on the next learning curve?
Should we have customised learner development charts in multiple domains from the analogy of paediatric development milestones or growth curves – correction for some confounding factors could be achieved by customisation – for example - gender, age, ethnicity, population of reference – could these be used in clinical education to generate ‘growth of learner performance’ curves. Sub-analysis may lead to greater understanding of the non-thriving learners - the “under effort for time” learner versus the “under performance for effort” learner in the analogy of the skinny child versus the stunted child!
Theme 3: Faculty Development - "Cultivating Deliberate Expertise"
We considered how learning curve analysis could inform medical registration policy for re-certification if the decay curves were further developed. The unit time for performance degradation may not be identical in each cycle for revision learners. The theory of spacing learning activity to afford deeper learning over time may contribute to determining the appropriate cycle time.
On 2015 Sep 29, Carlos Maia commented:
http://www.ncbi.nlm.nih.gov/pubmed/?term=26375808
On 2015 Jun 09, Carlos Maia commented:
Repercussion in the lay press:
Sofrimento e desperdício – a ideologia e a política no Déficit de Atenção. http://vida-estilo.estadao.com.br/blogs/daniel-martins-de-barros/sofrimento-e-desperdicio-a-ideologia-e-a-politica-no-deficit-de-atencao/
Brasil gasta mais de R$ 1,8 bilhão por tratamento inadequado ao TDAH. http://g1.globo.com/bom-dia-brasil/noticia/2015/06/brasil-gasta-mais-de-r-18-bilhao-por-tratamento-inadequado-ao-tdah.html
On 2015 Oct 21, Chetna Malhotra commented:
Thank you for your interest in the paper. You may also be interested in another paper from our team, using the same DCE, published in Health Policy (2015) comparing patient preferences with those of older adults in the community. A forthcoming manuscript by our team in BMC Palliative Care also uses a similar methodology to assess variation in physician recommendations for end-of-life care.
The attributes for the DCE used in this manuscript were based on a review of literature as well as results from our own focus groups with older Singaporeans (Malhotra et al, 2012), thus enabling us to tailor the DCE to our local context. Due to space considerations, we were unable to present the regression table in the paper, but the rescaled regression coefficients are shown in figure 1 of the manuscript. The figure allows for easy interpretation of the regression results. The DCE experimental design was a main effects design and thus limited any post hoc testing for interactions. This could be an area of future research. Ethical considerations limited our ability to recruit patients who were not aware of their own diagnosis. This would be a common consideration for all palliative care researchers working in similar settings.
On 2015 Oct 13, Cicely Saunders Institute Journal Club commented:
This paper was discussed at a Journal Club at the Cicely Saunders Institute, King's College London, on Wednesday 7th October 2015.
This study is a nice example of how a discrete choice experiment (DCE) can be used in palliative and end-of-life care to assess preferences for aspects of care. It also raises some very interesting questions about the differences in priorities and the extent to which caregivers might be able to act as a proxy for patients, an important consideration for end-of life care. Our Journal Club discussed the work required to ensure sufficient attribute identification for a robust DCE, and wondered if the attributes decided upon in this paper sufficiently captured what is most meaningful for patients and caregivers at the end of life, i.e., there was no mention of a systematic review used to develop the attributes (see Bridges et al., 2011 for an example of DCE reporting guidelines). We also would have liked to see a table of the probit regression output for clarity on how the willingness-to-pay was calculated, and more detail on this in the methods. Furthermore, we found it confusing that the authors state in the discussion that their sample size was too small to explore interaction effects, while it appears they recruited 70% more than their minimum acceptable sample size – some explanation would have been helpful. Lastly, we wondered about the potential risk of bias of only including those patients who knew their diagnosis. This may limit the generalisability of the findings, even to a Singapore context. We enjoyed discussing this paper, and look forward to more papers using DCE methodology in palliative and end-of-life care.
Commentary by Melinda Smith
On 2015 Apr 02, M Mangan commented:
With florid rhetoric in the discussion, this paper far over-reaches what the actual research accomplished. In the work, researchers dumped a variety of solutions on bacteria, and found bacteria opened some channel proteins to deal with it. This is a very non-specific response to anything bacteria might encounter, such as even a change of pH or some membrane-impacting detergents or altered salinity. Appropriate controls--such as just the active ingredients they claim in the title--were not done. Nor were controls for surfactants. The work does not support the wild claims that have resulted.
On 2016 Mar 18, ZHONGMING ZHAO commented:
My lab recently moved to the University of Texas Health Science Center at Houston. The software is now available at https://bioinfo.uth.edu/dmGWAS/.
On 2015 Jun 12, Philippe Terrier commented:
There is a very unlikely result in table 3: the authors report regression result for the dependent variable CBMS: 1.000 x APStdDev - 1.000 x MLRange, R<sup>2</sup> =1.000 . This is a perfect prediction, which is impossible given the variability reported in table 1. Moreover, mean APSstDev is 1.3 (table 1) and mean MLRange is 7.3, in parallel, the mean CBMS score was 46 (p. 810, 3.2): applying the regression equation give 1.3-7.3=46 ! Maybe I do not understand the methodology, but that must be clarified.
On 2017 Jul 13, Randi Pechacek commented:
Elisabeth Bik praises this paper for its innovation in a microBEnet blog post.
On 2015 Mar 30, Peter Hajek commented:
This is a good quit rate, well done. Re. the predictors of outcome, attendance is not really a predictor, people who are successful in quitting smoking usually continue to attend and treatment failures drop out, so attendance is a consequence rather than a cause of success.
On 2015 Jul 13, Bill Cayley commented:
A good example of when less can be "more": https://lessismoreebm.wordpress.com/2015/07/13/exercise-and-vitamin-d-in-fall-prevention-among-older-women-a-randomized-clinical-trial/
On 2015 Sep 16, Geriatric Medicine Journal Club commented:
We have so many guidelines with indications for when to start medications. Very few guidelines help the clinician assess when and how to stop medications. This article was critically appraised at the July 2015 Geriatric Medicine Journal Club (follow #GeriMedJC on Twitter). It was a lively discussion and the full transcript can be found at: http://embed.symplur.com/twitter/transcript?hashtag=GeriMedJC&fdate=07/31/2015&shour=00&smin=00&tdate=08/01/2015&thour=00&tmin=00 This pragmatic trial shows promise for conducting much needed deprescribing studies for other medications at end of life.
On 2015 Jun 10, Arthur Yin Fan commented:
J Integr Med. 2015 May;13(3):136-9. doi: 10.1016/S2095-4964(15)60172-8. The methodology flaws in Hinman's acupuncture clinical trial, Part II: Zelen design and effectiveness dilutions. Fan AY1.
On 2015 Dec 29, Timothy K Cooper commented:
There is additional correspondence related to this review at Cooper TK, 2015 and Tromp TR, 2015
On 2016 Jun 21, Lydia Maniatis commented:
The trick in science is to ask good questions, but that's more difficult than asking nonsense questions. Both types of questions can generate data, but only the former will, in some cases at least, produce data that is intelligible. The question and data here clearly fall into the latter category.
The question being asked is how confident observers will be if we ask them to judge some aspect of a stimulus presented for only 200 milliseconds, and how will this judgment of confidence change when we vary the frequency distribution of some aspect of the display. (The logic of varying frequencies in this way is related to a never-really-explained and huge and falsifiable assumption that a. signal detection theory is appropriate for modelling perceptual processes and b. that varying the distribution of some experimental display is equivalent to the noise term in this SDT paradigm.)
Why 200 milliseconds? Why were observers encouraged to respond quickly? Why do we care how observers feel (or at least respond when forced to express a feeling) about their performance in such extremely pinched and unnatural circumstances?
As it happens, the authors found no consistency between individuals (apparently each person has some preference for responding, but so what?) and no consistency between this study and other studies with the same focus.
The authors provide no justification for why they chose the particular task and the particular experimental parameters they did. What if they had used a different task? What if they had let observers see the stimulus for 500 milliseconds, or even an entire second? Would there be reason to expect different results? Why the forced choice? If you're really interested in confidence, then forcing observers to respond even if they have no real preference will just produce a false impression of confidence, a response based on some rule of thumb that doesn't necessarily measure confidence. You lose precisely the information that you're supposed to be interested in.
The number of possible studies along these lines, using arbitrary tasks and arbitrary parameters, is infinite. Each one will certainly produce some result, and the results will just as certainly be widely variable and often mutually inconsistent. "Visual confidence" is a data mill in need of a rationale adequate to guide experimental control of variables, so that the results of different experiments can be compared with more confidence than the hopelessly vague speculation on display here:
"In any case, the reasons why these inter-individual differences occurred in our study, but not in other studies (e.g. [9, 13]), remain to be clarified, but the stimuli or the procedure (e.g. the use of confidence ratings vs. confidence comparison) might have played a role in this issue. One could speculate that these inter-individual differences relate to the prior beliefs about the noise variance, or to the sensory sensitivity to motion variability or motion deviations. It is also possible that they relate to more cognitive phenomena like misperception of statistical variability ([20]), distortions in subjective probability weighting ([21]), or attitudes towards risk. In any case, past research has demonstrated that such individual differences do provide an interesting leverage when investigating choice behavior and metacognitive abilities, both from a behavioral and a neuroscientific perspective (e.g. [22㲴])."
Could be anything; the pitfalls of theory-lite data collection.
Throwing out three out of the 18 original participants based on "poor performance" or "extreme bias" in the confidence task is questionable methodologically and seems like a way to paper over the lack of robustness and consistency (and intelligibility) in the results of a task whose difficulty is of the nature of testing, e.g., figure-ground perception in a myope without their glasses. Adding theoretically trivial difficulty of this type makes the data fuzzy and allows flexibility and perpetual readjustment in their interpretation, and perpetual pretexts for more data collection.
With respect to the idea that individual diffs might "relate to the prior beliefs about the noise variance":
Not only is variance treated as "noise" in the signal detection scheme, but now we layer on top of this tenuous assumption another one, that the perceptual (or cognitive?) system might have prior beliefs about this variance/noise. Note that the experimenter-determined variance is never expressed in the stimulus as such. The stimuli experienced could be from any distribution that simply contains each sample experienced. How would we determine which distribution conforms to the supposed prior belief? If there is no way to determine this, then the possibility is not testable, and thus not scientific.
On 2015 Mar 31, Attila Csordas commented:
associated proteomics dataset available via PRIDE/ProteomeXchange: http://www.ebi.ac.uk/pride/archive/projects/PXD001980
On 2015 Apr 20, Lei Zhao commented:
excellent
On 2015 Mar 28, Kathleen Dickman commented:
I agree that proper attribution is very important, and a historical perspective provides an excellent educational opportunity for students. Unfortunately, many journals limit the number of references, forcing authors to use recent review aricles to cover the literature.
On 2016 Feb 10, Anders von Heijne commented:
A search of the EudraVigilance (European Union Drug Regulating Authorities Pharmacovigilance)database in February 2016 shows a further ten reported cases of PRES in fingolimod treated patients - seven in the USA and one each in Spain, Germany and Australia.
On 2015 Sep 28, Bill Cayley commented:
If not doing a CTCA led to reduced likelihood of an invasive angiogram, then perhaps in evaluating chest pain sometimes less is more - see other examples at: https://lessismoreebm.wordpress.com/?s=chest
On 2015 Apr 15, Michael Hoffman commented:
Correction: Segway no longer needs a computer cluster
Minor correction: since the release of Segway 1.2.0 on 29 August 2014, Segway will run on standalone computers not attached to a cluster.
On 2015 Mar 24, Jorge H RamÃrez commented:
This abstract does not comply with the extension to the CONSORT statement: http://www.consort-statement.org/extensions?ContentWidgetId=562
I am particularly concerned with the registration of this trial:
The registration number should appear in this abstract according to the CONSORT Statement.
I cannot confirm if the registration number appears in the full text of this manuscript because it's behind a paywall (i.e., not an open-access article).
No results for the search query "duloxetine carnitine" were retrieved by ClinicalTrials.gov and WHO ICTRP (search date: March 24, 2015).
A significant number of registered duloxetine trials remain unpublished despite being completed several years ago.(1)
References
On 2015 Apr 01, Mario Capasso commented:
The authors of this meta-analysis have reported into the manuscript this sentence: "the study performed by Capasso et al Nat Genet 2009 evaluating the association between BARD1 Arg378Ser polymorphism and neuroblastoma susceptibility reported the completely opposite result compared to the study performed Capasso et al Carcinogenesis 2013. We read these two papers carefully and didn’t find the interpretation about this phenomenon by the author." This is clearly wrong. Indeed, in the two papers, we reported the frequency of the minor allele (MAF) which in the American population is G, and in the Italian population is C. In both populations, the disease associated, or risk, allele is G, with a frequency of 0.51 and 0.42 in American cases and controls, and of 0.65 and 0.52 in Italian cases and controls. Therefore, while the minor allele is different, there is no difference in the neuroblastoma risk allele, and the results are consistent in the two populations.
On 2015 Aug 20, Anders von Heijne commented:
This paper rightly point out that individualized protocoling of CT and MRI examinations is an important part, indeed a sine qua non of delivering high quality radiology service.
On 2015 Nov 18, David Keller commented:
One DaTscan exposes basal ganglia to an ionizing radiation dose equal to 21 CT scans, for what benefit?
According to the DaTscan product information, this radio-pharmaceutical exposes the basal ganglia to 42.5 mSv of ionizing radiation, equivalent to having 21 brain CT scans [1], a level of radiation exposure with unknown effects on the already injured neurons of the substantia nigra (SN). Indeed, no clinical study has assessed the possible worsening of Parkinson's disease caused by a DaTscan, by means of accelerated death of SN neurons due to radiation exposure.
The gold standard used in this study is clinical diagnosis, which causes zero radiation exposure to the SN, and a significantly more sensitive and specific diagnostic yield. Why, then, should any clinician order a DaTscan, at least until we know the effects of 42.5 mSv of ionizing radiation on the sick SN neurons of a Parkinson's patient?
Reference:
1: Keller DL. Proposal for a clinical trial to test the safety of a widely-used radionuclide scan. Comment on PMID: 26236969. In: PubMed Commons [Internet]. 2015 Sept 15 [cited 2015 Nov 20]. Available from http://www.ncbi.nlm.nih.gov/pubmed/26236969#cm26236969_11818
On 2015 May 20, Bill Cayley commented:
A great example of when "Less" is "More": https://lessismoreebm.wordpress.com/2015/05/20/association-of-early-imaging-for-back-pain-with-clinical-outcomes-in-older-adults/
On 2015 Sep 16, Geriatric Medicine Journal Club commented:
The related study (Delayed-start analysis: Mild Alzheimer's disease patients in solanezumab trials, 3.5 years. Alzheimer's & Dementia: Translational Research & Clinical Interventions. In press. 2015) was critically appraised at the August 2015 Geriatric Medicine Journal Club (follow #GeriMedJC on Twitter). The full discussion can be found at: http://gerimedjc.blogspot.com/2015/09/study-author-joins-us-for-successful.html?spref=tw This is an interesting study design, but the hype around the results may be disproportionate or premature to the magnitude of clinically meaningful benefit shown.
On 2015 Mar 18, Peter Hajek commented:
The title is misleading. An association does not prove causation.
On 2016 Apr 06, Daniel Tsin commented:
Correction in reference 1. Tsin DA, Sequeria RJ, Giannikas G. Culdolaparoscopic cholecystectomy during vaginal hysterectomy. JSLS. 2003 Apr-Jun;7(2):171-2. PMID 12856851
On 2016 Jun 01, Kenneth Witwer commented:
It is reported that "miR-150 mRNA and protein expression levels" were assayed in this study, but miR-150, a 22-nucleotide RNA, is neither a messenger RNA nor a protein. The reverse transcription and RT-PCR steps described in the methods could not have amplified a microRNA specifically. Furthermore, both Western blots and immunohistochemistry images are shown and said to have been obtained with a "mouse polyclonal anti-miR-150 antibody." The target is repeatedly referred to as a protein, reducing the likelihood that typographical errors or translation issues interfered with reporting. Additional methodologic details would be helpful in resolving these problems, including primer sequences and the actual protein target and source of the antibody.
On 2015 Jul 10, Matthew Shirley commented:
I would just like to point out that the axes in Figure2 panels A & B should probably range from 0.1-1.0 and not 0.1-0.1.
On 2015 Apr 22, Thomas Heston commented:
Compared with the functional testing group, those undergoing an initial CT angiogram were 50% more likely to undergo catheterization (12.2% vs 8.1%) and almost twice as likely to undergo revascularization (6.2% vs 3.2%). These additional procedures, however, did not show any clinical benefit during a median follow-up period of 25 months, as measured by the primary outcome measure (3.3% in the CTA group vs 3.0% in the functional testing group). Thus, the obvious conclusion seems to be that CTA results in more radiation, more catheterizations, and more revascularizations --- without any improvement in clinical outcomes. The results from this study suggest that functional testing is the best initial noninvasive test in symptomatic patients with suspected coronary artery disease.
On 2015 Sep 16, Geriatric Medicine Journal Club commented:
This study aims to look at a multicomponent intervention to prevent cognitive decline in at-risk elderly. This article was critically appraised at the July 2015 Geriatric Medicine Journal Club (follow #GeriMedJC on Twitter). The full discussion can be found at: http://embed.symplur.com/twitter/transcript?hashtag=GeriMedJC&fdate=07/31/2015&shour=00&smin=00&tdate=08/01/2015&thour=00&tmin=00
On 2016 Apr 25, Johannes M Dijkstra commented:
The title of this article "CXCR3 chemokine receptor enables local CD8(+) T cell migration" is not substantiated by the experimental data, because increased presence of the CD8(+) T cells in the infected cell area may be explained by increased binding.
Although not immediately clear to readers, the article is mostly about a time window effect at days 5-7 after infection. Important observations for the virus titers on those days should be shown if Fig. 3F, in which the data for the day 5 p.i. result are contradictory to the story. That figure is either an error, or needs serious discussion.
Previously, I have posted these comments plus a few additional minor ones on the Immunity site below the article, but the authors did not respond, and Immunity made the comments close to invisible. Then I placed my comments as a correspondence article on F1000Research, where the advantage is that independent third parties can have their say as reviewers. For more explanation of the above points, please see that web-site http://f1000research.com/articles/4-922/v1 .
However, the F1000Research system requires two reviewers before the publication can proceed, and I only managed to find one reviewer within the relevant research field. The one reviewer, Dr. J.R. Groom, as I interpret her words, agreed with me that Fig. 3F requires an explanation by the authors, but feels that the text by Hickman et al. on the migration versus binding issue is more nuanced than I portray it in my criticism. Her comments can be read in detail at http://f1000research.com/articles/4-922/v1 . Although I do agree with her that within the Hickman et al. text some nuances can be found, that does not take away that they boldly and in my opinion without substantiation concluded a migration enabling effect in the title and that most readers will understand the wordings by Hickman et al. similar to as reflected in Fig. 1 of the corresponding preview article by Beura and Masopust http://www.cell.com/immunity/fulltext/S1074-7613(15)00095-3 .
Both Dr. Groom and I agree that the technical part of the experiments in the Hickman et al. article is mostly sound.
On 2015 May 15, M Felix Freshwater commented:
Although not called a systematic review, in fact it was one for two obvious reasons: 1. Systematic reviews are defined by Cochrane as analyses of articles with “a clearly stated set of objectives with pre-defined eligibility criteria for studies”. The authors’ stated objective was “to identify the most highly cited microsurgery articles”, and the authors’ pre-defined eligibility criteria included articles that appeared in five high-impact peer-reviewed journals. 2. It was assigned a Level of evidence III. Using the ASPS level of evidence system a level III is a systematic review of retrospective cohort or comparative study; case-control studies; or while according to 2009 OCEBM level 3 is a systematic review of case control studies.<br />This review does not meet the minimum standards on how a proper systematic review should be reported that were codified in the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) and published in 2009.<br> Item 10 of PRISMA’s checklist describes the proper methodology for validating extracted data: “Describe … any processes for … confirming data from investigators.” The authors did not describe how they confirmed that their data extraction was accurate. AMSTAR, a validated checklist for measuring the quality of systematic reviews states: “There should be at least two independent data extractors and a consensus procedure for disagreements should be in place.” This review contains erroneous data, which may be a result of not reading the original papers and/or of not complying with PRISMA. One obvious example is the misidentification of the country of origin of the most highly cited clinical article. While the review stated that the country of origin was the United Kingdom, the paper itself never uses the phrase “United Kingdom” and clearly identifies its country of origin as Australia on its first and final pages. As this review deemed it worthy to analyze papers by country, any results and conclusions based upon country of origin are suspect. Without duplicating the study, it is impossible for any reader to know which other data in this review are flawed. This review provides an educational opportunity, as it affords the editors and peer reviewers to join other journals that publish papers on microsurgery including Annals of Plastic Surgery, Journal of Plastic, Reconstructive & Aesthetic Surgery, Journal of Hand Surgery (Am) and Journal of Hand Surgery (Euro), which have adopted PRISMA as a requirement when reporting systematic reviews. I suggest that the editor, who also is a co-author of this paper, enforce the use of PRISMA in order to lessen the possibility of future errors arising from inaccurate data extraction.
On 2017 Mar 03, Matthew Speir commented:
To add on to what Kim Pruitt said in her comment, our previous "RefSeq Genes" track was not equivalent to what was provided by RefSeq. It was based on the realignment of their provided RNAs to the genome.
However, we recently released an "NCBI RefSeq" track that is based entirely on coordinates and alignments provided by the RefSeq group. You can read about it more on our website: https://genome.ucsc.edu/goldenPath/newsarch.html#030317.
On 2015 Mar 18, Kim D Pruitt commented:
As the head of NCBI’s RefSeq project I would like to make a clarification on the relevance of the authors' results to RefSeq. The authors refer to the RefSeq dataset and UCSC RefGene dataset as if they are equivalent. However, the RefGene data represents annotation derived from UCSC-generated alignments of approximately 1/3 of the RefSeq data. The analysis presented here is of the UCSC RefGene dataset and not the complete RefSeq set as obtained at NCBI which builds and curates RefSeq. NCBI also provides human genome annotation data that includes the comprehensive RefSeq transcript data set. Details about the annotated location of a given RefSeq transcript at NCBI may differ from that shown in the UCSC RefGene track.
Therefore, the relevance of this analysis to RefSeq is unclear.
On 2015 Mar 28, Markus Meissner commented:
Hi Juergen, Fully agree ! Will be great to see what happens when interactions are rapidly disrupted. This is one of the main caveats of current conditional systems....simply too slow for fast processes, such as gliding and invasion.
On 2015 Mar 24, Jürgen Bosch commented:
Thank you Markus for your positive feedback on our review. I think it will be crucial in the future to utilize chemical probes to study these invasion mechanisms in different parasites.
On 2015 Mar 18, Markus Meissner commented:
This is a very nice review by Boucher and Bosch, summarising our current knowledge of apicomplexan invasion pathways. In the first part of the review the authors focus on novel structural data of the individual complexes known to be involved in gliding motility and invasion, while in the second part the current data regarding potential, alternative invasion pathways are presented. While the authors favour the more “traditional” linear motor system, data from diverse groups have been openly discussed, although some of the arguments might need further clarification. For example, the authors do not mention one important feature of the GAP45-depleted parasites. In these parasites the integrity of the IMC is lost AND other motor components dissociate and mislocalise to the cytosol of the parasite. Yet, these parasites are still capable of moving and invading, although the anchorage for the motor complex is missing. In case of act1KO it is in our opinion unlikely that parasites still have sufficient actin for gliding motility and invasion yet not for egress or apicoplast replication. Furthermore, the controversy regarding the effect of CytoD on host or parasite actin (see Rynig and Remington, 1978; Dobrowolski et al., 1996; Gonzales et al., 2009) and recent data on the role of aldolase ( Shen et al., 2014 ) seriously undermine the original rationale for the linear motor model, and in our view suggest that the earlier data supporting the model should be treated with as much scrutiny as the recent data arguing against it.<br> I agree with the authors that findings in Toxoplasma cannot necessarily be directly transferred to Plasmodium. However, this is also the case for other apicomplexans, which have undoubtly different (or alternative) invasion mechanisms, such as Theileria or Cryptosporidium. Of note, Theileria has a well conserved AMA1, but doesn't form a tight junction. While Theileria might use AMA1 for “zippering” into the host cell, it doesn’t use it for force transmission, since invasion is independent of host AND parasite actin (Shaw, 1999). More experiments are required to make sense out of these sometimes conflicting data, which can at this point be interpreted in multiple ways, and we fully agree with the authors that we need an open, unbiased discussion in order to solve the puzzle.
On 2016 Jun 03, Lydia Maniatis commented:
The authors of this article perform a useful service: They experimentally falsify a claim that currently enjoys some favor. Falsifying (false) assumptions is a fundamental activity in science; a science incapable of rejecting false views is incapable of selecting true(er) ones, and thus incapable of progress.
This simple fact is so antithetical to the current “don't criticize” ethos in vision science that the authors have (either by choice or editorial demand) been forced to bury the lead and accentuate the mildly positive and/or vague. Thus the title of the article is vague, implying nothing and the abstract reports a mixed salad of findings. For a statement of any conclusions we're directed to the article itself.
From the intro, we learn that Christou and Koenderink (1997) have speculated that the presence of smooth occlusions is a key factor in seeing “shape-from-shading.” Amazingly, in the nearly 20 years since, no one – including its originators - has actually tested this claim. After explaining what a “reasonable” suggestion this is, Todd and Egan note that “virtually all past studies have included visible smooth contours.” So they propose to put this suggestion to a real test, but aren't allowed to state it this strongly so near the beginning of the article; they are merely going to “further examine” the issue.
The discussion also drags its feet in getting to the point, since the first thing we learn is that “One of the basic findings of the present investigation is that observers’ perceptions of 3-D shape from shading are sheared slightly toward the direction of illumination. This phenomenon was first discovered by Koenderink et al. (1996a, 1996b) and Christou and Koenderink (1997).” (The “phenomenon” is context-specific, since perceptions of 3D shape will certainly not always be sheared in the direction of illumination – it will depend on the shapes. All that can be said is that this sometimes happens).
Finally, we get to the point: “[Christou & Koenderink, 1997] speculated that the [high degree of] constancy was most likely due to information provided by visible smooth occlusion contours. The present investigation WAS DESIGNED SPECIFICALLY TO TEST THAT SUGGESTION, and the RESULTS SHOW CLEARLY that the absence of smooth occlusions in the masked conditions had a NEGLIGIBLE IMPACT [all caps mine] on the overall pattern of performance.”
So Christou and Koenderink's purportedly “reasonable” suggestion is apparently false. That's the point, and the authors shouldn't have been forced (or internalized a reequirement) to pussyfoot around it. They should have stated it as clearly up front as they do (eventually) in their discussion.
Falsification of FALSE theories is how science proceeds, and you can't show they're false unless you actually target specific assumptions for testing. Of course, proponents of the idea may, if they'd like, and can, make counterarguments.
So kudos to the authors for directly testing the claim, as they did in a previous article on an another ad hoc suggestion. Next time, I hope they adopt a more direct reporting style as well.
But on theory, there's more to be said, starting with https://pubpeer.com/publications/1220D804D501BB15474B6D0F33FC7D
On 2015 Aug 20, Lydia Maniatis commented:
The authors here report having “investigated how texture and stereo cues are integrated to perceive 3D slant.” The problem here (as with other literature dealing with the same topic) is with the unqualified references to “texture cues.”
2D “textures” are composed of 2D shapes, and 2D shape is dispositive when it comes to the perception of slant. If I start with a rectangle (or syncytium of rectangles) and I slant it so that it produces a trapezoidal 2D projection, then this projection will look like a slanted rectangle. If I start with a trapezoid and slant it so that it casts a rectangular 2D projection, then it will look like a fronto-parallel rectangle, not a slanted trapezoid. Perceived slant is a function of the shape of the projection.
Because shape is the key factor mediating apparent slant, and because textures are composed of shapes, saying that we will study the role of “texture” without specifying and controlling for the effects of the particular shapes of which the texture is composed is like proposing to investigate the role of “food cues” on blood pressure, without caring about what type of food we are employing as our “stimulus.” Such practice ensures the enduring confusion and ambiguity that characterizes slant studies, which often seem to contradict each other.
This study used “Voronoi” textures. Why? An earlier study (Todd et al, 2010) used textures composed of rectangles orthographically projected. Yet another study referred to by Saunders and Chen used Voronoi textures that were more regular than theirs. Do the authors believe that by using the type of structure the do, in which the cells' shape varies, and which has a particular degree of irregularity, they are controlling for the effects of shape? To continue my previous analogy, this would be like assuming that mixing many foods together will control for the effect of the individual nutrients on blood pressure.
If we know a variable matters, then we don't control for it by mixing it up its values, we control for it by controlling for it. “Food” in this analogy is obviously not an appropriate level of analysis, and the results will vary with the choice of “food.” The same goes for “texture.” What is left after we subtract shape? At the least, the authors should have provided some rationale for their choice of texture.
There is no doubt whatsoever that the choice of “texture” affects perceived slant. Erkelens (2013) used a “texture” composed of rectangles under perspective projection and found very good agreement with prediction, and an underestimation at all slants. Saunders and Chen found underestimation at low slants, and not at higher ones. They should explain why this low/high dichotomy should be found in their particular conditions, including their choice of pattern, and not in, e.g., Erkelens'. (Are they suggesting that by using “Voronoi” patterns, they have isolated the role of “texture,” independently of shape, and that their results are more valid?)
The authors' decision to deal with the potential role of the outline containing their texture by randomly varying this shape reflects the tendency to embed confounds in the data in the hope that they will average out (rather than distort or flatten the results – averaging black and white makes grey) rather than to confront and control for them head on.
Of course, they found that “texture” cues and disparity cues are somehow integrated (the claim that they are “optimally” integrated is difficult to judge, as it has been preceded by layers of speculation). The basic findings were a sure thing. The specifics of the data are uninterpretable due to lack of control of relevant variables.
On 2015 Apr 24, CHARLES KING commented:
I feel there is a serious methodological flaw in the recently published Cochrane Review “Circulating antigen tests and urine reagent strips for diagnosis of active schistosomiasis in endemic areas” by Ochodo, et el., 2015. The inaccurate analysis used in the HSROC estimation skews the reported summary results on the diagnostic performance of both antigen tests and dipsticks, and a correct analysis would actually invalidate several of the conclusions and recommendations found in the current version of the review: My objection is to the use of egg count diagnostics as a reference standard for the diagnosis of Schistosoma infection. The stool egg count for S. mansoni and S. japonicum and the urine filtration egg count for S. haematobium have long been known to be poorly sensitive for low intensity infections. When subjects are repeatedly tested for 7-15 days in a row, single day egg count testing has a sensitivity of 40-60%. Although these imperfect tests remain in widespread use in field studies and control campaigns because they accurately detect persons with heavy infections, they cannot be relied upon to establish infection in all subjects. The failings of stool counting for S. mansoni were documented in the work of de Vlas and colleagues cited below [1,2]. The limitations of stool counting for S. japonicum have been established by Carabin, et al.,[3] and Hubbard, et al.,[4] and the limitations of egg counting for S. haematobium can be found in Savioli et al.,[5] and Warren, et al.[6]
In all cases, egg counting cannot be considered a ‘gold standard’ diagnostic. Such a test, with ~50% sensitivity, is so inaccurate to be useless on a per-individual diagnostic basis. I feel that the appropriate comparison for the Ochodo, et al., review would have been Latent Class Analysis, in which two imperfect tests are compared in their attempt to classify an unmeasured ‘true’ infection status. Using egg count results as a reference standard in the HSROC was a serious error--reporting a new test’s performance benchmarked against an already flawed test is meaningless, and in fact, the reported comparisons are misleading to the practitioner or public health officer.
Secondly, I feel that the exclusion of results from populations or areas without significant Schistosoma risk was also a tactical error. If we are concerned about the specificity of new tests, there is great value in measuring results among persons who have a very low prior probability of infection.
I would strongly recommend that the Cochrane review be revised and re-issued after the authors revisit the data using the approach of Dendukuri, et al., 2012 [7] for situations where there is no gold standard. Their SAS code is available online, and the reanalysis could be done in a matter of a day. The Bayesian LCA should be informed by prior observations on the estimated specificity of single (or treble stool) examinations, and the known specificity estimates of dipsticks and antigen testing among non-endemic populations.
The concern is that while the authors discuss and reiterate the lack of a gold standard and the insensitivity of the egg count procedures they go right ahead and use them as their comparator and they present strong conclusions that are biased by their approach. This will only add to policymakers’ confusion about the utility of these alternative test approaches.
By way of disclosure, I have no relation to the manufacturers of these tests, and I have no conflict of interest in this matter.
On 2015 Jun 29, Bill Cayley commented:
A good example of when "Less" may be "more": https://lessismoreebm.wordpress.com/2015/05/15/surgical-vs-nonsurgical-treatment-of-adults-with-displaced-fractures-of-the-proximal-humerus-the-profher-randomized-clinical-trial/
On 2015 Mar 11, Alexis Clapin commented:
Congratulation for your work.
I would like to draw your attention on one of the four selected studies: MSCRG 1999 study(1). This study compared whole brain atrophy in relapsing-remitting MS patients treated with either Avonex or a placebo. One hundred forty patients are selected for this comparison. These patients participated to the initial MSCRG 1996 study (2), which was stopped earlier than planned. Among the 301 patients included, 172 were followed up for two years. The 140 patients are thus drawn from these 172 patients.
When reviewing the MSCRG 1996 study, the FDA analysed the efficacy of Avonex on the relapse rate for different subgroups of patients to check if, as Biogen said, there was a lag time between initiation of treatment and onset of clinical benefit. FDA reviewers demonstrated (3)that there was no lag time but that patients followed up for two years were different from those followed up for less than two years. During the first year of the study, Avonex patients followed up for less than two years experienced a +29% increase of the relapse rate versus placebo while patients followed up for at least two years experienced a -29% decrease versus placebo. During the second year, relapse rate did not change (-32%). FDA finally concluded that patients followed for two years were different from those followed up for less than two years, but did not provide a comparison of the subgroups.
The group of patients followed up for two years is thus a very odd subgroup of the randomised patients in the initial MSCRG 1996 study (2); obviously there are favouring the positive evaluation of the product.
For further explanation of the bias in the MSCRG 1996 study, you can see this analysis (4) on the MSCRG 1996 study (2).
The Cochrane collaboration recently considered that Avonex had a negative benefit/risk ratio (5). Their risk of bias analysis for the MSCRG (1996) (2) is more negative than the one you provide for the MSCRG 1999 study (1). To conclude, I am not sure that you can consider MSCRG 1999 (2) patients study as an unbiased subgroup of the initial MSCRG 1996 study (1). It is just a comparison of a group of best responders to Avonex to a group of worst responders to placebo.
(1)http://www.ncbi.nlm.nih.gov/pubmed/10563615 (2)http://www.ncbi.nlm.nih.gov/pubmed/8602746<br> (3)http://www.fda.gov/downloads/Drugs/DevelopmentApprovalProcess/HowDrugsareDevelopedandApproved/ApprovalApplications/TherapeuticBiologicApplications/ucm086056.pdf (4)http://www.ncbi.nlm.nih.gov/pubmed/23662092<br> (5)http://www.ncbi.nlm.nih.gov/pubmed/23744561
On 2015 Jul 10, Matthew Shirley commented:
I won't discount the utility of writing your own software to solve a problem, but I do take issue with the fact that this application note does not mention (reference) except in supplement #1 the existence of existing mature tools that accomplish much of what VASP aims to provide. The authors also do not clearly state what about the software is novel or better that these existing tools (only that it "makes no assumptions regarding the underlying disease transmission mechanism", which other programs arguably allow by integrating the results from multiple parameterized runs?). To be clear, I do not think these are reasons to prevent publication or development of this program - I just find the presentation of the research results a bit misleading.
On 2016 Jun 06, Dr, Stanley Goldberg commented:
Why would you transect the internal sphincter routinely when you only have to do it in a small proportion of the patients when the intra-sphincteric fistula persists?
On 2015 May 04, Christopher Southan commented:
Good paper, see http://cdsouthan.blogspot.se/2015/05/antimalarial-dot-joining-for-mmv008138.html for database mapping of compounds
On 2017 Mar 25, Gerhard Holt commented:
by Gerhard Holt
Research into cellular aging and the Senescence-Associated Secretory Phenotype indicates that selective elimination of senescent cells may provide substantial benefits - potentially including increases in healthspan.[1]
Many surface antigens may be differentially expressed on senescent/SASP cells relative to non-senescent cells. Ideally, the chosen cell surface antigen(s) would be highly specific to senescent/SASP cells to reduce collateral damage to non-senescent cells. For example, EFNB1 and/or EFNB3 may be appealing targets.[1]
These "Senescence Specific Surface Antigen" targets might - if necessary - include potentially spurious surface antigens that may have negligible causal relation to SASP but are nevertheless fairly specific. One could presumably also target multiple "SSSA"s to achieve better coverage.
Several methods to target cells expressing these SSSA's might be used - including :
(1) CAR-T cells vs the antigen(s). [2]
Pros :
Extensive removal of target cells. Long lasting surveillance against subsequent reemergence of the senescent/SASP cells with those surface antigens.
Cons :
May cause collateral damage or impair other important functions (for example - potentially - wound healing).
Questions :
Could one potentially embed a switchable "suicide gene" in the CAR-T cells, or perhaps a reversible switch to transiently deactivate the CAR-Ts either systemically or locally?
Could one also embed a highly specific artificial set of inducible surface antigens on the CAR-Ts to facilitate subsequent removal or modification by mAbs or minicells (see below)?[3]
(In the longer term one might also potentially examine logic-gated CAR-T cell approaches for increased specificity, or to target the absence of a surface antigen that is differentially expressed on Non-senescent cells ? [3])
(2) mAbs vs the antigen(s).
Pro :
Well established approach.
Con :
No longer term surveillance.
(3) Minicells vs the antigen(s). [4]
Pros :
Highly specific targeting. Minicells could also be targeted to multiple different SSSA's.
Can specifically carry cytotoxic medications to the target cells.
Can add siRNAs to the minicells to perform more subtle intracellular actions (perhaps inducing apoptosis, reversing (or accelerating) aberrant intracellular processes, attracting CAR-T cells, or modifying natural immune responses to the cell, or expressing alternative surface antigens).
Could be used in addition to CAR-T approaches, or perhaps as a backup to help selectively deactivate CAR-T cells if responses cause excessive collateral damage or if one needs to (perhaps temporarily) damp the response.
Con :
No long term surveillance.
Targeting senescence specific surface antigens may be a useful way to selectively destroy senescent/SASP cells.
The application of CAR-T cell, mAb, and minicell approaches might be effective in this task, and will hopefully be the subject of further research.
[1] Zhu, Y. Tchkonia, T. et al. (2015) The Achilles' heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell. 2015 Aug;14(4):644-58. doi: 10.1111/acel.12344. Epub 2015 Apr 22.
www.ncbi.nlm.nih.gov/pubmed/25754370
[2] Kochenderfer JN et al. (2010) Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells. Blood. 2010 Nov 11;116(19):3875-86. doi: 10.1182/blood-2010-01-265041. Epub 2010 Jul 14.
www.bloodjournal.org/content/bloodjournal/116/19/3875.full.pdf
[3] Roybal, K.T., et al. (2016). Precision tumor recognition by T cells with combinatorial antigen-sensing circuits. Cell 164, 770–779. dx.doi.org/10.1016/j.cell.2016.01.011
www.sciencedirect.com/science/article/pii/S0092867416000519
[4] MacDiarmid, J.A. et al. (2009) Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug. Nat. Biotechnol. 27, 643–651.
www.nature.com/nbt/journal/v27/n7/pdf/nbt.1547.pdf
On 2017 Jan 13, Yuwei Fan commented:
How could VITA Enamic contain "high amount of Al2O3 (approximately 23 wt%)"? There is no actual alumina phase in Enamic. A very misleading article.
On 2017 Apr 20, Richard L Harvey commented:
Yes, the electrode was placed ipsilesionally and localized using stereotaxic techniques based on perilesional fMRI signal during affected hand movement tasks.
On 2017 Apr 18, Lawrence Moon commented:
Does this report mention where stimulation was performed? Based on the Harvey et al paper previously I'm assuming it's ipsilesional to infarct.
On 2015 Mar 11, David Mage commented:
This comment was written from reading this abstract the instant it was uploaded before the link to the pdf was added by PUBMED. A final comment is added at the end as a CODA that was made necessary when the article was read. The medical literature has at this instant of writing 10778 PUBMED returns for SIDS (some are not on sudden infant death syndrome but with the same acronym). Most of them are worthless shots-in-the-dark hoping to hit something. The burgeoning literature has an insatiable demand for content and editors and reviewers are not guarding the gates, as true experts cannot review every article submitted in their fields before publication. Hundreds of articles are written on small sample size studies that report a glimmer of a correlation of SIDS with something that they hope by some undiscovered alchemical legerdemain can be converted into a causation. And yet, as the sample size increases the vision of gold always becomes one of pyrites. Its like the fisherman hooking something big leading to visions of a record size catch, only to find when it breaks the surface that it is an old tire. Temperature is involved with SIDS but in the completely opposite direction. SIDS rate maximizes in the winter, not in the summer. Hawaii, a state without seasons, (O.K., maybe beautiful weather and very beautiful weather) has a maximum SIDS rate in the Northern hemisphere winter (Mage DT, 2004) that we relate to the higher incidence of respiratory infection in Japan and the continental U.S. by a tourist infection vector (Mage DT, 2009). This writer served with the WHO and spent 3.5 years in Malaysia where the tropical seasonal heat and humidity on a normal day would put Montreal to shame on its hottest and most humid day. O.K. now lets look at Canada (Mage DT, 2005). For years 1985-89 and 1994-1998 there were in all of Canada during the winter (Jan-Mar) 504 SIDS and 368 SIDS in the summer (Jul-Sep). Oh high temperature, where is thy sting? CODA: The authors wrote perceptively a la Trofim Desinovich Lysenko - "Another issue is that Taiwan has a mild climate with a population accustomed to heat, which may mitigate the impact of temperature on SIDS." Ah yes, the parental accomodation to heat by living in semi-tropical Taiwan is passed on through their mutated-genes to their offspring who at birth have their parent's ability to withstand the fearsome heat waves uniquely endemic to Taiwan.
On 2015 Jul 25, Kamaldeep Bhui commented:
see also: Health Technol Assess. 2015 Apr;19(31):vii-xxiv, 1-173. doi: 10.3310/hta19310.
If you're interested in this paper, see also:
Interventions designed to improve therapeutic communications between black and minority ethnic people and professionals working in psychiatric services: a systematic review of the evidence for their effectiveness.
Bhui K(1), Aslam RW(1), Palinski A(1), McCabe R(1), Johnson MR(2), Weich S(3), Singh SP(3), Knapp M(4), Ardino V(4), Szczepura A(3).
We need more debate and research on the components of interventions to improve therapeutic communications, and engage socially excluded or hard to reach populations.
On 2015 Jul 25, Kamaldeep Bhui commented:
The affiliation for Bhui and the host institution in this publication is incorrect. It should be Queen Mary University of London, and not Swansea University which is the affiliation for Dr Ahmed.
On 2015 Dec 11, Mark Johnston commented:
An interactive protocol from this article is freely available at protocols.io.
On 2015 Mar 19, David Keller commented:
High-dose Coenzyme Q10 was safe in the Parkinson Study Group trial
In their reply to my letter [1] pointing out that the doses of Coenzyme Q10 tested may have been too small to treat statin-induced myopathy, Banach and Mikhailidis state: "Another question is whether higher dosages of CoQ10 have adverse effects. Contemporary data concerning the administration of CoQ10 at dosages higher than 1200 mg/d are limited" [2].
To address these safety concerns, consider the Parkinson Study Group's trial of high-dose CoQ10; 600 subjects with early Parkinson disease were randomized to placebo or to high-dose CoQ10. 94 subjects received placebo, 87 received 1200 mg/d of CoQ10, and 86 received 2400 mg/d of CoQ10 [3]. Only 65 participants withdrew prematurely: 29 who received placebo, 19 who received 1200 mg/d of CoQ10, and 17 who received 2400 mg/d of CoQ10, and it was reported that "treatments were well tolerated with no safety concerns".
While it was disappointing that high-dose Coenzyme Q10 did not slow the progression of Parkinson's disease, at least we learned that doses of up to 2400 mg per day seem to be safe and well-tolerated.
References
1: Keller DL. Coenzyme Q10 and statin-induced myopathy--I. Mayo Clin Proc. 2015 Mar;90(3):419-20. doi: 10.1016/j.mayocp.2015.01.006. PubMed PMID: 25744125.
2: Banach M, Mikhailidis DP; Lipid and Blood Pressure Meta-analysis Collaboration (LBPMC) Group. In reply-Coenzyme Q10 and Statin-Induced Myopathy. Mayo Clin Proc. 2015 Mar;90(3):420-1. doi: 10.1016/j.mayocp.2015.01.003. PubMed PMID: 25744127.
3: Parkinson Study Group QE3 Investigators, A randomized clinical trial of high-dosage coenzyme Q10 in early Parkinson disease: no evidence of benefit. JAMA Neurol. 2014 May;71(5):543-52. doi: 10.1001/jamaneurol.2014.131. PubMed PMID: 24664227.
On 2015 Oct 07, Bill Cayley commented:
A good example of when "less-medical" is better in wound care: https://lessismoreebm.wordpress.com/?s=wound
On 2015 Mar 17, Christopher Southan commented:
This link includes the PubChem matches for the three sets of structures http://cdsouthan.blogspot.se/2015/03/getting-open-kinetoplast-data-more-open.html
On 2015 Mar 10, Donald Forsdyke commented:
ADAPTATION DECOUPLED FROM SPECIATION. This fine new paper presents an impressive synthesis of phylogenetic data aiming to “explore how it bears on evolutionary hypotheses and mechanisms of speciation and diversification.” In keeping with the results of Venditti et al. (2010) that are cited, the major conclusion is that “if adaptation is largely decoupled from speciation, we should not expect it to be a driver of speciation.” Indeed, “Cases where the phenotype has changed little (e.g. cryptic species) … are interpreted here as evidence of uncoupling.” There is reference to geographic isolation as “the major model,” but it is noted that “time constraints should be similar with ecological speciation, and other models exist.”
One of these “other models” is considered by Venditti et al. (2008 Biologist 55, 140-146), who note: “There is a growing appreciation amongst evolutionary biologists that rapid reproductive isolation is more common than previously thought and is often associated with what is known as sympatric speciation, or speciation between populations which share the same geographic range.” The idea of a non-geographic decoupling of adaptation from speciation was advanced by Darwin’s research associate George Romanes in 1886. As with Venditti et al. (2010), the present results nicely support Romanes, whose work is the major focus of my speciation text (The Origin of Species, Revisited, McGill-Queen's University Press, 2001). There is further elaboration both in our biography of the geneticist William Bateson (Treasure Your Exceptions, Springer, New York, 2008) and in my textbook Evolutionary Bioinformatics (Springer, New York, 2011).
On 2015 Jul 25, Egon Willighagen commented:
David, you may want to read with J. Wales has to say about this [0]:
But if the Professor has a more nuanced view that Wikipedia should not be cited "as a source" by university students then I agree completely! I think the same thing about citing Britannica or any other encyclopedia. Citing an encyclopedia for an academic paper at the University level is not appropriate
On 2015 Jul 23, James M Heilman commented:
You sort of missed the point. The point is that Wikipedia is incredibly frequently read. This includes by the lay public, medical students, and physicians. One can warn people until they are blue in the face but I doubt it is going to change how frequently they use Wikipedia for medical information. In my opinion time is much better spent trying to improve the site. It really is not that difficult.
On 2015 May 11, David Gortler commented:
I have to say that although this data sounds promising, I would never use wikipedia as an authoritative resource for anything patient-related, and firmly instill warnings regarding wikipedia to my students as well. I was given a moderator account at one point and took time and effort to carefully compose several specialty pharmacology articles, only to have those articles edited incorrectly, filled with obvious biases, or inexplicably "re-organized" to the point that they were essentially vandalized. I had offenders blocked or banned, only to have scores more crawl out of the bowels of the internet to do the same. I have since stopped trying to correctly edit or even view my articles for accuracy.
The last time I used wikipedia was years ago and I think it was to look up something about vintage automobiles. I also looked up Gilligan's Island on it around the same time. That's about as far as I would trust it. Anyone who relies on wikipedia for anything clinically related is placing patient lives at risk. Anyone who relies on wikipedia to look up anything or research related is wasting their time and money.
On 2015 May 10, James M Heilman commented:
Yes looking at top editors I know most of those listed. A proportion are those who write a great deal of content and mostly work on medicine. Another proportion are those who do maintenance and vandalism reversion Wikipedia wide. What we are capturing is only a proportion of their edits as we just looked at medical editors. If we were to look at Wikipedia as a whole they would far surpass all those listed here.
So I agree on a global scale the top editors are more involved in maintenance. However within a specific area the top editors are more content contributors (there are of course still maintence people aswell).
On 2015 May 08, Gwinyai Masukume commented:
Thank you for engaging with this and making the data publicly available.
Five users appear on both lists (Top ten by number of bytes changed and Top ten by number of edits) and only one user is in the same position.
Perhaps the situation is a hybrid of Jimmy Wales’ and Aaron Swartz’s thoughts, the degree differing depending on the context. Looking forward to further insights from your data.
On 2015 May 13, James M Heilman commented:
And now we have data for 2014 https://en.wikipedia.org/wiki/Wikipedia:WikiProject_Medicine/Stats/Top_English_medical_editors_2014
On 2015 May 07, James M Heilman commented:
We now have data looking at the top editors for 2013 based on bytes changed here https://en.wikipedia.org/wiki/Wikipedia:WikiProject_Medicine/Stats/Top_English_medical_editors_2013b
There is a fairly good relationship with top editors for 2013 based on number of edits here https://en.wikipedia.org/wiki/Wikipedia:WikiProject_Medicine/Stats/Top_English_medical_editors_2013
So my analysis is more in line with the thoughts of Jimmy Wales rather than Aaron Swartz.
On 2015 Mar 26, James M Heilman commented:
Often people with the highest edit count also have the largest number of bytes changed.
One would really want to look at the persistent bytes contributed by a user. One also needs to keep in mind that more text is not necessarily better text. Lots of improvements involved trimming material.
Agree that their is no perfect measure of "authorship" which can be carried out in an automated fashion. Will look at running the analysis you suggest and posting the results here.
On 2015 Mar 21, Gwinyai Masukume commented:
The authors use the number of edits made to measure participation. An edit, for example, can be adding a full stop/period “.” or it can be adding a whole paragraph. Each of these actions would be counted as one edit.
Another way to measure participation is by considering the amount of text added by a contributor. This approach of considering the amount of text added has in the past yielded different results and insights compared to considering the number of edits made. Some contributors with relatively low edit counts have been found to have added a relatively high amount of text.
I am of the view that only using edit counts is a limitation. This limitation could have been remedied by considering the amount of text added by contributors from a limited number of randomly selected articles from the authors' sampling frame.
Reference
Swartz A. Who writes Wikipedia? 2006. Available: http://www.aaronsw.com/weblog/whowriteswikipedia (accessed 21 March 2015).
On 2016 Aug 23, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0157384. We believe the correct ID, which we have found by hand searching, is NCT01573845.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2017 Jul 13, Randi Pechacek commented:
Bubba Brooks, co-author of this paper, wrote a blog on microBEnet giving background and commentary.
On 2015 Apr 21, David Keller commented:
Clinical recommendations should not be biased by economic considerations
These recommendations for treatment of pressure ulcers ("bed sores") ignore the evidence in favor of certain mattress types, simply because of cost considerations. For example, air-fluidized beds have moderate quality evidence of reducing pressure ulcer size, compared with other surfaces, leading to an improved overall treatment effect (see Table 3 of this paper). In trying to understand why air-fluidized beds were not included in the recommended treatments for pressure ulcers, I noted that the section on "High Value Care" states that "the use of advanced support surfaces adds unnecessary costs to the health care systems". However, the evidence demonstrating improvement due to electrical stimulation was of similar quality ("moderate") as air-fluidized beds. Electrical stimulation was included in the recommended treatments for pressure ulcers. Is electrical stimulation really less expensive than an air-fluidized bed, after accounting for the professional fees charged by the clinician providing that service? How many communities have such a clinician? The cost of air-fluidized beds, like any other commodity, is flexible and based on the volume of orders received. A recommendation by ACP for air-fluidized beds would increase the number of orders and decrease the cost of such beds, due to economies of scale. Economic considerations should not bias clinical recommendations. We are physicians, not economists. We should make recommendations purely on the basis of clinical benefits, and leave the economic analysis to experts in that field, who are more qualified to provide such analysis.
On 2015 Sep 18, Sacha Laurent commented:
I've written an opinion piece on my blog where I discuss the findings of this paper and their impact on the "evolutionary success polyploids" debate. I'll be happy to get any feedback or opinion. Yours,
On 2016 Jan 01, Jaime A. Teixeira da Silva commented:
I have self-published my views on this paper.
Teixeira da Silva, J.A. (2016) Assessing the potentially misleading nature of metrics and of those who assess and create them. Self-published 4 pp. https://www.researchgate.net/publication/288835044
On 2016 Jan 11, BSH Cancer Screening, Help-Seeking and Prevention Journal Club commented:
Relevant to our current research goals, the HBRC journal club was interested to review this paper with particular interest in adding to our understanding of the role of descriptive norms in cancer risk-reducing behaviours. The paper demonstrates a strong rationale for investigating the role of descriptive norms in established risk-reducing behaviours, and in uncertain and relatively unknown behaviours. Furthermore, it offers an additional explanation to the reasons why descriptive norm literature is usually inconsistent, or every so often insignificant for health-behaviour change.
The study employed a cross-sectional design that included an opportunistic sample aged 18 to 95, and reported the use of a theoretical framework, known as the Integrative Model of Behavioural Prediction, which strengthened the methodology of the paper. Although the authors acknowledged their decision for defining uncertainty as a limitation, they attributed the uncertainty of risk-reducing behaviours using scientific knowledge rather than public perceptions of the uncertainty of the behaviours. However, we felt that the study might have benefited from the inclusion of other elements such as beliefs about causes of cancer, scientific literacy, or specifically knowledge, and controlling for age to evaluate further associations with descriptive norms and scientific uncertainty.
The journal club also discussed the possibility of controlling for individuals’ current health behaviours as another factor that could influence descriptive norms. We also deliberated on whether the established risk-reducing behaviours are also linked to other chronic illnesses, therefore; there may be differences in motivations to take up those behaviours.
Overall, the HBRC journal club enjoyed reading this article and feel that the paper is an important example of using integrated theoretical models which could improve the way we implement theoretically grounded research.
Conflicts of interest. We report no conflict of interests and note that the comments produced by the group are collective and not the opinion of any one individual.
On 2015 Mar 03, Robert Eibl commented:
Looks like a great, new approach; fascinating.
On 2015 Mar 27, James M Heilman commented:
A great analysis of this paper exists here https://en.wikipedia.org/wiki/Wikipedia:Wikipedia_Signpost/2015-03-25/Recent_research
"A paper in Advances in Physiology Education[2] claims to assess the suitability of Wikipedia's respiratory articles for medical student learning. Forty Wikipedia articles on respiratory topics were sampled on 27 April 2014. These articles were assessed by three researchers with a modified version of the DISCERN tool. Article references were checked for accuracy and typography. Readability was assessed with the Flesch–Kincaid and Coleman–Liau tools.
The paper found a wide range of accuracy scores using the modified DISCERN tool, from 14.67 for "[Nail] clubbing" to 38.33 for "Tuberculosis". Incorrect, incomplete or inconsistent formatting of references were commonly found, although these were not quantified in the paper. Readability of the articles was typically at a college level. On the basis of these findings, the paper declares Wikipedia's respiratory articles as unsuitable for medical students.
The researcher apparently uses an arbitrary unvalidated modification of the DISCERN tool to assess the accuracy of articles. The nature of this modification is not specified; nor is it available at the journal's website as claimed in the paper.
The DISCERN tool does not assess accuracy; rather, it is designed to assess "information about treatment choices specifically for health consumers". As such, the use of this tool is inappropriate to assess the suitability for medical students.
There is no acknowledgement that Wikipedia is an encyclopedia. Several of the DISCERN tool's questions are unsuitable for an encyclopedia. DISCERN questions such as "Does it describe how each treatment works?" and "Does it describe the risks of each treatment?" would be answered on other Wikipedia pages, not on the disease article's page. The author makes an a priori assumption that the medical textbooks used for comparison are perfect sources. The author does not assess those textbooks with the DISCERN tool.
The paper states: "[t]he number of citations from peer-reviewed journals published in the last 5 yr was only 312 (19%)." However this is far superior to the number of citations in the textbooks listed. The chapter on "Neoplasms of the lung" in Harrison's Principles of Internal Medicine (18th ed.) contains no citations at all. Seven sources are listed in its "Further readings" section, of which only one is from the last five years.
The claim that the article on "clubbing ... had no references or external links" is incorrect. On 27 April 2014, Wikipedia's article on "Nail clubbing" had ten references.
Several of the articles are at a rudimentary stage, containing limited information and lacking appropriate references. However two articles, "Lung cancer" and "Diffuse panbronchiolitis", were assessed by Wikipedia's editors at the highest standard and awarded "Featured article" status. Five more articles, "Asthma", "Chronic obstructive pulmonary disease", "Pneumonia", "Pneumothorax" and "Tuberculosis", reached "Good article" standard. These articles are exceptionally detailed, accurate, and well-referenced. Azer's paper makes no mention of the high quality of these articles.
The research uses an unvalidated tool for an inappropriate purpose without applying a suitable comparator, and inevitably draws incorrect conclusions.
Wikipedia is an encyclopedia. It is not a medical textbook; nor is it intended to replace medical textbooks. Rather, it should be used as a starting point by medical students. The quality of an individual article should be quickly assessed by the reader, and information can be confirmed in the references provided. Missing information should be sought from other sources, such as textbooks. Students should be encouraged to use Wikipedia alongside medical textbooks to assist their learning."
It is by User:Axl and is under a CC BY SA license
On 2016 Jul 05, STEPHEN ROPER commented:
Despite the impressive technique and the many fine figures in this paper, the findings regarding the microvascular permeability in taste buds (Fig 4) are deeply flawed. Specifically, the authors purport to show that compounds such as fluorescein injected into the blood stream have ready access to the cells within taste buds (Fig. 4g-i). Regrettably, this figure, and specifically Fig 4h, reveals a serious misconception about taste buds. This micrograph shows fluorescein-laden lingual surface epithelial squames surrounding the taste bud pore. It does NOT show taste cells. The taste bud itself lies below this plane of focus. Because the quantification in Fig 4i is taken from Fig 4h, it thus is correspondingly in error. Compounds injected into the bloodstream indeed have ready access to the stratified lingual epithelium, including superficial layers, as shown by a previous publication (Dando et al, 2015, Am J Physiol Cell Physiol. 308:C21-32. Epub 2014 Sep 10).
In fact, contrary to the conclusions reported here, there is some form of selectively permeable barrier protecting taste bud cells from many blood-borne chemicals (ibid.). Indeed, Fig. 4g of Choi et al may be consistent with such a barrier, assuming that the relatively fluorescein-free central area in this micrograph is a taste bud. [It might merely be the somewhat acellular connective tissue core of the papilla. This would also be relatively free of fluorescein].
On 2015 Mar 18, George McNamara commented:
See also
Assessing the prevalence of mycoplasma contamination in cell culture via a survey of NCBI's RNA-seq archive. Olarerin-George AO, Hogenesch JB. Nucleic Acids Res. 2015; 43(5): 2535-42. doi: 10.1093/nar/gkv136. PMID: 25712092 Mycoplasmas are notorious contaminants of cell culture and can have profound effects on host cell biology by depriving cells of nutrients and inducing global changes in gene expression. Over the last two decades, sentinel testing has revealed wide-ranging contamination rates in mammalian culture. To obtain an unbiased assessment from hundreds of labs, we analyzed sequence data from 9395 rodent and primate samples from 884 series in the NCBI Sequence Read Archive. We found 11% of these series were contaminated (defined as ≥100 reads/million mapping to mycoplasma in one or more samples). Ninety percent of mycoplasma-mapped reads aligned to ribosomal RNA. This was unexpected given 37% of contaminated series used poly(A)-selection for mRNA enrichment. Lastly, we examined the relationship between mycoplasma contamination and host gene expression in a single cell RNA-seq dataset and found 61 host genes (P < 0.001) were significantly associated with mycoplasma-mapped read counts. In all, this study suggests mycoplasma contamination is still prevalent today and poses substantial risk to research quality.
On 2015 Sep 01, Coby Viner commented:
A version of this article is now publicly available from TSpace (University of Toronto's institutional repository). The post-print version remains available from the publisher.
On 2016 Jan 16, Lewis G Halsey commented:
Fay worries that in the real world of data collection, the power of a study is not known in advance. If true, this argument would only compound our own, which is that unless power is very high (>90%) P has surprisingly low repeatability (Halsey et al., 2015), and the power of most studies calculated after the data analysis is far lower than this (Button et al., 2013, Maxwell, 2004). Therefore, researchers would not be able to design their experiment to ensure it has a very high power, and they could not rely on good fortune instead for their experiment to turn out this way.
But anyway, an integral step in testing the null hypothesis generates an estimate of the variance of the pooled population. Using this estimated parameter, obtained as the data are analysed, the researcher can immediately gauge the study’s power. The exact parameters of the population are never known. These parameters are hypothesised and then estimated, with varying certainty, according to the sample that we have. With a limited sample, these estimates can vary substantially each time an experiment is repeated. If our samples, and the estimates they generate, suggest that power is poor, then any P value that we obtain, low or not, is untrustworthy. A small P value is of little import: a repetition of the same study would give another result (our study, figure 4). This is like looking at the world through a pinhole. When the theoretical power is 0.48, P values less than 0.05 are no more likely than P values greater than 0.05. Why get excited if P is <0.01, when the next replicate experiment could give a P of 0.6?
Fay asks if there is a single better measure than P to test the likelihood that the null hypothesis is untenable. First, this brings us back to the nub of the problem - P is only a good test of the null in the ideal circumstances that study power is very high. Second, there are long-held, big concerns about the value of null hypothesis significance testing as a method for analysing and interpreting data (Cohen, 1994).
Lewis G Halsey and Gordon B Drummond
BUTTON, K., IOANNIDIS, J., MOKRYSZ, C., NOSEK, B., FLINT, J., ROBINSON, E. & MUNAFO, M. (2013) Power failure: why small sample size undermines the reliability of neuroscience. Nature Reviews Neuroscience, 14, 365-376. COHEN, J. (1994) The Earth is round (p < 0.05). American Psychologist 49, 997-1003. HALSEY, L., CURRAN-EVERETT, D., VOWLER, S. & DRUMMOND, G. (2015) The fickle P value generates irreproducible results. Nature Methods, 12, 179-185. MAXWELL, S. (2004) The persistence of underpowered studies in psychological research: Causes, consequences, and remedies. Psychological Methods, 9, 147-163.
On 2016 Jan 13, Mike Fay commented:
Halsey, Curran-Everett, Vowler, and Drummond (2015) correctly point out that P values are variable and that estimates and confidence intervals often provide more useful information. I disagree with some of the apparent implications they make from these points. For example, they state “The P value is often used without the realization that in most cases the statistical power of a study is too low for P to assist the interpretation of the data.” The problem with this statement is that in practice we never know the statistical power of a study, so we never know if it is too low. The statistical power is a function of the sample size, the statistical model and the true value of the parameters. If the statistical model describes the data generating process and we knew the true value of the parameters, then we could know the power. The problem is that we collect data precisely because we do not know the true value of the parameters, and hence do not know the power. So we never know if the power of a study is “too low”. P can assist in interpreting the data. The P value represents the probability of observing equal or more extreme data when the null hypothesis is true. So small values of the P value imply that the null hypothesis is not likely to hold.
Here is another quote from the paper: “Put simply, the P value is usually a poor test of the null hypothesis.” This statement begs the question, is there another single statistic that is better to test the null hypothesis? If you want one statistic to test the null hypothesis, the P value is just the statistic to do that. So the P value is not “flawed” (see last paragraph of the article), but is one statistic designed to perform one function. Certainly, P values should not be the whole statistical story for any data set, but they can work for what they are designed to do.
On 2015 Mar 02, William Grant commented:
For a paper on how increasing vitamin D intake and levels might reduce the mortality rates for those with disabilities, see this open access paper: Grant WB, Wimalawansa SJ, Holick MF, Cannell JJ, Pludowski P, Lappe JM, Pittaway M, May P. Emphasizing the health benefits of vitamin D for those with neurodevelopmental disorders and intellectual disabilities. Nutrients. 2015, 7, 1538-1564. http://www.mdpi.com/2072-6643/7/3/1538
On 2016 Feb 05, Christopher Southan commented:
zileuton = http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5297 (but racemate)
MMV007384 = https://pubchem.ncbi.nlm.nih.gov/compound/17325420
MMV666023 = https://pubchem.ncbi.nlm.nih.gov/compound/2853195
MMV665805 = https://pubchem.ncbi.nlm.nih.gov/compound/16437129
On 2015 Aug 19, Bill Cayley commented:
A good example of when less-medical is better: https://lessismoreebm.wordpress.com/2015/07/02/allergy-in-children-in-hand-versus-machine-dishwashing/
On 2015 Mar 05, Ivan Oransky commented:
Mario Saad, one of the authors of the four papers subject to this expression of concern, has sued the journal to force them to remove the expression of concern, and to prevent them from retracting the papers: http://retractionwatch.com/2015/03/05/researcher-asks-court-to-overturn-motion-denying-his-request-to-quash-expressions-of-concern/
On 2016 Jan 08, Andrea Messori commented:
Drug-drug interactions in oncology
A.Messori, HTA Unit, Regional Health Service, 50100 Firenze, Italy and SIFACT (Società Italiana di Farmacia Clinica e Terapia), 20100 Milano
In the field of oncology, drug-drug interactions (DDIs) represent a topic in which a large amount of information is available. Hence, a critical selection in this area is generally thought to be needed to maximize the usefulness of recommendations and to avoid an overload of messages. In this selection process, two criteria are most frequently advocated: (1): prioritizing the DDIs showing a marked clinical relevance (that, in the main data banks, are denoted as major interactions or contra-indications); (2): prioritizing those DDIs the frequency of which is not negligible and has been documented in the real-world setting. The first point is adequately addressed by the scores assigned to single DDIs in the most authoritative data banks (e.g. Micromedex). As regards the second point, the reference list reported below indicates which DDIs have been most frequently found in the main studies conducted on this topic in cancer patients. References 1. Carcelero E, Anglada H, Tuset M, Creus N. Interactions between oral antineoplastic agents and concomitant medication: a systematic review. Expert Opin Drug Saf. 2013 May;12(3):403-20. doi: 10.1517/14740338.2013.784268. Epub 2013 Apr 16. Review. PubMed PMID: 23586848.
Chan A, Tan SH, Wong CM, Yap KY, Ko Y. Clinically significant drug-drug interactions between oral anticancer agents and nonanticancer agents: a Delphi-survey of oncology pharmacists. Clin Ther. 2009;31 Pt 2:2379-86. doi: 10.1016/j.clinthera.2009.11.008. PubMed PMID: 20110047.
Depont F, Vargas F, Dutronc H, Giauque E, Ragnaud JM, Galpérine T, Abouelfath A, Valentino R, Dupon M, Hébert G, Moore N. Drug-drug interactions with systemic antifungals in clinical practice. Pharmacoepidemiol Drug Saf. 2007 Nov;16(11):1227-33. PubMed PMID: 17879355.
Girre V, Arkoub H, Puts MT, Vantelon C, Blanchard F, Droz JP, Mignot L. Potential drug interactions in elderly cancer patients. Crit Rev Oncol Hematol.2011 Jun;78(3):220-6. doi: 10.1016/j.critrevonc.2010.05.004. Epub 2010 Jul 1. Review. PubMed PMID: 20594867.
Kotlinska-Lemieszek A, Klepstad P, Haugen DF. Clinically significant drug-drug interactions involving opioid analgesics used for pain treatment in patients with cancer: a systematic review. Drug Des Devel Ther. 2015 Sep 16;9:5255-67. doi: 10.2147/DDDT.S86983. eCollection 2015. Review. PubMed PMID: 26396499; PubMed Central PMCID: PMC4577251.
Kruse V, Somers A, Van Bortel L, De Both A, Van Belle S, Rottey S. Sunitinib for metastatic renal cell cancer patients: observational study highlighting the risk of important drug-drug interactions. J Clin Pharm Ther. 2014 Jun;39(3):259-65. doi: 10.1111/jcpt.12134. Epub 2014 Jan 13. PubMed PMID:24417304.
Miranda V, Fede A, Nobuo M, Ayres V, Giglio A, Miranda M, Riechelmann RP. Adverse drug reactions and drug interactions as causes of hospital admission in oncology. J Pain Symptom Manage. 2011 Sep;42(3):342-53. doi: 10.1016/j.jpainsymman.2010.11.014. Epub 2011 Mar 31. PubMed PMID: 21454043.
Riechelmann RP, Del Giglio A. Drug interactions in oncology: how common are they? Ann Oncol. 2009 Dec;20(12):1907-12. doi: 10.1093/annonc/mdp369. Epub 2009 Aug 27. Review. PubMed PMID: 19713244.
Stoll P, Kopittke L. Potential drug-drug interactions in hospitalized patients undergoing systemic chemotherapy: a prospective cohort study. Int J Clin Pharm. 2015 Jun;37(3):475-84. doi: 10.1007/s11096-015-0083-6. Epub 2015 Feb 25. PubMed PMID: 25711852.
Teo YL, Ho HK, Chan A. Metabolism-related pharmacokinetic drug-drug interactions with tyrosine kinase inhibitors: current understanding, challenges and recommendations. Br J Clin Pharmacol. 2015 Feb;79(2):241-53. doi:10.1111/bcp.12496. Review. PubMed PMID: 25125025; PubMed Central PMCID: PMC4309630.
Turner JP, Shakib S, Singhal N, Hogan-Doran J, Prowse R, Johns S, Bell JS. Prevalence and factors associated with polypharmacy in older people with cancer. Support Care Cancer. 2014 Jul;22(7):1727-34. doi: 10.1007/s00520-014-2171-x. Epub 2014 Mar 2. Erratum in: Support Care Cancer. 2014 Jul;22(7):1735. PubMed PMID:24584682.
van Leeuwen RW, Brundel DH, Neef C, van Gelder T, Mathijssen RH, Burger DM, Jansman FG. Prevalence of potential drug-drug interactions in cancer patients treated with oral anticancer drugs. Br J Cancer. 2013 Mar 19;108(5):1071-8. doi: 10.1038/bjc.2013.48. Epub 2013 Feb 14. PubMed PMID: 23412102; PubMed CentralPMCID: PMC3619066.
van Leeuwen RW, van Gelder T, Mathijssen RH, Jansman FG. Drug-druG interactions with tyrosine-kinase inhibitors: a clinical perspective. Lancet Oncol. 2014 Jul;15(8):e315-26. doi: 10.1016/S1470-2045(13)70579-5. Review. PubMed PMID: 24988935.
Voll ML, Yap KD, Terpstra WE, Crul M. Potential drug-drug interactions between anti-cancer agents and community pharmacy dispensed drugs. Pharm World Sci. 2010 Oct;32(5):575-80. doi: 10.1007/s11096-010-9410-0. Epub 2010 Jul 20.PubMed PMID: 20645002.
On 2015 Mar 30, John Cannell commented:
In Denmark, like all Scandinavian countries, the use of cod liver oil is common. Cod liver oil will raise 25(OH)D levels but also increase vitamin A intake. Increased vitamin A intake has been associated with increased mortality. This would explain the J shaped relationship found by the authors.
Bjelakovic G, Nikolova D, Gluud LL, Simonetti RG, Gluud C. supplements for prevention of mortality in healthy participants and patients with various diseases. Cochrane Database Syst Rev. 2008 Apr 16;(2):CD007176.
On 2015 Feb 25, Sundeep Salvi commented:
The sexual dysfunction seen only in Type I diabetic females could be due to use of Insulin rather than other causes as mentioned. Among Type 2 diabetic females, how many were receiving insulin? Was there a difference in sexual dysfunction between Type 2 diabetic females using insulin and those not using insulin?
On 2017 May 19, Zvi Herzig commented:
The methodology of this study would lead to unrealistic overheating producing unrealistically high levels of toxicants. The authors note:
The E-cigarette puffs were actuated by a pump and programmed to cycle every 15 seconds until the cartridge was empty. Each actuation was 6 seconds...
However, puffing an e-cigarette until the cartridge is empty would lead to overheating when liquid levels fall low, which users avoid, but entails high levels of toxicant production Farsalinos KE, 2013 Farsalinos KE, 2015.
Also, users have been shown to take four-second puffs with 20-30 s intervals Farsalinos KE, 2013. Increasing puff duration and decreasing the time of the cycle between puffs would also increase overheating.
On 2017 Sep 09, Louise B Andrew MD JD commented:
Reason(s) for withdrawal?
On 2015 Apr 21, David Keller commented:
The observed association between sauna bathing and improved cardiovascular outcomes may be due to self-selection bias
Persons at higher risk for adverse cardiac events may experience unpleasant symptoms due to the tachycardia induced by sitting in a hot sauna, such as mild dyspnea, orthostasis, or chest discomfort, at higher frequency or severity than persons in good cardiovascular health, These adverse symptoms might cause them to avoid saunas, thereby biasing the group of sauna-takers to include persons at lower risk of adverse cardiac events than the general public.
The authors suggest that, based on this study, "sauna bathing is a recommendable health habit". I disagree, and suggest that physicians should await the results of a randomized trial of sauna bathing before we recommend it for health enhancement. Only randomized trials can provide the quality of evidence required for a physician to recommend a potentially dangerous intervention for health enhancement. Observational studies such as this one are supposed to be for "hypothesis generation" only.
On 2015 Mar 04, Raphael Stricker commented:
In this one-sided opinion piece about Lyme disease, Eugene Shapiro once again finds "no evidence that viable B. burgdorferi persist in humans after conventional treatment with antimicrobials". Shapiro is a well known member of the shrinking "Lyme Denialist" cabal that views Lyme disease as a trivial illness that is "hard to catch and easy to cure", apparently ignoring the latest CDC figures showing more than 300,000 new cases per year in the USA. The fact that Lyme disease has become a major epidemic that is six times more common than HIV/AIDS in this country fails to impress Shapiro, who adheres to the dogma that persistent infection with B. burgdorferi, the Lyme spirochete, does not exist following short-course antibiotic therapy despite extensive evidence to the contrary (Stricker & Johnson, Infect Drug Resist 4: 1-9, 2011; Cameron et al, Expert Rev. Anti Infect. Ther. 12:1103-1135, 2014).
Significant controversy over Lyme disease exists for three main reasons: (1) lack of accurate and/or universally accepted testing for the disease, (2) disagreement about symptoms associated with persistent infection in chronic Lyme disease, and (3) misinterpretation and misrepresentation of underpowered Lyme antibiotic treatment trials. While many studies describe the constellation of musculoskeletal, neurocognitive and/or cardiac symptoms associated with chronic Lyme disease, Shapiro views these as "medically unexplained symptoms" not necessarily related to persistent B. burgdorferi infection. Without a universally accepted "gold standard" test, the controversy over persistent infection and optimal therapy continues to smoulder while thousands of patients continue to suffer due to the dogma espoused by Shapiro (Johnson et al. PeerJ 2:e322, 2014).
A major problem faced by Shapiro is that he is trying to prove a negative. Thus if there is any evidence that persistent infection with B. burgdorferi does exist following short-course antibiotic therapy, his opinion is obviously wrong. To address this problem, Shapiro narrows his evidence to two recent Lyme disease articles, ignoring numerous studies in animals and humans that support persistent infection or leave the issue unsettled (Cairns & Godwin, Int J Epidemiol 34: 1340-1345, 2005; Berndtson, Int J Gen Med 6: 291-306, 2013; Stricker & Johnson, PLoS Pathog 10: e1003796, 2014). Shapiro dismisses this contrary evidence as "speculative", but his narrow selection of two "convincing" studies is insufficient to support his biased conclusion.
The first study examined a group of 17 patients with recurrent erythema migrans (EM) rashes who were promptly treated for their initial episode of Lyme disease and then developed one or more EM rashes at a later date. Culture of the rashes revealed different strains of B. burgdorferi in the subsequent episodes, and Shapiro points to this as evidence for new infection rather than relapse in these patients. However as pointed out in a letter addressing the article, this is a poor model for chronic Lyme disease due to persistent infection because all patients were promptly treated for their initial illness, lived in endemic areas and most likely were reinfected with a different strain of the spirochete from a subsequent tickbite. This is a very different situation from a patient who may have been infected and never treated for months to years and develops the constellation of musculoskeletal, neurocognitive and/or cardiac symptoms that are characteristic of persistent infection with the Lyme spirochete (Donta, N Engl J Med 368:1063-1064, 2013). Thus the model for persistent infection in this study is flawed.
The second study was a xenodiagnosis safety study of 36 patients (26 Lyme patients in different stages of disease and 10 controls) who allowed ticks to feed on them, and the ticks were then examined for B. burgdorferi transmission. Shapiro states that "no viable B. burgdorferi were cultured from ticks fed on any of these patients". This conclusion is flawed for two reasons: First, 30-50% of ticks were lost during the study, rendering the transmission results uninterpretable. Second, one patient with post-treatment Lyme disease syndrome (PTLDS) was found to have a positive culture from one tick, as stated in the Results: "One nymph was found to be positive by PCR of the nymph lysate culture, but direct PCR of the nymph lysate and microscopic evaluation of the culture were negative....The original positive OspA PCR of the tick culture was confirmed by PCRs for other B. burgdorferi genes.... The DNA extracted from this culture sample was then tested by IA/PCR/ESI-MS, which was positive for 7 of the 8 assay primer pairs" (emphasis added). Thus this patient had culture-confirmed evidence of persistent infection with the Lyme spirochete in PTLDS. Shapiro generously states that this finding is "provocative" when in fact it provides definitive evidence that he is wrong.
In summary, this one-sided opinion piece will only add to the confusion and misinformation surrounding Lyme disease. With better testing and novel treatments, a solution to this tickborne disease will someday be found. Shapiro's muddled article fails to contribute to this solution.
Disclosure: RBS is a member of the International Lyme and Associated Diseases Society (ILADS) and a director of LymeDisease.org. He has no financial or other conflicts to declare.
On 2016 Sep 23, Israel Hanukoglu commented:
The link to the Proteopedia page with animations and examples: http://www.proteopedia.org/w/Rossmann_fold
On 2017 Jul 10, Randi Pechacek commented:
Rachel Adams, first author of this paper, wrote a blog post on microBEnet to provide some background.
On 2016 Mar 08, Kenneth Witwer commented:
Because of continuing interest in this topic, an extended version of these comments has been deposited on the "Negative Results" track on ResearchGate.
On 2015 Mar 04, Avinash Bidra commented:
My response to these comments can be found at: http://www.ncbi.nlm.nih.gov/pubmed/25702969
On 2016 Mar 18, ZHONGMING ZHAO commented:
My lab recently moved to the University of Texas Health Science Center at Houston. The software is now available at https://bioinfo.uth.edu/VirusFinder/.
On 2015 Mar 19, Donna Beales commented:
My understanding is that there was a change to the formulation of the suspension medium used in some trials with T. suis ova. Such alterations could conceivably have unanticipated effects on living organism therapies. Quoted as follows: All prior and very successful studies, this final formulation was of a pH value between 2.7 – 3 and had no preservative, while for the TRUST and some other newly pilot studies on other indications a formulation of a pH value of 5 plus potassium sorbate as a preservative was used... Nevertheless, the decision of changing the formulation for the drug approval studies is understandable if one takes into account what the common practice is in normal drug development according to the pharmacopeia, but a living organism does not necessarily fit into these regulations designed for single molecules and chemical compounds."
Too, 12 weeks may not be sufficient time for clinical efficacy with a living organism; even pharmaceutical immunosuppressants may require a period of several months for full effectiveness. "Another critical issue in the TRUST studies was that the endpoint was set after just 12 weeks of treatment, which is known to be the time frame where the agent just begins to unfold its mode of action effectively." Source: http://tanawisa.com/news/
These factors are relatively unknown, and should be considered in any interpretation of study conclusion.
On 2015 Apr 22, Hans-Peter Müller commented:
Response to Müller HP. Direct and CBCT dentogingival tissue thickness measurements. Oral Surg Oral Med Oral Pathol Oral Radiol 2015; 119: 482-481. http://www.ncbi.nlm.nih.gov/pubmed/25687197
On 2016 Aug 30, Ben Goldacre commented:
This trial has the wrong trial registry ID associated with it on PubMed. The ID given is NCT014182482377 - the correct ID, which we found within the text of the article itself, is NCT00962377.
This comment is being posted as part of the OpenTrials.net project<sup>[1]</sup> , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected in PubMed.
Many thanks,
Jessica Fleminger, Ben Goldacre*
[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367
* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG
On 2015 Feb 23, William Grant commented:
Concerns over Vitamin D and clinical practice at a crossroads recommendations
In their viewpoint piece, Vitamin D and clinical practice at a crossroads, Manson and Bassuk state among other things that the Institute of Medicine (IOM) set the recommended dietary allowance for vitamin D at 600 IU/d for those living in the upper latitudes of North America aged to 70 years and 800 IU/d for those older in order to reach a 25-hydroxyvitamin D [25(OH)D] concentration of 20 ng/mL (50 nmol/L) [1]. However, it is not clear how the Dietary Reference Intakes for Calcium and Vitamin D committee arrived at that number. For example, on p. 3-20 of the vitamin D and calcium IOM report [2], Figure 3-4 from Cashman et al. [3] is given as Figure 3-4, although without the 95% confidence intervals as in the original paper. The results were based on a 22-week placebo, randomized controlled supplementation study involving men and women aged 20-40 years. Inspection of Figure 2 in Ref. 3 indicates that it would take 1155 IU/d vitamin D3 for 97.5% of the 20-40 year old population sampled to reach 50 nmol/L. In a subsequent paper based on a systematic review and meta-analysis of vitamin D intake and 25(OH)D concentrations, the same group determined that it would take 930 IU/d vitamin D3 for people living in northern Europe to reach 50 nmol/L [4]. Further complicating matters is the fact that not all of the contributions from diet are accounted for in most studies. It is becoming apparent that some food such as meat has vitamin D in the form of 25(OH)D. Thus, vegans in the UK have 25(OH)D concentrations 20 nmol/L lower than omnivores [5], so require higher vitamin D intake from non-dietary sources or solar UVB exposure.
Their comment that "while awaiting the results of the large trials now in progress, physicians would be well advised to follow current USPSTF and IOM recommendations and avoid overscreening and overprescribing supplemental vitamin D" is also not well grounded. The IOM restricted its assessment of the benefits of vitamin D to vitamin D randomized controlled trials [RCTs] with substantial benefits by 2010. A number of trials since then demonstrated health benefits, e.g., for biomarkers of inflammation, where it was found that RCTs with baseline 25(OH)D concentrations below 48 nmol/L had a 50% chance of findings benefits from vitamin D supplementation compared to 25% with baseline 25(OH)D concentrations above 50 nmol/L [6]. In addition, ecological, observational, clinical, and laboratory studies have found many health benefits of solar UVB exposure and/or vitamin D. Since the IOM report was published (29 November, 2010), 13,535 publications with vitamin D in the title or abstract have been published at PubMed.gov as of 23 February, 2015, compared with 27,775 published before that date. Many of these publications strengthen the case for vitamin D supplementation and UVB exposure.
In terms of confounding factors related to observational studies, one not mentioned in Ref. 1 is the possibility that solar UV exposure may have health benefits in addition to vitamin D production. As a result, 25(OH)D concentrations may be an index of UVB exposure. Beneficial effects of UV exposure in addition to vitamin D production have been reported for intestinal cancer [7], multiple sclerosis [8], and blood pressure [9].
As for concern about adverse effects of higher 25(OH)D concentrations based on observational studies, it should be noted that most such studies do not obtain any information from participants about vitamin D supplementation prior to having 25(OH)D concentrations measured. Thus, those with adverse health outcomes and high 25(OH)D concentrations may have started taking vitamin D supplements shortly before blood draw. For example, studies of frailty vs. 25(OH)D concentration found a U-shaded relation for elderly women [10] but a linear inverse relation for elderly men [11]. Elderly women in the U.S. are much more likely to be advised to take vitamin D supplements than men, and starting to take vitamin D late in life cannot erase the adverse effects of years of low 25(OH)D concentrations. In addition, meta-analyses of observational studies of health outcomes with respect to 25(OH)D concentrations do not show U-shaped relations for cardiovascular disease [12] or all-cause mortality rates [13].
As to their comment regarding how interest in vitamin D could jeopardize ongoing vitamin D RCTs, that should not be the case if trial participants are screened by measuring 25(OH)D concentration prior to acceptance and including only those with 25(OH)D concentrations below 50 nmol/L then dropping any who are subsequently prescribed supplements in excess of the IOM recommendations. Over 99% of the population is not enrolled in vitamin D RCTs and should not be held hostage to ongoing or planned trials since there appear to be many health benefits and very few risks of vitamin D supplementation below 4000 IU/d [14] even by the IOM's admission [2].
References 1. Manson JE, Bassuk SS. Vitamin D research and clinical practice: at a crossroads. JAMA. 2015 Feb 19. doi: 10.1001/jama.2015.1353. [Epub ahead of print] 2. Ross AC, Taylor CL, Yaktine AL, Del Valle HB, eds. ; Committee to Review Dietary Reference Intakes for Vitamin D and Calcium; Dietary Reference Intakes for Calcium and Vitamin D. Institute of Medicine. ISBN: 0-309-16395-1, 482 pages, (2010) Available from National Academies Press at: http://www.nap.edu/catalog/13050.html 3. Cashman KD, Hill TR, Lucey AJ, et al. Estimation of the dietary requirement for vitamin D in healthy adults. Am J Clin Nutr. 2008;88(6):1535-42. 4. Cashman KD, Fitzgerald AP, Kiely M, Seamans KM. A systematic review and meta-regression analysis of the vitamin D intake-serum 25-hydroxyvitamin D relationship to inform European recommendations. Br J Nutr. 2011;106(11):1638-48. 5. Crowe FL, Steur M, Allen NE, et al. Plasma concentrations of 25-hydroxyvitamin D in meat eaters, fish eaters, vegetarians and vegans: results from the EPIC-Oxford study. Public Health Nutr. 2011;14(2):340-6. 6. Cannell JJ, Grant WB, Holick MF. Vitamin D and inflammation. Dermato-Endocrinology. 2014;6(1):e983401-1-10.<br> 7. Rebel H, der Spek CD, Salvatori D, et al.UV exposure inhibits intestinal tumour growth and progression to malignancy in intestine-specific Apc mutant mice kept on low vitamin D diet. Int J Cancer. 2015;136(2):271-7. 8. Zivadinov R, Treu CN, Weinstock-Guttman B, et al. Interdependence and contributions of sun exposure and vitamin D to MRI measures in multiple sclerosis. J Neurol Neurosurg Psychiatry. 2013;84(10):1075-81. 9. Opländer C, Volkmar CM, Paunel-Görgülü A, et al. Whole body UVA irradiation lowers systemic blood pressure by release of nitric oxide from intracutaneous photolabile nitric oxide derivates. Circ Res. 2009;105(10):1031-40. 10. Ensrud KE, Ewing SK, Fredman L, et al. Circulating 25-hydroxyvitamin D levels and frailty status in older women. J Clin Endocrinol Metab. 2010;95(12):5266-73. 11. Ensrud KE, Blackwell TL, Cauley JA, et al. Circulating 25-hydroxyvitamin D levels and frailty in older men: the osteoporotic fractures in men study. J Am Geriatr Soc. 2011;59(1):101-6. 12. Wang L, Song Y, Manson JE, et al. Circulating 25-hydroxy-vitamin D and risk of cardiovascular disease: A meta-analysis of prospective studies. Circ Cardiovasc Qual Outcomes. 2012;5(6):819-29. 13. Garland CF, Kim JJ, Mohr SB, et al. Meta-analysis of all-cause mortality according to serum 25-hydroxyvitamin D. Am J Pub Health. 2014;104(8):e43-50. 14. Vieth R. Implications for 25-hydroxyvitamin D testing of public health policies about the benefits and risks of vitamin D fortification and supplementation. Scand J Clin Lab Invest Suppl. 2012;243:144-53.
Disclosure I receive funding from Bio-Tech Pharmacal, Inc. (Fayetteville, AR), MediSun Technology (Highland Park, IL), and the Vitamin D Council (San Luis Obispo, CA).
On 2015 Feb 25, Ivan Oransky commented:
Following a great deal of criticism of this article, the journal issued a statement of concern and then reclassified the paper as "opinion." http://retractionwatch.com/2015/02/24/frontiers-lets-hiv-denier-article-stand-reclassifies-it-as-opinion/
On 2015 Oct 22, Alan Fairlamb commented:
This is an excellent and comprehensive review of the prospects for elimination of Gambiense HAT. A number of uncertainties are identified and important research questions highlighted. However, one posible threat not considered is the risk of drug resistance emerging to the limited armamentarium of drugs available to treat patients and thereby reduce transmission. Drug susceptibility testing of clinical isolates would be useful in defining optimal treatment regimens.
Antimicrob Agents Chemother. 2010 Jul;54(7):2893-900. doi: 10.1128/AAC.00332-10. Epub 2010 May 3.
On 2015 Apr 21, Helmi BEN SAAD commented:
A letter to the Editor, highlighting some methodological problems in the above article is now published: http://www.libyanjournalofmedicine.net/index.php/ljm/article/view/27760
H Ben Saad. Methodological problems in the article comparing lung function profiles and aerobic capacity of adult cigarette and hookah smokers after 12 weeks intermittent training.Libyan J Med 2015, 10: 27760 - http://dx.doi.org/10.3402/ljm.v10.27760
On 2016 Jul 14, Andrea Fuso commented:
The analysis was initially made on these two genes since those are the genes we were studying in relation to muscle differentiation (myogenin) and Alzheimer's Disease (PSEN1). In these two models we gained in the years sufficient knowledge to finely modulate methylation and to foresee that different treatments correspond to differential methylation. Moreover, we are interested in "rapid" methylation changes and it is our hypothesis that genes without CpG islands can be modulated by dynamic changes in DNA methylation that are more rapid than in CpG islands (in wich methylation-dependent silencing/activation is more stable) and possible also in non replicating tissues (brain). We are now checking promoters with and without CpG islands. Of course, designing MIPs in CpG islands could be very difficult or even impossible. That's a limitation.
On 2016 Jul 14, Long-Cheng Li commented:
Dear Andrea,
I am sorry for not having not responded earlier and thank you for your reply.
If the possibility of incomplete conversion can be excluded as you have explained above, I think the findings in your work is significant in that they makes researchers better aware of the non-CpG methylatioon issue. I do have another comment though which is why you chose two genes (myogenin and PSEN1) without CpG islands in their promoters instead of genes with CpG islands where differential methylation often occurs.
On 2016 Jul 13, Andrea Fuso commented:
None
On 2016 Jul 13, Andrea Fuso commented:
Dear Long-Cheng, thank you for your critic comments. Discussing this issue is very important and I'm sincerely happy you took some time to read our manuscript and share your thoughts. When we published the paper, we were hopeful it could raise some discussion useful to a better understanding of the non-CpG issue.
First of all, I would like to emphasize that our paper was not a criticism of MethPrimer. As a matter of fact (as disclosed in the paper) different primer design softwares, not just “MethPrimer”, allow to design bisulfite primers based on the assumption that non-CpG cytosines are transformed. MethPrimer is simply the most used and known and we defined “methprimers” the oligo designed using these different softwares. Our criticism were, on the contrary, addressed toward the concept that stands at the base of all these primer design softwares: i.e. that non-CpG cytosines are (almost) always demethylated. The idea of releasing MethPrimer was great and in line with the widely accepted concept of that era on non-CpG methylation. We should now critically consider that concept and make some effort to better understand extension and significance of non-CpG methylation and, in case, revise our tools for the study of DNA methylation. The adaptation of MethPrimer to the picking of primers in regions with few cytosines goes in this way and it is highly appreciable.
As for your comments about incomplete conversion: your considerations are correct but you are not correct when you affirm that “no efforts were made to verify the completeness of bisulfite conversion of the template DNA”. If you look at the methods and at the previous papers cited in the methods (previously published description were not repeated and just cited) you can see that we took many efforts to demonstrate that our analysis was not affected by artifacts. Our studies on myogenin methylation (some years ago) started with classical bisulphite conversion (no kits) but in the years we started to place side by side classical and kit-assisted bisulphite conversion, obtaining comparable results. The present study was made by using the Qiagen Epitect Kit but specific (high and low methylated samples) controls were modified using the ZymoResearch kit and the in-lab prepared bisulphite. These controls were real samples, not just PCR products. According to your idea that our data could be due to incomplete conversion, you should explain why incomplete conversion occurs only (or mainly) for high methylated DNA but not in low methylated DNA, since the difference between methprimers and MIPs is less when analyzing low methylated samples. In our analyses, in which samples with different (expected) methylation levels are modified in the same run, we can indeed observe both methylated and unmethylated sequences, according to the expected methylation. I think that this observation, more than any “control” witness the quality of the bisulphite conversion we make. If you suggest, or suspect, that bisulphite conversion kit (like the Qiagen and the Zymoresearch) that are today used in almost all the methylation studies, and that are preferred to the in-lab prepared bisulphite just to guarantee reliability and avoid incomplete conversion, are responsible for incomplete conversion….well, the problem is much bigger. I will be happy if you and others want to add more to this interesting discussion.
In conclusion, I completely agree with you that much more care should be put in the control of the bisulphite analysis…and as a reviewer of papers dealing with DNA methylation, I can see that few researchers take care of performing rigorous controls. But, I also invite you and the other colleagues to consider that new and unexpected results, such as relevant non-CpG methylation, deserve to be considered with unbiased attitude and methods.
On 2016 Jul 04, Long-Cheng Li commented:
As the author of MethPrimer, I thank the authors of this paper for looking into the bias issue of our program. However the conclusion reached that "MethPrimers can result in underestimation of the high methylation levels eventually biasing the detection of differences" could be misleading based on the following reasons:
1) MethPrimer was developed in an era when there was little knowledge about the existence of non-CpG methylation and under the assumption that all non-CpG cytosines are not methylated. One of the important principles used by MethPrimer in picking primers is to select primers that preferentially amplify bisulfite converted DNA, given the inherent issue of incomplete conversion of unmethylated cytosines during bisulfite treatment. This is implemented by forcing picking primers in regions which must contain a minimum number of non-CpG cytosines.
2) Using “methylation-insensitive primers” (MIPs) in which non-CpG Cs are degenerated, the authors detected higher levels of methylation compared to primers designed by MethPrimer in the promoter regions of two mouse genes (myogenin and PSEN1). However, no efforts were made to verify the completeness of bisulfite conversion of the template DNA. Although control samples with complete methylated and unmethylated DNA were included in the analysis, the use of PCR products as a control for unmethylated DNA is problematic since incomplete conversion is less an issue for PCR products compared to genomic DNA. In other words, complete conversion of the control DNA does not necessarily mean that genomic DNA was also completely converted. If that were true, the non-CpG methylation detected could be merely an artifact.
I do caution that researchers should keep in mind potential non-CpG methylation. Before more evidence is available about the prevalence of non-CpG methylation and its function, researchers should care more about potential incompleteness of bisulfite conversion and subsequent overestimation of methylation levels in the DNA.
On 2015 Apr 23, Janet Kern commented:
Because of differences noted between the study conclusion and the results, on February 24, 2015, an email was sent to Dr. Hewitson requesting the dataset. However, to date, the authors have ignored repeated requests for the dataset.
On 2015 Feb 21, Dan Laks commented:
None
On 2015 Dec 12, Donald Forsdyke commented:
LESS BP MEDICATION NEEDED IN HOT WEATHER This paper recommends “More aggressive blood pressure lowering treatment in the cold months … in high risk individuals” (1), which implies less aggressive blood pressure (BP) lowering treatment in hot months. Indeed, a well-documented “J-curve” observation is that, below a certain value, BP lowering is harmful – e.g. acute kidney injury (2). Quite rightly, the cartoon in the accompanying editorial has question marks at both the high and low ends of the temperature scale (3). However, the paper’s focus is on more treatment in winter, not on less treatment in summer, and it only scores the deaths attributed to cardiovascular disease (CVD), a number that declines in hot weather (1). Cases where mortality can be attributed to other causes are excluded.
Regarding CVD it is reported that “The excess risk was similar between people treated with blood pressure lowering agents and those without” (1). But given the widely different mechanisms of action of different BP lowering agents, surely this statement needs backing with more information on agents and their dosages? Large summertime systolic BP declines that mandate treatment adjustment are not uncommon (4). Differential responses in hot weather can depend on type and dosage of antihypertensive medication. Indeed, extrapolation from the supplementary plot (Fig 1) of Yang et al. (2015), the BP would be normal at 40°C and medication could be dispensed with (1). Taking medication at that temperature could be lethal (5). Indeed, a Canadian case study with an angiotensin receptor blocker found that medication could be dispensed with when summer temperatures reached 33°C (6).
It is obvious from Fig. 3 that the statement that “the seasonal variation in blood pressure … was abolished by the use of home central heating” (1), is incorrect. In Harbin province, where winter temperatures are similar to those in Canada, there is less BP increase in cold weather than in other provinces, and this is attributed to central heating. But the seasonal BP increase is clearly not abolished. Despite central heating, in the Canadian case study the BP decline for a 10°C increase in temperature was of the order of 20 mm Hg (6) – a far higher value than the 6 mm Hg reported here (1).
1 Yang L, Li L, Lewington S. Guo Y, Sherliker P, Bian Z, Collins R, et al (2015) Outdoor temperature, blood pressure, and cardiovascular disease mortality among 23000 individuals with diagnosed cardiovascular diseases from China. Eur Heart J 36:1178-1185. Yang L, 2015
2 Tomlinson LA, Abel GA, Chaudhry AN, Tomson CR, Wilkinson IB, Roland MO et al (2013) ACE inhibitor and angiotensin-II receptor antagonist prescribing and hospital admissions with acute kidney injury: a longitudinal ecological study. PLoS One 8:e78465.Tomlinson LA, 2013
3 Bruno RM, Taddei S (2015) ‘Tis bitter cold and I am sick at heart’: establishing the relationship between outdoor temperature, blood pressure, and cardiovascular mortality. Eur Heart J 36:1152-1154.Bruno RM, 2015
4 Stergiou GS, Myrsilidi A, Kollias A, Destounis A, Roussias L, Kalogeropoulos P (2015) Seasonal variation in meteorological parameters and office, ambulatory and home blood pressure: predicting factors and clinical implications. Hypertension Research 38(12):869-875. Stergiou GS, 2015
5 Editorial (2015) Health professionals: be prepared for heatwaves. Lancet 386:219. Anonymous, 2015
6 Forsdyke DR (2015) Summertime dosage-dependent hypersensitivity to an angiotensin II receptor blocker. BMC Res Notes 8:227. Forsdyke DR, 2015
On 2015 Feb 18, Hilda Bastian commented:
This study states as its objective "to determine the efficacy and safety of varenicline" for quitting smoking via smoking reduction. The authors point out that one limitation of the study is its generalizability to a broad population, given its stringent and extensive exclusion criteria. However, it does not stress that both this, and the size of the study, very much preclude this single study "determining" safety of varenicline. The findings in relation to serious adverse events need to be considered in the light of the lower risk for serious adverse events in this study population.
The paper does not refer readers to the safety warnings and concerns about varenicline issued by both the US FDA and European Medicines Agency (EMA), in relation both to psychiatric (FDA boxed warning) and cardiovascular events (FDA, 2012)(see also EMA). (Readers may also be interested in Singh S, 2011 on the issue of cardiovascular events.)
UPDATE: On 9 March 2015, the FDA reviewed safety data on varenicline, retaining the boxed safety warning, and including a warning on interaction with alcohol. However, in March a large meta-analysis found that varenicline increased insomnia and bad dreams, but not depression, suicide, or suicidal ideation (Thomas KH, 2015).
In terms of effectiveness, the authors rightly raise the issue of a lack of direct comparisons between varenicline and others options for smoking reduction. Readers might be interested in Asfar T, 2011, which finds that nicotine replacement therapy (NRT) achieved smoking reduction rates that were not dramatically dissimilar. Cahill K, 2010 found some (inconclusive) evidence that NRT and varenicline result in similar quit rates. Nor are pharmacological means the only successful options for reducing smoking without the risk of serious adverse events.
Note also that this study was funded by Pfizer, manufacturer of the varenicline product marketed as Chantix in the US (Champix in Europe).
On 2015 Feb 21, William Grant commented:
Outdoor workers have better health outcomes due to UVB exposure
The paper by Bauer and colleagues recommended that outdoor workers reduce their UV radiation exposure in order to reduce their risk of squamous cell carcinoma (SCC) and basal cell carcinoma (BCC) [1]. Overlooked in this paper was any discussion of the health benefits of UV exposure through outdoor work.
Solar UVB exposure reduces risk of many types of cancer as shown in geographical ecological studies from Australia, China, France, Japan, Spain, and the United States [2]. Deaths due to internal cancers are much higher than those due to non-melanoma skin cancer [3]. Solar UVB exposure is the primary source of vitamin D for most people, and there are many health outcomes linked inversely to 25-hydroxyvitamin D concentrations [4].
Perhaps most relevant for Germany is a study of cancer incidence rates with respect to occupation in Nordic countries [5]. Using a data base of nearly three million cancer incidence cases for 54 occupation categories [6], an index of UVB exposure was developed, namely, lip cancer incidence rate less lung cancer incidence rate for males. Fourteen types of cancer were significantly inversely correlated with this index for males, but only three for females. Since females wear lipstick, an independent index could not be developed for them. Interestingly, this index was inversely correlated with incidence of non-melanoma skin cancer as well as melanoma for males.
Furthermore, a study in Denmark found "Mortality was reduced among patients with BCC (10-year MRR = 0.91 (95% CI: 0.89-0.92) and did not vary by age, comorbidity, or socioeconomic status. Mortality among patients with SCC was increased and varied by age, selected chronic diseases, but not socioeconomic status." [7]. Since smoking is a risk factor for SCC [8], the finding of an increased risk of death associated with SCC is not surprising since it is also an important risk factor for many types of cancer [2] as well as cardiovascular disease and other diseases.
Since skin pigmentation has adapted to where people have lived for many generations to both reduce the adverse effects of solar UVB as well as to produce sufficient vitamin D for optimal health [9,10], it is not clear that undue protection against solar UVB exposure is warranted. However, erythema is best avoided.
References 1. Bauer A, Beissert S, Knuschke P. [Prevention of occupational solar UV radiation-induced epithelial skin cancer.] Hautarzt. 2015 Feb 17. [Epub ahead of print] 2. Moukayed M, Grant WB. Molecular link between vitamin D and cancer prevention. Nutrients. 2013;5(10):3993-4023. 3. Grant WB. In defense of the sun: An estimate of changes in mortality rates in the United States if mean serum 25-hydroxyvitamin D levels were raised to 45 ng/mL by solar ultraviolet-B irradiance. Dermatoendocrinol. 2009;1(4):207-14. 4. Pludowski P, Holick MF, Pilz S, et al. Vitamin D effects on musculoskeletal health, immunity, autoimmunity, cardiovascular disease, cancer, fertility, pregnancy, dementia and mortality- a review of recent evidence. Autoimmun Rev. 2013;12(10):976-89. 5. Grant WB. Role of solar UV irradiance and smoking in cancer as inferred from cancer incidence rates by occupation in Nordic countries. Dermatoendocrinol. 2012;4(2):203-11. 6. Pukkala E, Martinsen JI, Lynge E, et al. Occupation and cancer—follow-up of 15 million people in five Nordic countries. Acta Oncol 2009;48:646-790; 7. Jensen AØ, Lamberg AL, Jacobsen JB, et al. Non-melanoma skin cancer and ten-year all-cause mortality: a population-based cohort study. Acta Derm Venereol. 2010;90(4):362-7. 8. Leonardi-Bee J, Ellison T, Bath-Hextall F. Smoking and the risk of nonmelanoma skin cancer: systematic review and meta-analysis. Arch Dermatol. 2012;148(8):939-46. 9. Yuen AW, Jablonski NG. Vitamin D: in the evolution of human skin colour. Med Hypotheses. 2010;74(1):39-44. 10. Jablonski NG, Chaplin G. Colloquium paper: human skin pigmentation as an adaptation to UV radiation. Proc Natl Acad Sci U S A. 2010;107 Suppl 2:8962-8.
Disclosure I receive funding from Bio-Tech Pharmacal, Inc. (Fayetteville, AR), MediSun Technology (Highland Park, IL), and the Vitamin D Council (San Luis Obispo, CA).
On 2015 Feb 24, Amanda Capes-Davis commented:
Are the authors able to comment further on the cell lines used in this study, to confirm that results are not related to the cell culture models used?
The Materials and Methods section states that cell lines (MCF-7, MCF-10A and BT549) were obtained from the ATCC and authenticated before purchase. I am very pleased to see information included on source and previous testing. However, it is not clear how long ago testing was performed. In some cases, cell lines are used by many different laboratory members and may be passed from laboratory to laboratory. That gives time for cross-contamination or other cell culture problems to arise. Mycoplasma contamination, or cross-contamination by another cell line, might result in behavioral changes at the time that morphine is introduced.
The results here have significant clinical implications, suggesting that pain control in breast cancer may contribute to chemoresistance. So it is essential to ensure that cell culture models are tested to eliminate any possibility of artefacts.
I particularly raise this issue because, as the authors note in their Discussion, previous studies have suggested that morphine decreases cell proliferation in many cancer cell types.
The International Cell Line Authentication Committee (ICLAC) has released a checklist that sets out cell line reporting requirements for manuscripts and grant applications. The checklist can be found at http://iclac.org/resources/cell-line-checklist/.
On 2015 Sep 16, Geriatric Medicine Journal Club commented:
Sleep disturbances are common in the elderly and adversely affect quality of life. Pharmacotherapy is often limited by lack of efficacy and/or adverse events. This article was critically appraised at the May 2015 Geriatric Medicine Journal Club (follow #GeriMedJC on Twitter). The full discussion can be found at: http://gerimedjc.blogspot.com/2015/05/may-2015-gerimedjc.html?spref=tw While mindfulness meditation seems to improve sleep quality in older adults, the challenge is how to operationalize this type of intervention.
On 2017 Mar 05, Atanas G. Atanasov commented:
Very good overview on the health-modulating potential of mushrooms. I have highlighted this review on: http://healthandscienceportal.blogspot.com/2017/03/mushrooms-for-improvement-of-health-and.html
On 2015 Feb 15, Jinlei Nie commented:
In RESULTS: "not significant", but and "P<0.05"???
On 2015 Jun 18, Elsamma Chacko commented:
Exercise before breakfast increases hepatic glucose production and glucose levels can go up.
On 2016 Apr 18, Tom Kindlon commented:
James C Coyne PhD has blogged here https://jcoynester.wordpress.com/2016/03/20/why-the-cochrane-collaboration-needs-to-clean-up-conflicts-of-interest/ about my comment:
"Selective reporting (outcome bias)" and White et al. (2011) I don't believe that White et al. (2011) (the PACE Trial) (3) should be classed as having a low risk of bias under "Selective reporting (outcome bias)" (Figure 2, page 15). According to the Cochrane Collaboration's tool for assessing risk of bias (21), the category of low risk of bias is for: "The study protocol is available and all of the study’s pre-specified (primary and secondary) outcomes that are of interest in the review have been reported in the pre-specified way". This is not the case in the PACE Trial. The three primary efficacy outcomes can be seen in the published protocol (22). None have been reported in the pre-specified way. The Cochrane Collaboration's tool for assessing risk of bias states that a “high risk” of bias applies if any one of several criteria are met, including that “not all of the study’s pre-specified primary outcomes have been reported” or “one or more primary outcomes is reported using measurements, analysis methods or subsets of the data (e.g. subscales) that were not pre-specified”. In the PACE Trial, the third primary outcome measure (the number of "overall improvers") was never published. Also, the other two primary outcome measures were reported using analysis methods that were not pre-specified (including switching from the bimodal to the Likert scoring method for The Chalder Fatigue Scale, one of the primary outcomes in your review). These facts mean that the “high risk of bias” category should apply.
and the response I received from one of the authors .
On 2015 Sep 14, Tom Kindlon commented:
None
On 2016 Jun 07, Tom Kindlon commented:
None
On 2015 Sep 14, Tom Kindlon commented:
(contd.)
11 National Institute for Health and Clinical Excellence. Chronic fatigue syndrome/myalgic encephalomyelitis (or encephalopathy): diagnosis and management of CFS/ME in adults and children, 2007. http://www.nice.org.uk/guidance/CG53 Accessed September 6, 2015. London: National Institute for Health and Clinical Excellence.
12 White PD, Goldsmith KA, Johnson AL, Potts L, Walwyn R, DeCesare JC, et al. Comparison of adaptive pacing therapy, cognitive behaviour therapy, graded exercise therapy, and specialist medical care for chronic fatigue syndrome (PACE): a randomised trial. The Lancet 2011;377:823-36.
13 Kindlon T. PACE Trial - 97% of the participants who didn't have a psychiatric disorder satisfied the definition of M.E. used. https://listserv.nodak.edu/cgi-bin/wa.exe?A2=ind1106A&L=CO-CURE&P=R2764 Accessed: September 6, 2015
14 Ellen Goudsmit on PubMed Commons: http://www.ncbi.nlm.nih.gov/myncbi/ellen m.goudsmit.1/comments/
15 Green CR, Cowan P, Elk R, O'Neil KM, Rasmussen AL. National Institutes of Health Pathways to Prevention Workshop: advancing the research on myalgic encephalomyelitis/chronic fatigue syndrome. Ann Intern Med. 2015; 162:860-5.
16 Haney E, Smith MEB, McDonagh M, Pappas M, Daeges M, Wasson N, et al. Diagnostic methods for myalgic encephalomyelitis/chronic fatigue syndrome: a systematic review for a National Institutes of Health Pathways to Prevention Workshop. Ann Intern Med. 2015; 162:834-40.
17 Smith MEB, Haney E, McDonagh M, Pappas M, Daeges M, Wasson N, et al. Treatment of myalgic encephalomyelitis/chronic fatigue syndrome: a systematic review for a National Institutes of Health Pathways to Prevention Workshop. Ann Intern Med. 2015; 162:841-50.