[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 7

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.D835del | Summary: The p.D835del mutation in FLT3-TKD is associated with tumor development in acute myeloid leukemia (AML) as indicated by its presence in primary AML cells. Evidence Type: Oncogenic | Mutation: p.Q61R | Summary: The p.Q61R mutation in NRAS is implicated in tumor progression in acute myeloid leukemia (AML) as it was identified as an additional aberration in the patient’s AML cells.

Gene→Variant (gene-first): 2322:p.D835del 4893:p.Q61R

Genes: 2322 4893

Variants: p.D835del p.Q61R

[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: R132C | Summary: The R132C mutation in IDH1 is associated with sensitivity to the IDH1 inhibitor BAY1436032, indicating a predictive relationship for therapy response. Evidence Type: Predictive | Mutation: R132G | Summary: The R132G mutation in IDH1 shows sensitivity to the IDH1 inhibitor BAY1436032, suggesting it is predictive of treatment response. Evidence Type: Predictive | Mutation: R132H | Summary: The R132H mutation in IDH1 correlates with sensitivity to the IDH1 inhibitor BAY1436032, indicating a predictive relationship for therapy response. Evidence Type: Predictive | Mutation: R132L | Summary: The R132L mutation in IDH1 is linked to sensitivity to the IDH1 inhibitor BAY1436032, suggesting a predictive relationship for treatment response. Evidence Type: Predictive | Mutation: R132S | Summary: The R132S mutation in IDH1 is associated with sensitivity to the IDH1 inhibitor BAY1436032, indicating a predictive relationship for therapy response. Evidence Type: Oncogenic | Mutation: R132C | Summary: The R132C mutation in IDH1 contributes to tumor development, supporting its classification as an oncogenic variant. Evidence Type: Oncogenic | Mutation: R132G | Summary: The R132G mutation in IDH1 is implicated in tumor development, supporting its classification as an oncogenic variant. Evidence Type: Oncogenic | Mutation: R132H | Summary: The R132H mutation in IDH1 is associated with tumor development, indicating its oncogenic potential. Evidence Type: Oncogenic | Mutation: R132L | Summary: The R132L mutation in IDH1 contributes to tumor development, supporting its classification as an oncogenic variant. Evidence Type: Oncogenic | Mutation: R132S | Summary: The R132S mutation in IDH1 is implicated in tumor development, indicating its oncogenic potential.

Gene→Variant (gene-first): 3417:R132C 3417:R132G 3417:R132H 3417:R132L 3417:R132S 3418:R140Q

Genes: 3417 3418

Variants: R132C R132G R132H R132L R132S R140Q

[Paragraph-level] PMCID: PMC3973211 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Prognostic, Functional, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: Arg248 | Summary: The Arg248 mutation is associated with shorter patient survival, indicating its prognostic significance in human cancers. Evidence Type: Prognostic | Mutation: Arg282 | Summary: The Arg282 mutation is linked to shorter patient survival, highlighting its prognostic relevance in cancer outcomes. Evidence Type: Functional | Mutation: R282W | Summary: The R282W mutation significantly upregulates CYP3A4 mRNA and protein levels, indicating an alteration in molecular function related to drug metabolism. Evidence Type: Oncogenic | Mutation: R282W | Summary: The R282W mutation contributes to tumor development by displaying higher expression and resistance to chemotherapeutic drugs, demonstrating its oncogenic potential.

Gene→Variant (gene-first): 7157:Arg248 7157:Arg282 7157:R282W

Genes: 7157

Variants: Arg248 Arg282 R282W

[Paragraph-level] PMCID: PMC4234187 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: C118S | Summary: The C118S mutation in the Kras gene is investigated for its role in tumorigenesis, showing that it impedes urethane-induced lung tumor development, indicating its contribution to cancer progression. Evidence Type: Functional | Mutation: C118S | Summary: The C118S mutation alters the molecular function of the Kras protein, as it affects the activation and subsequent tumorigenic potential in response to carcinogen exposure.

Gene→Variant (gene-first): 4843:C118 4843:C118S 4843:cysteine 118

Genes: 4843

Variants: C118 C118S cysteine 118

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with a reduction in cell motility in response to PLX4032, indicating a functional impact on the behavior of melanoma cells. Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation contributes to tumor development or progression, as evidenced by its differential response to PLX4032 compared to BRAFWT melanoma cells.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 23

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with changes in cell adhesion and migration in melanoma cells, indicating its role in tumor development and progression. Evidence Type: Functional | Mutation: BRAFV600E | Summary: The BRAFV600E mutation alters molecular function, as evidenced by the changes in phospho-FAK activation and ERK1/2 phosphorylation in response to treatment.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 21

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Q61L | Summary: The NRAS Q61L mutation is associated with tumor development or progression in melanoma, as indicated by its presence in primary melanoma cells. Evidence Type: Functional | Mutation: Q61L | Summary: The Q61L mutation in NRAS may alter molecular or biochemical function, as it is implicated in the activation of signaling pathways in melanoma cells.

Gene→Variant (gene-first): 4893:Q61L

Genes: 4893

Variants: Q61L

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 18

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with the lack of activation of IL8 in response to PLX4032 treatment, indicating its role in tumor development or progression. Evidence Type: Predictive | Mutation: BRAFV600E | Summary: The presence of the BRAFV600E mutation correlates with the lack of response to PLX4032 treatment, suggesting its predictive value for therapy resistance.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with altered activation of early response genes and contributes to tumor development or progression as indicated by its impact on ERK1/2 functional activation in melanoma cells. Evidence Type: Functional | Mutation: BRAFV600E | Summary: The BRAFV600E mutation alters the molecular function of signaling pathways, as evidenced by the differential activation and downregulation of FOS and JUNB in response to treatment in mutant versus wild-type melanoma cells.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with non-detectable activity in certain cell lines, indicating its role in tumor development or progression. Evidence Type: Oncogenic | Mutation: BRAFV600K | Summary: The BRAFV600K mutation is associated with non-detectable activity in certain cell lines, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 673:BRAFV600E 673:BRAFV600K

Genes: 673

Variants: BRAFV600E BRAFV600K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with a response to the drug PLX4032, indicating its predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation contributes to tumor development or progression, as evidenced by its role in melanoma cells.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: BRAFV600E | Summary: The BRAFV600E mutation is associated with changes in the phosphorylation state of ERK1/2, indicating an alteration in molecular function related to signaling pathways in melanoma cells. Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation contributes to tumor development or progression in melanoma, as evidenced by its presence in specific melanoma cell lines and its impact on ERK signaling.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: BRAFV600E | Summary: The BRAFV600E mutation correlates with the response to the therapy PLX4032, as it abolishes ERK1/2 activating phosphorylation in melanoma cells. Evidence Type: Predictive | Mutation: BRAFV600K | Summary: The BRAFV600K mutation also correlates with the response to PLX4032, as it shows a similar pattern of ERK1/2 phosphorylation in response to the drug. Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation contributes to tumor development or progression, as indicated by its role in melanoma cells. Evidence Type: Oncogenic | Mutation: BRAFV600K | Summary: The BRAFV600K mutation contributes to tumor development or progression, as indicated by its role in melanoma cells.

Gene→Variant (gene-first): 673:BRAFV600K 673:V600E/K

Genes: 673

Variants: BRAFV600K V600E/K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The V600E mutation in BRAF is associated with sensitivity to the therapy PLX4032, indicating a predictive relationship between the mutation and treatment response. Evidence Type: Oncogenic | Mutation: V600E | Summary: The V600E mutation in BRAF contributes to tumor development and progression in melanoma, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.T599dup BRAF | Summary: The p.T599dup BRAF variant is associated with tumor development or progression, as indicated by its presence in tumor-extracted DNA from the patient's resection. Evidence Type: Functional | Mutation: p.T599dup BRAF | Summary: The p.T599dup BRAF variant alters molecular or biochemical function, as it was detected through deep, targeted sequencing of tumor DNA.

Gene→Variant (gene-first): NA:p.T599dup BRAF

Genes: NA

Variants: p.T599dup BRAF

[Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.T599dup | Summary: The BRAF p.T599dup mutation was identified in a low-grade glioma, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: p.T599dup | Summary: The BRAF p.T599dup mutation is likely to alter molecular or biochemical function, as it is associated with a specific tumor type.

Gene→Variant (gene-first): 673:p.T599dup

Genes: 673

Variants: p.T599dup

[Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: BRAFV600E | Summary: The BRAFV600E mutation contributes to tumor development by leading to disordered vessel formation and impaired blood flow in zebrafish models, recapitulating clinical features of vascular malformations. Evidence Type: Predictive | Mutation: BRAFV600E | Summary: The BRAFV600E mutation correlates with response to vemurafenib treatment, an approved BRAF inhibitor, as zebrafish with this mutation exhibited improved blood flow following therapy.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.159_173del | Summary: The variant c.159_173del is part of a cluster of pathogenic variants identified in MAP2K1, contributing to the development of arteriovenous malformations (AVMs) and indicating its role in tumor progression within the RAS/MAPK signaling pathway. Evidence Type: Functional | Mutation: c.159_173del | Summary: The c.159_173del variant alters the molecular function of the MAP2K1 gene, which is implicated in the RAS/MAPK signaling pathway, suggesting a biochemical impact relevant to the clinical phenotype observed in patients with AVMs.

Gene→Variant (gene-first): 5604:c.159_173del

Genes: 5604

Variants: c.159_173del

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Prognostic

Summary: Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is associated with non-MSI tumors and contributes to tumor development or progression in colorectal cancer. Evidence Type: Prognostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation correlates with the expression of specific miRNAs, indicating its potential as a prognostic biomarker in colorectal cancer.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Diagnostic

Summary: Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is associated with tumor development or progression in colorectal cancer (CRC) specimens, indicating its role as an oncogenic variant. Evidence Type: Diagnostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation is used to classify and define subtypes of colorectal cancer based on their mutational profiles and MSI status.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Summary: Evidence Type: Diagnostic | Mutation: V600E | Summary: The BRAF V600E mutation is associated with colorectal cancers (CRCs), indicating its role in defining or classifying this subtype of cancer. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation contributes to tumor development or progression in colorectal cancers.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Prognostic

Summary: Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is associated with tumor development and progression in colorectal cancer (CRC), as indicated by its presence in CRC specimens and its correlation with miR-31 expression levels. Evidence Type: Prognostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation correlates with poorer mortality and shorter median survival time in patients with advanced CRC, suggesting its role as a prognostic biomarker.

Gene→Variant (gene-first): 673:V600E 673:serine/threonine

Genes: 673

Variants: V600E serine/threonine

[Paragraph-level] PMCID: PMC6333965 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E545K | Summary: The PIK3CA E545K missense mutation is established as a canonical mutation contributing to tumor development. Evidence Type: Oncogenic | Mutation: R58X | Summary: The CDKN2A R58X nonsense mutation is associated with tumor development due to its role in cell cycle regulation. Evidence Type: Oncogenic | Mutation: R209Q/W | Summary: The TP53 inactivating mutations R209Q/W are implicated in cell cycle deregulation, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: R243W/Q | Summary: The TP53 inactivating mutations R243W/Q are associated with cell cycle deregulation, indicating their role in tumor development.

Gene→Variant (gene-first): 5290:E545K 7157:R209Q/W 7157:R243W/Q 1029:R58X

Genes: 5290 7157 1029

Variants: E545K R209Q/W R243W/Q R58X

[Paragraph-level] PMCID: PMC6333965 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E545K | Summary: The PIK3CA E545K mutation is noted as a potentially targetable alteration, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: R58X | Summary: The CDKN2A R58X mutation is also mentioned as a potentially targetable alteration, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 5290:E545K 1029:R58X

Genes: 5290 1029

Variants: E545K R58X

[Paragraph-level] PMCID: PMC3997489 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Diagnostic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is associated with the development and progression of Diffuse Intrinsic Pontine Glioma (DIPG), contributing to the tumor's oncogenic characteristics. Evidence Type: Diagnostic | Mutation: K27M | Summary: The presence of the K27M mutation is used to classify and define the molecular subgroup of DIPG, aiding in the understanding of its genetic drivers.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predictive, Oncogenic, Prognostic

Summary: Evidence Type: Predictive | Mutation: Y537S | Summary: The Y537S mutation is associated with resistance to fulvestrant treatment, indicating its predictive value in therapy response. Evidence Type: Oncogenic | Mutation: Y537S | Summary: The Y537S mutation contributes to tumor development or progression, as it is positively selected during treatment. Evidence Type: Prognostic | Mutation: Y537S | Summary: The presence of the Y537S mutation correlates with progression-free survival outcomes, suggesting its prognostic significance.

Gene→Variant (gene-first): 5728:Y537S

Genes: 5728

Variants: Y537S

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E542K | Summary: The E542K mutation shows limited evidence for positive selection, indicating its potential role in tumor development or progression. Evidence Type: Oncogenic | Mutation: E545K | Summary: The E545K mutation is one of the most common acquired variants, suggesting its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: H1047L | Summary: The H1047L mutation is validated as an acquired variant, indicating its potential role in tumor development or progression. Evidence Type: Oncogenic | Mutation: H1047R | Summary: The H1047R mutation is validated as an acquired variant, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047L 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047L H1047R

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Q257X | Summary: The Q257X mutation in the RB1 gene is associated with the development of resistance to palbociclib and fulvestrant treatment, indicating its role in tumor progression. Evidence Type: Functional | Mutation: Q257X | Summary: The Q257X mutation is likely to result in abrogated Rb function due to the introduction of a stop codon, affecting the molecular function of the RB1 protein.

Gene→Variant (gene-first): 5925:Q257X

Genes: 5925

Variants: Q257X

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.K569E | Summary: The p.K569E mutation in FGFR2 is described as an activating mutation that contributes to tumor development, particularly in the context of resistance to treatment with palbociclib plus fulvestrant. Evidence Type: Functional | Mutation: Q75E | Summary: The Q75E mutation in ESR1 is mentioned in relation to changes in dominant mutations and sub-clonal selection, suggesting it may have functional implications, although it is not recognized as a cause of resistance. Evidence Type: Oncogenic | Mutation: D538G | Summary: The D538G mutation in ESR1 was negatively selected during treatment, indicating its role in tumor progression and response to therapy, thus supporting its oncogenic potential.

Gene→Variant (gene-first): 2263:D538G 2099:Q75E 2263:p.K569E

Genes: 2263 2099

Variants: D538G Q75E p.K569E

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.Q257X | Summary: The p.Q257X mutation in RB1 is associated with resistance to treatment, indicating its role in tumor development or progression. Evidence Type: Oncogenic | Mutation: p.N519fs | Summary: The p.N519fs mutation in RB1 is linked to the emergence of a resistant subclone, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 5925:p.N519fs 5925:p.Q257X

Genes: 5925

Variants: p.N519fs p.Q257X

[Paragraph-level] PMCID: PMC8203843 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: R132H | Summary: The IDH1 R132H mutation is associated with sensitivity to PARP inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1 R132H mutation contributes to tumor development and progression, particularly in the context of glioma.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC8203843 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: R132H | Summary: The R132H variant is associated with sensitivity to PARP inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: R132H | Summary: The R132H variant contributes to tumor development or progression, as it is implicated in cancer-related pathways.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC7086303 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G598V | Summary: The G598V mutation in EGFR is associated with increased sensitivity to the EGFR inhibitor afatinib, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: G598V | Summary: The G598V mutation is described as an activating mutation in EGFR, contributing to tumor development and progression in BTSC cultures.

Gene→Variant (gene-first): 1956:G598V

Genes: 1956

Variants: G598V

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 19

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation is associated with a response to the irreversible EGFR inhibitor CL-387,785, which shows greater effectiveness compared to gefitinib or erlotinib in inhibiting colony formation and autophosphorylation. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation contributes to tumor development or progression, as indicated by its role in transformation and autophosphorylation in cancer cells.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: mutant EGFR | Summary: The mutant EGFR leads to constitutive activation of signaling pathways, indicating an alteration in molecular function related to cell survival. Evidence Type: Oncogenic | Mutation: mutant EGFR | Summary: The mutant EGFR contributes to tumor development by activating downstream signaling pathways, which are involved in promoting cell survival.

Gene→Variant (gene-first): 207:serine/threonine

Genes: 207

Variants: serine/threonine

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: L858R | Summary: The L858R mutant EGFR alters molecular function by constitutively activating STAT signaling pathways and increasing STAT3-dependent gene expression in transformed cells. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation in EGFR contributes to tumor development as evidenced by its transformation of NIH-3T3 cells and activation of oncogenic signaling pathways.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: L858R | Summary: The L858R mutation in EGFR leads to constitutive phosphorylation of Shc, indicating an alteration in molecular function related to downstream signaling pathways. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation in EGFR contributes to tumor development by causing constitutive activation and signaling alterations in cancer cells.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with ligand-independent autophosphorylation, indicating that it alters molecular function related to receptor activation. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation contributes to tumor development and progression, as it is implicated in the activation of EGFR in lung adenocarcinoma.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutant form of EGFR was shown to enhance anchorage-independent growth in hTBE cells, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutant form of EGFR conferred enhanced anchorage-independent growth in hTBE cells, supporting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: L747_E749del A750P | Summary: The L747_E749del A750P deletion and insertion mutants formed colonies in soft agar with high efficiency, suggesting their oncogenic potential. Evidence Type: Oncogenic | Mutation: D770_N771insNPG | Summary: The D770_N771insNPG insertion mutant also demonstrated the ability to form colonies in soft agar, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: V12 | Summary: The expression of H-RAS V12 in hTBE cells was mentioned in the context of anchorage-independent growth, suggesting its oncogenic behavior, although it is not an EGFR mutation.

Gene→Variant (gene-first): 1956:D770_N771insNPG 1956:G719S 1956:L747_E749del A750P 1956:L858R 3265:V12

Genes: 1956 3265

Variants: D770_N771insNPG G719S L747_E749del A750P L858R V12

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: A750P | Summary: The A750P mutation was assessed for transforming activity and was shown to contribute to tumor development by promoting colony formation in soft agar. Evidence Type: Oncogenic | Mutation: D770_N771insNPG | Summary: The D770_N771insNPG mutation demonstrated transforming activity, contributing to tumor development as indicated by increased colony formation efficiency in NIH-3T3 cells. Evidence Type: Oncogenic | Mutation: L747_E749del | Summary: The L747_E749del mutation was shown to have transforming activity, contributing to tumor development through enhanced colony formation in soft agar. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation exhibited transforming activity, as evidenced by its comparable colony formation efficiency to the deletion mutant in NIH-3T3 cells. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutation was part of the study assessing transforming activity, indicating its role in tumor development through altered cellular behavior in focus formation assays.

Gene→Variant (gene-first): 1956:A750P 1956:D770_N771insNPG 1956:E749del 1956:G719S 1956:L858R

Genes: 1956

Variants: A750P D770_N771insNPG E749del G719S L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R EGFR mutation contributes to tumor development as demonstrated by the formation of tumors in immunocompromised mice after injection of transformed NIH-3T3 fibroblasts. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S EGFR mutation contributes to tumor development as shown by the formation of tumors in immunocompromised mice following the injection of transformed NIH-3T3 fibroblasts. Evidence Type: Functional | Mutation: D837A | Summary: The D837A mutation is described as kinase-inactive, indicating an alteration in molecular function compared to the wild-type EGFR.

Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

Genes: 1956

Variants: D837A G719S L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutation was shown to transform NIH-3T3 cells to anchorage independence, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation was able to transform NIH-3T3 cells to anchorage independence, demonstrating its contribution to tumor progression. Evidence Type: Functional | Mutation: D837A | Summary: The D837A mutation is described as kinase-dead and failed to induce colony formation, indicating an alteration in molecular function.

Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

Genes: 1956

Variants: D837A G719S L858R

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 9

Evidence Type(s): Prognostic, Diagnostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: K27M | Summary: The K27M mutation in histone H3 is associated with worse overall survival in DIPG patients compared to those without histone mutations, indicating its prognostic significance. Evidence Type: Diagnostic | Mutation: K27M | Summary: The presence of the K27M mutation in histone H3 is used to classify and define the subtype of tumors in DIPG patients, serving as a diagnostic marker. Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation in histone H3 contributes to tumor development and progression in DIPG, indicating its oncogenic potential.

Gene→Variant (gene-first): 90:K27M

Genes: 90

Variants: K27M

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 8

Evidence Type(s): Diagnostic, Oncogenic

Summary: Evidence Type: Diagnostic | Mutation: K27M | Summary: The K27M mutation is associated with specific histological features, which can be used to classify or define certain types of tumors. Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation contributes to tumor development and progression, indicating its role as an oncogenic variant.

Gene→Variant (gene-first): 90:K27M

Genes: 90

Variants: K27M

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 7

Evidence Type(s): Prognostic, Oncogenic, Functional

Summary: Evidence Type: Prognostic | Mutation: K27M | Summary: The K27M mutation is associated with worse overall survival in patients with leptomeningeal spread, averaging 0.63 years compared to 1.84 years for wild-type cases. Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation contributes to tumor development, as indicated by its presence in cases of GBM and its association with leptomeningeal dissemination. Evidence Type: Functional | Mutation: p.Glu545Gly | Summary: The p.Glu545Gly alteration in PIK3CA is a mutation that may alter the molecular function of the protein, contributing to tumorigenesis. Evidence Type: Functional | Mutation: p.Gly328Val | Summary: The p.Gly328Val substitution in ACVR1 is a mutation that may affect the molecular function of the protein, potentially playing a role in tumor development.

Gene→Variant (gene-first): 90:K27M 5290:p.Glu545Gly 90:p.Gly328Val

Genes: 90 5290

Variants: K27M p.Glu545Gly p.Gly328Val

[Paragraph-level] PMCID: PMC7467277 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: chr8:208343-27992852 | Summary: The deletion observed on chromosome 8p, specifically spanning the region chr8:208343-27992852, is classified as a somatic copy number alteration (CNA) that contributes to tumor development or progression.

Gene→Variant (gene-first): NA:chr8:208343-27992852

Genes: NA

Variants: chr8:208343-27992852

[Paragraph-level] PMCID: PMC4654747 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Prognostic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation in H3.3 (H3F3A) contributes to tumor development and progression in diffuse intrinsic pontine glioma (DIPG), driving distinct oncogenic programs. Evidence Type: Oncogenic | Mutation: K27I | Summary: The K27I mutation in H3F3A is associated with tumor development in DIPG, contributing to the loss of trimethylation and driving oncogenic behavior. Evidence Type: Prognostic | Mutation: K27M | Summary: Patients with tumors harboring the K27M mutation in H3.3 exhibited significantly earlier relapse and more metastatic recurrences, indicating a poor prognosis.

Gene→Variant (gene-first): 3021:K27I 3021:K27M 126961:lysine-to-isoleucine

Genes: 3021 126961

Variants: K27I K27M lysine-to-isoleucine

[Paragraph-level] PMCID: PMC6843359 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: G309A | Summary: The G309A mutation is associated with receptor activation in the HER2 extracellular domain, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: G309E | Summary: The G309E mutation contributes to receptor activation in the HER2 extracellular domain, suggesting its involvement in tumor progression. Evidence Type: Oncogenic | Mutation: S310 | Summary: The S310 mutation is implicated in receptor activation within the HER2 extracellular domain, indicating its potential role in oncogenesis. Evidence Type: Oncogenic | Mutation: S310F | Summary: The S310F mutation induces receptor activation and is involved in the formation of active heterodimers with EGFR, contributing to tumor development. Evidence Type: Oncogenic | Mutation: S310Y | Summary: The S310Y mutation is associated with receptor activation in the HER2 extracellular domain, indicating its role in tumor progression.

Gene→Variant (gene-first): 2064:G309A 2064:G309E 2064:S310 2064:S310F 2064:S310Y

Genes: 2064

Variants: G309A G309E S310 S310F S310Y

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 24

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with acquired resistance to 1st/2nd generation EGFR-TKI therapy and correlates with response to the third generation EGFR-TKI osimertinib. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation contributes to tumor development and progression, particularly in the context of resistance to EGFR-TKI therapy. Evidence Type: Oncogenic | Mutation: c.2155G>T; p.G719C | Summary: The c.2155G>T; p.G719C mutation is an activating mutation in the EGFR gene that contributes to tumor development. Evidence Type: Oncogenic | Mutation: V600E | Summary: The V600E mutation in the BRAF gene is associated with tumor development and progression, particularly in the context of the patient's cancer. Evidence Type: Oncogenic | Mutation: p.R248W | Summary: The p.R248W mutation in the TP53 gene is a common genetic variant in small-cell lung cancer that contributes to tumor development.

Gene→Variant (gene-first): 1956:G719C 1956:T790M 673:V600E 1956:c.2155G>T 1956:p.G719C 7157:p.R248W

Genes: 1956 673 7157

Variants: G719C T790M V600E c.2155G>T p.G719C p.R248W

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 13

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation was detected in three patients, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.2527G>A; p.V843I | Summary: The c.2527G>A; p.V843I mutation is described as activating from a biological perspective, indicating its contribution to tumor development or progression in lung cancer. Evidence Type: Predictive | Mutation: c.2527G>A; p.V843I | Summary: Although the c.2527G>A; p.V843I mutation is activating, it does not confer sensitivity to EGFR-TKIs, which relates to its predictive value regarding therapy response.

Gene→Variant (gene-first): 1956:c.2527G>A 1956:p.V843I

Genes: 1956

Variants: c.2527G>A p.V843I

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: c.2543C>T; p.P848L | Summary: The mutation c.2543C>T; p.P848L is associated with a patient's response to erlotinib, indicating its predictive value for treatment outcomes. Evidence Type: Oncogenic | Mutation: c.2543C>T; p.P848L | Summary: The mutation has been previously described in lung samples, suggesting its role in tumor development or progression, thus supporting its classification as oncogenic.

Gene→Variant (gene-first): 1956:c.2543C>T 1956:p.P848L

Genes: 1956

Variants: c.2543C>T p.P848L

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: c.2258T>C; p.P753L | Summary: The mutation c.2258T>C; p.P753L was associated with treatment using erlotinib, indicating a potential correlation with resistance or sensitivity to this therapy. Evidence Type: Oncogenic | Mutation: c.2258T>C; p.P753L | Summary: The mutation is noted in the context of a patient with stage IIIA SCC, suggesting its contribution to tumor development or progression in lung cancer.

Gene→Variant (gene-first): 1956:c.2258T>C 1956:p.P753L

Genes: 1956

Variants: c.2258T>C p.P753L

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.2203G>A; p.G735S | Summary: The mutation c.2203G>A; p.G735S has been described in the context of lung cancer, indicating its potential role in tumor development or progression. Evidence Type: Predictive | Mutation: c.2203G>A; p.G735S | Summary: The patient with the mutation c.2203G>A; p.G735S showed progressive disease on 2nd line EGFR-TKI therapy with gefitinib, suggesting a correlation with resistance to this specific therapy.

Gene→Variant (gene-first): 1956:c.2203G>A 1956:p.G735S

Genes: 1956

Variants: c.2203G>A p.G735S

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF mutation V600E is identified as an oncogenic driver mutation contributing to tumor development in patients with AC.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC5652823 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: T790M | Summary: The EGFR-T790M mutation is associated with response to the 3rd-generation EGFR-TKI osimertinib, indicating its predictive value for treatment sensitivity. Evidence Type: Oncogenic | Mutation: T790M | Summary: The presence of the EGFR-T790M mutation contributes to tumor progression, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 1956:T790M

Genes: 1956

Variants: T790M

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 25

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: 21 T > C | Summary: The 21 T > C variant is associated with increased BCL2 expression and correlates with resistance to paclitaxel treatment, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: 21 T > C | Summary: The 21 T > C variant contributes to tumor development by leading to higher BCL2 expression, which is linked to resistance against paclitaxel, a common chemotherapeutic agent.

Gene→Variant (gene-first): 596:21 T > C

Genes: 596

Variants: 21 T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: + 21 T > C | Summary: The + 21 T > C substitution is hypothesized to lead to a more stable transcript, resulting in increased BCL2 protein levels, indicating a change in molecular function. Evidence Type: Oncogenic | Mutation: + 21 T > C | Summary: The increase in BCL2 protein levels associated with the + 21 T > C mutation suggests a contribution to tumor development or progression in ovarian cancer patients.

Gene→Variant (gene-first): 596:+ 21 T > C 596:C instead of a T

Genes: 596

Variants: + 21 T > C C instead of a T

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: + 21 T > C | Summary: The mutation from C to T at location 21 of BCL2 is associated with resistance to the chemotherapy drug paclitaxel, indicating its predictive value for treatment response. Evidence Type: Oncogenic | Mutation: + 21 T > C | Summary: The transition from C to T at location 21 of BCL2 contributes to tumor development or progression, highlighting its oncogenic potential.

Gene→Variant (gene-first): 596:+ 21 T > C 596:C to a T

Genes: 596

Variants: + 21 T > C C to a T

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 26

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.5946delT | Summary: The BRCA2:c.5946delT mutation is described as pathogenic and is associated with the presentation of neoantigens, indicating its contribution to tumor development. Evidence Type: Oncogenic | Mutation: c.68_69delAG | Summary: The BRCA1:c.68_69delAG mutation is identified as pathogenic and is linked to the generation of neoantigens, suggesting its role in tumor progression. Evidence Type: Oncogenic | Mutation: c.5266dupC | Summary: The BRCA1:c.5266dupC mutation is classified as pathogenic and is associated with neoantigen presentation, indicating its involvement in tumor development.

Gene→Variant (gene-first): 672:c.5266dupC 675:c.5946delT 672:c.68_69delAG

Genes: 672 675

Variants: c.5266dupC c.5946delT c.68_69delAG

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.C61S | Summary: The BRCA1:p.C61S missense mutation is described as pathogenic, indicating it contributes to tumor development or progression. Evidence Type: Oncogenic | Mutation: p.M1I | Summary: The BRCA1:p.M1I pathogenic mutation is noted to result in loss of the translation start site, suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 672:p.C61S 672:p.M1I

Genes: 672

Variants: p.C61S p.M1I

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.7355delA | Summary: The mutation c.7355delA in BRCA2 is described as a pathogenic mutation, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 675:c.7355delA

Genes: 675

Variants: c.7355delA

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

Evidence Type(s): Oncogenic, Diagnostic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is classified as a 'classical mutation' and is associated with tumor development or progression in patients, particularly in the context of adenocarcinomas and smoking status. Evidence Type: Diagnostic | Mutation: L858R | Summary: The presence of the L858R mutation is used to classify patients within the 'classical mutations' group, indicating its role in defining or confirming a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E746V | Summary: The E746V mutation is identified as a classical mutation in patients, suggesting its contribution to tumor development or progression due to its somatic origin. Evidence Type: Oncogenic | Mutation: G719D | Summary: The G719D mutation is classified as a classical mutation in patients, indicating its role in tumor development or progression as it is of somatic origin. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is noted as a classical point mutation in patients, supporting its involvement in tumor development or progression due to its somatic nature.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: H1047R | Summary: The PIK3CA H1047R mutation is described as an activating mutation that contributes to tumor development and progression, particularly in high-grade astrocytoma (WHO IV). Evidence Type: Functional | Mutation: H1047R | Summary: The H1047R mutation affects the catalytic domain of PIK3CA, indicating an alteration in molecular or biochemical function related to the PI3K pathway.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is identified as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development. Evidence Type: Functional | Mutation: K27M | Summary: The K27M mutation alters the molecular function of histone proteins, specifically in the context of histone 3 variants, impacting chromatin regulation and contributing to tumorigenesis.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is associated with tumorigenesis in Diffuse Intrinsic Pontine Gliomas (DIPGs) and is involved in the development and progression of these tumors.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Summary: Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3 V855A somatic mutation is implicated in the development and progression of non-small cell lung cancer (NSCLC) and enhances ligand-induced transformation in cell lines, indicating its role in tumor development. Evidence Type: Predictive | Mutation: V855A | Summary: The presence of the HER3 V855A mutation suggests potential sensitivity to HER-targeted inhibitors, indicating its relevance in predicting response to targeted therapies in NSCLC. Evidence Type: Functional | Mutation: V855A | Summary: In silico modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the activity of HER3, indicating a change in molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation may correlate with a malignant phenotype, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The HER3-V855A variant is investigated for its therapeutic targeting potential, showing varying sensitivity to inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant is associated with altered growth inhibition in Ba/F3 cells, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular interaction between HER3 and HER2, enhancing their physical interaction, particularly in the presence of NRG1beta. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development by increasing the activity of HER3 through enhanced interaction with HER2, suggesting a role in cancer progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to HER signaling. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development by enhancing HER2 trans-phosphorylation, which is a key event in cancer signaling pathways.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular function of HER3, as it affects the phosphorylation levels of HER3 and its downstream targets in response to NRG1beta treatment. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development or progression, as it is associated with transforming activity that requires a competent HER2 receptor.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the molecular function of Ba/F3 cells, affecting their growth response and colony formation in the presence of TGFalpha. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is implicated in tumor development as it demonstrates a robust growth response in a cellular model, indicating its potential role in oncogenic processes.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant alters the colony formation ability, resulting in significantly larger colony sizes compared to wild-type HER3, indicating a change in molecular function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development or progression as evidenced by its enhanced colony formation capabilities in the presence of NRG1beta treatment.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the growth response of Ba/F3 cells in the presence of NRG1beta, indicating a change in molecular function related to HER3 activation. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation contributes to tumor development by promoting IL-3-independent growth in the presence of specific ligands, suggesting its role in oncogenic processes.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation was studied in a Ba/F3 model system to determine its functional impact, indicating that it alters molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is described as a contributor to oncogenic transformation and tumorigenesis, particularly in combination with HER2, suggesting its role in tumor development.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation is suggested to have a functional effect due to its position in a conserved sequence motif that may affect protein kinase activity. Evidence Type: Functional | Mutation: L858 | Summary: The L858 mutation is part of a conserved sequence motif that stabilizes the inactive position of the alphaC helix, indicating potential functional relevance. Evidence Type: Oncogenic | Mutation: L597V | Summary: The L597V mutation is classified as an intermediate kinase active variant that significantly increases BRAF activity, contributing to tumor development. Evidence Type: Functional | Mutation: L597V | Summary: The L597V mutation is associated with increased ERK activation, indicating a functional alteration in molecular activity.

Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

Genes: 673 1956 324

Variants: L597V L858 L858R V855 V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with increased sensitivity to EGFR TKIs, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R missense mutation is classified as an activating mutation that contributes to tumor development in the context of EGFR-related cancers.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: T-to-C | Summary: The T-to-C mutation in the HER3 gene is identified as a somatic variant that contributes to tumor development, as it was detected in the tumor sample but not in the patient's peripheral blood DNA. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation in the HER3 gene is a somatic variant that plays a role in tumor progression, as indicated by its presence in the tumor sample. Evidence Type: Functional | Mutation: p. Val855Ala | Summary: The p. Val855Ala mutation alters the molecular function of the HER3 protein, as it involves a substitution of valine to alanine at codon 855, which is part of the activation loop.

Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

Genes: 2065 324

Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.2466T>A; p.N822K | Summary: The mutation p.N822K (c.2466T>A) is associated with tumor development in a case of jejunal cancer, indicating its potential role in oncogenesis.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.1504_1509 dup GCCTAT | Summary: The mutation c.1504_1509 dup GCCTAT is associated with tumor development in cases of small intestine tumors, indicating its role in oncogenesis. Evidence Type: Functional | Mutation: Ala-Tyr | Summary: The duplication of Ala-Tyr at codons 502-503 suggests an alteration in molecular function due to the mutation. Evidence Type: Oncogenic | Mutation: c.1509_1510insACCTAT | Summary: The insertion mutation c.1509_1510insACCTAT is noted in a case of duodenal GIST, contributing to tumor progression. Evidence Type: Functional | Mutation: p.Y503_F504insTY | Summary: The insertion of p.Y503_F504insTY indicates a change in the molecular or biochemical function associated with the mutation.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558del; c.1654_1674delATGTATGAAGTACAGTGGAAG | Summary: The in-frame deletion in exon 11 is associated with tumor development in a GIST, indicating its role in oncogenesis. Evidence Type: Oncogenic | Mutation: p.K642R; c.1925A>G | Summary: The novel substitution mutation in exon 13 is implicated in tumor progression in a GIST, supporting its oncogenic potential.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.1666C>G | Summary: The mutation c.1666C>G, resulting in the p.Q556E protein change, is identified as a novel mutation in a classic hot-spot region, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: c.1666_1668dupCAG | Summary: The mutation c.1666_1668dupCAG, leading to the p.Q556dup protein change, is noted as a novel mutation associated with double mutations, indicating its potential role in tumor progression. Evidence Type: Oncogenic | Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation c.1672_1677delAAGGTTinsAGT, resulting in the p.K558_V559delinsS protein change, is described as a partner mutation in double mutations, suggesting its involvement in oncogenic processes.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558 del | Summary: The K558 del mutation is part of a common in-frame deletion associated with tumor development. Evidence Type: Oncogenic | Mutation: V555del | Summary: The V555del mutation is identified as a somatic variant contributing to tumor progression. Evidence Type: Oncogenic | Mutation: c.1669_1674delTGGAAG | Summary: The c.1669_1674delTGGAAG mutation is a common in-frame deletion that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: c.1676T>A | Summary: The c.1676T>A mutation is associated with oncogenic activity as a somatic variant. Evidence Type: Oncogenic | Mutation: c.1679T>A | Summary: The c.1679T>A mutation is recognized as a somatic variant that contributes to tumor progression. Evidence Type: Oncogenic | Mutation: p.V559D | Summary: The p.V559D mutation is identified as a somatic variant that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: p.V560D | Summary: The p.V560D mutation is associated with oncogenic behavior as a somatic variant.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation in metastatic colorectal cancer is associated with treatment response to vemurafenib and erlotinib, indicating its predictive value for therapy efficacy. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in tumor development and progression in metastatic colorectal cancer, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation is associated with the development of combination therapies involving oral BRAF inhibitors and EGFR-targeting antibodies, indicating its potential role in predicting response to these therapies. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in the progression of metastatic colorectal cancer, suggesting its role as an oncogenic driver in tumor development.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.K656E | Summary: The p.K656E mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development. Evidence Type: Oncogenic | Mutation: p.V561M | Summary: The p.V561M mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development.

Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

Genes: 2260

Variants: c.1681G>A c.1966A>G p.K656E p.V561M

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The IDH1 p.R132H mutation is associated with tumor development or progression in gliomas, although this specific tumor was noted to be IDH1 negative.

Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

Genes: 3417 673

Variants: p.R132H p.V600E

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Summary: Evidence Type: Diagnostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation is used to classify and confirm the subtype of tumors in which it is found, indicating its diagnostic relevance. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is known to contribute to tumor development and progression, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: p.L755P | Summary: The p.L755P mutation in HER2 is associated with a response to osimertinib in a patient with NSCLC, suggesting its potential as a predictive biomarker for targeted treatment. Evidence Type: Oncogenic | Mutation: p.L755P | Summary: The p.L755P mutation contributes to tumor development or progression in the context of NSCLC, indicating its oncogenic potential.

Gene→Variant (gene-first): 2064:p.L755P

Genes: 2064

Variants: p.L755P

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.2262_2264delinsTCC | Summary: The ERBB2 exon 19 mutation is associated with tumor development or progression in the context of stage IV NSCLC. Evidence Type: Predictive | Mutation: c.2262_2264delinsTCC | Summary: The mutation correlates with the patient's response to osimertinib treatment, indicating its predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: p.(L755P) | Summary: The p.(L755P) mutation in ERBB2 is implicated in contributing to tumor development or progression in NSCLC. Evidence Type: Predictive | Mutation: p.(L755P) | Summary: This mutation is associated with the patient's response to osimertinib, suggesting its predictive role in therapy sensitivity.

Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

Genes: 2064

Variants: c.2262_2264delinsTCC p.(L755P)

[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.K57N | Summary: The MAP2K1 mutation p.K57N is associated with the development of arteriovenous malformation (AVM) through its presence in endothelial cells, indicating its role in tumor progression. Evidence Type: Functional | Mutation: p.K57N | Summary: The p.K57N variant in MAP2K1 alters the molecular function related to endothelial cell behavior, contributing to the pathophysiology of AVM.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Oncogenic, Predisposing

Summary: Evidence Type: Oncogenic | Mutation: c.2514+1G>C | Summary: The somatic mutation c.2514+1G>C in PALB2 is associated with tumor development or progression, contributing to the patient's pancreatic cancer. Evidence Type: Predisposing | Mutation: c.3114-1G>A | Summary: The germline mutation c.3114-1G>A in PALB2 is associated with an inherited risk for disease, indicating a predisposition to cancer in this patient.

Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

Genes: 79728

Variants: c.2514+1G>C c.3114-1G>A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: M886I | Summary: The mutation M886I is associated with cancer progression through altered binding to co-repressors or co-regulators, indicating its role in tumor development. Evidence Type: Functional | Mutation: M886I | Summary: The mutation M886I may not change activity from wild type but is suggested to alter molecular interactions, impacting its biochemical function.

Gene→Variant (gene-first): 9611:M886I

Genes: 9611

Variants: M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation demonstrates a significant loss of function in receptor activity, indicating its alteration of molecular function in the presence of DHT. Evidence Type: Oncogenic | Mutation: M749I | Summary: The M749I mutation has been identified in relapsed tumors and may contribute to prostate cancer progression, suggesting its role in tumor development. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows a modest loss of function at low DHT levels but gains constitutive activity at higher levels, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: Q798E | Summary: The Q798E mutation's constitutive activity could have significant implications for prostate cancer development, suggesting its contribution to tumor progression. Evidence Type: Functional | Mutation: H874Y | Summary: The H874Y mutation exhibits increased constitutive activity and notable gains of function, indicating a change in molecular function that may influence receptor signaling. Evidence Type: Oncogenic | Mutation: H874Y | Summary: The H874Y mutation is associated with constitutive activity and promiscuous ligand activation, representing a potential driver of prostate cancer progression.

Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

Genes: 367 1387 10514

Variants: H874Y M749I Q798E

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: L57Q | Summary: The L57Q mutation exhibited loss of function at all concentrations of DHT, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation demonstrated constitutive activity and gain of function in the presence of DHT, suggesting its role in tumor development. Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation represented a transition from loss of function to gain of function, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation showed a transition from wild-type activity to gain of function, indicating an alteration in molecular function.

Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

Genes: 2232 367

Variants: G142V L57Q P390L P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

Evidence Type(s): Predisposing, Oncogenic, Functional

Summary: Evidence Type: Predisposing | Mutation: K720E | Summary: The K720E mutation is implicated in a 6-fold increased risk of prostate cancer, indicating its role as a predisposing variant. Evidence Type: Oncogenic | Mutation: R726L | Summary: The R726L mutation contributes to tumor development by impairing binding interactions critical for androgen receptor function. Evidence Type: Functional | Mutation: N756 | Summary: The N756 mutation may be involved in AR dimerization, and its mutation to aspartate resulted in complete loss of function. Evidence Type: Functional | Mutation: A765T | Summary: The A765T mutation displayed compromised transactivation activity, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Y763C | Summary: The Y763C mutation also displayed compromised transactivation activity, suggesting it alters molecular function. Evidence Type: Functional | Mutation: Q902 | Summary: The Q902 residue is part of an H-bonding network, and its mutation to arginine (Q902R) may disrupt this interaction, indicating a functional alteration.

Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

Genes: 367 9611

Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K910R | Summary: The K910R mutation is associated with driving prostate cancer (PCa) development, despite showing only minor divergence from wild type (WT) and distinctive losses of function. Evidence Type: Functional | Mutation: M886I | Summary: The M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability in prostate cancer.

Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

Genes: 367 9611

Variants: K910R M886 M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation functions like wild-type (WT) at low DHT but gains function upon DHT binding, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M523V | Summary: The M523V mutation exhibits constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: G524D | Summary: The G524D mutation demonstrates constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M537V | Summary: The M537V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

Genes: 2232 367

Variants: G142V G524D M523V M537V P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: D221H | Summary: The D221H mutation is associated with a loss of function that may contribute to tumor development or progression, as indicated by its context in prostate cancer. Evidence Type: Oncogenic | Mutation: D528G | Summary: The D528G mutation is implicated in tumor development or progression, as suggested by its context in prostate cancer. Evidence Type: Functional | Mutation: S296R | Summary: The S296R mutation alters interaction with the co-repressor N-CoR, leading to reduced transactivational activity, indicating a change in molecular function. Evidence Type: Functional | Mutation: P340L | Summary: The P340L mutation is predicted to create a new alpha-helix and is associated with reduced binding to TFIIF, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: E198G | Summary: The E198G mutation has been shown to maintain transactivational activity similar to wild-type in the presence of ART-27, indicating a functional aspect. Evidence Type: Functional | Mutation: P269S | Summary: The P269S mutation is reported to have transactivational activity comparable to wild-type when stimulated by ART-27, suggesting it alters molecular function. Evidence Type: Functional | Mutation: S334P | Summary: The S334P mutation also maintains transactivational activity similar to wild-type in the presence of ART-27, indicating a functional change. Evidence Type: Oncogenic | Mutation: P340L | Summary: The P340L mutation exemplifies a loss of function that can drive prostate cancer progression through reduced growth suppression, indicating its oncogenic potential.

Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 207 367 2232 9611

Variants: D221H D528G E198G P269S P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Predictive, Oncogenic

Summary: Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation alters the binding affinity of the BCL-2 protein to the selective antagonist S55746, indicating a change in molecular function compared to the wild-type. Evidence Type: Predictive | Mutation: G101V | Summary: The G101V mutation is associated with a significantly higher LC50 concentration for the drug S55746, suggesting that it may influence the response to this therapy. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation in BCL-2 is implicated in altering the drug binding characteristics, which may contribute to tumor development or progression.

Gene→Variant (gene-first): 596:G101V

Genes: 596

Variants: G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: E152 | Summary: The E152 mutation alters the conformation and binding affinity of the BCL-2 protein, impacting its interaction with venetoclax. Evidence Type: Functional | Mutation: E152A | Summary: The E152A mutation maintains comparable binding to wild-type BCL-2 and restores high affinity for venetoclax when combined with G101V. Evidence Type: Functional | Mutation: G101A | Summary: The G101A mutation exhibits a binding affinity to venetoclax that is comparable to wild-type BCL-2, indicating a functional role in drug interaction. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation contributes to altered binding dynamics with venetoclax, suggesting a role in tumor development or progression through its impact on drug affinity.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

Genes: 596

Variants: E152 E152A G101A G101V

[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Trp557Gly | Summary: The Trp557Gly mutation in KIT is identified as a missense point mutation associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Evidence Type: Functional | Mutation: Trp557Gly | Summary: The Trp557Gly mutation alters the molecular function of the KIT protein, which is implicated in the pathogenesis of the tumors described.

Gene→Variant (gene-first): 3815:Trp557Gly

Genes: 3815

Variants: Trp557Gly

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Predisposing

Summary: Evidence Type: Oncogenic | Mutation: V37M | Summary: The V37M variant was identified in patients with B-ALL, indicating a potential contribution to tumor development in leukemia. Evidence Type: Oncogenic | Mutation: R181H | Summary: The R181H variant was also found in patients with B-ALL, suggesting its involvement in tumor progression. Evidence Type: Predisposing | Mutation: V37M | Summary: The V37M variant is described as a rare germline variant, indicating it may confer inherited risk for leukemia. Evidence Type: Predisposing | Mutation: R181H | Summary: The R181H variant is also classified as a rare germline variant, suggesting a potential inherited risk for leukemia.

Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

Genes: 2120

Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predisposing, Oncogenic

Summary: Evidence Type: Predisposing | Mutation: c.1153-5_1153_1delAACAG | Summary: The heterozygous deletion in ETV6 was identified in the proband and his mother, suggesting an inherited risk for acute lymphoblastic leukemia (ALL). Evidence Type: Oncogenic | Mutation: N385fs | Summary: The frameshift mutation at codon 385 in ETV6 is predicted to contribute to tumor development in the context of acute lymphoblastic leukemia (ALL).

Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

Genes: 2120

Variants: N385fs c.1153-5_1153_1delAACAG

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Oncogenic, Functional

Summary: Evidence Type: Diagnostic | Mutation: 415 T>C | Summary: The variant 415 T>C is associated with the diagnosis of thrombocytopenia and/or ALL, as it co-segregates with affected individuals in the family. Evidence Type: Oncogenic | Mutation: 415 T>C | Summary: The 415 T>C variant is a somatic mutation that contributes to tumor development, as it is present in all affected family members tested. Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation results in a substitution that alters the molecular function of the ETV6 protein, impacting its role in cellular processes.

Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

Genes: 10320 2120

Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

[Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predisposing, Oncogenic, Functional

Summary: Evidence Type: Predisposing | Mutation: p. L349P | Summary: The p. L349P mutation is identified as a germline variant in a kindred affected by thrombocytopenia and acute lymphoblastic leukemia (ALL), suggesting it confers inherited risk for the disease. Evidence Type: Oncogenic | Mutation: p. N385fs | Summary: The p. N385fs mutation was found in leukemic cells, contributing to tumor development as it is associated with acute lymphoblastic leukemia (ALL) and secondary myelodysplasia/acute myeloid leukemia. Evidence Type: Functional | Mutation: p. N385fs | Summary: The p. N385fs mutation alters the molecular function of ETV6, as it impairs nuclear localization and reduces the ability to regulate the transcription of ETV6 target genes.

Gene→Variant (gene-first): 2120:p. L349P 2120:p. N385fs

Genes: 2120

Variants: p. L349P p. N385fs

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with resistance to EGFR inhibitors, specifically indicating a mechanism of resistance to the third-generation EGFR inhibitor osimertinib. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation contributes to tumor development or progression as it is a mechanism of resistance that arises in patients treated with EGFR inhibitors. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is known to contribute to tumor development or progression in the context of EGFR mutations. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutation is part of a composite mutation that is implicated in tumor development or progression. Evidence Type: Oncogenic | Mutation: L861Q | Summary: The L861Q mutation is part of a composite mutation that is implicated in tumor development or progression.

Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

Genes: 1956

Variants: G719S L858R L861Q T790M

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with overall survival (OS) outcomes, indicating that patients with this mutation have a comparable prognosis to those with uncommon actionable variants when adjusted for age, sex, and year of diagnosis. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is implicated in tumor development and progression, as it is associated with worse outcomes compared to other variants in the context of overall survival analysis.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Diagnostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with treatment and survival data, indicating a correlation with disease outcome independent of therapy. Evidence Type: Diagnostic | Mutation: L858R | Summary: The L858R mutation is used to classify and confirm the presence of a specific EGFR mutation in patients, aiding in the diagnosis of the disease. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is a somatic variant that contributes to tumor development and progression in patients with EGFR mutations.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is identified as a classical, actionable EGFR mutation that contributes to tumor development or progression in a significant proportion of patients. Evidence Type: Oncogenic | Mutation: L861X | Summary: The L861X mutation is noted as an uncommon but actionable EGFR mutation that may also contribute to tumor development or progression, particularly in patients tested with multi-gene assays.

Gene→Variant (gene-first): 1956:L858R 1956:L861X

Genes: 1956

Variants: L858R L861X

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: Gln61 | Summary: The passage discusses the impact of insertions on the catalytic Gln61, indicating that these variants alter molecular function related to GTP hydrolysis. Evidence Type: Oncogenic | Mutation: Gln61 | Summary: The mention of insertions in tumor samples suggests that these variants contribute to tumor development or progression, classifying them as oncogenic.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The HRAS p.G12V variant alters molecular function by inducing phosphorylation of ERK and AKT, indicating its role in RAS signaling pathways. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The HRAS p.G12V variant contributes to tumor development by enhancing signaling capabilities, as evidenced by increased levels of phosphorylated ERK and AKT in transfected cells.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The variant KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The p.G12V variant of KRAS shows reduced intrinsic GTP hydrolysis rates compared to wild type, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The p.G12V variant is classified as a classical oncogenic variant, contributing to tumor development and progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: KRAS p.G12V is described as a classical oncogenic variant, indicating its role in tumor development or progression. The variant's interaction with Raf-RBD and its altered dissociation rate further support its oncogenic properties. Evidence Type: Functional | Mutation: p.G12V | Summary: The variant KRAS p.G12V alters the intrinsic dissociation rate of the nucleotide, demonstrating a change in molecular function compared to wild type KRAS.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.Q61L | Summary: The passage discusses the functional consequences of the p.Q61L mutation in relation to RAS signaling, indicating that it is a classic pathogenic missense mutation that may alter molecular function. Evidence Type: Oncogenic | Mutation: p.Q61L | Summary: The p.Q61L mutation is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 4893:p.Q61L

Genes: 4893

Variants: p.Q61L

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.G12A | Summary: The p.G12A mutation is described as affecting a classical position in the P-loop of KRAS, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: p.G13H | Summary: The p.G13H mutation is also noted to affect a classical position in the P-loop of KRAS, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: p.Q22K | Summary: The p.Q22K mutation is associated with increased GTP loading, indicating an alteration in molecular or biochemical function.

Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

Genes: 3845

Variants: p.G12A p.G13H p.Q22K

[Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation is associated with tumor development and progression in malignant melanomas, as it is found in 50-70% of these cases. Evidence Type: Predictive | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, which has been validated by the success of RAF and MEK inhibitors in clinical trials.

Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

Genes: 673

Variants: B-RAFV600E serine/threonine

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: A126T | Summary: The A126T variant is described as a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, indicating it does not alter the molecular function of the RAD51C complexes. Evidence Type: Functional | Mutation: D109Y | Summary: The D109Y variant is also a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, suggesting it does not affect the molecular function of the RAD51C complexes. Evidence Type: Oncogenic | Mutation: L138F | Summary: The L138F variant is identified as a deleterious variant that fails to coimmunoprecipitate with RAD51D and XRCC2, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: L27P | Summary: The L27P variant is classified as a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: T336P | Summary: The T336P variant is a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: T86I | Summary: The T86I variant is described as an intermediate variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: D159N | Summary: The D159N variant is classified as an intermediate variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: G162E | Summary: The G162E variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: S163R | Summary: The S163R variant is classified as a deleterious variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, suggesting a change in molecular function. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: R258H | Summary: The R258H variant, observed as a homozygous variant in a FANCO patient, displays reduced binding for all complex members, indicating a change in molecular function.

Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

Genes: 5889 5892

Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with a response to ruxolitinib treatment, indicating its potential predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: S703I | Summary: The presence of the S703I mutation in JAK1 suggests its contribution to tumor development or progression, highlighting its oncogenic potential.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The JAK1S703I mutation correlates with sensitivity to the JAK1/2 inhibitor ruxolitinib, indicating its potential role in predicting treatment response. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is suggested to play a critical role in tumorigenesis in the LI-03-0191 PDX model, indicating its contribution to tumor development.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with tumor development or progression, as indicated by its presence in a patient-derived xenograft (PDX) model. Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation correlates with the response to the therapy ruxolitinib, suggesting its predictive value in treatment outcomes.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study evaluating the transformation ability of JAK1 mutations, indicating a potential alteration in molecular function. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is capable of continual proliferation in the absence of IL-3, suggesting it contributes to tumor development or progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation serves as a positive control in the study, indicating its role in enabling continual proliferation and suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study exploring biological functions in the JAK-STAT signaling pathway, indicating its potential role in tumor development. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is associated with elevated expression levels of phosphorylated JAK1 and STAT proteins, suggesting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation is described as a known and recurrent activating mutation, indicating its role in tumor development.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation is identified as an activating mutation of the JAK1 gene, contributing to tumor development in HCC patients. Evidence Type: Oncogenic | Mutation: A1086S | Summary: The A1086S mutation is located in the catalytic kinase domain of JAK1, suggesting its role in tumor development. Evidence Type: Oncogenic | Mutation: N451S | Summary: The N451S mutation is found in the SH2 domain of JAK1, indicating its potential contribution to tumor progression. Evidence Type: Oncogenic | Mutation: E483D | Summary: The E483D mutation, located in the SH2 domain of JAK1, may also play a role in tumor development.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: Y641F | Summary: The Y641F mutation in EZH2 contributes to tumor development in mouse B-cells, leading to high-penetrance lymphoma. Evidence Type: Oncogenic | Mutation: Y646F | Summary: The Y646F mutation in EZH2 is associated with tumor progression in melanoma, as demonstrated in a mouse model.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F

[Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: N540K | Summary: The N540K mutation is reinforced as an important alteration that contributes to tumor development and progression, as it is associated with activating mutations in FGFR3. Evidence Type: Oncogenic | Mutation: K650E | Summary: The K650E mutation is established as a significant alteration that contributes to tumor development and progression, being linked to the activation of FGFR3. Evidence Type: Functional | Mutation: R669G | Summary: The R669G mutation is noted for its role in altering the activation state of FGFR3, although it does not occur at high frequency and may not be linked to activation.

Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G

Genes: 2261

Variants: K650E N540K R669G

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: c.199G>A | Summary: The c.199G>A variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Prognostic | Mutation: c.169A>G | Summary: The c.169A>G variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Oncogenic | Mutation: c.199G>A | Summary: The c.199G>A variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs. Evidence Type: Oncogenic | Mutation: c.169A>G | Summary: The c.169A>G variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs.

Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: c.1268G>T; p.Gly423Val | Summary: The variant c.1268G>T; p.Gly423Val is associated with a complete response to first-line therapy, indicating its potential predictive value for treatment response. Evidence Type: Oncogenic | Mutation: c.1268G>T; p.Gly423Val | Summary: The presence of the FBXW7 variant c.1268G>T; p.Gly423Val suggests a role in tumor development or progression, supporting its classification as oncogenic.

Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val

Genes: 55294

Variants: c.1268G>T p.Gly423Val

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: c.1798G>A (p.Asp600Asn) | Summary: The c.1798G>A variant is associated with a shorter progression-free survival (PFS) in patients, indicating a potential prognostic role. Evidence Type: Oncogenic | Mutation: c.1513C>T (p.Arg505Cys) | Summary: The c.1513C>T variant has been reported in several cancer types and is associated with loss of function of the protein, suggesting both oncogenic potential and functional impact.

Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn

Genes: 55294 1956 673

Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.638_639insA | Summary: The insertion mutation in NF1 leads to a premature stop codon, contributing to tumor development through loss of function and increased activation of the RAS signaling pathway. Evidence Type: Oncogenic | Mutation: c.5101A>T | Summary: The SNV in NF1 results in a premature stop codon, which is associated with tumor progression due to loss of function and enhanced RAS signaling. Evidence Type: Functional | Mutation: c.638_639insA | Summary: This insertion mutation alters the molecular function of NF1 by creating a premature stop codon, leading to loss of function. Evidence Type: Functional | Mutation: c.5101A>T | Summary: The SNV creates a premature stop codon in NF1, affecting its molecular function and resulting in loss of regulatory control over the RAS pathway.

Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter

Genes: 4763

Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G in the MAP2K1 gene results in a substitution that alters the molecular function of the MEK1 protein, leading to a gain of function. Evidence Type: Oncogenic | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G is associated with a gain of function in the MEK1 protein, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.183A>T; p.Gln61His | Summary: The KRAS variant (c.183A>T; p.Gln61His) was identified in tumor tissue, indicating its potential role in tumor development or progression. Evidence Type: Functional | Mutation: c.183A>T; p.Gln61His | Summary: The variant is associated with molecular alterations, as it was confirmed through ddPCR analysis, suggesting it affects the biochemical function of the KRAS gene.

Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His

Genes: 3845

Variants: c.183A>T p.Gln61His

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.275_276insGGCC | Summary: The variant c.275_276insGGCC in TP53 is associated with tumor development or progression, contributing to oncogenic behavior. Evidence Type: Oncogenic | Mutation: c.837_838InsG | Summary: The variant c.837_838InsG in TP53 is implicated in tumor development or progression, indicating its oncogenic potential. Evidence Type: Oncogenic | Mutation: c.4467_4468insCATTTTG | Summary: The variant c.4467_4468insCATTTTG in APC is associated with tumor development or progression, suggesting it has oncogenic properties. Evidence Type: Oncogenic | Mutation: c.4098_4099delTCinsAT | Summary: The variant c.4098_4099delTCinsAT in APC contributes to tumor development or progression, indicating its role as an oncogenic variant. Evidence Type: Oncogenic | Mutation: c.589_590insGAGTT | Summary: The variant c.589_590insGAGTT in APC is linked to tumor development or progression, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG

Genes: 7157 324

Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 196_197insHP | Summary: The mutation in CEBPA (196_197insHP) was identified in a post-repotrectinib tumor biopsy, suggesting its potential role in tumor development or progression. Evidence Type: Oncogenic | Mutation: E171G | Summary: The TP53 mutation (E171G) was detected in the post-repotrectinib tumor biopsy, indicating its possible contribution to tumor progression. Evidence Type: Oncogenic | Mutation: H178Q | Summary: The TP53 mutation (H178Q) found in the post-repotrectinib tumor biopsy may play a role in tumor development or progression. Evidence Type: Oncogenic | Mutation: H179Y | Summary: The TP53 mutation (H179Y) identified in the post-repotrectinib tumor biopsy suggests its involvement in tumor progression. Evidence Type: Oncogenic | Mutation: H555R | Summary: The RB1 mutation (H555R) detected in the post-repotrectinib tumor biopsy indicates its potential role in tumor development. Evidence Type: Oncogenic | Mutation: R143Q | Summary: The ERBB2 mutation (R143Q) found in the post-repotrectinib tumor biopsy suggests its contribution to tumor progression.

Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q

Genes: 1050 7157 896 2064 5925

Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with a positive response to repotrectinib treatment in a patient with ROS1-rearranged NSCLC, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation is part of the CD74-ROS1 rearrangement, which contributes to tumor development in the context of ROS1-rearranged non-small cell lung cancer (NSCLC).

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The ROS1-G2032R mutation is associated with varying responses to different tyrosine kinase inhibitors (TKIs), indicating its predictive value for treatment outcomes with cabozantinib and lorlatinib. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The ROS1-G2032R mutation contributes to tumor growth in the YU1079 model, demonstrating its role in oncogenic processes.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with resistance to crizotinib, and the passage indicates that repotrectinib can overcome this resistance, suggesting a predictive relationship with therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation in ROS1 is implicated in crizotinib resistance, indicating its role in tumor development or progression, thus supporting its classification as oncogenic.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: R882H | Summary: The R882H mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882C | Summary: The R882C mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882P | Summary: The R882P mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: W893S | Summary: The W893S mutation in DNMT3A is associated with tumor development or progression in AML patients.

Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S

Genes: 1788

Variants: R882 R882C R882H R882P W893 W893S

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is associated with tumor development in the context of non-small cell lung cancer (NSCLC) patients, indicating its role as a somatic variant contributing to cancer progression. Evidence Type: Oncogenic | Mutation: V600E | Summary: The V600E mutation in BRAF is implicated in tumor development, as it was detected in colon cancer cases, suggesting its role as a somatic variant contributing to cancer progression.

Gene→Variant (gene-first): 1956:T790M 673:V600E

Genes: 1956 673

Variants: T790M V600E

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.982_1028del47 | Summary: The mutation p.982_1028del47 is associated with the detection of a METex14del transcript, indicating a potential alteration in molecular function related to the MET gene. Evidence Type: Oncogenic | Mutation: p.982_1028del47 | Summary: The presence of the METex14del mutation (p.982_1028del47) suggests a contribution to tumor development or progression, as it is being screened in a cohort of cancer patients.

Gene→Variant (gene-first): 4916:p.982_1028del47

Genes: 4916

Variants: p.982_1028del47

[Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: G12C | Summary: The G12C mutation in KRAS is identified as a common mutation occurring in codon 12, which contributes to tumor development or progression in lung cancer.

Gene→Variant (gene-first): 3845:G12C

Genes: 3845

Variants: G12C

[Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L1196Q | Summary: The L1196Q mutation in ALK was identified after alectinib resistance developed, leading to the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Evidence Type: Oncogenic | Mutation: L1196Q | Summary: The L1196Q mutation is associated with the development of resistance to ALK inhibitors, indicating its role in tumor progression in the context of inflammatory myofibroblastic tumors.

Gene→Variant (gene-first): 238:L1196Q

Genes: 238

Variants: L1196Q

[Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Prognostic, Diagnostic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M-H3.3 mutation is prevalent in pediatric glioblastomas and contributes to tumor development, defining clinically and biologically distinct subgroups. Evidence Type: Prognostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is universally associated with short survival in DIPG, indicating its prognostic significance in disease outcome. Evidence Type: Diagnostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is used to define clinically and biologically distinct subgroups in pediatric glioblastomas, supporting its role in diagnostic testing.

Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M

Genes: 3021

Variants: G34V G34V/R K27M

[Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1 R132H mutation is identified as a somatic mutation that occurs frequently in gliomas and is implicated in tumorigenesis through its effects on enzyme function and the accumulation of D-2-hydroxyglutarate. Evidence Type: Functional | Mutation: R132H | Summary: The R132H mutation in IDH1 causes a loss of normal enzyme function and a gain-of-function, leading to the reduction of alpha-ketoglutarate to D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC3100313 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The heterozygous mutation p.R132H in IDH1 is associated with glioblastoma, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: p.R132H | Summary: The mutation p.R132H alters the molecular function of the IDH1 enzyme, which is relevant in the context of glioblastoma.

Gene→Variant (gene-first): 728294:R132 79944:arginine to histidine 728294:c.395G>A 3417:p.R132H

Genes: 728294 79944 3417

Variants: R132 arginine to histidine c.395G>A p.R132H

[Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: AKT1 (E17K) | Summary: The AKT1 E17K mutation is reported as an activating mutation contributing to tumor development in breast, ovarian, and colorectal cancers, as well as melanoma. Evidence Type: Functional | Mutation: AKT3 (E17K) | Summary: The AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, indicating a change in molecular function.

Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K

Genes: 207

Variants: AKT1 (E17K E17K

[Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: lysine-to-methionine | Summary: The lysine-to-methionine mutation at histone H3 lysine 27 (H3K27M) is associated with the development and progression of diffuse midline gliomas, contributing to the tumor's lethal characteristics. Evidence Type: Functional | Mutation: lysine-to-methionine | Summary: The H3K27M mutation alters histone modifications, impacting the function of the SWI/SNF complex and leading to changes in chromatin accessibility and gene expression.

Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine

Genes: 3021 55193

Variants: lysine 27 lysine-to-methionine

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: D1288N | Summary: The D1288N mutation is associated with MET TKI resistance, indicating its role in tumor development or progression. Evidence Type: Oncogenic | Mutation: L1195I | Summary: The L1195I mutation is known as a secondary mutation associated with MET TKI resistance, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: L1195V | Summary: The L1195V mutation is recognized as a secondary mutation linked to MET TKI resistance, playing a role in tumor development. Evidence Type: Oncogenic | Mutation: Y1230H | Summary: The Y1230H mutation is identified as a secondary mutation associated with MET TKI resistance, indicating its contribution to tumor progression.

Gene→Variant (gene-first): 79811:D1288N L1195I 79811:L1195V 79811:Y1230H 2064:c.1899-936_1946+520del

Genes: 79811 2064

Variants: D1288N L1195I L1195V Y1230H c.1899-936_1946+520del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with advanced LUAD and is relevant for predicting response to osimertinib therapy. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation contributes to tumor development in advanced LUAD. Evidence Type: Oncogenic | Mutation: L755S | Summary: The L755S mutation is suggested as a potential resistance mechanism in the context of osimertinib treatment. Evidence Type: Oncogenic | Mutation: D769Y | Summary: The D769Y mutation is indicated as a possible resistance mechanism following treatment with osimertinib. Evidence Type: Oncogenic | Mutation: c.1899-32_1909del | Summary: The c.1899-32_1909del alteration is detected as a concurrent alteration in the context of resistance mechanisms after osimertinib progression.

Gene→Variant (gene-first): 2064:D769Y 2064:L755S 1956:L858R 2064:c.1899-32_1909del

Genes: 2064 1956

Variants: D769Y L755S L858R c.1899-32_1909del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.1899-880_1946+761del | Summary: The variant c.1899-880_1946+761del was detected in two patients, indicating its potential role in tumor development or progression. Evidence Type: Predictive | Mutation: c.1899-2A>G | Summary: The variant c.1899-2A>G was identified in a patient after treatment, suggesting a correlation with treatment response or resistance.

Gene→Variant (gene-first): 2064:c.1899-2A>G 2064:c.1899-880_1946+761del

Genes: 2064

Variants: c.1899-2A>G c.1899-880_1946+761del

[Paragraph-level] PMCID: PMC5111006 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The CHEK2 mutation p.R474C alters the tertiary structure of CHK2 by disrupting the salt bridge between p.R474 and p.E394, indicating its functional importance. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The homozygous CHEK2 variant p.R474C is suggested to be contributory to familial cancer, as inactivation of CHEK2 in mice led to cancers in multiple organs.

Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

Genes: 11200

Variants: p.R474 p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The variant p.R474C alters the molecular function of CHK2, resulting in instability and poor activation by DNA damage compared to wild-type CHK2. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The variant p.R474C contributes to tumor development or progression by affecting the function of CHK2, a gene implicated in cell cycle regulation and DNA damage response.

Gene→Variant (gene-first): 11200:p.R474C

Genes: 11200

Variants: p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation in the EGFR gene is associated with tumor development in lung cancer, indicating its role as a somatic variant contributing to oncogenesis.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: A>G | Summary: The A>G mutation is associated with the development of ccRCC precursor lesions in mice, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: C>A | Summary: The C>A mutation is part of the frequent SNVs observed in human ccRCC, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: C>T | Summary: The C>T mutation is one of the most frequently occurring mutations in human ccRCC, indicating its potential role in oncogenesis. Evidence Type: Oncogenic | Mutation: G>A | Summary: The G>A mutation is included in the common classes of mutations found in human ccRCC, supporting its involvement in tumorigenesis. Evidence Type: Oncogenic | Mutation: G>T | Summary: The G>T mutation is part of the frequent SNVs in human ccRCC, suggesting its contribution to cancer development. Evidence Type: Oncogenic | Mutation: T>C | Summary: The T>C mutation is among the most frequently occurring mutations in human ccRCC, indicating its potential role in tumor progression.

Gene→Variant (gene-first): 7428:A>G 7428:C>A 7428:C>T 7428:G>A 7428:G>T 7428:T>C

Genes: 7428

Variants: A>G C>A C>T G>A G>T T>C

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Trp53 deletion | Summary: The deletion of Trp53 in mice contributes to tumor development, as evidenced by the increased incidence and earlier onset of tumors in VhlDelta/DeltaTrp53Delta/DeltaRb1Delta/Delta mice compared to other genotypes. Evidence Type: Functional | Mutation: Trp53 deletion | Summary: The functional deletion of Trp53 alters the molecular behavior of renal epithelial cells, leading to the development of cysts and dysplasia, indicating a change in cellular function associated with tumorigenesis.

Gene→Variant (gene-first): 7428:Trp53 deletion

Genes: 7428

Variants: Trp53 deletion

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Predictive, Oncogenic

Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with defective PI3K binding and Akt activation, indicating an alteration in molecular function related to signaling pathways. Evidence Type: Predictive | Mutation: K-RasG12D | Summary: The sensitivity of Ba/F3 cells expressing K-RasG12D to MEK inhibition suggests that this mutation correlates with response to specific therapies, indicating predictive value. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to the transformed, cytokine-independent growth of Ba/F3 cells, indicating its role in tumor development.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras shows a markedly reduced interaction with FLAG-p110alpha, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with a profound reduction in binding to FLAG-p110alpha, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: Y64G | Summary: The Y64G mutation in K-Ras, when combined with K-RasG12D, results in a significantly reduced binding to FLAG-p110alpha, indicating an alteration in molecular function.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D 5290:Y64G

Genes: 5295 3845 5290

Variants: A66dup K-RasG12D Y64G

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters molecular function, as indicated by the increased levels of pERK and pAkt in response to its expression in Ba/F3 cells. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to tumor development or progression, as it is associated with elevated signaling pathways indicative of oncogenic activity.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation. Evidence Type: Oncogenic | Mutation: A66dup | Summary: The A66dup variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: Glutamine 61; Q61 | Summary: The passage discusses potential effects on the molecular function of Glutamine 61 (Q61) due to structural changes from switch 2 insertions, indicating alterations in protein-protein interactions and the GTP conformation of Ras. Evidence Type: Oncogenic | Mutation: Glutamine 61; Q61 | Summary: The analysis suggests that alterations involving Q61 may contribute to tumor development or progression by favoring the GTP conformation of Ras, which is associated with oncogenic activity.

Gene→Variant (gene-first): 3845:Glutamine 61 3845:Q61

Genes: 3845

Variants: Glutamine 61 Q61

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation induces cytokine-independent colony formation and contributes to tumor development by promoting hypersensitive growth patterns in hematopoietic progenitor cells. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters the growth response of myeloid progenitors to GM-CSF, indicating a change in molecular function related to colony formation. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras insertion variants sensitizes myeloid progenitors to GM-CSF, suggesting an alteration in biochemical function related to growth response.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.178_198dup | Summary: The c.178_198dup variant is a partial duplication of the switch 2 domain of K-Ras, which is associated with juvenile myelomonocytic leukaemia (JMML) and contributes to tumor development. Evidence Type: Oncogenic | Mutation: c.184_198dup | Summary: The c.184_198dup variant is a tandem duplication found in lung adenocarcinomas and colorectal cancer, indicating its role in tumor progression.

Gene→Variant (gene-first): 3845:c.178_198dup 3845:c.184_198dup

Genes: 3845

Variants: c.178_198dup c.184_198dup

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The EGFR T790M mutation is maintained in osimertinib-resistant RPC-9/OsiR cells, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 1956:C797S 1956:T790M

Genes: 1956

Variants: C797S T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with gefitinib resistance in lung adenocarcinoma, indicating its role in tumor development and progression. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation in EGFR is implicated in gefitinib resistance in lung adenocarcinoma, contributing to tumor development and progression.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19del mutation is associated with the development of resistance in lung cancer cells, indicating its role in tumor progression.

Gene→Variant (gene-first): 1956:19del

Genes: 1956

Variants: 19del

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: C797S | Summary: The C797S mutation is associated with resistance to osimertinib, indicating its role in therapy response. Evidence Type: Oncogenic | Mutation: C797S | Summary: The C797S mutation contributes to tumor progression by conferring resistance to EGFR-TKIs, which is a characteristic of oncogenic behavior.

Gene→Variant (gene-first): 1956:C797S

Genes: 1956

Variants: C797S

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with tumor development and progression in lung cancer, as indicated by its presence in both naive and acquired gefitinib-resistant cell lines. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is implicated in tumor development and progression, as it is found in acquired gefitinib-resistant lung cancer cells, indicating its role in resistance mechanisms.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with a partial or complete response to treatment with FGFR TKIs, indicating its correlation with drug efficacy. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation is identified as the most frequent mutation of FGFR3, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2261:S249C

Genes: 2261

Variants: S249C