2,352 Matching Annotations
  1. Last 7 days
    1. Interestingly, we noted very few missense pathogenic mutations in the set of reported reversions. For example, in the Incidence tumour sequencing datasets used previously, we found that (40/849, 4.7%) of these pathogenic

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: p.C61S | Summary: The BRCA1:p.C61S missense mutation is described as pathogenic, indicating it contributes to tumor development or progression. Evidence Type: Oncogenic | Mutation: p.M1I | Summary: The BRCA1:p.M1I pathogenic mutation is noted to result in loss of the translation start site, suggesting it contributes to tumor development or progression.

      Gene→Variant (gene-first): 672:p.C61S 672:p.M1I

      Genes: 672

      Variants: p.C61S p.M1I

    2. For each of these common founder mutations, we noted that the reversions that emerged in these patients were generally localised to the 3' flanking sequence of the original pathogenic mutation (transcriptionally downstre

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: c.7355delA | Summary: The mutation c.7355delA in BRCA2 is described as a pathogenic mutation, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 675:c.7355delA

      Genes: 675

      Variants: c.7355delA

    3. Amongst the 91 patients we collated data from, most (68/91, 75%) had unique pathogenic mutations (Figure 1E, annotated as "single-patient mutations" and Supplementary Figure 1). There were eight pathogenic mutations repr

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic

      Summary: Evidence Type: Diagnostic | Mutation: c.185delAG | Summary: The BRCA1:c.185delAG mutation is mentioned as a pathogenic mutation used to classify patients in the dataset, indicating its role in defining a disease subtype. Evidence Type: Diagnostic | Mutation: c.5946delT | Summary: The BRCA2:c.5946delT mutation is identified as a common founder mutation in multiple patients, supporting its use in disease classification. Evidence Type: Diagnostic | Mutation: c.6174delT | Summary: The BRCA2:c.6174delT mutation is noted as a pathogenic mutation represented by multiple patients, indicating its role in defining a disease subtype.

      Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

      Genes: 672 675

      Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

    1. Median OS was 48 weeks (range=4-140). None of the following factors had a significant impact on OS: PS (P=0.403), histology (P=0.198), smoking (P=0.242), sex (P=0.475), skin rash (P=0.182) and EFGR IHC expression (P=0.63

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation was analyzed in relation to overall survival (OS), but no statistically significant difference in OS was found when compared to patients with the DEL19 mutation.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    2. The median follow-up period was 109 weeks and the median time to tumour progression (TTP) 20 weeks (range=4-140). A total of 23 (36%) patients had a TTP>24 weeks and 7 (10.9%) >52 weeks (Table 5). There was no difference

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with time to tumor progression (TTP), indicating its potential role in influencing disease outcome independent of therapy. However, the difference in TTP compared to other mutations did not reach statistical significance.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    3. The DCR was significantly higher in patients of the 'classical' mutations than in patients of the 'wild-type' (90.9 and 43.3%, respectively; P=0.006) group; conversely, there was no significant difference between the DCR

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation is associated with disease control, as two out of three patients with this mutation experienced disease control (one with PR and one with SD). Evidence Type: Predictive | Mutation: G719D | Summary: The G719D mutation is associated with disease control, as both patients with this mutation achieved stable disease (SD). Evidence Type: Predictive | Mutation: E746V | Summary: The E746V mutation is associated with disease control, as both patients with this mutation achieved stable disease (SD).

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    4. A total of 1 (1.1%) patient (no. 13) had two 'other' mutations, while 3 (3.4%) patients (nos. 9, 11 and 18), who were included in the 'classical mutations' group, had both the exon 21 L858R mutation and an 'other' mutati

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Oncogenic, Diagnostic

      Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is classified as a 'classical mutation' and is associated with tumor development or progression in patients, particularly in the context of adenocarcinomas and smoking status. Evidence Type: Diagnostic | Mutation: L858R | Summary: The presence of the L858R mutation is used to classify patients within the 'classical mutations' group, indicating its role in defining or confirming a subtype of disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. According to the mutational status, three groups of patients were identified as follows: (i) the 'wild-type' group (n=61 patients; 71%) with no detectable mutations; (ii) 'classical' mutations group (n=11 patients, 13%;

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: E746V | Summary: The E746V mutation is identified as a classical mutation in patients, suggesting its contribution to tumor development or progression due to its somatic origin. Evidence Type: Oncogenic | Mutation: G719D | Summary: The G719D mutation is classified as a classical mutation in patients, indicating its role in tumor development or progression as it is of somatic origin. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is noted as a classical point mutation in patients, supporting its involvement in tumor development or progression due to its somatic nature.

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    6. 'Classical' mutations in the EGFR tyrosine kinase domain (exons 18, 19 and 21) have been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. The aim of the current study was to evalua

      [Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: G719X | Summary: The G719X mutation has been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation has been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC.

      Gene→Variant (gene-first): 1956:G719X 1956:L858R

      Genes: 1956

      Variants: G719X L858R

    1. The finding that gilteritinib inhibited FLT3-D835Y and FLT3-ITD-D835Y, both of which harbor mutations in the activation loop essential for binding type 2 inhibitors, suggests that gilteritinib is a type 1 FLT3 inhibitor.

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Functional

      Summary: Evidence Type: Predictive | Mutation: D835Y | Summary: The mutation D835Y is associated with the response to gilteritinib, a type 1 FLT3 inhibitor, indicating its predictive value for therapy. Evidence Type: Predictive | Mutation: D835 | Summary: The mutation D835 is implicated in the response to gilteritinib, suggesting its role in predicting treatment outcomes. Evidence Type: Functional | Mutation: F691 | Summary: The F691 position is noted for its hydrophobic interaction with gilteritinib, indicating a functional alteration in the molecular interaction with the drug.

      Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

      Genes: 2322

      Variants: D835 D835Y F691

    2. Since mutations within the TKD of FLT3 (eg, FLT3-D835Y or FLT3-F691) often confer resistance to FLT3 inhibitors that were previously effective against FLT3-ITD, the effect of gilteritinib on these resistance mutations wa

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: D835Y | Summary: The D835Y mutation is associated with resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to gilteritinib. Evidence Type: Predictive | Mutation: F691 | Summary: The F691 mutation is implicated in resistance to FLT3 inhibitors, suggesting it affects the response to gilteritinib treatment. Evidence Type: Predictive | Mutation: F691 L | Summary: The F691 L mutation is associated with resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to gilteritinib. Evidence Type: Predictive | Mutation: F691I | Summary: The F691I mutation is implicated in resistance to FLT3 inhibitors, suggesting it affects the response to gilteritinib treatment.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

      Genes: 2322

      Variants: D835Y F691 F691 L F691I

    3. Inhibitory activity of gilteritinib against FLT3 containing ITD +- D835Y or F691 L/I mutations

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: D835Y | Summary: The D835Y mutation is associated with the response to gilteritinib, indicating its predictive value for therapy sensitivity. Evidence Type: Predictive | Mutation: F691 L/I | Summary: The F691 L/I mutation is associated with the response to gilteritinib, indicating its predictive value for therapy sensitivity.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

      Genes: 2322

      Variants: D835Y F691 L/I

    1. Four human NSCLC cell lines expressing different forms of the EGFR were investigated. Sensitivity of each cell line to the anti-proliferative effect of erlotinib was evaluated by methylene blue assay and is presented in

      [Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation is associated with reduced sensitivity to erlotinib treatment in the NCI-H1975 cell line, indicating a correlation with resistance to this therapy. Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with reduced sensitivity to erlotinib treatment in the NCI-H1975 cell line, indicating a correlation with resistance to this therapy.

      Gene→Variant (gene-first): 1956:L858R 1956:T790M

      Genes: 1956

      Variants: L858R T790M

    1. In addition to the main driver mutations discussed above, several patients carry recurrent mutations that are clearly subclonal (present in some but not all tumour areas in a patient) and occur at later stages of tumour

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: H1047R | Summary: The PIK3CA H1047R mutation is described as an activating mutation that contributes to tumor development and progression, particularly in high-grade astrocytoma (WHO IV). Evidence Type: Functional | Mutation: H1047R | Summary: The H1047R mutation affects the catalytic domain of PIK3CA, indicating an alteration in molecular or biochemical function related to the PI3K pathway.

      Gene→Variant (gene-first): 5290:H1047R

      Genes: 5290

      Variants: H1047R

    2. We analysed 134 punch cores from nine DIPG whole brain specimens obtained at autopsy as previously described. Selected punch cores represented multiple spatial regions of the primary tumour and adjacent areas within the

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is identified as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development. Evidence Type: Functional | Mutation: K27M | Summary: The K27M mutation alters the molecular function of histone proteins, specifically in the context of histone 3 variants, impacting chromatin regulation and contributing to tumorigenesis.

      Gene→Variant (gene-first): 8358:K27M

      Genes: 8358

      Variants: K27M

    3. Diffuse Intrinsic Pontine Gliomas (DIPGs) are deadly paediatric brain tumours where needle biopsies help guide diagnosis and targeted therapies. To address spatial heterogeneity, here we analyse 134 specimens from variou

      [Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is associated with tumorigenesis in Diffuse Intrinsic Pontine Gliomas (DIPGs) and is involved in the development and progression of these tumors.

      Gene→Variant (gene-first): 8358:K27M

      Genes: 8358

      Variants: K27M

    1. Somatic mutations found within the tyrosine kinase domain (TKD) of the human epidermal growth factor (HER) family of receptors have been implicated in the development and progression of non-small cell lung cancer (NSCLC)

      [Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive, Functional

      Summary: Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3 V855A somatic mutation is implicated in the development and progression of non-small cell lung cancer (NSCLC) and enhances ligand-induced transformation in cell lines, indicating its role in tumor development. Evidence Type: Predictive | Mutation: V855A | Summary: The presence of the HER3 V855A mutation suggests potential sensitivity to HER-targeted inhibitors, indicating its relevance in predicting response to targeted therapies in NSCLC. Evidence Type: Functional | Mutation: V855A | Summary: In silico modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    2. Taken together, these data suggest that the V855A mutation alters the activity of HER3, which may correlate with a malignant phenotype.

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the activity of HER3, indicating a change in molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation may correlate with a malignant phenotype, suggesting its contribution to tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    3. To elucidate and predict the impact of mutant V855A on the conformation of the wild-type HER3, protein modeling was performed via the automated I-TASSER server. Server predicted models were further refined by submitting

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular structure of the wild-type HER3 protein, specifically affecting the kinase domain and the carboxyl-terminal end.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    4. Impact of V855A on HER3 protein structure

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The variant V855A is associated with alterations in the molecular or biochemical function of the HER3 protein.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    5. We further examined the effects of the inhibitors on HER-related signaling activity and survival using the Ba/F3 model system. Afatinib (100nmol/L) potently inhibited NRG1beta-induced phosphorylation of HER3, wild type H

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The HER3-V855A mutation may predict response to targeted therapy, as indicated by the differential effects of inhibitors on HER-related signaling activity and survival in the presence of this mutation.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    6. To assess the effect of the inhibitors on colony formation, Ba/F3 co-transfectants were seeded onto methyl-cellulose and treated with HER inhibitors in the presence of NRG1beta. As shown in Fig 6b, afatinib (100 nmol/L)

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Functional

      Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The V855A mutation in HER3 is associated with differential response to HER inhibitors, indicating its predictive value for therapy effectiveness. Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the colony formation ability of HER3 co-transfectants, demonstrating a change in molecular function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    7. To investigate whether HER3-V855A can be therapeutically targeted; we examined the growth inhibitory effects of inhibitors targeting the extracellular and kinase domain of the HER receptors. These inhibitors include: erl

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The HER3-V855A variant is investigated for its therapeutic targeting potential, showing varying sensitivity to inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant is associated with altered growth inhibition in Ba/F3 cells, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    8. To further confirm that the V855A mutation provides increased activity to HER3 through enhanced physical interaction with HER2, we performed co-immunoprecipitaton experiments on Ba/F3 co-transfectants stimulated with or

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular interaction between HER3 and HER2, enhancing their physical interaction, particularly in the presence of NRG1beta. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development by increasing the activity of HER3 through enhanced interaction with HER2, suggesting a role in cancer progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    9. Tyrosine trans-phosphorylation is a major event in HER signaling. To examine if HER3-V855A enhances trans-phosphorylation of HER2, we performed immunoblot analysis on Ba/F3 and HEK 293Tlysates after 16hr incubation in se

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to HER signaling. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development by enhancing HER2 trans-phosphorylation, which is a key event in cancer signaling pathways.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    10. We next examined the effect of chronic treatment with NRG1beta on HER3/HER2 phosphorylation and their downstream targets AKT and ERK 1/2 in the Ba/F3 co-transfectants. As shown in Figure 3e, a five-day chronic treatment

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular function of HER3, as it affects the phosphorylation levels of HER3 and its downstream targets in response to NRG1beta treatment. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development or progression, as it is associated with transforming activity that requires a competent HER2 receptor.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    11. We also investigated the functional relevance of stable Ba/F3 transfectants co-expressing HER3-V855A and EGFR (Supplemental Fig. 1a). While Ba/F3 cells co-expressing HER3-V855A and EGFR exerted a robust growth response t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the molecular function of Ba/F3 cells, affecting their growth response and colony formation in the presence of TGFalpha. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is implicated in tumor development as it demonstrates a robust growth response in a cellular model, indicating its potential role in oncogenic processes.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    12. To assess the ability of HER3-V855A to form colonies we performed a methyl cellulose-based colony formation assay. As shown in Fig 3c & 3d, while NRG1beta treatment did not induce an increase in colony number between the

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant alters the colony formation ability, resulting in significantly larger colony sizes compared to wild-type HER3, indicating a change in molecular function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development or progression as evidenced by its enhanced colony formation capabilities in the presence of NRG1beta treatment.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    13. To determine the transforming potential of HER3-V855A in the context of IL-3 -independent growth, Ba/F3 transfectants were grown in the absence or presence of IL-3, or HER cognate ligands (neuregulin1beta (NRG1beta) or t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the growth response of Ba/F3 cells in the presence of NRG1beta, indicating a change in molecular function related to HER3 activation. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation contributes to tumor development by promoting IL-3-independent growth in the presence of specific ligands, suggesting its role in oncogenic processes.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    14. HER3 has been described as a contributor to oncogenic transformation and tumorigenesis, particularly when combined with its HER2 dimerization partner. Therefore, we hypothesized that the HER3 kinase mutation may cause a

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation was studied in a Ba/F3 model system to determine its functional impact, indicating that it alters molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is described as a contributor to oncogenic transformation and tumorigenesis, particularly in combination with HER2, suggesting its role in tumor development.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    15. To analyze the location and significance of the novel HER3-V855A mutation, we performed protein sequence alignment of exon 21 of the EGFR and HER3. Although, the amino acid at position 855 in HER3 is not conserved relati

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation is suggested to have a functional effect due to its position in a conserved sequence motif that may affect protein kinase activity. Evidence Type: Functional | Mutation: L858 | Summary: The L858 mutation is part of a conserved sequence motif that stabilizes the inactive position of the alphaC helix, indicating potential functional relevance. Evidence Type: Oncogenic | Mutation: L597V | Summary: The L597V mutation is classified as an intermediate kinase active variant that significantly increases BRAF activity, contributing to tumor development. Evidence Type: Functional | Mutation: L597V | Summary: The L597V mutation is associated with increased ERK activation, indicating a functional alteration in molecular activity.

      Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

      Genes: 673 1956 324

      Variants: L597V L858 L858R V855 V855A

    16. EGFR pathogenic mutations sensitize in varying degrees to inhibition by small molecule TKIs. These mutations include both class I short in-frame deletions and class II missense mutations. One of these mutations, the L858

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with increased sensitivity to EGFR TKIs, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R missense mutation is classified as an activating mutation that contributes to tumor development in the context of EGFR-related cancers.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    17. Homology between the HER3-V855A and EGFR-L858R kinase mutation

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: L858R | Summary: The L858R mutation is mentioned in the context of its homology with the HER3-V855A mutation, suggesting a potential alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation is mentioned in the context of its homology with the EGFR-L858R mutation, indicating a potential alteration in molecular or biochemical function.

      Gene→Variant (gene-first): 1956:L858R 324:V855A

      Genes: 1956 324

      Variants: L858R V855A

    18. A single arm multicenter phase II clinical study initiated in 2006 (FIELT1 study; NCT00339586) was coordinated by our department to evaluate the safety and efficacy of first-line erlotinib in patients with advanced NSCLC

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: T-to-C | Summary: The T-to-C mutation in the HER3 gene is identified as a somatic variant that contributes to tumor development, as it was detected in the tumor sample but not in the patient's peripheral blood DNA. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation in the HER3 gene is a somatic variant that plays a role in tumor progression, as indicated by its presence in the tumor sample. Evidence Type: Functional | Mutation: p. Val855Ala | Summary: The p. Val855Ala mutation alters the molecular function of the HER3 protein, as it involves a substitution of valine to alanine at codon 855, which is part of the activation loop.

      Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

      Genes: 2065 324

      Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

    1. A single case with p.N822K (c.2466T>A) [Figure 4b] was identified. The tumor originated in jejunum in an elderly man with spindle morphology.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: c.2466T>A; p.N822K | Summary: The mutation p.N822K (c.2466T>A) is associated with tumor development in a case of jejunal cancer, indicating its potential role in oncogenesis.

      Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

      Genes: 3815

      Variants: c.2466T>A p.N822K

    2. Three cases involving p.K642E mutation (c.1924A>G) [Figure 4a], 2/3 were in elderly men, at gastric, an anorectal site with mixed morphology. One was a double mutation in association with exon 11 [Table 2].

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

      Genes: 3815

      Variants: c.1924A>G p.K642E

    3. Mutations were identified in 10 cases located in the small intestine with significant association (P = 0.004). One was located in the retroperitoneum. Ninety percent (9/10) tumors revealed internal tandem duplications (I

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: c.1504_1509 dup GCCTAT | Summary: The mutation c.1504_1509 dup GCCTAT is associated with tumor development in cases of small intestine tumors, indicating its role in oncogenesis. Evidence Type: Functional | Mutation: Ala-Tyr | Summary: The duplication of Ala-Tyr at codons 502-503 suggests an alteration in molecular function due to the mutation. Evidence Type: Oncogenic | Mutation: c.1509_1510insACCTAT | Summary: The insertion mutation c.1509_1510insACCTAT is noted in a case of duodenal GIST, contributing to tumor progression. Evidence Type: Functional | Mutation: p.Y503_F504insTY | Summary: The insertion of p.Y503_F504insTY indicates a change in the molecular or biochemical function associated with the mutation.

      Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

      Genes: 3815

      Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

    4. Insertion of 3 nucleotides, p.K558delinsBP (c.1673_1674insTCC), and duplication p.Y577_K580dup (c.1731_1742dupTTATGATCACAA) was seen 1 case (1.8%) each, respectively.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: p.K558delinsBP | Summary: The mutation p.K558delinsBP (c.1673_1674insTCC) indicates an alteration in molecular or biochemical function due to the insertion of nucleotides.

      Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

      Genes: 3815

      Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

    5. The substitution mutations were p.V559D (3/57; 5%), p.V560D (3/57; 5%), p.V559A (2/57; 3.5%), and 1 (1.8%) cases each with p.V560G, p.T574I, and p.L576P among this 9 were homozygous and 2 heterozygous.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

      Genes: 3815

      Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

    6. One case with simultaneous mutations in exons 11 and 13 harbored in-frame deletion in exon 11; p.M552_K558del (c.1654_1674delATGTATGAAGTACAGTGGAAG) and a novel substitution mutation; p.K642R (c.1925A>G) [Figure 1d] in ex

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: K558del; c.1654_1674delATGTATGAAGTACAGTGGAAG | Summary: The in-frame deletion in exon 11 is associated with tumor development in a GIST, indicating its role in oncogenesis. Evidence Type: Oncogenic | Mutation: p.K642R; c.1925A>G | Summary: The novel substitution mutation in exon 13 is implicated in tumor progression in a GIST, supporting its oncogenic potential.

      Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

      Genes: 3815 5156 728378

      Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

    7. Exon 11 mutations were heterogeneous with in-frame deletion of 3-51 nucleotides (codons 550-576) in classic hot-spot region at the 5' end of the exon (codons 550-560). Double mutations were identified in 9 cases (16%), 8

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: c.1666C>G | Summary: The mutation c.1666C>G, resulting in the p.Q556E protein change, is identified as a novel mutation in a classic hot-spot region, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: c.1666_1668dupCAG | Summary: The mutation c.1666_1668dupCAG, leading to the p.Q556dup protein change, is noted as a novel mutation associated with double mutations, indicating its potential role in tumor progression. Evidence Type: Oncogenic | Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation c.1672_1677delAAGGTTinsAGT, resulting in the p.K558_V559delinsS protein change, is described as a partner mutation in double mutations, suggesting its involvement in oncogenic processes.

      Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

      Genes: 728378 3815

      Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

    8. Exon 11 mutations were in 57% of cases [Table 2]. In-frame deletions in 35 (61.4%), 11 substitutions (19.3%), 9 double mutations (15.7%), 1 insertion and duplication (1.8%), respectively. Common mutation was p.W557_K558

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: K558 del | Summary: The K558 del mutation is part of a common in-frame deletion associated with tumor development. Evidence Type: Oncogenic | Mutation: V555del | Summary: The V555del mutation is identified as a somatic variant contributing to tumor progression. Evidence Type: Oncogenic | Mutation: c.1669_1674delTGGAAG | Summary: The c.1669_1674delTGGAAG mutation is a common in-frame deletion that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: c.1676T>A | Summary: The c.1676T>A mutation is associated with oncogenic activity as a somatic variant. Evidence Type: Oncogenic | Mutation: c.1679T>A | Summary: The c.1679T>A mutation is recognized as a somatic variant that contributes to tumor progression. Evidence Type: Oncogenic | Mutation: p.V559D | Summary: The p.V559D mutation is identified as a somatic variant that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: p.V560D | Summary: The p.V560D mutation is associated with oncogenic behavior as a somatic variant.

      Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

      Genes: 3815

      Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

    1. Results: We found that rs3786362 G allele of thymidylate synthase (TYMS) gene was significantly associated with PFS (P = 1.10 x 10-2), OS (P = 2.50 x 10-2) and DCR (P = 5.00 x 10-3). The expression of TYMS was overexpres

      [Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Prognostic, Functional

      Summary: Evidence Type: Prognostic | Mutation: rs3786362 | Summary: The G allele of the rs3786362 variant in the TYMS gene is significantly associated with progression-free survival (PFS) and overall survival (OS), indicating its potential role as a prognostic marker in cancer outcomes. Evidence Type: Functional | Mutation: rs3786362 | Summary: The rs3786362 variant is associated with altered expression levels of the TYMS gene, suggesting a functional impact on molecular or biochemical activity in colorectal cancer (CRC) tissues compared to normal tissues.

      Gene→Variant (gene-first): 7298:rs3786362

      Genes: 7298

      Variants: rs3786362

    1. Thirty-two patients with BRAF V600E positive metastatic colorectal cancer (mCRC) and 7 patients with other cancers were enrolled. No dose-limiting toxicities were observed in escalation, with vemurafenib 960 mg twice dai

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation in metastatic colorectal cancer is associated with treatment response to vemurafenib and erlotinib, indicating its predictive value for therapy efficacy. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in tumor development and progression in metastatic colorectal cancer, supporting its classification as an oncogenic variant.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    2. BRAF V600E mutant metastatic colorectal cancer represents a significant clinical problem, with combination approaches being developed clinically with oral BRAF inhibitors combined with EGFR-targeting antibodies. While co

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation is associated with the development of combination therapies involving oral BRAF inhibitors and EGFR-targeting antibodies, indicating its potential role in predicting response to these therapies. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in the progression of metastatic colorectal cancer, suggesting its role as an oncogenic driver in tumor development.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. Whole exome sequencing identified a total of 15 somatic mutations, including nine missense mutations. Interestingly, we identified two activating mutations affecting FGFR1, including FGFR1 p.K656E (NM_023110.3:c.1966A>G)

      [Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: p.K656E | Summary: The p.K656E mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development. Evidence Type: Oncogenic | Mutation: p.V561M | Summary: The p.V561M mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development.

      Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

      Genes: 2260

      Variants: c.1681G>A c.1966A>G p.K656E p.V561M

    2. Patient is an 18-month-old otherwise healthy boy who presented with acute onset nausea, vomiting, and gait instability, resulting in a fall on the day of presentation. On arrival to the ED, vital signs were notable for h

      [Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The IDH1 p.R132H mutation is associated with tumor development or progression in gliomas, although this specific tumor was noted to be IDH1 negative.

      Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

      Genes: 3417 673

      Variants: p.R132H p.V600E

    1. Comparisons of PFS and OS (univariate and multivariate) of patients with mutation variants to patients with non-mutated tumors revealed the KRAS exon 2 G12C-variant (n = 28) to correlate with inferior OS compared with no

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: G12C | Summary: The KRAS exon 2 G12C variant correlates with inferior overall survival (OS) compared to non-mutated tumors, indicating a negative prognostic effect. Evidence Type: Prognostic | Mutation: G13D | Summary: The KRAS exon 2 G13D variant shows a trend towards inferior overall survival (OS) compared to non-mutated tumors, suggesting a potential negative prognostic effect. Evidence Type: Prognostic | Mutation: G12V | Summary: The KRAS exon 2 G12V mutation variant had a negative prognostic effect on progression-free survival (PFS) in the multivariate analysis.

      Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

      Genes: 3845

      Variants: G12C G12D G12V G13D

    2. The median PFS of patients with KRAS exon 2 mutant tumor subtypes ranged from 8.8 [95% confidence interval (CI) 7.6-10.0] months (G13D mutation) to 10.5 (95% CI 9.0-11.9) months in (G12D variants). The median OS widely r

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: G13D | Summary: The G13D mutation is associated with a median progression-free survival (PFS) of 8.8 months, indicating its correlation with disease outcome. Evidence Type: Prognostic | Mutation: G12D | Summary: The G12D variant shows a median PFS of 10.5 months and a median overall survival (OS) of 25.2 months, suggesting its impact on disease outcome. Evidence Type: Prognostic | Mutation: G12C | Summary: The G12C mutation is linked to a median overall survival (OS) of 16.8 months, indicating its association with disease outcome.

      Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

      Genes: 3845

      Variants: A146T G12C G12D G13D Q61H

    3. Of 1239 analyzed tumors, in 664 tumors (53.6%), no mutation was detected, whereas 462 tumors harboring KRAS (37.3%) mutations and 39 NRAS (3.1%) mutations were found. Additionally, a total of 74 tumors (6.0%) were carryi

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Diagnostic, Oncogenic

      Summary: Evidence Type: Diagnostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation is used to classify and confirm the subtype of tumors in which it is found, indicating its diagnostic relevance. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is known to contribute to tumor development and progression, supporting its classification as an oncogenic variant.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. This is the first report to our knowledge to demonstrate activity of osimertinib in a patient with NSCLC harboring HER2 exon 19, p.L755P mutation resulting in intra- and extracranial response. In the future, osimertinib

      [Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: p.L755P | Summary: The p.L755P mutation in HER2 is associated with a response to osimertinib in a patient with NSCLC, suggesting its potential as a predictive biomarker for targeted treatment. Evidence Type: Oncogenic | Mutation: p.L755P | Summary: The p.L755P mutation contributes to tumor development or progression in the context of NSCLC, indicating its oncogenic potential.

      Gene→Variant (gene-first): 2064:p.L755P

      Genes: 2064

      Variants: p.L755P

    2. A 68-year-old female with a past medical history of type 2 diabetes and minimal smoking was diagnosed with stage IV NSCLC. Next generation sequencing on tumor tissue demonstrated an ERBB2 exon 19 c.2262_2264delinsTCC, p.

      [Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Oncogenic, Predictive

      Summary: Evidence Type: Oncogenic | Mutation: c.2262_2264delinsTCC | Summary: The ERBB2 exon 19 mutation is associated with tumor development or progression in the context of stage IV NSCLC. Evidence Type: Predictive | Mutation: c.2262_2264delinsTCC | Summary: The mutation correlates with the patient's response to osimertinib treatment, indicating its predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: p.(L755P) | Summary: The p.(L755P) mutation in ERBB2 is implicated in contributing to tumor development or progression in NSCLC. Evidence Type: Predictive | Mutation: p.(L755P) | Summary: This mutation is associated with the patient's response to osimertinib, suggesting its predictive role in therapy sensitivity.

      Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

      Genes: 2064

      Variants: c.2262_2264delinsTCC p.(L755P)

    1. Extracranial arteriovenous malformation (AVM) is most commonly caused by MAP2K1 mutations in the endothelial cell. The purpose of this study was to determine if local tissue overgrowth associated with AVM is caused by di

      [Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: p.K57N | Summary: The MAP2K1 mutation p.K57N is associated with the development of arteriovenous malformation (AVM) through its presence in endothelial cells, indicating its role in tumor progression. Evidence Type: Functional | Mutation: p.K57N | Summary: The p.K57N variant in MAP2K1 alters the molecular function related to endothelial cell behavior, contributing to the pathophysiology of AVM.

      Gene→Variant (gene-first): 5604:p.K57N

      Genes: 5604

      Variants: p.K57N

    1. We describe a 57-year-old woman with resected stage IIIB pancreatic cancer who underwent several lines of conventional chemotherapy after multiple lymph node metastases. When the disease progressed again, the patient rec

      [Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Oncogenic, Predisposing

      Summary: Evidence Type: Oncogenic | Mutation: c.2514+1G>C | Summary: The somatic mutation c.2514+1G>C in PALB2 is associated with tumor development or progression, contributing to the patient's pancreatic cancer. Evidence Type: Predisposing | Mutation: c.3114-1G>A | Summary: The germline mutation c.3114-1G>A in PALB2 is associated with an inherited risk for disease, indicating a predisposition to cancer in this patient.

      Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

      Genes: 79728

      Variants: c.2514+1G>C c.3114-1G>A

    1. This analysis examined 45 single missense mutations detected in PCa with metastasis or high Gleason scores, and which extend along the entire length of the protein. Our sensitive assay system uncovered a previously unide

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: G142V | Summary: The G142V mutation demonstrates constitutive transactivational activity, indicating that it alters molecular function related to regulatory element binding. Evidence Type: Functional | Mutation: G524D | Summary: The G524D mutation exhibits constitutive transactivational activity, suggesting it modifies molecular function in the context of regulatory element binding. Evidence Type: Functional | Mutation: M523V | Summary: The M523V mutation shows constitutive transactivational activity, indicating an alteration in molecular function associated with regulatory element binding. Evidence Type: Functional | Mutation: M537V | Summary: The M537V mutation displays constitutive transactivational activity, suggesting it affects molecular function related to regulatory element binding. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation is involved in regulatory element binding, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation has been shown to possess a constitutive gain of function, indicating an alteration in molecular function in the absence of androgen. Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation exhibits a constitutive gain of function, suggesting it alters molecular function in the context of androgen response. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows a constitutive gain of function, indicating an alteration in molecular function related to androgen response.

      Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

      Genes: 2232 367 1387 10514 10499

      Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

    2. Mutations with no apparent change of activity from WT may be able to drive cancer progression though several diverse routes. These include altered binding to co-repressors or co-regulators e.g. M886I, regulatory element-

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: M886I | Summary: The mutation M886I is associated with cancer progression through altered binding to co-repressors or co-regulators, indicating its role in tumor development. Evidence Type: Functional | Mutation: M886I | Summary: The mutation M886I may not change activity from wild type but is suggested to alter molecular interactions, impacting its biochemical function.

      Gene→Variant (gene-first): 9611:M886I

      Genes: 9611

      Variants: M886I

    3. The LBD mutations had a greater dependence on the regulatory elements, emphasizing the importance of interdomain communication for receptor function. While the major losses of function seen with M749I at 10 nM DHT were c

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation demonstrates a significant loss of function in receptor activity, indicating its alteration of molecular function in the presence of DHT. Evidence Type: Oncogenic | Mutation: M749I | Summary: The M749I mutation has been identified in relapsed tumors and may contribute to prostate cancer progression, suggesting its role in tumor development. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows a modest loss of function at low DHT levels but gains constitutive activity at higher levels, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: Q798E | Summary: The Q798E mutation's constitutive activity could have significant implications for prostate cancer development, suggesting its contribution to tumor progression. Evidence Type: Functional | Mutation: H874Y | Summary: The H874Y mutation exhibits increased constitutive activity and notable gains of function, indicating a change in molecular function that may influence receptor signaling. Evidence Type: Oncogenic | Mutation: H874Y | Summary: The H874Y mutation is associated with constitutive activity and promiscuous ligand activation, representing a potential driver of prostate cancer progression.

      Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

      Genes: 367 1387 10514

      Variants: H874Y M749I Q798E

    4. Mutations within the DBD and hinge domains of the AR would be expected to have the greatest influence on regulating ARE binding and indeed, the profile for T575A in the first zinc finger of the DBD was markedly different

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation in the DBD alters the binding profile and transactivation activity, indicating a change in molecular function related to androgen receptor activity. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation affects regulatory element activation and may interfere with acetylation of the 629RKLKK633 motif, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: I672T | Summary: The I672T mutation is predicted to disrupt the conformation of a protein-protein interaction surface, indicating a potential change in molecular function.

      Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

      Genes: 2908 10499

      Variants: I672 I672T R629 R629Q T575A

    5. The results for the AR NTD mutations investigated with PSA61Luc closely matched those for GRE2-TATA-Luc. AR mutation L57Q had loss of function at all concentrations of DHT with both reporters although they were less pron

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: L57Q | Summary: The L57Q mutation exhibited loss of function at all concentrations of DHT, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation demonstrated constitutive activity and gain of function in the presence of DHT, suggesting its role in tumor development. Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation represented a transition from loss of function to gain of function, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation showed a transition from wild-type activity to gain of function, indicating an alteration in molecular function.

      Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

      Genes: 2232 367

      Variants: G142V L57Q P390L P533S

    6. In general, the profiles of PSA61Luc stimulation for the different AR mutations were very similar to those for GRE2-TATA-Luc; indicating that the findings in the broad GRE2-TATA-Luc study accurately reveal the effects of

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation is associated with a loss of function in the absence of DHT, indicating an alteration in molecular function related to androgen receptor activity. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation is linked to a loss of function in the absence of DHT, suggesting it alters the molecular function of the androgen receptor. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation shows a loss of function in the absence of DHT, indicating a change in the molecular function of the androgen receptor.

      Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

      Genes: 367 10499

      Variants: P390L R629Q T575A

    7. The LBD contained two mutations, D879G and Q919R, which fall within the grouping of loss to gain of function, although recovery to a modest 19% gain of function and WT levels respectively took place at only the highest c

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: D879G | Summary: The D879G mutation is associated with a loss to gain of function, indicating that it alters molecular or biochemical function, with a modest recovery of function at high concentrations of DHT. Evidence Type: Functional | Mutation: Q919R | Summary: The Q919R mutation is described as part of a loss to gain of function, suggesting it alters molecular or biochemical function, although specific details on its activity are not provided. Evidence Type: Functional | Mutation: H874Y | Summary: The H874Y mutation exhibits constitutive activity and displays loss of function relative to wild type (WT) at higher levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: T877A | Summary: The T877A mutation shows a significant constitutive gain of function with a 625% increase in activity compared to WT, indicating a substantial alteration in molecular or biochemical function.

      Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

      Genes: 10499 367

      Variants: D879G H874Y Q919R T877A

    8. Mutations K720E and R726L, which is implicated in a 6-fold increased risk of prostate cancer, reside in a positive cluster in helix 3 with lysine 720 creating a charged clamp with glutamate 897, and both residues partici

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

      Evidence Type(s): Predisposing, Oncogenic, Functional

      Summary: Evidence Type: Predisposing | Mutation: K720E | Summary: The K720E mutation is implicated in a 6-fold increased risk of prostate cancer, indicating its role as a predisposing variant. Evidence Type: Oncogenic | Mutation: R726L | Summary: The R726L mutation contributes to tumor development by impairing binding interactions critical for androgen receptor function. Evidence Type: Functional | Mutation: N756 | Summary: The N756 mutation may be involved in AR dimerization, and its mutation to aspartate resulted in complete loss of function. Evidence Type: Functional | Mutation: A765T | Summary: The A765T mutation displayed compromised transactivation activity, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Y763C | Summary: The Y763C mutation also displayed compromised transactivation activity, suggesting it alters molecular function. Evidence Type: Functional | Mutation: Q902 | Summary: The Q902 residue is part of an H-bonding network, and its mutation to arginine (Q902R) may disrupt this interaction, indicating a functional alteration.

      Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

      Genes: 367 9611

      Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

    9. Within the LBD, all but two loss of function mutations were clustered between residues 720 and 798. Of these, half had essentially no transactivational activity at physiological levels of DHT and comprise of L744F, A748V

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: A748V | Summary: The A748V mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: A765T | Summary: The A765T mutation is part of a group of loss-of-function mutations that exhibit essentially no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: L744F | Summary: The L744F mutation is identified as a loss-of-function mutation with no transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation is classified as a loss-of-function mutation with no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: N756D | Summary: The N756D mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: S759P | Summary: The S759P mutation is part of a group of loss-of-function mutations that exhibit no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: Y763C | Summary: The Y763C mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: K720E | Summary: The K720E mutation is part of a group of mutations showing a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: V757A | Summary: The V757A mutation shows a modest loss of function at all levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: V757I | Summary: The V757I mutation is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows impaired binding to co-regulatory proteins and is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: M886V | Summary: The M886V mutation is part of a group of loss-of-function mutations that exhibit impaired binding to co-regulatory proteins, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Q902R | Summary: The Q902R mutation is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function.

      Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

      Genes: 367 9611 1387 10514

      Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

    10. Mutations in the LBD have historically been considered as the most likely candidates for driving PCa, therefore, the finding that the majority of mutations under investigation had no change from WT or loss of function wa

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: K910R | Summary: The K910R mutation is associated with driving prostate cancer (PCa) development, despite showing only minor divergence from wild type (WT) and distinctive losses of function. Evidence Type: Functional | Mutation: M886I | Summary: The M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability in prostate cancer.

      Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

      Genes: 367 9611

      Variants: K910R M886 M886I

    11. Within the hinge region, mutation I672T has been included in the arbitrary classification of no change from WT due to deviation of less than 10% at 0 and 0.1 nM DHT changing to a 14% gain of function at 10 nM. Interestin

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: I672T | Summary: The I672T mutation shows a gain of function at 10 nM DHT and a loss of function at 1 nM, indicating its influence on ligand binding and molecular function. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation exhibits a loss of function at low DHT concentrations and a significant gain of function at 10 nM, demonstrating its impact on molecular activity. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation shows a loss of function at low DHT concentrations and a substantial gain of function at 10 nM, indicating its role in altering molecular function. Evidence Type: Functional | Mutation: A586V | Summary: The A586V mutation transitions from a loss of function at low DHT concentrations to a remarkable gain of function at 10 nM, highlighting its significant effect on transactivational activity. Evidence Type: Functional | Mutation: A587S | Summary: The A587S mutation displays constitutive transactivational activity with modest gains of function across all DHT levels, indicating its influence on molecular function.

      Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

      Genes: 597 367 2908 10499

      Variants: A586V A587S I672T R629Q T575A

    12. The only mutation to function like WT at low DHT and then gain function compared to WT upon DHT binding was P533S in the NTD. As with other groupings, mutations leading to constitutive transactivation activity were prese

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation functions like wild-type (WT) at low DHT but gains function upon DHT binding, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M523V | Summary: The M523V mutation exhibits constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: G524D | Summary: The G524D mutation demonstrates constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M537V | Summary: The M537V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression.

      Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

      Genes: 2232 367

      Variants: G142V G524D M523V M537V P533S

    13. The novel class of mutation, namely loss of function at low levels or in the absence of DHT recovering to WT values or a gain of function upon binding of DHT was present in the NTD. Mutations P269S and S515G had WT level

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: P269S | Summary: The P269S mutation is associated with wild-type levels of transactivation at 10 nM DHT, indicating it does not alter molecular function in this context. Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation acquired a 26% gain of function at 10 nM DHT, suggesting it alters molecular function related to AR signaling. Evidence Type: Functional | Mutation: P514S | Summary: The P514S mutation acquired a 30% gain of function at 10 nM DHT, indicating it alters molecular function in the context of AR signaling. Evidence Type: Functional | Mutation: S515G | Summary: The S515G mutation is associated with wild-type levels of transactivation at 10 nM DHT, indicating it does not alter molecular function in this context.

      Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

      Genes: 367 10514

      Variants: P269S P390L P514S S515G

    14. Interestingly, there was exiguous rescue at the highest concentration of DHT with D221H, P504L and D528G, while P340L manifested a striking dose-dependent recovery. The S296R mutation has been shown to have altered inter

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: D221H | Summary: The D221H mutation is associated with a loss of function that may contribute to tumor development or progression, as indicated by its context in prostate cancer. Evidence Type: Oncogenic | Mutation: D528G | Summary: The D528G mutation is implicated in tumor development or progression, as suggested by its context in prostate cancer. Evidence Type: Functional | Mutation: S296R | Summary: The S296R mutation alters interaction with the co-repressor N-CoR, leading to reduced transactivational activity, indicating a change in molecular function. Evidence Type: Functional | Mutation: P340L | Summary: The P340L mutation is predicted to create a new alpha-helix and is associated with reduced binding to TFIIF, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: E198G | Summary: The E198G mutation has been shown to maintain transactivational activity similar to wild-type in the presence of ART-27, indicating a functional aspect. Evidence Type: Functional | Mutation: P269S | Summary: The P269S mutation is reported to have transactivational activity comparable to wild-type when stimulated by ART-27, suggesting it alters molecular function. Evidence Type: Functional | Mutation: S334P | Summary: The S334P mutation also maintains transactivational activity similar to wild-type in the presence of ART-27, indicating a functional change. Evidence Type: Oncogenic | Mutation: P340L | Summary: The P340L mutation exemplifies a loss of function that can drive prostate cancer progression through reduced growth suppression, indicating its oncogenic potential.

      Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

      Genes: 207 367 2232 9611

      Variants: D221H D528G E198G P269S P340L P504L S296R S334P

    15. The predominant type of mutation i.e. loss of function, was well represented in the NTD. Mutations L57Q, E198G, D221H, A234T, S296R; S334P, P340L, P504L and D528G all displayed loss of function with E198G showing the gre

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: L57Q | Summary: The L57Q mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: E198G | Summary: The E198G mutation shows a significant reduction in function (50% at 1 nM), indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: D221H | Summary: The D221H mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: A234T | Summary: The A234T mutation is located at a critical site affecting function, contributing to loss of transactivational ability. Evidence Type: Functional | Mutation: S296R | Summary: The S296R mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: S334P | Summary: The S334P mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: P340L | Summary: The P340L mutation is associated with loss of function and is noted to be present in AIS, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: P504L | Summary: The P504L mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: D528G | Summary: The D528G mutation is associated with loss of function, indicating an alteration in molecular or biochemical function.

      Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

      Genes: 1387 207 367 2232 9611

      Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

    16. All five classes of mutation were represented within the NTD. Of the five mutations in AR classified as having no change from WT, G166S showed the least variance from the unmutated receptor. The mutation M537R also had m

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: G166S | Summary: The mutation G166S showed the least variance from the unmutated receptor, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: M537R | Summary: The mutation M537R exhibited a 23% gain of function at 0.1 nM DHT, suggesting an alteration in molecular function, particularly in a low androgen environment.

      Gene→Variant (gene-first): 367:G166S 367:M537R

      Genes: 367

      Variants: G166S M537R

    17. Unsurprisingly, the DBD is virtually unaltered across a wide range of species with 100% homology between the examples shown here; except for two conservative substitutions in Xenopus, one of which T575, has been included

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: T575 | Summary: The mutation T575 is mentioned in the context of a functionally distinct domain of the androgen receptor, indicating its potential role in altering molecular function. Evidence Type: Functional | Mutation: R629 | Summary: The mutation R629 is highlighted as a highly conserved amino acid, suggesting its importance in the molecular function of the androgen receptor. Evidence Type: Functional | Mutation: I672 | Summary: The mutation I672 is also noted as a highly conserved amino acid, indicating its potential role in the molecular function of the androgen receptor.

      Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

      Genes: 2908 10499

      Variants: I672 R629 T575

    18. The NTD is by far the least conserved domain with mouse, chicken and Xenopus having only 75, 32 and 34% similarity to human respectively. Alignment of the investigated human AR mutations to the primary sequence of AR in

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: A234 | Summary: The mutation A234 is located within a highly conserved motif, suggesting a possible role in the mechanics of AR function. Evidence Type: Functional | Mutation: D221 | Summary: The mutation D221 is implicated in prostate cancer (PCa) and is present in at least four species, indicating a potential impact on AR function. Evidence Type: Functional | Mutation: E198 | Summary: The mutation E198 is part of a group of amino acids implicated in PCa and is present in multiple species, suggesting its relevance to AR function. Evidence Type: Functional | Mutation: G142 | Summary: The mutation G142 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: G166 | Summary: The mutation G166 is part of the residues examined for their role in prostate cancer, suggesting its involvement in AR function. Evidence Type: Functional | Mutation: L57 | Summary: The mutation L57 is implicated in prostate cancer and is present in multiple species, indicating its potential role in AR function. Evidence Type: Functional | Mutation: M523 | Summary: The mutation M523 is mentioned as being present in at least four species, suggesting its relevance to the mechanics of AR function. Evidence Type: Functional | Mutation: M537 | Summary: The mutation M537 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: P269 | Summary: The mutation P269 is located within a highly conserved motif associated with prostate cancer, suggesting its relevance to AR function. Evidence Type: Functional | Mutation: P340 | Summary: The mutation P340 is part of the residues implicated in prostate cancer, indicating its potential role in AR function. Evidence Type: Functional | Mutation: P390 | Summary: The mutation P390 is located within a highly conserved motif, suggesting a possible role in the mechanics of AR function. Evidence Type: Functional | Mutation: P514 | Summary: The mutation P514 is mentioned as being present in at least four species, indicating its relevance to the mechanics of AR function. Evidence Type: Functional | Mutation: P515 | Summary: The mutation P515 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: G524 | Summary: The mutation G524 is part of the residues examined for their role in prostate cancer, suggesting its involvement in AR function. Evidence Type: Functional | Mutation: S296 | Summary: The mutation S296 is one of the two mutated residues found only in humans, indicating its potential significance in AR function. Evidence Type: Functional | Mutation: S334 | Summary: The mutation S334 is confined to mammals and is implicated in prostate cancer, suggesting its potential role in AR function. Evidence Type: Functional | Mutation: P533 | Summary: The mutation P533 is one of the two residues confined to mammals, indicating its potential significance in AR function.

      Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

      Genes: 1387 207 367 2232 10514

      Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

    1. To further investigate this we solved the structure of BCL-2 G101V bound to S55746 (Table 1). We obtained diffraction to 2.0 A in a P 21 spacegroup with two molecules in the asymmetric unit. The BCL-2 G101V:S55746 struct

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: E152 | Summary: The E152 residue's rotamer configuration is altered in the BCL-2 G101V:S55746 structure, indicating a change in molecular function related to binding affinity. Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation affects the binding affinity of S55746, demonstrating a change in molecular function due to the variant. Evidence Type: Functional | Mutation: E152A | Summary: The E152A double mutant shows altered binding affinity to S55746, indicating a functional impact on molecular interactions.

      Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

      Genes: 596

      Variants: E152 E152A G101V V101

    2. S55746 is another BCL-2 selective antagonist that has progressed to the clinic. The recently disclosed crystal structure of BCL-2 WT bound to S55746 revealed binding to the P1, P2 and P3 pockets, in contrast to venetocla

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Predictive, Oncogenic

      Summary: Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation alters the binding affinity of the BCL-2 protein to the selective antagonist S55746, indicating a change in molecular function compared to the wild-type. Evidence Type: Predictive | Mutation: G101V | Summary: The G101V mutation is associated with a significantly higher LC50 concentration for the drug S55746, suggesting that it may influence the response to this therapy. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation in BCL-2 is implicated in altering the drug binding characteristics, which may contribute to tumor development or progression.

      Gene→Variant (gene-first): 596:G101V

      Genes: 596

      Variants: G101V

    3. E152 moved into the base of the P2 pocket in the BCL-2 G101V:venetoclax structure (Fig. 2b, c). To test the role of E152 in reducing affinity we generated a BCL-2 G101V/E152A double mutant. Alanine does not have a Cgamma

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: E152 | Summary: The E152 mutation alters the conformation and binding affinity of the BCL-2 protein, impacting its interaction with venetoclax. Evidence Type: Functional | Mutation: E152A | Summary: The E152A mutation maintains comparable binding to wild-type BCL-2 and restores high affinity for venetoclax when combined with G101V. Evidence Type: Functional | Mutation: G101A | Summary: The G101A mutation exhibits a binding affinity to venetoclax that is comparable to wild-type BCL-2, indicating a functional role in drug interaction. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation contributes to altered binding dynamics with venetoclax, suggesting a role in tumor development or progression through its impact on drug affinity.

      Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

      Genes: 596

      Variants: E152 E152A G101A G101V

    4. The role of E152 in venetoclax affinity

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: E152 | Summary: The variant E152 is associated with venetoclax affinity, suggesting it may correlate with response or sensitivity to this specific therapy.

      Gene→Variant (gene-first): 596:E152

      Genes: 596

      Variants: E152

    5. SPR experiments were performed using a BIMBH3 or BAXBH3 immobilised sensor surface with BCL-2 mutants as the analyte and determining venetoclax affinity by competition experiments, (Fig. 3, Table 2 and Supplementary Fig.

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: G101V | Summary: The G101V mutation is associated with reduced affinity for venetoclax, indicating a potential resistance to therapy. Evidence Type: Predictive | Mutation: F104L | Summary: The F104L mutation shows a significant change in venetoclax affinity, suggesting it may contribute to resistance against the drug. Evidence Type: Predictive | Mutation: F104C | Summary: The F104C mutation demonstrates altered venetoclax affinity, which implies a role in resistance to therapy.

      Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

      Genes: 596

      Variants: F104C F104L G101V

    6. The crystals of venetoclax complexed with BCL-2 F104L and BCL-2 WT are isomorphous (Table 1). Well-defined electron density for the drug in the mutant complex structure (Supplementary Fig. 1) suggests two conformations f

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: F104L | Summary: The F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function. Evidence Type: Functional | Mutation: F104 | Summary: The F104 residue plays a role in separating the P2 and P4 pockets of BCL-2, suggesting its importance in molecular function.

      Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

      Genes: 596

      Variants: F104 F104L L104

    7. To understand how these BCL-2 mutations compromise drug binding we solved crystal structures of both complexes (Table 1 and Fig. 2). The G101V mutation resides on the BCL-2 alpha2 helix packing against the alpha5 helix a

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation alters drug binding by changing the interactions within the P2 pocket, affecting the positioning of venetoclax in relation to the BCL-2 structure. Evidence Type: Functional | Mutation: G101A | Summary: The G101A mutation introduces a milder bulk at the G101 position, which affects the interactions with venetoclax but maintains the overall positioning of the drug in the P4 pocket. Evidence Type: Functional | Mutation: E152 | Summary: The E152 mutation exhibits a rotamer change that influences the positioning of venetoclax, indicating an alteration in molecular function related to drug binding.

      Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

      Genes: 596

      Variants: E152 G101 G101A G101V

    8. Crystal structures of BCL-2 with ABT-263 and various analogues of venetoclax have been deposited in the PDB and described in the literature (Fig. 1a, b). One of those analogues is 4-[4-((4'-chloro-3-[2-(dimethylamino)eth

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 596:F104

      Genes: 596

      Variants: F104

    1. Multiple jejunalgastrointestinal stromal tumors (GISTs) were found in a 52-year-old woman with a history of neurofibromatosis type 1. These tumors were composed of interlacing fascicles of uniform spindle cells with eosi

      [Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: Trp557Gly | Summary: The Trp557Gly mutation in KIT is identified as a missense point mutation associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Evidence Type: Functional | Mutation: Trp557Gly | Summary: The Trp557Gly mutation alters the molecular function of the KIT protein, which is implicated in the pathogenesis of the tumors described.

      Gene→Variant (gene-first): 3815:Trp557Gly

      Genes: 3815

      Variants: Trp557Gly

    1. Fusions involving ETV6 in leukemia have long been recognized. Other mutation types, including single nucleotide variations, insertions, deletions, frame-shifts and non-sense alterations are also becoming increasingly evi

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Predisposing

      Summary: Evidence Type: Oncogenic | Mutation: V37M | Summary: The V37M variant was identified in patients with B-ALL, indicating a potential contribution to tumor development in leukemia. Evidence Type: Oncogenic | Mutation: R181H | Summary: The R181H variant was also found in patients with B-ALL, suggesting its involvement in tumor progression. Evidence Type: Predisposing | Mutation: V37M | Summary: The V37M variant is described as a rare germline variant, indicating it may confer inherited risk for leukemia. Evidence Type: Predisposing | Mutation: R181H | Summary: The R181H variant is also classified as a rare germline variant, suggesting a potential inherited risk for leukemia.

      Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

      Genes: 2120

      Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

    2. To examine whether the L349P and N385fs mutations negatively impact translation or alter subcellular localization of the ETV6 protein, we performed cell fractionation assays and western blotting of HeLa cells transiently

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation is evaluated for its impact on translation and subcellular localization of the ETV6 protein, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation is assessed for its effect on translation and subcellular localization of the ETV6 protein, suggesting a change in molecular function. Evidence Type: Functional | Mutation: P214L | Summary: The P214L mutation is described as being detectable in both cytoplasmic and nuclear fractions, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: R369Q | Summary: The R369Q mutation is noted for its presence in both cytoplasmic and nuclear fractions, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: R399C | Summary: The R399C mutation is mentioned as being detectable in both cytoplasmic and nuclear fractions, indicating a potential change in molecular function.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

      Genes: 2120

      Variants: L349P N385fs P214L R369Q R399C

    3. To evaluate the functional consequences of these mutations, we first assessed whether L349P and N385fs might impair transcriptional repression by ETV6. HeLa cells were transiently co-transfected with constructs encoding

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation was assessed for its impact on transcriptional repression by ETV6, showing significantly decreased repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation was evaluated for its ability to impair transcriptional repression by ETV6, exhibiting significantly decreased repression relative to wild-type ETV6. Evidence Type: Functional | Mutation: P214L | Summary: The P214L mutation, a germline variant, was compared to other ETV6 mutations and demonstrated significantly decreased transcriptional repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: R369Q | Summary: The R369Q mutation was analyzed alongside other ETV6 variants and showed significantly reduced transcriptional repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: R399C | Summary: The R399C mutation was included in the analysis of ETV6 variants and exhibited significantly decreased transcriptional repression compared to wild-type ETV6.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

      Genes: 2120

      Variants: L349P N385fs P214L R369Q R399C

    4. Both ETV6 variants were absent in the National Heart Lung Blood Institute (NHLBI) Exome Sequencing Project (ESP) (http://evs.gs.washington.edu/EVS/), Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/),

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation is predicted to cause significant conformational changes in the ETV6 protein, suggesting an alteration in its molecular function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation is predicted to truncate the ETV6 protein at a region involved in DNA interaction, indicating a change in its biochemical function.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs

      Genes: 2120

      Variants: L349P N385fs

    5. Fibroblast and lymphocyte DNA from the proband with ALL and parents in Kindred 2 were analyzed by clinical whole exome sequencing (Ambry Genetics, Aliso Viejo, CA, USA). The proband and his mother harbored a heterozygous

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Predisposing, Oncogenic

      Summary: Evidence Type: Predisposing | Mutation: c.1153-5_1153_1delAACAG | Summary: The heterozygous deletion in ETV6 was identified in the proband and his mother, suggesting an inherited risk for acute lymphoblastic leukemia (ALL). Evidence Type: Oncogenic | Mutation: N385fs | Summary: The frameshift mutation at codon 385 in ETV6 is predicted to contribute to tumor development in the context of acute lymphoblastic leukemia (ALL).

      Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

      Genes: 2120

      Variants: N385fs c.1153-5_1153_1delAACAG

    6. DNA from 16 individuals in Kindred 1 (9 individuals with thrombocytopenia and/or ALL and 7 unaffected individuals) was subjected to Sanger sequencing for all exons of a targeted panel of leukemia-associated genes (Method

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Oncogenic, Functional

      Summary: Evidence Type: Diagnostic | Mutation: 415 T>C | Summary: The variant 415 T>C is associated with the diagnosis of thrombocytopenia and/or ALL, as it co-segregates with affected individuals in the family. Evidence Type: Oncogenic | Mutation: 415 T>C | Summary: The 415 T>C variant is a somatic mutation that contributes to tumor development, as it is present in all affected family members tested. Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation results in a substitution that alters the molecular function of the ETV6 protein, impacting its role in cellular processes.

      Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

      Genes: 10320 2120

      Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

    7. Inherited mutations of transcription factors have recently been associated with susceptibility to acute leukemia. Here we report two unrelated kindreds with inherited mutations in ETV6, the gene encoding the transcriptio

      [Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predisposing, Functional

      Summary: Evidence Type: Predisposing | Mutation: L349P | Summary: The L349P mutation is described as a germline mutation associated with inherited susceptibility to acute leukemia, indicating a predisposing factor for the disease. Evidence Type: Predisposing | Mutation: N385fs | Summary: The N385fs mutation is also identified as a germline mutation linked to inherited risk for acute leukemia, supporting its role as a predisposing factor. Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation alters the localization of the ETV6 protein, preventing it from localizing to the nucleus and affecting its regulatory function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation results in an abnormally truncated ETV6 protein, which shows decreased ability to regulate the expression of genes typically suppressed by ETV6, indicating a functional alteration.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs

      Genes: 2120

      Variants: L349P N385fs

    8. Somatic mutations affecting ETV6 often occur in acute lymphoblastic leukemia (ALL), the most common childhood malignancy. The genetic factors that predispose to ALL remain poorly understood. Here we identify a novel germ

      [Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predisposing, Oncogenic, Functional

      Summary: Evidence Type: Predisposing | Mutation: p. L349P | Summary: The p. L349P mutation is identified as a germline variant in a kindred affected by thrombocytopenia and acute lymphoblastic leukemia (ALL), suggesting it confers inherited risk for the disease. Evidence Type: Oncogenic | Mutation: p. N385fs | Summary: The p. N385fs mutation was found in leukemic cells, contributing to tumor development as it is associated with acute lymphoblastic leukemia (ALL) and secondary myelodysplasia/acute myeloid leukemia. Evidence Type: Functional | Mutation: p. N385fs | Summary: The p. N385fs mutation alters the molecular function of ETV6, as it impairs nuclear localization and reduces the ability to regulate the transcription of ETV6 target genes.

      Gene→Variant (gene-first): 2120:p. L349P 2120:p. N385fs

      Genes: 2120

      Variants: p. L349P p. N385fs

    1. In 2017, the third-generation EGFR inhibitor osimertinib was approved for use in patients who developed the EGFR T790M mutation as a mechanism of resistance. In this year, of the 254 patients who received an EGFR inhibit

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with resistance to EGFR inhibitors, specifically indicating a mechanism of resistance to the third-generation EGFR inhibitor osimertinib. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation contributes to tumor development or progression as it is a mechanism of resistance that arises in patients treated with EGFR inhibitors. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is known to contribute to tumor development or progression in the context of EGFR mutations. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutation is part of a composite mutation that is implicated in tumor development or progression. Evidence Type: Oncogenic | Mutation: L861Q | Summary: The L861Q mutation is part of a composite mutation that is implicated in tumor development or progression.

      Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

      Genes: 1956

      Variants: G719S L858R L861Q T790M

    2. Uni- and multivariable Cox regression analyses were performed to evaluate whether the type of EGFR mutation is associated with OS (Table 3). Because OS for patients with EGFR exon 20 insertions and patients with not acti

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Prognostic, Oncogenic

      Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with overall survival (OS) outcomes, indicating that patients with this mutation have a comparable prognosis to those with uncommon actionable variants when adjusted for age, sex, and year of diagnosis. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is implicated in tumor development and progression, as it is associated with worse outcomes compared to other variants in the context of overall survival analysis.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    3. The proportion of patients receiving first-line targeted therapy was highest for those with an exon 19 deletion (321/390; 82%) or L858R mutation (227/287; 79%), lower for those with uncommon, actionable variants (69/103;

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Prognostic

      Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation correlates with response to first-line targeted therapy, as indicated by the proportion of patients receiving this therapy. Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with median overall survival (OS) outcomes, with a median OS of 18.3 months for patients treated with first-line targeted therapy.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    4. OS in patients with any EGFR mutation was higher for those diagnosed in 2017 (median 18.1 months; 95% CI, 15.7-20.5) compared to 2013 (median 14.3 months; 95% CI, 12.5-16.1; p = 0.035), but similar to 2015 (median 17.6 m

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with a median overall survival (OS) of 16.7 months, indicating its correlation with disease outcome independent of therapy.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. Treatment and survival data were available for 10,237 out of 10,254 patients (99.8%). This included 390 patients with an exon 19 deletion, 287 patients with L858R, 103 patients with an uncommon, actionable variant, 69 pa

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Prognostic, Diagnostic, Oncogenic

      Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with treatment and survival data, indicating a correlation with disease outcome independent of therapy. Evidence Type: Diagnostic | Mutation: L858R | Summary: The L858R mutation is used to classify and confirm the presence of a specific EGFR mutation in patients, aiding in the diagnosis of the disease. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is a somatic variant that contributes to tumor development and progression in patients with EGFR mutations.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    6. Of the 7908 patients tested for EGFR mutations at initial diagnosis, one or more mutations were reported in 11.7% of all cases (95% CI, 11.0-12.4%; n = 925) (Table 2). Female patients were more likely to harbor EGFR muta

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is identified as a classical, actionable EGFR mutation that contributes to tumor development or progression in a significant proportion of patients. Evidence Type: Oncogenic | Mutation: L861X | Summary: The L861X mutation is noted as an uncommon but actionable EGFR mutation that may also contribute to tumor development or progression, particularly in patients tested with multi-gene assays.

      Gene→Variant (gene-first): 1956:L858R 1956:L861X

      Genes: 1956

      Variants: L858R L861X

    1. An in-house database search for insertions comparable to the VMOS RAS variants revealed one in-frame insertion in KRAS in a case suspected for Noonan syndrome (Fig. 7A). Furthermore, a screen of the current literature an

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: Gln61 | Summary: The passage discusses the impact of insertions on the catalytic Gln61, indicating that these variants alter molecular function related to GTP hydrolysis. Evidence Type: Oncogenic | Mutation: Gln61 | Summary: The mention of insertions in tumor samples suggests that these variants contribute to tumor development or progression, classifying them as oncogenic.

      Gene→Variant (gene-first): 5921:Gln61

      Genes: 5921

      Variants: Gln61

    2. The biophysical characterisation of the VMOS RAS variants showed two opposing effects. VMOS RAS variants appeared insensitive to the action of GEFs with a consequently decrease of signalling capability. On the other hand

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The HRAS p.G12V variant alters molecular function by inducing phosphorylation of ERK and AKT, indicating its role in RAS signaling pathways. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The HRAS p.G12V variant contributes to tumor development by enhancing signaling capabilities, as evidenced by increased levels of phosphorylated ERK and AKT in transfected cells.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    3. To analyse the effect of the VMOS RAS variants on GAP catalysed GTP hydrolysis, G-proteins were incubated in the presence of various concentration of RAS-GAP. GTP and GDP content was analysed after termination of the rea

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The variant KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    4. GTP hydrolysis was followed over time by terminating the reactions at different points in time, and GDP and GTP contents analysis by HPLC. The intrinsic GTP hydrolysis rates of VMOS RAS variants were reduced by a factor

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The p.G12V variant of KRAS shows reduced intrinsic GTP hydrolysis rates compared to wild type, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The p.G12V variant is classified as a classical oncogenic variant, contributing to tumor development and progression.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    5. The interaction of G-protein and the nucleotide is stabilised in the ternary complex with the effector and in consequence the rate of nucleotide dissociation is reduced. This effect was used to analyse the interaction of

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: KRAS p.G12V is described as a classical oncogenic variant, indicating its role in tumor development or progression. The variant's interaction with Raf-RBD and its altered dissociation rate further support its oncogenic properties. Evidence Type: Functional | Mutation: p.G12V | Summary: The variant KRAS p.G12V alters the intrinsic dissociation rate of the nucleotide, demonstrating a change in molecular function compared to wild type KRAS.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    6. The clinical context indicated that VMOS RAS variants cause enhanced RAS signalling, but the outcome of the in silico analysis is not unambiguously supporting this expectation. In fact, it strongly suggested deficiencies

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.Q61L | Summary: The passage discusses the functional consequences of the p.Q61L mutation in relation to RAS signaling, indicating that it is a classic pathogenic missense mutation that may alter molecular function. Evidence Type: Oncogenic | Mutation: p.Q61L | Summary: The p.Q61L mutation is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

      Gene→Variant (gene-first): 4893:p.Q61L

      Genes: 4893

      Variants: p.Q61L

    7. On amino acid level the DNA duplications and insertions found in the VMOS RAS variants resulted in an insertion of mainly duplicated sequence around position 65 (Fig. 2A). It is difficult to predict to what extent the in

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: Gln61 | Summary: The residue Gln61 is involved in GTP hydrolysis and is likely affected by insertions that alter molecular interactions, impacting the protein's biochemical function.

      Gene→Variant (gene-first): 5921:Gln61

      Genes: 5921

      Variants: Gln61

    8. Sensitive NGS based screening of frequently mutated positions in a panel of multiple genes were applied in 299 cases. In 108 cases, putative causative variants were identified, of which in 15 cases RAS genes were affecte

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: p.G12A | Summary: The p.G12A mutation is described as affecting a classical position in the P-loop of KRAS, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: p.G13H | Summary: The p.G13H mutation is also noted to affect a classical position in the P-loop of KRAS, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: p.Q22K | Summary: The p.Q22K mutation is associated with increased GTP loading, indicating an alteration in molecular or biochemical function.

      Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

      Genes: 3845

      Variants: p.G12A p.G13H p.Q22K

    1. Oncogenic mutations in the serine/threonine kinase B-RAF are found in 50-70% of malignant melanomas. Pre-clinical studies have demonstrated that the B-RAFV600E mutation predicts a dependency on the mitogen activated prot

      [Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive

      Summary: Evidence Type: Oncogenic | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation is associated with tumor development and progression in malignant melanomas, as it is found in 50-70% of these cases. Evidence Type: Predictive | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, which has been validated by the success of RAF and MEK inhibitors in clinical trials.

      Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

      Genes: 673

      Variants: B-RAFV600E serine/threonine

    1. Structural details can provide mechanistic insight into variant effects on protein function. However, the structure of the RAD51C protein had not been experimentally determined at the time of this study. Initially, a hom

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: K131 | Summary: The K131 variant removes a positively charged residue that directly interacts with the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: R168 | Summary: The R168 variant removes a positively charged residue that directly interacts with the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: Q133E | Summary: The Q133E variant introduces a negatively charged group that destabilizes the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: T132I | Summary: The T132I variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: V140E | Summary: The V140E variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: R312W | Summary: The R312W variant removes a positively charged residue that may weaken the interaction with the negatively charged gamma phosphate group of ATP, influencing RAD51C activity. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant disrupts a hydrophobic core and may interfere with RAD51C protomer formation, influencing RAD51C function.

      Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu

      Genes: 5889 5892

      Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu

    2. RAD51C forms the BCDX2 and CX3 complexes that are involved in RAD51 recruitment to sites of DNA damage. To evaluate the influence of RAD51C variants on the integrity of these intrinsic complexes, coimmunoprecipitation of

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: A126T | Summary: The A126T variant is described as a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, indicating it does not alter the molecular function of the RAD51C complexes. Evidence Type: Functional | Mutation: D109Y | Summary: The D109Y variant is also a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, suggesting it does not affect the molecular function of the RAD51C complexes. Evidence Type: Oncogenic | Mutation: L138F | Summary: The L138F variant is identified as a deleterious variant that fails to coimmunoprecipitate with RAD51D and XRCC2, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: L27P | Summary: The L27P variant is classified as a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: T336P | Summary: The T336P variant is a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: T86I | Summary: The T86I variant is described as an intermediate variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: D159N | Summary: The D159N variant is classified as an intermediate variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: G162E | Summary: The G162E variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: S163R | Summary: The S163R variant is classified as a deleterious variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, suggesting a change in molecular function. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: R258H | Summary: The R258H variant, observed as a homozygous variant in a FANCO patient, displays reduced binding for all complex members, indicating a change in molecular function.

      Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

      Genes: 5889 5892

      Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

    3. Because RAD51C participates in DNA damage signaling by regulating cell cycle progression, colony formation assays were performed to evaluate the influence of RAD51C variants on cell proliferation. U2OS RAD51C-/- landing

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant alters molecular function by causing a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: K131I | Summary: The K131I variant alters molecular function, leading to a significant decrease in RAD51 foci, which suggests a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant affects molecular function, resulting in a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant alters molecular function, as evidenced by a decrease in RAD51 foci, suggesting a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: R168G | Summary: The R168G variant impacts molecular function, leading to a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair.

      Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

      Genes: 5889

      Variants: G130R G302V K131I L138F Q133E R168G T132R

    4. In parallel, a recent study evaluated the influence of 36 RAD51C missense variants on HR activity of U2OS and 21 on HR activity of MCF10A cells. Importantly, 18 of 36 evaluated in U2OS and 13 of 21 evaluated in MCF10A ce

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Predictive

      Summary: Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant is characterized as deleterious and shows reduced HDR activity in U2OS cells, indicating that it alters molecular function related to homologous recombination. Evidence Type: Predictive | Mutation: L138F | Summary: The L138F variant is associated with sensitivity to cisplatin and olaparib in CL-V4B cells, suggesting it may correlate with response to specific therapies.

      Gene→Variant (gene-first): 5889:L138F

      Genes: 5889

      Variants: L138F

    5. To confirm the functional effects of RAD51C variants in a human cell line, RAD51C WT and 7 deleterious or intermediate missense variants in the HDR assay (G130R, K131I, T132R, Q133E, L138F, R168G and G302V) were introduc

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional, Predictive

      Summary: Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: K131I | Summary: The K131I variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: Q133E | Summary: The Q133E variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: R168G | Summary: The R168G variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Predictive | Mutation: G130R | Summary: The G130R variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: K131I | Summary: The K131I variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: T132R | Summary: The T132R variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: Q133E | Summary: The Q133E variant had intermediate effects on sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: G302V | Summary: The G302V variant had intermediate effects on sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy.

      Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

      Genes: 5889

      Variants: G130R G302V K131I L138F Q133E R168G T132R

    6. An inability to form RAD51 foci at the sites of DNA DSBs is a key component of an HR deficient phenotype. Because disruption of RAD51C substantially decreases RAD51 foci formation the influence of RAD51C missense variant

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: P21S | Summary: The P21S variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D109Y | Summary: The D109Y variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: C147Y | Summary: The C147Y variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D108G | Summary: The D108G variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: V140E | Summary: The V140E variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: A155E | Summary: The A155E variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D159Y | Summary: The D159Y variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: G306R | Summary: The G306R variant exhibits partially reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response.

      Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu

      Genes: 5889 5888

      Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu

    7. RAD51C loss promotes HR deficiency and sensitizes cells to cisplatin and olaparib PARP inhibitor. Thus, the influence of 60 RAD51C missense variants from the HDR assay (30 deleterious, 23 neutral, and 7 intermediate) on

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Functional

      Summary: Evidence Type: Predictive | Mutation: E94K | Summary: The variant p.Glu94Lys (E94K) shows a significant reduction in sensitivity to cisplatin and a notable decrease in sensitivity to olaparib, indicating its potential role in predicting treatment response. Evidence Type: Predictive | Mutation: G306R | Summary: The variant p.Gly306Arg (G306R) demonstrates a marked reduction in sensitivity to both cisplatin and olaparib, suggesting its predictive value for treatment response. Evidence Type: Functional | Mutation: E94K | Summary: The variant p.Glu94Lys (E94K) is associated with altered IC50 values for cisplatin and olaparib, indicating a change in molecular function. Evidence Type: Functional | Mutation: G306R | Summary: The variant p.Gly306Arg (G306R) exhibits altered IC50 values for cisplatin and olaparib, suggesting a functional impact on drug response.

      Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg

      Genes: 5889

      Variants: E94K G306R p.Glu94Lys p.Gly306Arg

    8. A cell-based DR-GFP HDR colorimetric reporter assay was used to assess the influence of 173 missense mutations on RAD51C HR DNA repair activity (Supplementary Table S1). RAD51C deficient CL-V4B cells were reconstituted w

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: A126T | Summary: The A126T mutation was assessed in a cell-based HDR assay, indicating its influence on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y mutation was categorized as deleterious in the HDR assay, demonstrating its impact on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: D159N | Summary: The D159N mutation was classified as intermediate in the HDR assay, suggesting it alters RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G125V | Summary: The G125V mutation was identified as deleterious in the HDR assay, indicating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G153D | Summary: The G153D mutation was categorized as deleterious in the HDR assay, reflecting its influence on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G264S | Summary: The G264S mutation was classified as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G264V | Summary: The G264V mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G3R | Summary: The G3R mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: L138F | Summary: The L138F mutation was identified as deleterious in the HDR assay, demonstrating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: L219S | Summary: The L219S mutation was classified as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: Q143R | Summary: The Q143R mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R214C | Summary: The R214C mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R258H | Summary: The R258H mutation was classified as intermediate in the HDR assay, suggesting it alters RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R312W | Summary: The R312W mutation was identified as deleterious in the HDR assay, demonstrating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R366Q | Summary: The R366Q mutation was reported as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: T287A | Summary: The T287A mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: V169A | Summary: The V169A mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity.

      Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala

      Genes: 5889

      Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala

    1. Firstly, the level of total STAT3 in two HCC patient samples appeared to be higher than that in corresponding adjacent normal tissues. Interestingly, treatment of ruxolitinib led to a significant reduction (50%) of the p

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with a response to ruxolitinib treatment, indicating its potential predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: S703I | Summary: The presence of the S703I mutation in JAK1 suggests its contribution to tumor development or progression, highlighting its oncogenic potential.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    2. In vivo efficacy studies of JAK1/2 inhibitor, ruxolitinib, were conducted in these four JAK1-mutant models and a JAK1-WT PDX model as a control (Figure 3A). The results showed that, only in LI-03-0191 model bearing JAK1S

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The JAK1S703I mutation correlates with sensitivity to the JAK1/2 inhibitor ruxolitinib, indicating its potential role in predicting treatment response. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is suggested to play a critical role in tumorigenesis in the LI-03-0191 PDX model, indicating its contribution to tumor development.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    3. Anti-tumor activity of ruxolitinib in JAK1S703I-mutant PDX model

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic, Predictive

      Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with tumor development or progression, as indicated by its presence in a patient-derived xenograft (PDX) model. Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation correlates with the response to the therapy ruxolitinib, suggesting its predictive value in treatment outcomes.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    4. To further evaluate the transformation ability of these JAK1 mutations, Ba/F3 cells were stably infected with lentivirus expressing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703I, JAK1A1086S, and JAK1S729C, respec

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study evaluating the transformation ability of JAK1 mutations, indicating a potential alteration in molecular function. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is capable of continual proliferation in the absence of IL-3, suggesting it contributes to tumor development or progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation serves as a positive control in the study, indicating its role in enabling continual proliferation and suggesting it contributes to tumor development or progression.

      Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

      Genes: 3716

      Variants: E483D S703I S729C

    5. To explore the biological functions of JAK1 mutations in JAK-STAT signaling pathway, we introduced these mutations into pLVX-IRES-Neo-JAK1 plasmid. Plasmids containing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study exploring biological functions in the JAK-STAT signaling pathway, indicating its potential role in tumor development. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is associated with elevated expression levels of phosphorylated JAK1 and STAT proteins, suggesting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation is described as a known and recurrent activating mutation, indicating its role in tumor development.

      Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

      Genes: 3716

      Variants: E483D S703I S729C

    6. Specifically, S703I mutation was found in the pseudo-kinase domain of JAK1 protein, and could potentially cause the disruption of auto-inhibition of JAK1 kinase. Notably, S703I was previously identified in tumors of two

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation is identified as an activating mutation of the JAK1 gene, contributing to tumor development in HCC patients. Evidence Type: Oncogenic | Mutation: A1086S | Summary: The A1086S mutation is located in the catalytic kinase domain of JAK1, suggesting its role in tumor development. Evidence Type: Oncogenic | Mutation: N451S | Summary: The N451S mutation is found in the SH2 domain of JAK1, indicating its potential contribution to tumor progression. Evidence Type: Oncogenic | Mutation: E483D | Summary: The E483D mutation, located in the SH2 domain of JAK1, may also play a role in tumor development.

      Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

      Genes: 3716 728378

      Variants: A1086S E483D N451S S703I

    7. More than 160 HCC PDX models were established at WuXi AppTec in the past three years, of which over 60 models were characterized by WES. Among them, four models (LI-03-0012, LI-03-0155, LI-03-0191, and LI-03-0257) were i

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

      Genes: 3716 728378

      Variants: A1086S E483D N451S S703I

    1. To examine if upregulation of NRG1 is induced by hormone therapy, we treated freshly isolated primary CAFs from CWR22Pc tumors or pCAFs with CSS or Enz. CSS and Enz both induced NRG1 mRNA and protein expression after 7 d

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 8850:S7C

      Genes: 8850

      Variants: S7C

    2. To gain insight into the potential clinical relevance of these findings, we examined NRG1 expression in a cohort of 43 patients with localized prostate cancer who underwent radical prostatectomy surgery, 23 of whom recei

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 3084:S6 8850:S7

      Genes: 3084 8850

      Variants: S6 S7

    3. Our earlier analysis of five canonical AR target genes suggested that NRG1 preserves tumor cell viability without restoring AR target gene expression (Figures 2G and 2H). To address this question more comprehensively, we

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 1956:S2 3084:S6C

      Genes: 1956 3084

      Variants: S2 S6C

    4. To carry out the purification, serum-free 22Pc-CAFCM was collected, concentrated, and applied to a Q-Superose anion exchange column, from which we eluted two protein peaks by using 30% and 100% high-salt buffer B (termed

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 5979:Q8

      Genes: 5979

      Variants: Q8

    1. B-cell lymphoma and melanoma harbor recurrent mutations in the gene encoding the EZH2 histone methyltransferase, but the carcinogenic role of these mutations is unclear. Here we describe a mouse model in which the most c

      [Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: Y641F | Summary: The Y641F mutation in EZH2 contributes to tumor development in mouse B-cells, leading to high-penetrance lymphoma. Evidence Type: Oncogenic | Mutation: Y646F | Summary: The Y646F mutation in EZH2 is associated with tumor progression in melanoma, as demonstrated in a mouse model.

      Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

      Genes: 2146

      Variants: Y641F Y646F

    1. Frequent genetic alterations discovered in FGFRs and evidence implicating some as drivers in diverse tumors has been accompanied by rapid progress in targeting FGFRs for anticancer treatments. Wider assessment of the imp

      [Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: N540K | Summary: The N540K mutation is reinforced as an important alteration that contributes to tumor development and progression, as it is associated with activating mutations in FGFR3. Evidence Type: Oncogenic | Mutation: K650E | Summary: The K650E mutation is established as a significant alteration that contributes to tumor development and progression, being linked to the activation of FGFR3. Evidence Type: Functional | Mutation: R669G | Summary: The R669G mutation is noted for its role in altering the activation state of FGFR3, although it does not occur at high frequency and may not be linked to activation.

      Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G

      Genes: 2261

      Variants: K650E N540K R669G

    1. Results: Among a total of 148 patients, 48 (32%) had mutated KRAS, 77% at codon 12 and 23% at codon 13. The PFS was significantly worse in the mutant KRAS patients in comparison to wild type KRAS patients (p < 0.05). The

      [Paragraph-level] PMCID: PMC4378307 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Prognostic

      Summary: Evidence Type: Prognostic | Mutation: G12D | Summary: The G12D mutation in KRAS is associated with a poor prognosis in progression-free survival (PFS), indicating it serves as an independent negative prognostic factor.

      Gene→Variant (gene-first): 3845:G12D

      Genes: 3845

      Variants: G12D

    1. In the cBioPortal database, variants of the MAP2K1 gene are reported at frequencies of 1.7% in CRC patients (Table 1) and correlated with worse disease/progression-free survival (Logrank Test P-Value: 1.815e-3), but not

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Prognostic, Oncogenic

      Summary: Evidence Type: Prognostic | Mutation: c.199G>A | Summary: The c.199G>A variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Prognostic | Mutation: c.169A>G | Summary: The c.169A>G variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Oncogenic | Mutation: c.199G>A | Summary: The c.199G>A variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs. Evidence Type: Oncogenic | Mutation: c.169A>G | Summary: The c.169A>G variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs.

      Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu

      Genes: 5604

      Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu

    2. The CNVs were much more frequent among patients with longer PFS. Within this cohort, patient P16 had a significant copy number gain of ERBB2 (78.99) that was confirmed by FISH analysis (data not shown). Patient P16 had a

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: c.1268G>T; p.Gly423Val | Summary: The variant c.1268G>T; p.Gly423Val is associated with a complete response to first-line therapy, indicating its potential predictive value for treatment response. Evidence Type: Oncogenic | Mutation: c.1268G>T; p.Gly423Val | Summary: The presence of the FBXW7 variant c.1268G>T; p.Gly423Val suggests a role in tumor development or progression, supporting its classification as oncogenic.

      Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val

      Genes: 55294

      Variants: c.1268G>T p.Gly423Val

    3. Of the three missense mutations detected in FBXW7, two were found in patients with a PFS shorter than median PFS. Patient P14 (PFS 8.07 months) carried the c.1798G>A variant (p.Asp600Asn) and patient P18 (PFS 1.73 months

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Prognostic, Oncogenic

      Summary: Evidence Type: Prognostic | Mutation: c.1798G>A (p.Asp600Asn) | Summary: The c.1798G>A variant is associated with a shorter progression-free survival (PFS) in patients, indicating a potential prognostic role. Evidence Type: Oncogenic | Mutation: c.1513C>T (p.Arg505Cys) | Summary: The c.1513C>T variant has been reported in several cancer types and is associated with loss of function of the protein, suggesting both oncogenic potential and functional impact.

      Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn

      Genes: 55294 1956 673

      Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn

    4. Two patients (P20 and P21) had variants in NF1, a negative regulator of RAS, inactivated by mutation in various cancers. Specifically, we found an insertion (c.638_639insA; p.Asn214Lys fs*2) in the tumor from patient P20

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: c.638_639insA | Summary: The insertion mutation in NF1 leads to a premature stop codon, contributing to tumor development through loss of function and increased activation of the RAS signaling pathway. Evidence Type: Oncogenic | Mutation: c.5101A>T | Summary: The SNV in NF1 results in a premature stop codon, which is associated with tumor progression due to loss of function and enhanced RAS signaling. Evidence Type: Functional | Mutation: c.638_639insA | Summary: This insertion mutation alters the molecular function of NF1 by creating a premature stop codon, leading to loss of function. Evidence Type: Functional | Mutation: c.5101A>T | Summary: The SNV creates a premature stop codon in NF1, affecting its molecular function and resulting in loss of regulatory control over the RAS pathway.

      Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter

      Genes: 4763

      Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter

    5. Patient P3 (PFS 6.63 months) carried the variant c.169A>G in the MAP2K1 gene coding for the MEK1 protein. This variant has been already reported in the cBioPortal database. It results in the substitution of an amino acid

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G in the MAP2K1 gene results in a substitution that alters the molecular function of the MEK1 protein, leading to a gain of function. Evidence Type: Oncogenic | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G is associated with a gain of function in the MEK1 protein, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu

      Genes: 5604

      Variants: c.169A>G p.Lys57Glu

    6. All variants were at an allelic frequency >5% with the exception of a KRAS variant (c.183A>T; p.Gln61His) that was identified in the tumor tissue from patient P7 (PFS 3.93 months) at an allelic frequency of 0.4%. This va

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: c.183A>T; p.Gln61His | Summary: The KRAS variant (c.183A>T; p.Gln61His) was identified in tumor tissue, indicating its potential role in tumor development or progression. Evidence Type: Functional | Mutation: c.183A>T; p.Gln61His | Summary: The variant is associated with molecular alterations, as it was confirmed through ddPCR analysis, suggesting it affects the biochemical function of the KRAS gene.

      Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His

      Genes: 3845

      Variants: c.183A>T p.Gln61His

    7. Of the 54 SNVs and insertions/deletions (Indels) identified, 35% and 41% were APC and TP53 variants, respectively (Figure 1). Nineteen patients (90.47%) had at least one TP53 SNV or Indel, whereas 15/21 (71.43%) patients

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: c.275_276insGGCC | Summary: The variant c.275_276insGGCC in TP53 is associated with tumor development or progression, contributing to oncogenic behavior. Evidence Type: Oncogenic | Mutation: c.837_838InsG | Summary: The variant c.837_838InsG in TP53 is implicated in tumor development or progression, indicating its oncogenic potential. Evidence Type: Oncogenic | Mutation: c.4467_4468insCATTTTG | Summary: The variant c.4467_4468insCATTTTG in APC is associated with tumor development or progression, suggesting it has oncogenic properties. Evidence Type: Oncogenic | Mutation: c.4098_4099delTCinsAT | Summary: The variant c.4098_4099delTCinsAT in APC contributes to tumor development or progression, indicating its role as an oncogenic variant. Evidence Type: Oncogenic | Mutation: c.589_590insGAGTT | Summary: The variant c.589_590insGAGTT in APC is linked to tumor development or progression, supporting its classification as an oncogenic variant.

      Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG

      Genes: 7157 324

      Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG

    1. Finally, we investigated genetic mutation status in biopsies of two patients who progressed on repotrectinib in clinical trial using targeted sequencing. Patient A, a 46-year-old male with a 20 pack-year smoking history,

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: 196_197insHP | Summary: The mutation in CEBPA (196_197insHP) was identified in a post-repotrectinib tumor biopsy, suggesting its potential role in tumor development or progression. Evidence Type: Oncogenic | Mutation: E171G | Summary: The TP53 mutation (E171G) was detected in the post-repotrectinib tumor biopsy, indicating its possible contribution to tumor progression. Evidence Type: Oncogenic | Mutation: H178Q | Summary: The TP53 mutation (H178Q) found in the post-repotrectinib tumor biopsy may play a role in tumor development or progression. Evidence Type: Oncogenic | Mutation: H179Y | Summary: The TP53 mutation (H179Y) identified in the post-repotrectinib tumor biopsy suggests its involvement in tumor progression. Evidence Type: Oncogenic | Mutation: H555R | Summary: The RB1 mutation (H555R) detected in the post-repotrectinib tumor biopsy indicates its potential role in tumor development. Evidence Type: Oncogenic | Mutation: R143Q | Summary: The ERBB2 mutation (R143Q) found in the post-repotrectinib tumor biopsy suggests its contribution to tumor progression.

      Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q

      Genes: 1050 7157 896 2064 5925

      Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q

    2. The clinical activity of repotrectinib against ROS1 SFM was seen in a 49-year-old female ROS1-rearranged patient who progressed after 44 months of crizotinib treatment with an identified CD74-ROS1 G2032R mutation. The pa

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with a positive response to repotrectinib treatment in a patient with ROS1-rearranged NSCLC, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation is part of the CD74-ROS1 rearrangement, which contributes to tumor development in the context of ROS1-rearranged non-small cell lung cancer (NSCLC).

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    3. We identified the ROS1-G2032R mutation in YU1079, which was serially established in the same patient as YU1078 but after progressing on crizotinib treatment. Based on recent studies examining lorlatinib and cabozantinib

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The ROS1-G2032R mutation is associated with varying responses to different tyrosine kinase inhibitors (TKIs), indicating its predictive value for treatment outcomes with cabozantinib and lorlatinib. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The ROS1-G2032R mutation contributes to tumor growth in the YU1079 model, demonstrating its role in oncogenic processes.

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    4. Repotrectinib overcomes crizotinib-resistant ROS1 G2032R

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with resistance to crizotinib, and the passage indicates that repotrectinib can overcome this resistance, suggesting a predictive relationship with therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation in ROS1 is implicated in crizotinib resistance, indicating its role in tumor development or progression, thus supporting its classification as oncogenic.

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    1. DNMT3A exon 23 screening was performed on available samples coming from 288 AML patients aged from 18 to 65-year old and treated in Toulouse between 2000 and 2009. DNMT3A exon 23 mutations were detected in 39 patients (1

      [Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: R882H | Summary: The R882H mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882C | Summary: The R882C mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882P | Summary: The R882P mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: W893S | Summary: The W893S mutation in DNMT3A is associated with tumor development or progression in AML patients.

      Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S

      Genes: 1788

      Variants: R882 R882C R882H R882P W893 W893S

    1. A total of 3 out of 42 GC patients were METex14del positive (Table 3). All GC cases were MET IHC 3+ and the only case in the series with MET amplification. For example, one case was a 27-year old male patient who present

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is associated with tumor development in the context of non-small cell lung cancer (NSCLC) patients, indicating its role as a somatic variant contributing to cancer progression. Evidence Type: Oncogenic | Mutation: V600E | Summary: The V600E mutation in BRAF is implicated in tumor development, as it was detected in colon cancer cases, suggesting its role as a somatic variant contributing to cancer progression.

      Gene→Variant (gene-first): 1956:T790M 673:V600E

      Genes: 1956 673

      Variants: T790M V600E

    2. All 13 METex14del cases were further confirmed by qualitative RT-PCR using probes overlapping an exon 13-15 junction, a fusion transcript caused by exon 14 skipping. In all cases, although the absolute Ct (cycles to thre

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 4

      Evidence Type(s): None

      Summary: Not enough information in this passage.

      Gene→Variant (gene-first): 7157:c.3082+811A TTTTAACA > GGTTTGAT

      Genes: 7157

      Variants: c.3082+811A TTTTAACA > GGTTTGAT

    3. The patient cohort from the NEXT-1 trial (NCT02141152), which is an actively enrolling clinical trial for genomic profiling in cancer patients, was used (Figure 1). Of 428 patients enrolled and screened, sufficient RNAs

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.982_1028del47 | Summary: The mutation p.982_1028del47 is associated with the detection of a METex14del transcript, indicating a potential alteration in molecular function related to the MET gene. Evidence Type: Oncogenic | Mutation: p.982_1028del47 | Summary: The presence of the METex14del mutation (p.982_1028del47) suggests a contribution to tumor development or progression, as it is being screened in a cohort of cancer patients.

      Gene→Variant (gene-first): 4916:p.982_1028del47

      Genes: 4916

      Variants: p.982_1028del47

    1. Based on our search criteria, a total of 41 studies, which enrolled 13,103 KRAS assessable patients with 18 percent (2,374) KRAS mutant positive cases, were eligible for inclusion in the present analyses. The process of

      [Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: G12C | Summary: The G12C mutation in KRAS is identified as a common mutation occurring in codon 12, which contributes to tumor development or progression in lung cancer.

      Gene→Variant (gene-first): 3845:G12C

      Genes: 3845

      Variants: G12C

    1. We report two inflammatory myofibroblastic tumor (IMT) patients with ALK fusions (RRBP-ALK and TNS1-ALK, respectively). They both received tumor resection surgery and treatment with ALK inhibitors crizotinib followed by

      [Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: L1196Q | Summary: The L1196Q mutation in ALK was identified after alectinib resistance developed, leading to the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Evidence Type: Oncogenic | Mutation: L1196Q | Summary: The L1196Q mutation is associated with the development of resistance to ALK inhibitors, indicating its role in tumor progression in the context of inflammatory myofibroblastic tumors.

      Gene→Variant (gene-first): 238:L1196Q

      Genes: 238

      Variants: L1196Q

    1. Pediatric glioblastomas (GBM) including diffuse intrinsic pontine gliomas (DIPG) are devastating brain tumors with no effective therapy. Here, we investigated clinical and biological impacts of histone H3.3 mutations. Fo

      [Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Prognostic, Diagnostic

      Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M-H3.3 mutation is prevalent in pediatric glioblastomas and contributes to tumor development, defining clinically and biologically distinct subgroups. Evidence Type: Prognostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is universally associated with short survival in DIPG, indicating its prognostic significance in disease outcome. Evidence Type: Diagnostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is used to define clinically and biologically distinct subgroups in pediatric glioblastomas, supporting its role in diagnostic testing.

      Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M

      Genes: 3021

      Variants: G34V G34V/R K27M

    1. Isocitrate dehydrogenases (IDHs) catalyse oxidative decarboxylation of isocitrate to alpha-ketoglutarate (alpha-KG). IDH1 functions in the cytosol and peroxisomes, whereas IDH2 and IDH3 are both localized in the mitochon

      [Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1 R132H mutation is identified as a somatic mutation that occurs frequently in gliomas and is implicated in tumorigenesis through its effects on enzyme function and the accumulation of D-2-hydroxyglutarate. Evidence Type: Functional | Mutation: R132H | Summary: The R132H mutation in IDH1 causes a loss of normal enzyme function and a gain-of-function, leading to the reduction of alpha-ketoglutarate to D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    2. We studied 47 glioblastomas (WHO grade IV). Heterozygous mutations of IDH1 were found in 6/47 tumours (12%). All 6 mutations were single base substitutions c.395G>A occurring at residue R132, resulting in an arginine to

      [Paragraph-level] PMCID: PMC3100313 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The heterozygous mutation p.R132H in IDH1 is associated with glioblastoma, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: p.R132H | Summary: The mutation p.R132H alters the molecular function of the IDH1 enzyme, which is relevant in the context of glioblastoma.

      Gene→Variant (gene-first): 728294:R132 79944:arginine to histidine 728294:c.395G>A 3417:p.R132H

      Genes: 728294 79944 3417

      Variants: R132 arginine to histidine c.395G>A p.R132H

    1. Recently, a rare activating mutation of AKT1 (E17K) has been reported in breast, ovarian, and colorectal cancers. However, analogous activating mutations in AKT2 or AKT3 have not been identified in any cancer lineage. To

      [Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: AKT1 (E17K) | Summary: The AKT1 E17K mutation is reported as an activating mutation contributing to tumor development in breast, ovarian, and colorectal cancers, as well as melanoma. Evidence Type: Functional | Mutation: AKT3 (E17K) | Summary: The AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, indicating a change in molecular function.

      Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K

      Genes: 207

      Variants: AKT1 (E17K E17K

    1. Diffuse midline gliomas (DMGs) including diffuse intrinsic pontine gliomas (DIPGs) bearing lysine-to-methionine mutations in histone H3 at lysine 27 (H3K27M) are lethal childhood brain cancers. These tumors harbor a glob

      [Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: lysine-to-methionine | Summary: The lysine-to-methionine mutation at histone H3 lysine 27 (H3K27M) is associated with the development and progression of diffuse midline gliomas, contributing to the tumor's lethal characteristics. Evidence Type: Functional | Mutation: lysine-to-methionine | Summary: The H3K27M mutation alters histone modifications, impacting the function of the SWI/SNF complex and leading to changes in chromatin accessibility and gene expression.

      Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine

      Genes: 3021 55193

      Variants: lysine 27 lysine-to-methionine

    1. P05 was a female patient with EGFR exon 19 deletion-mutant stage IV LUAD with bone metastasis, and ERBB2DeltaEx16 was identified from her plasma sample after progression on osimertinib plus crizotinib ( Table 2 ; Figure

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: D1288N | Summary: The D1288N mutation is associated with MET TKI resistance, indicating its role in tumor development or progression. Evidence Type: Oncogenic | Mutation: L1195I | Summary: The L1195I mutation is known as a secondary mutation associated with MET TKI resistance, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: L1195V | Summary: The L1195V mutation is recognized as a secondary mutation linked to MET TKI resistance, playing a role in tumor development. Evidence Type: Oncogenic | Mutation: Y1230H | Summary: The Y1230H mutation is identified as a secondary mutation associated with MET TKI resistance, indicating its contribution to tumor progression.

      Gene→Variant (gene-first): 79811:D1288N L1195I 79811:L1195V 79811:Y1230H 2064:c.1899-936_1946+520del

      Genes: 79811 2064

      Variants: D1288N L1195I L1195V Y1230H c.1899-936_1946+520del

    2. P03 was a female patient with EGFR L858R-mutant advanced LUAD with bone metastasis. ERBB2DeltaEx16 was detected after disease progression with osimertinib using her plasma samples but not in the paired tissue rebiopsy (

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with advanced LUAD and is relevant for predicting response to osimertinib therapy. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation contributes to tumor development in advanced LUAD. Evidence Type: Oncogenic | Mutation: L755S | Summary: The L755S mutation is suggested as a potential resistance mechanism in the context of osimertinib treatment. Evidence Type: Oncogenic | Mutation: D769Y | Summary: The D769Y mutation is indicated as a possible resistance mechanism following treatment with osimertinib. Evidence Type: Oncogenic | Mutation: c.1899-32_1909del | Summary: The c.1899-32_1909del alteration is detected as a concurrent alteration in the context of resistance mechanisms after osimertinib progression.

      Gene→Variant (gene-first): 2064:D769Y 2064:L755S 1956:L858R 2064:c.1899-32_1909del

      Genes: 2064 1956

      Variants: D769Y L755S L858R c.1899-32_1909del

    3. Of the 21 unique ERBB2DeltaEx16 variants detected from Chinese patients, 9 involved complete deletion of exon 16, 3 were deletions or point mutations involving splice donors, and 9 deletions or point mutations affecting

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Predictive

      Summary: Evidence Type: Oncogenic | Mutation: c.1899-880_1946+761del | Summary: The variant c.1899-880_1946+761del was detected in two patients, indicating its potential role in tumor development or progression. Evidence Type: Predictive | Mutation: c.1899-2A>G | Summary: The variant c.1899-2A>G was identified in a patient after treatment, suggesting a correlation with treatment response or resistance.

      Gene→Variant (gene-first): 2064:c.1899-2A>G 2064:c.1899-880_1946+761del

      Genes: 2064

      Variants: c.1899-2A>G c.1899-880_1946+761del

    1. In clinical practice, there are a number of cancer patients with clear family histories, but the patients lack mutations in known familial cancer syndrome genes. Recent advances in genomic technologies have enhanced the

      [Paragraph-level] PMCID: PMC5111006 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The CHEK2 mutation p.R474C alters the tertiary structure of CHK2 by disrupting the salt bridge between p.R474 and p.E394, indicating its functional importance. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The homozygous CHEK2 variant p.R474C is suggested to be contributory to familial cancer, as inactivation of CHEK2 in mice led to cancers in multiple organs.

      Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

      Genes: 11200

      Variants: p.R474 p.R474C

    2. Among the variants detected in the runs of homozygosity common to both siblings, five were recorded as disease-associated variants in the HGMD public entries. However, they are related to diabetes or insulin secretion (r

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Diagnostic

      Summary: Evidence Type: Diagnostic | Mutation: rs757110 | Summary: The variant rs757110 in ABCC8 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs5215 | Summary: The variant rs5215 in KCNJ11 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs5219 | Summary: The variant rs5219 in KCNJ11 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs2468844 | Summary: The variant rs2468844 in SAA2 is associated with carotid intima media thickness, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs11703684 | Summary: The variant rs11703684 in PIWIL3 is associated with oligospermia, indicating its role in defining or classifying a disease.

      Gene→Variant (gene-first): 440822:rs11703684 6289:rs2468844 3767:rs5215 3767:rs5219 6833:rs757110

      Genes: 440822 6289 3767 6833

      Variants: rs11703684 rs2468844 rs5215 rs5219 rs757110

    3. We surveyed variants in potential hereditary loci including those in TP53 (causative gene for Li-Fraumeni syndrome), BRCA2 (causative gene for hereditary breast/ovarian cancer), and mismatch repair genes (MSH2, MSH6, PMS

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predisposing

      Summary: Evidence Type: Predisposing | Mutation: rs1042522 | Summary: The variant rs1042522 (TP53, p.P72R) is associated with Li-Fraumeni syndrome, indicating a potential inherited risk for disease. Evidence Type: Predisposing | Mutation: rs169547 | Summary: The variant rs169547 (BRCA2, p.V2466A) is linked to hereditary breast/ovarian cancer, suggesting it may confer inherited risk for disease.

      Gene→Variant (gene-first): 7157:p.P72R 675:p.V2466A 7157:rs1042522 2956:rs1042821 4072:rs1126497 675:rs169547 5395:rs1805323 5395:rs2228006 4436:rs2303424

      Genes: 7157 675 2956 4072 5395 4436

      Variants: p.P72R p.V2466A rs1042522 rs1042821 rs1126497 rs169547 rs1805323 rs2228006 rs2303424

    4. CHK2 is a cell cycle checkpoint regulator activated by DNA damage. The above analysis and the function of CHK2 suggest that CHEK2 is a contributory gene for this familial case. We therefore examined the function of CHK2

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The variant p.R474C alters the molecular function of CHK2, resulting in instability and poor activation by DNA damage compared to wild-type CHK2. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The variant p.R474C contributes to tumor development or progression by affecting the function of CHK2, a gene implicated in cell cycle regulation and DNA damage response.

      Gene→Variant (gene-first): 11200:p.R474C

      Genes: 11200

      Variants: p.R474C

    5. CHK2 p.R474C Protein Is Poorly Activated in the Cell upon DNA Damage

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The mutation p.R474C in CHK2 is associated with altered molecular function, specifically indicating that the protein is poorly activated in response to DNA damage.

      Gene→Variant (gene-first): 11200:p.R474C

      Genes: 11200

      Variants: p.R474C

    6. The tertiary structure of FCGRT-immunoglobulin Fc fragment complex was determined. p.R210 contacts the carboxyl terminus of the immunoglobulin Fc fragment. Although there is a salt bridge between p.R210 and the Fc fragme

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: p.R210 | Summary: The mutation p.R210 is described in the context of its interaction with the immunoglobulin Fc fragment, but it is noted that it is not well conserved and does not significantly affect the function or structure of the protein. Evidence Type: Functional | Mutation: p.R210Q | Summary: The mutation p.R210Q is mentioned as not likely to affect the function and structure of the protein, indicating a focus on its molecular function.

      Gene→Variant (gene-first): 2217:p.R210 2217:p.R210Q

      Genes: 2217

      Variants: p.R210 p.R210Q

    7. Second, we examined how the amino acid substitutions affect the tertiary structure of the proteins. The tertiary structure of the inactive CHK2 homodimer (PDB code: 3i6w) is shown in Figure 4B. p.R474 is located away fro

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: p.R474 | Summary: The mutation p.R474 is involved in forming a salt bridge that is crucial for protein stability, indicating its role in altering molecular function. Evidence Type: Functional | Mutation: p.R474C | Summary: The mutation p.R474C disrupts the salt bridge with p.E394, likely leading to protein instability and altering its molecular function.

      Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

      Genes: 11200

      Variants: p.R474 p.R474C

    8. First, the effects of these missense variants were predicted using the Variant Effect Predictor at Ensembl, for which SIFT (Sorting Intolerant from Tolerant) and PolyPhen (Polymorphism Phenotyping) are used. Three varian

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: p.R474 | Summary: The variant p.R474 of CHEK2 was analyzed for its impact on protein function, showing high conservation in homologs, which suggests a potential functional significance. Evidence Type: Functional | Mutation: p.R218 | Summary: The variant p.R218 of FCGRT was assessed for its effect on protein function, with lower conservation in homologs indicating a possible alteration in molecular function.

      Gene→Variant (gene-first): 11200:p.R474

      Genes: 11200

      Variants: p.R474

    9. The female patient, FL2, was 6 years older than the male patient. At the age of 38, she was diagnosed with uterine myoma and developed multiple primary lung cancer at the age of 60 with no history of smoking. Three prima

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation in the EGFR gene is associated with tumor development in lung cancer, indicating its role as a somatic variant contributing to oncogenesis.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    1. Ninety-two of the 93 tumors were amenable to data analysis. TP53 was the most common mutation, occurring in 47 (51%) patients, followed by CDKN2A (n=23, 25%), CCND1 (n=22, 24%), and PIK3CA (n=19, 21%). The total mutation

      [Paragraph-level] PMCID: PMC6333965 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: E545K | Summary: The PIK3CA E545K mutation is noted as a potentially targetable alteration, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: R58X | Summary: The CDKN2A R58X mutation is also mentioned as a potentially targetable alteration, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 5290:E545K 1029:R58X

      Genes: 5290 1029

      Variants: E545K R58X

    1. Single nucleotide variants (SNVs) and insertions and deletions (InDels) were identified in mouse ccRCCs versus matched liver. The most frequent SNVs were C>A/G>T transversions, C>T/G>A transitions and A>G/T>C transitions

      [Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: A>G | Summary: The A>G mutation is associated with the development of ccRCC precursor lesions in mice, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: C>A | Summary: The C>A mutation is part of the frequent SNVs observed in human ccRCC, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: C>T | Summary: The C>T mutation is one of the most frequently occurring mutations in human ccRCC, indicating its potential role in oncogenesis. Evidence Type: Oncogenic | Mutation: G>A | Summary: The G>A mutation is included in the common classes of mutations found in human ccRCC, supporting its involvement in tumorigenesis. Evidence Type: Oncogenic | Mutation: G>T | Summary: The G>T mutation is part of the frequent SNVs in human ccRCC, suggesting its contribution to cancer development. Evidence Type: Oncogenic | Mutation: T>C | Summary: The T>C mutation is among the most frequently occurring mutations in human ccRCC, indicating its potential role in tumor progression.

      Gene→Variant (gene-first): 7428:A>G 7428:C>A 7428:C>T 7428:G>A 7428:G>T 7428:T>C

      Genes: 7428

      Variants: A>G C>A C>T G>A G>T T>C

    2. To functionally test this idea in mice, we genetically deleted Vhl together with two tumour suppressor genes that encode proteins that function as the key controllers of cell cycle entry in the p53/G1-S network, namely T

      [Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: Trp53 deletion | Summary: The deletion of Trp53 in mice contributes to tumor development, as evidenced by the increased incidence and earlier onset of tumors in VhlDelta/DeltaTrp53Delta/DeltaRb1Delta/Delta mice compared to other genotypes. Evidence Type: Functional | Mutation: Trp53 deletion | Summary: The functional deletion of Trp53 alters the molecular behavior of renal epithelial cells, leading to the development of cysts and dysplasia, indicating a change in cellular function associated with tumorigenesis.

      Gene→Variant (gene-first): 7428:Trp53 deletion

      Genes: 7428

      Variants: Trp53 deletion

    1. The observation that K-RasG12D and switch 2 insertion mutant proteins are defective for PI3K binding and Akt activation suggested that this might alter effector pathway dependencies. To address this question, we exposed

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional, Predictive, Oncogenic

      Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with defective PI3K binding and Akt activation, indicating an alteration in molecular function related to signaling pathways. Evidence Type: Predictive | Mutation: K-RasG12D | Summary: The sensitivity of Ba/F3 cells expressing K-RasG12D to MEK inhibition suggests that this mutation correlates with response to specific therapies, indicating predictive value. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to the transformed, cytokine-independent growth of Ba/F3 cells, indicating its role in tumor development.

      Gene→Variant (gene-first): 3845:K-RasG12D

      Genes: 3845

      Variants: K-RasG12D

    2. Together with prior structural modelling predictions, these biochemical data prompted us to directly assess the ability of WT and mutant K-Ras proteins to bind to effectors in vitro. As expected, His-K-Ras WT bound GST-R

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras shows a markedly reduced interaction with FLAG-p110alpha, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with a profound reduction in binding to FLAG-p110alpha, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: Y64G | Summary: The Y64G mutation in K-Ras, when combined with K-RasG12D, results in a significantly reduced binding to FLAG-p110alpha, indicating an alteration in molecular function.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D 5290:Y64G

      Genes: 5295 3845 5290

      Variants: A66dup K-RasG12D Y64G

    3. To assess how acute activation of K-Ras duplication mutants modulates effector pathway activation, we engineered tetracycline inducible GFP-K-Ras constructs and introduced them into Ba/F3 cells (Supplementary Fig. 4). In

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters molecular function, as indicated by the increased levels of pERK and pAkt in response to its expression in Ba/F3 cells. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to tumor development or progression, as it is associated with elevated signaling pathways indicative of oncogenic activity.

      Gene→Variant (gene-first): 3845:K-RasG12D

      Genes: 3845

      Variants: K-RasG12D

    4. Expression of K-RasG12D and each tandem duplication mutant, but not WT K-Ras, transformed interleukin 3 (IL-3)-dependent Ba/F3 cells to cytokine-independent growth (Supplementary Fig. 3a). Ba/F3 cells expressing K-RasG12

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation. Evidence Type: Oncogenic | Mutation: A66dup | Summary: The A66dup variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    5. To directly test these predictions, we produced N-terminal histidine fusions encoding amino acids 1-166 of K-RasG60_A66dup or K-RasE62_A66dup, and compared their biochemical properties with WT K-Ras and K-RasG12D (Supple

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation alters the biochemical properties of K-Ras, leading to impaired intrinsic GTPase activity and increased accumulation in the active GTP conformation. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation exhibits resistance to GAP stimulation and altered GTPase activity, indicating a change in molecular function.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    6. We next examined published crystal structures to model potential effects of switch 2 insertions on the following: (1) the positions of critical residues involved in intrinsic catalysis such as Glutamine 61 (Q61); (2) the

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: Glutamine 61; Q61 | Summary: The passage discusses potential effects on the molecular function of Glutamine 61 (Q61) due to structural changes from switch 2 insertions, indicating alterations in protein-protein interactions and the GTP conformation of Ras. Evidence Type: Oncogenic | Mutation: Glutamine 61; Q61 | Summary: The analysis suggests that alterations involving Q61 may contribute to tumor development or progression by favoring the GTP conformation of Ras, which is associated with oncogenic activity.

      Gene→Variant (gene-first): 3845:Glutamine 61 3845:Q61

      Genes: 3845

      Variants: Glutamine 61 Q61

    7. A hypersensitive pattern of colony-forming unit granulocyte macrophage (CFU-GM) progenitor formation in response to colony-stimulating factor (GM-CSF) is a cellular hallmark of JMML. To ask whether K-Ras insertion mutant

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation induces cytokine-independent colony formation and contributes to tumor development by promoting hypersensitive growth patterns in hematopoietic progenitor cells. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters the growth response of myeloid progenitors to GM-CSF, indicating a change in molecular function related to colony formation. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras insertion variants sensitizes myeloid progenitors to GM-CSF, suggesting an alteration in biochemical function related to growth response.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    8. Juvenile myelomonocytic leukaemia (JMML) is an aggressive myeloproliferative neoplasm (MPN) characterized by driver Ras pathway mutations in 85% of cases, including known oncogenic KRAS and NRAS substitutions. We discove

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: c.178_198dup | Summary: The c.178_198dup variant is a partial duplication of the switch 2 domain of K-Ras, which is associated with juvenile myelomonocytic leukaemia (JMML) and contributes to tumor development. Evidence Type: Oncogenic | Mutation: c.184_198dup | Summary: The c.184_198dup variant is a tandem duplication found in lung adenocarcinomas and colorectal cancer, indicating its role in tumor progression.

      Gene→Variant (gene-first): 3845:c.178_198dup 3845:c.184_198dup

      Genes: 3845

      Variants: c.178_198dup c.184_198dup

    1. Finally, we tested the effects of the combination therapies on cell proliferation in osimertinib-resistant cell lines. Similar to RPC-9/NaqR cells, the osimertinib-resistant cell lines were derived from RPC-9 cells, desi

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The EGFR T790M mutation is maintained in osimertinib-resistant RPC-9/OsiR cells, indicating its role in tumor development or progression.

      Gene→Variant (gene-first): 1956:C797S 1956:T790M

      Genes: 1956

      Variants: C797S T790M

    2. Next we investigated RPC-9/NaqR cells, which were derived from gefitinib-resistant lung adenocarcinoma cell lines (RPC-9 cells harboring the EGFR exon 19del and T790M mutations). Exposure to naquotinib inhibited the phos

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with gefitinib resistance in lung adenocarcinoma, indicating its role in tumor development and progression. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation in EGFR is implicated in gefitinib resistance in lung adenocarcinoma, contributing to tumor development and progression.

      Gene→Variant (gene-first): 1956:19del 1956:T790M

      Genes: 1956

      Variants: 19del T790M

    3. To further examine the role of MET in EGFR-TKI-naive cancer cells, we developed another resistant cell line from EGFR-TKI-naive lung cancer cells, HCC827, which harbor the EGFR exon 19del. The resistant cell line, design

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19del mutation is associated with the development of resistance in lung cancer cells, indicating its role in tumor progression.

      Gene→Variant (gene-first): 1956:19del

      Genes: 1956

      Variants: 19del

    4. Next, we assessed the effects of several generations of EGFR-TKIs in these naquotinib-resistant cell lines. The resistant cell lines exhibited 52- to 157-fold resistance to naquotinib compared with each parental cell lin

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: C797S | Summary: The C797S mutation is associated with resistance to osimertinib, indicating its role in therapy response. Evidence Type: Oncogenic | Mutation: C797S | Summary: The C797S mutation contributes to tumor progression by conferring resistance to EGFR-TKIs, which is a characteristic of oncogenic behavior.

      Gene→Variant (gene-first): 1956:C797S

      Genes: 1956

      Variants: C797S

    5. First, to explore the mechanism of resistance to naquotinib, we established naquotinib-resistant lung cancer cells using a cell line-based model. The following cell lines were examined: 1. EGFR-TKI-naive PC-9 cells harbo

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with tumor development and progression in lung cancer, as indicated by its presence in both naive and acquired gefitinib-resistant cell lines. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is implicated in tumor development and progression, as it is found in acquired gefitinib-resistant lung cancer cells, indicating its role in resistance mechanisms.

      Gene→Variant (gene-first): 1956:19del 1956:T790M

      Genes: 1956

      Variants: 19del T790M

    1. We also investigated whether drug efficacy is dependent on the FGFR variants in patients. For this purpose, we retrospectively collected variant information and drug efficacy data related to FGFR inhibitors in 399 cases

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with a partial or complete response to treatment with FGFR TKIs, indicating its correlation with drug efficacy. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation is identified as the most frequent mutation of FGFR3, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 2261:S249C

      Genes: 2261

      Variants: S249C

    2. Furthermore, the existence of concurrent mutations between FGFRs and the genes involved in different pathways, such as PIK3CA, PTEN, AKT1/2/3, and MAP2K1 was investigated. Indeed, concurrent mutations with PIK3CA were fr

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: E542K | Summary: The mutation E542K is described as an oncogenic mutation that contributes to tumor development or progression when co-mutated with PIK3CA. Evidence Type: Oncogenic | Mutation: E545K | Summary: The mutation E545K is identified as an oncogenic mutation that plays a role in tumor development or progression in conjunction with PIK3CA. Evidence Type: Oncogenic | Mutation: H1047R | Summary: The mutation H1047R is classified as an oncogenic mutation, indicating its contribution to tumor development or progression when occurring alongside PIK3CA.

      Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

      Genes: 5290

      Variants: E542K E545K H1047R

    3. More than 400 types of FGFR compound mutations were observed in the COSMIC database, and 34 types of those were reported in more than two samples (Fig. 7a). The most frequent compound mutation is the combination of S249C

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Oncogenic, Predictive

      Summary: Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with transforming activities in cancer cells, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: K650E | Summary: The K650E mutation, when combined with S249C, shows stronger transforming activities than each single mutation, suggesting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: K650M | Summary: The K650M mutation, in combination with S249C, exhibits enhanced transforming activities, supporting its role in oncogenesis. Evidence Type: Predictive | Mutation: Y373C | Summary: The Y373C mutation, when combined with S249C, does not significantly affect sensitivity to E7090 and erdafitinib, indicating its potential role in treatment response dynamics.

      Gene→Variant (gene-first): 2261:K650E 2261:K650M 2261:S249C 2261:Y373C

      Genes: 2261

      Variants: K650E K650M S249C Y373C

    4. Next, we measured the effectiveness of E7090 and erdafitinib in vivo. Mouse 3T3 fibroblasts expressing FGFR1 N546K, FGFR2 N549K, FGFR3 R248C, FGFR3 K650M, or FGFR3 K650N were injected into nude mice that were subsequentl

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: N546K | Summary: The variant FGFR1 N546K was associated with a lack of effectiveness of E7090 and erdafitinib in suppressing tumor growth, indicating a potential resistance to these therapies. Evidence Type: Predictive | Mutation: N549K | Summary: Tumors with the FGFR2 N549K variant exhibited a better response to treatment with E7090 compared to erdafitinib, suggesting a correlation with therapy effectiveness. Evidence Type: Predictive | Mutation: R248C | Summary: The FGFR3 R248C variant showed significant antitumor activity against tumors treated with E7090, indicating a potential sensitivity to this therapy. Evidence Type: Predictive | Mutation: K650N | Summary: The FGFR3 K650N variant was associated with significantly decreased tumor volumes in response to both E7090 and erdafitinib, indicating a favorable response to these therapies. Evidence Type: Predictive | Mutation: K650M | Summary: The drug responses of tumors with the FGFR3 K650M variant were similar to those recorded in vitro, suggesting a correlation with therapy effectiveness.

      Gene→Variant (gene-first): 2261:K650M 2261:K650N 2260:N546K 2263:N549K 2261:R248C

      Genes: 2261 2260 2263

      Variants: K650M K650N N546K N549K R248C

    5. Inhibition of FGFRs and downstream signaling pathways by FGFR TKIs was evaluated through immunoblot analyses (Fig. 3c). While phosphorylation of FGFR3 K650M was suppressed by E7090 at 100 nM, that of FGFR3 K650N was decr

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: K650M | Summary: The K650M mutation in FGFR3 shows a correlation with response to the FGFR TKI E7090, indicating its predictive value for therapy response. Evidence Type: Predictive | Mutation: K650N | Summary: The K650N mutation in FGFR3 demonstrates decreased phosphorylation at lower concentrations of the FGFR TKI E7090, suggesting its predictive relevance for therapy response.

      Gene→Variant (gene-first): 2261:K650M 2261:K650N

      Genes: 2261

      Variants: K650M K650N

    6. Hierarchical clustering analysis was conducted to evaluate the similarity of FGFR inhibitors and FGFR variants using drug sensitivity data of Fig. 4 (Supplementary Fig. 11). FGFR variants were classified into four cluste

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: G12V | Summary: The KRAS G12V variant is associated with resistance to all FGFR inhibitors, indicating its predictive role in therapy response. Evidence Type: Predictive | Mutation: N546K | Summary: The FGFR1 N546K variant is included in a cluster that is relatively resistant to all FGFR inhibitors, suggesting its predictive significance in treatment response. Evidence Type: Predictive | Mutation: N549D/K | Summary: The FGFR N549D/K variants are part of a cluster that shows resistance to all FGFR inhibitors, highlighting their predictive value in therapy response.

      Gene→Variant (gene-first): 3845:G12V 2260:N546K 2263:N549D/K

      Genes: 3845 2260 2263

      Variants: G12V N546K N549D/K

    7. To validate the results of the pooled assay, the respective variants to which drug sensitivity was different among TKIs were further analyzed. Interestingly, in the evaluation with the MANO method, different missense var

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: N549D | Summary: The N549D variant in FGFR2 is associated with different drug sensitivities to FGFR inhibitors, indicating a correlation with treatment response. Evidence Type: Predictive | Mutation: N549H | Summary: The N549H variant in FGFR2 shows varying drug sensitivities to FGFR inhibitors, suggesting its role in influencing treatment response. Evidence Type: Predictive | Mutation: K656E | Summary: The K656E variant in FGFR3 is linked to different sensitivities to FGFR inhibitors, indicating its potential impact on treatment response. Evidence Type: Predictive | Mutation: K656M | Summary: The K656M variant in FGFR3 demonstrates varying drug sensitivities to FGFR inhibitors, suggesting its relevance in treatment response. Evidence Type: Predictive | Mutation: K656N | Summary: The K656N variant in FGFR3 is associated with different drug sensitivities to FGFR inhibitors, indicating its role in influencing treatment response.

      Gene→Variant (gene-first): 2263:K656 2263:K656E/M 2263:N549 2263:N549D/H

      Genes: 2263

      Variants: K656 K656E/M N549 N549D/H

    8. The drug sensitivity of transformed FGFR variants was also assessed through the MANO method. The mixture of 3T3 cells expressing different types of FGFR variants were treated with eight different targeted drugs, and drug

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive

      Summary: Evidence Type: Predictive | Mutation: N546K | Summary: The N546K variant is associated with resistance to FGFR TKIs, indicating its role in predicting drug sensitivity. Evidence Type: Predictive | Mutation: N549D/K | Summary: The N549D/K variant shows relative resistance to FGFR TKIs, suggesting its predictive value for treatment response. Evidence Type: Predictive | Mutation: N535K | Summary: The N535K variant is sensitive to the FGFR4 inhibitor H3B-6527, indicating its predictive role in therapy response.

      Gene→Variant (gene-first): 2264:N535K 2260:N546K 2263:N549D/K 2263:V550L

      Genes: 2264 2260 2263

      Variants: N535K N546K N549D/K V550L

    9. The mRNA expression levels were similar among variants in previous studies using the MANO method. We evaluated the mRNA and protein expression of several FGFR3 variants using real-time PCR and western blotting. While a s

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: R248H | Summary: The R248H variant is described as a non-oncogenic variant, indicating that it does not contribute to tumor development or progression compared to oncogenic variants.

      Gene→Variant (gene-first): 1956:R248H

      Genes: 1956

      Variants: R248H

    10. Thus, we utilized the MANO method to compare the number of 3T3 cells expressing each FGFR variant between Day 3 and Day 18 in the assessment of the transforming potential (Fig. 2 and Supplementary Fig. 3). In parallel wi

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: N549H | Summary: The N549H variant in FGFR2 exhibits significant transforming activity, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: K659E | Summary: The K659E variant in FGFR2 shows significant transforming activity, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: W290C | Summary: The W290C variant in FGFR2 demonstrates significant oncogenic potential compared to wild-type FGFR2. Evidence Type: Oncogenic | Mutation: S342F | Summary: The S342F variant in FGFR4 exhibits significant oncogenicity, indicating its contribution to tumor development. Evidence Type: Oncogenic | Mutation: R248C | Summary: The R248C variant in FGFR3 is located in the ligand binding site and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C variant in FGFR3 is located in the ligand binding site and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: G370C | Summary: The G370C variant in FGFR3 is located in the transmembrane domain and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: S371C | Summary: The S371C variant in FGFR3 is located in the transmembrane domain and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: Y373C | Summary: The Y373C variant in FGFR3 is located in the transmembrane domain and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: G380E/R | Summary: The G380E/R variant in FGFR3 is located in the transmembrane domain and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: K650E/M | Summary: The K650E/M variant in FGFR3 is located in the kinase domain and is associated with oncogenic mutations.

      Gene→Variant (gene-first): 2261:G370C 2261:G380E/R 2261:K650E/M 2263:K659E 2263:N549H 2261:R248C 2261:S249C 6867:S342F 2261:S371C 2263:W290C 2261:Y373C

      Genes: 2261 2263 6867

      Variants: G370C G380E/R K650E/M K659E N549H R248C S249C S342F S371C W290C Y373C

    11. FGFRs are highly conserved transmembrane receptor tyrosine kinases, comprised of an extracellular domain with three Ig-like domains, followed by a transmembrane domain and a tyrosine kinase domain (Fig. 1a). Firstly, the

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: K656E | Summary: The K656E mutation in the FGFR1 tyrosine kinase domain is reported as an oncogenic mutation frequently discovered in glioma. Evidence Type: Oncogenic | Mutation: N546K | Summary: The N546K mutation in the FGFR1 tyrosine kinase domain is identified as an oncogenic mutation commonly found in glioma. Evidence Type: Oncogenic | Mutation: S252W | Summary: The S252W mutation in FGFR2, located in the ligand-binding region, is recognized as an oncogenic hotspot mutation in endometrial cancers. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is noted as an oncogenic hotspot mutation in bladder cancer. Evidence Type: Oncogenic | Mutation: V550L | Summary: The V550L mutation in FGFR4, located in the tyrosine kinase domain, is reported as an oncogenic mutation in rhabdomyosarcoma.

      Gene→Variant (gene-first): 2260:K656E 2260:N546K 2261:S249C 2263:S252W 2263:V550L

      Genes: 2260 2261 2263

      Variants: K656E N546K S249C S252W V550L

    1. IDH1 R132H and ATRX KO have similar levels of PARP inhibitor sensitivity.

      [Paragraph-level] PMCID: PMC8203843 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: R132H | Summary: The R132H variant is associated with sensitivity to PARP inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: R132H | Summary: The R132H variant contributes to tumor development or progression, as it is implicated in cancer-related pathways.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    1. FLT3 mutations are the most frequently identified genetic alterations in acute myeloid leukemia (AML) and are associated with poor prognosis. Multiple FLT3 inhibitors are in various stages of clinical evaluation. However

      [Paragraph-level] PMCID: PMC8255005 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Prognostic, Predictive, Oncogenic

      Summary: Evidence Type: Prognostic | Mutation: D835 | Summary: The D835 mutation is associated with poor prognosis in acute myeloid leukemia (AML). Evidence Type: Predictive | Mutation: F691L | Summary: The F691L mutation is described as a "gatekeeper" mutation that is resistant to most available FLT3 inhibitors, indicating its role in treatment resistance. Evidence Type: Oncogenic | Mutation: D835Y | Summary: The D835Y mutation is part of the FLT3-TKD mutations that contribute to tumor development and progression in AML. Evidence Type: Oncogenic | Mutation: F691 | Summary: The F691 mutation is implicated in the resistance to FLT3 inhibitors and contributes to tumor progression in AML.

      Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691 2322:F691L

      Genes: 2322

      Variants: D835 D835Y F691 F691L

    1. To get a deeper insight into the molecular characteristics of this group, we analyzed next-generation sequencing results from 17 cases. Seven cases were analyzed using the Heidelberg 130 gene panel, six cases were sequen

      [Paragraph-level] PMCID: PMC7785563 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Predisposing, Functional

      Summary: Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1-R132H mutation is associated with conventional supratentorial IDH-mutant astrocytomas, indicating its role in tumor development or progression. Evidence Type: Predisposing | Mutation: MSH2 (germline) | Summary: The presence of a known deleterious germline MSH2 mutation in cases diagnosed with Lynch syndrome suggests an inherited risk for colorectal cancer. Evidence Type: Predisposing | Mutation: MSH6 (germline) | Summary: The identification of germline mutations in MSH6 in several tumors indicates a hereditary predisposition to MMR-deficiency syndromes, including Lynch syndrome. Evidence Type: Functional | Mutation: MSH6 | Summary: The tumor cell-specific loss of MSH6 expression in one case suggests that the mutation alters the molecular function of the MMR pathway, contributing to tumorigenesis.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    1. In metastatic breast cancer, HER2 activating mutations frequently co-occur with mutations in the PIK3CA, TP53, or E-cadherin genes. Of these co-occurring mutations, HER2 and PIK3CA mutations are the most prevalent gene p

      [Paragraph-level] PMCID: PMC10527017 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive, Functional

      Summary: Evidence Type: Oncogenic | Mutation: V777L | Summary: The HER2V777L mutation contributes to tumor development and progression in breast cancer, as evidenced by accelerated tumor formation and increased invasion in genetically engineered mice. Evidence Type: Predictive | Mutation: V777L | Summary: The HER2V777L mutation is associated with resistance to the pan-HER tyrosine kinase inhibitor neratinib, indicating its predictive value for therapy response. Evidence Type: Functional | Mutation: V777L | Summary: The HER2V777L mutation alters molecular function, as indicated by changes in gene expression and cell cycle markers in breast cancer organoids.

      Gene→Variant (gene-first): 2064:V777L

      Genes: 2064

      Variants: V777L

    1. ALK-break positive non-small cell lung cancer (NSCLC) patients initially respond to crizotinib, but resistance occurs inevitably. In this study we aimed to identify fusion genes in crizotinib resistant tumor samples. Re-

      [Paragraph-level] PMCID: PMC4821611 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic

      Summary: Evidence Type: Oncogenic | Mutation: p.C1156Y | Summary: The ALK mutation p.C1156Y was detected in post-treatment tumor samples, indicating its contribution to tumor development or progression, particularly in the context of crizotinib resistance. Evidence Type: Oncogenic | Mutation: p.G1269A | Summary: The ALK mutation p.G1269A was also found in post-treatment tumor samples, suggesting its role in tumor development or progression related to crizotinib resistance.

      Gene→Variant (gene-first): 238:p.C1156Y 238:p.G1269A

      Genes: 238

      Variants: p.C1156Y p.G1269A

    2. Mutations in ALK, EGFR and KRAS have been reported to confer resistance against crizotinib. To determine presence of mutations in these genes in the three post-treatment samples, we inspected the RNA-seq bam files in IGV

      [Paragraph-level] PMCID: PMC4821611 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Summary: Evidence Type: Predictive | Mutation: p.C1156Y | Summary: The mutation p.C1156Y in the ALK gene has been reported to confer resistance against crizotinib, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: p.C1156Y | Summary: The mutation p.C1156Y contributes to tumor development or progression as it is found in a significant percentage of RNA-seq reads in patient #1. Evidence Type: Oncogenic | Mutation: p.G1269A | Summary: The mutation p.G1269A is present in 100% of the RNA-seq reads in patient #3, indicating its role in tumor development or progression.

      Gene→Variant (gene-first): 238:c.3467G>A 238:c.3806G>C 238:p.C1156Y 238:p.G1269A

      Genes: 238

      Variants: c.3467G>A c.3806G>C p.C1156Y p.G1269A

    1. In TERT-NHUC, abolishing PLCgamma1 phosphorylation significantly reduced the increase in saturation density associated with S249C FGFR3 (13% vs. 24%, p=0.05) (Figure 6a), suggesting that PLCgamma1 signaling contributes t

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with altered cell cycle distribution and viability, indicating a change in molecular function related to PLCgamma1 signaling. Evidence Type: Functional | Mutation: Y762F | Summary: The Y762F mutation, when combined with S249C, shows an increase in cell numbers at confluence, suggesting it also alters molecular function in the context of FGFR3 signaling. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation is linked to reduced viability and saturation density in TERT-NHUC cells, indicating a functional impact on cell behavior.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

      Genes: 2261

      Variants: K652E S249C Y762F

    2. To clarify whether the lack of constitutive PLCgamma1 phosphorylation may explain the different phenotypic behavior associated with the K652E mutation, we used a construct encoding a S249C FGFR3 protein with a mutated PL

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Functional, Oncogenic

      Summary: Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation is associated with a lack of constitutive PLCgamma1 phosphorylation, suggesting it alters molecular function related to PLCgamma1 signaling. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is linked to morphological transformation, increased proliferation, and colony formation in soft agar, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: Y762F | Summary: The Y762F mutation, when combined with S249C, contributes to morphological transformation and increased proliferation in NIH-3T3 cells, supporting its oncogenic potential.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

      Genes: 2261

      Variants: K652E S249C Y762F

    3. As expected, FGF1 induced phosphorylation of FRS2alpha, ERK1/2 and PLCgamma1 in normal urothelial cells over-expressing wildtype FGFR3 (Figure 4b). Consistent with their complete ligand-independence, FGF1 treatment faile

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation exhibits complete ligand-independence, failing to stimulate signaling in response to FGF1 treatment. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation shows a small increase in ERK1/2 activation in response to FGF1 treatment, indicating altered molecular function. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation displays increased phosphorylation of PLCgamma1, ERK1/2, and FRS2alpha in response to FGF1 treatment, suggesting a significant alteration in molecular function.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C

    4. We next examined whether cells expressing wildtype and mutant FGFR3 were responsive to FGF1 stimulation in terms of receptor activation (Figure 4a, Supplementary Figure 5) and signaling (Figure 4b, Supplementary Figure 5

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 exhibits strong constitutive phosphorylation, indicating a change in molecular function that leads to ligand-independence. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 shows increased levels of phosphorylation in response to ligand stimulation, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 also demonstrates increased phosphorylation levels in response to ligand stimulation, indicating a change in molecular function.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C

    5. Signaling was examined in cells at various degrees of confluence, in full and depleted medium (Figure 3c, Supplementary Figure 4b). In all conditions tested, no differences were observed between mutant and control cells

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 was associated with increased phosphorylation of PLCgamma1, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 was linked to increased phosphorylation of PLCgamma1, suggesting a change in biochemical function.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C

    6. To investigate the reason for the differential behavior of cells expressing K652E FGFR3, we assessed the phosphorylation levels of FGFR3 mutant proteins and downstream effectors in urothelial cells. All mutant forms of F

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional

      Summary: Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 alters the phosphorylation levels and activation state of the receptor, indicating a change in molecular function. Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 leads to ligand-independent dimerization, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 also results in ligand-independent dimerization, indicating a change in molecular function.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C