The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
333 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
Cloning in VRl 020 mammalian expression vector
-
Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE
-
Large scale plasmid DNA isolation
-
collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.
-
Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was
-
Small scale plasmid DNA isolation and restriction
-
separately on LB plates containing 100 j...tg/ml ampicillin, 80 j...tg/ml of X-gal and 20 mM of IPTG. The plates were incubated at 37°C for 12 h.
-
The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated
-
Preparation of competent cells and transformation
-
The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).
-
Media composition and bacterial culture
-
The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.
-
Agarose gel electrophoresis and ligation of PCR amplified fragments in pPCR-Script Amp SK (+)cloning vector
-
mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
-
The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
-
Assembly of eDNA encoding dZP3-rG fusion protein by PCR
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
PCR amplification of rG cDNAs
-
GAAGATCTCAGACCATCTGGCCAACT-3' as the forward pnmer, and 5'-GAAGATCTT-TAAGTGTGGGAAACAGACTT-3' as the reverse primer as described for bmZPl except that primer annealing was performed at 53°C for 1 min.
-
The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-
-
PCR amplification of dZP3 eDNA
-
Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.
-
PCR amplification of bmZPl eDNA
-
CLONING OF eDNA ENCODING bmZPl, dZP3, rG AND dZP3-rG GLYCOPROTEINS IN MAMMALIAN EXPRESSION VECTOR VR1020
Tags
- Method-1-Method-5
- Method-1-Method-10
- Method-1-Method-7-detail
- Method-1-Method-4-detail
- Method-1-Method-2-detail
- Method-1-Method-10-detail
- Method-1
- Method-1-Method-6
- Method-1-Method-5-detail
- Method-1-Method-3
- Method-1-Method-2
- Method-1-Method-4
- method-1-method-9
- method-1-method-1
- Method-1-Method-1-detail
- method-1-method-8
- Method-1-Method-7
- method-1-method-9-detail
- method-1-method-8-detail
- Method-1-Method-6-detail
- Method-1-Method-3-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters
-
Collectionofplasma
-
ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)
-
Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%
-
Ionconcentrations
-
Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg
-
Plasmaosmolality
-
Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
-
Plasmaseparation
-
0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes
-
Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof
-
Collectionoftissues
-
TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard
-
Totalproteins
-
MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC
-
MCV
-
BloodwastakenbyheartpunctureusingMS222astheanaesthetic.Nofishwasusedmorethanonce.
-
CollectionofBlood
-
Theeffectof2%,5%and7%effluentexposureontheoxygenuptakewasmeasuredatexperimentalconditions,viz.,(a)whenaccesstoairwasprevented(aquaticconsumption),(b)whenitwasallowed(bimodalrespiration)and(c)underaerialconditions(aerialrespiration)
-
Effectofeffluentexposureontheoxygenconsumption
-
Channapunctata(Family:Channidae)(15-20g;10-15cm)usedinthisinvestigationwerewildcaughtandbroughttothelaboratoryinplasticbuckets.
-
Collectionoffish
Tags
- Method-17-Method-1
- Method-19-Method-1-detail
- Method-10-Method-1
- Method-8-Method-1
- Method-1
- Method-18-Method-1
- Method-18-Method-1-Method-2
- Method-10-Method-6-Method-1-detail
- Method-16-Method-1-detail
- Method-1-detail
- Method-18-Method-1-Method-1-detail
- Method-18-Method-1-Method-2-detail
- Method-18-Method-1-detail
- Method-10-Method-1-detail
- Method-16-Method-1
- Method-18-Method-1-Method-1
- Method-10-Method-6-Method-1
- Method-17-Method-1-detail
- Method-19-Method-1
- Method-8-Method-1-detail
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-
until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
-
Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
-
Capture-C
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
Percentage lethality was calculated as:100×((number of non-CyO/ number CyO)×100)
-
Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}
-
Fly Stocks and Crosses
-
Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).
-
Molecular Biology Protocols
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
CR conditions for amplification of vif gene of HIV -1 1. Denaturation-940C-5min 2. Denaturation-940C-30sec 3. Annealing-630C-30sec 4. Extension-720C-45sec 5. Final extension-720C-5min
-
The polymerase chain reaction (PCR) was carried out using the PCR Core System I (Promega, U.S.A.). 200ng of template DNA/oligonucleotide and 1 pM terminal primers were combined in 2Spl reaction volume finally containing 1X Mg free reaction buffer (500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% Triton X-100), dNTP mix with 0.2mM of each, 1.5mM MgCh and 0.62SU of Taq DNA Polymerase. 30 thermal reaction cycles from steps 2-4 were repeatedly carried out, in GeneAmp PCR 2400 machine (Perkin Elmer, USA). PCR amplification was analyzed by 1-2% agarose gel electrophoresis using a 100 bp ladder or A Hind ill marker (Promega, USA). PCR conditions for amplification of HBx gene of HBV 1. Denaturation-94oC-5min 2. Denaturation-94oC-1min 3. Annealing-42oC-2min 4. Extension-72oC-2min 5. Final extension-72oC-5min PCR conditions for amplification of hammerhead-Rz 1. Denaturation-94oC-5min 2. Denaturation-94oC-30sec 3. Annealing-42oC-1min 4. Extension-72oC-15sec 5. Final extension-72oC-2min
-
olymerase chain reaction
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
For experiments, cells in the logarithmic phase were taken from slant or liquid medium and dead cells removed by centrifugation at 129 x g for 5 min at RT. The supernatant was centrifuged at 1258 x g for 10 min at RT to pellet the live cells which were then resuspended in fresh medium to a cells count of 107 cells per mL. Treatment with PAT (stock solution of 10mg/mL prepared freshly in medium) was carried out at 100, 200 and 300 Jig/mL; with miltefosine (800Jig/mL stock solution prepared in DMSO) at 10, 20, 40, 60 and 80 JIM, and with H202 at 100, 200 and 300 JIM. Ketoconazole (10mM, prepared in absolute ethanol) and clotrimazole (10mM, prepared in DMSO) were used at 10 and 30 JIM. Ergosterol (3mg/ mL prepared in chloroform or absolute ethanol) was added to culture medium at a final concentration of 5-10Jig/ mL.
-
Drug treatments
-
debris, polysaccharides, and high molecular weight DNA The supernatant was gently decanted into a fresh microcentrifuge tube and 200!!L of chloroform/ mL of TRizol was added and the tube was shaken vigorously for 15s. The mixture was incubated at room temperature for 2-3 min before centrifugation at 12000 x g for 15 min at 4 °C. This resulted in the separation of the mixture into a lower organic phase and an upper aqueous phase. The aqueous phase containing the RNA was gently aspirated and transferred into a fresh microcentrifuge tube and 500!!L of isopropanol/ mL of TRizol reagent was added and incubated at RT for 10min. The mixture was centrifuged at 12000 x g for 10 min at 4 °C to isolate the RNA as a pellet. The supernatant was discarded and the pellet was washed once with 70% ethanol, centrifuged and the pellet was air-dried and re-dissolved in approximate quantity of nuclease free (DEPC-treated) water. The purity (A2so/ A260 >1.8) and concentration (A2soX dilution factor X 40) of the obtained RNA was determined by measuring the absorbance at 260nm (A26o) and 280nm (A2so). For storage, the RNA was resuspended in 1mL of absolute ethanol and stored at -70°C. Subsequently before use, the RNA was pelleted at 12000 x g for 10 min at 4°C, washed with 70% ethanol and redissolved in DEPC-treated water.
-
Total RNA was isolated from cells using TRizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Briefly 2X108 cells were harvested by centrifugation at 1258 x g for 10 min, and washed 1X with PBS. The cell pellet was lysed with 2 mL ice-cold TRizol reagent. The lysate was centrifuged at 12000 x g for 10 min at 4 °C to pellet down cellular
-
Total RNA isolation
-
Long-term axenic amastigotes were generated by subjecting promastigotes to pH and temperature modulations as described elsewhere (Debrabant et al., 2004). Briefly, live metacyclic promastigotes were harvested by centrifugation and resuspended in DMEM containing 20% FBS and a pH of 5.5 and sub-cultured at 23°C after 72 h three times. Following this, the cells were then transferred to 37°C, 5% C02 for 3 passages after 72 h each. Axenic amastigotes obtained after the last subculture was stained with Giemsa stain and checked under the microscope. They were then maintained at 37°C in a humidified atmosphere containing 5% C02 in air
-
Leishmania donovani promastigotes (MHOM/IN/80/DD8) were obtained from Dr. R Vishwakarma from the National Institute of Immunology, New Delhi, India. These were grown routinely on blood agar slants containing 1% glucose, 5.2% brain heart infusion agar extract, 6%(v jv) of rabbit blood and 1mg/mL of gentamycin as antibiotic (Sudhandiran and Shaha, 2003) at 23°C. After three days of culture on slants, fresh slants were streaked using a loop for regular maintenance. For liquid cultures, cells were transferred from a slant to modified DMEM (3. 7 g Sodium bicarbonate, 5. 96g HE PES, 5mg Hemin, 1mg Biotin, 13.36mg Adenine, 7.6mg Xanthine, 0.5rnl Triethanolamine, 40mg Tween 80) with 10 % foetal bovine serum (FBS). Before experiments, the cells were centrifuged at 129 x g for 10 min to remove dead and agglutinated parasites; the supernatant was centrifuged at 1258 x g for 10 min to pellet the live cells which were then resuspended in appropriate amounts of media for experiments
-
In vitro Leishmania donovani culture
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Identification of selected micro-organism
-
3.0–5.0, phosphate buffer for pH 6.0–8.0 and Tris-HCl buffer for pH 9.0) were used. •pH stability: The pH stability of the selected tannases was examined in the range of 3.0–9.0 by incubating the enzyme samples for 6 h in different buffers. Tannase activity was estimated under standard assay conditions. •Temperature tolerance: Temperature tolerance of the tannases was examined by assaying their activity at different temperatures in the range of 20 to 80ºC. •Temperature stability: Temperature stability of the tannases was determined by incubating them in the temperature range of 20 to 70 ºC for 6 h. After the incubation tannase activity (%) was determined under standard assay conditions. •Organic solvent stability: In order to determine the suitability of the selected tannases for organic synthesis, their stability was determined in different organic solvents. Experimentally, 10 mg of each of the crude lyophilized tannase from the selected cultures were mixed with 1.0 ml of the following organic solvent: a) Hexane b) Methanol c) Propanol d) Isoamyl alcohol e) Petroleum ether f ) Chloroform The mixture was incubated for 6 h at optimal temperature and the organic solvents were then decanted and the residues were dried in a vacuum desiccator. These dried samples were dissolved in 1.0 ml of citrate phosphate buffer (50 mM, pH 5.0) and the tannase activity was determined under standard assay conditions. The tannase activity thus obtained from each culture were compared with initial tannase activity. Finally, on the basis of tannase titres produced per ml and desirable biochemical properties, the best tannase producer was selected for further investigations
-
The tannases obtained (at high titres) from selected cultures were evaluated for the following important biochemical properties. 1. pH tolerance and stability 2. Temperature tolerance and stability 3. Organic solvent stability •pH tolerance: pH-tolerance of the selected tannases was examined in the range of 3.0–9.0. Buffers (0.05 M) of different pH (citrate phosphate for pH
-
Preliminary biochemical characterization of tannases from the potent tannase producers
-
The reaction mixture contained 10 μl of culture filtrate, 490 μl of double distilled water (DDW) and 300 μl of methanolic rhodanine solution. This mixture was incubated for 5 min at 30°C in a water bath. The reaction was stopped by adding 0.3 ml of methanolic rhodanine solution (0.667 %), which resulted in the formation of complex between gallate and rhodanine. This was followed by the addition of 0.2 ml of KOH solution (0.5N) and the tubes were further incubated at 30°C for 5 min. The total reaction mixture in each tube was diluted with 4.0 ml of distilled water. Tubes were further incubated at 30°C for 10 min. The absorbance was measured at 520 nm against a control having distilled water in place of culture filtrate. The absorbance thus obtained was used to calculate the amount of gallic acid present in the culture filtrate, from the standard gallic acid curve prepared in the range of 100-1000 μg/ml.
-
The procedure of Sharma et al. (2000) was used to estimate the gallic acid in the culture filtrate. Reagents: Methanolic rhodanine solution (0.667% w/v): Prepared by dissolving 0.667 g of rhodanine in 100 ml of methanol.Potassium hydroxide (0.5 N): 2.8 gpotassium hydroxide dissolved in100 ml of distilled water.
-
Gallic acid estimation (Sharma et al., 2000)
-
The tannin sample (1.0 ml) was added to 2.0 ml BSA solution in a 15 ml glass centrifuge tube. The solution was mixed and allowed to stand at room temperature for 15 min and then centrifuged at 10000 rpm for 15 min to separate the precipitated tannin-protein complex as pellet. The supernatant was discarded and the pellet and the walls of the tube were washed with acetate buffer without disturbing the pellet. Now, the pellet was dissolved in 4.0 ml of SDS-triethanolamine solution and to this, 1.0 ml of ferric chloride reagent was added and was mixed immediately. After 30 min of addition of ferric chloride, the absorbance was noted at 510 nm on spectrophotometer. All observations were carried out in triplicates. The concentration of the tannin was determined with the help of tannic acid (Sigma) standard curve prepared in the range of 0.2 to 1.0 mg/ml
-
The procedure of Hagerman and Butler (1978) was used to estimate the tannin content in different tannin sources. Reagents: Bovine serum albumin (BSA) 1.0 mg/ml: 10.0 mg of bovine serum albumin was dissolved in 10.0 ml of 0.2 M acetate buffer, pH 5.0, containing 0.17 M sodium chloride. Sodium dodecyl sulfate (SDS)-triethanolamine solution: The solution contained 1.0% SDS and 5.0% (v/v) triethanolamine in distilled water. Ferric chloride reagent (0.01 M): 1.62 g of ferric chloride was dissolved in 1.0 L of 0.01 N hydrochloric acid.
-
Tannin estimation (Hagerman and Butler, 1978)
-
To 1.0 ml of suitably diluted culture filtrate, 5.0 ml of solution C was added. It was incubated for 10 min at room temperature. To this, 0.5 ml of Folin Ciocalteau’s reagent (diluted 1:1 with distilled water) was added. The solution was vortexed and kept in dark for 30 min. After incubation, absorbance was read at 660 nm against a reagent blank. Protein content was calculated (in mg/ml) using standard curve of bovine serum albumin (BSA) prepared in the range 100-1000 μg/ml
-
The total protein content in the culture filtrate was estimated by Lowry’s method as described below: Reagents: Solution A: 2.0% Na2CO3 in 0.1 N NaOHSolution B: 0.5 % CuSO4 in 1.0 % Sodium potassium tartarate Solution C: 50.0 ml of solution A was mixed with 1.0 ml of solution B Folin Ciocalteau’s reagent
-
Protein estimation (Lowry et al., 1951)
-
For estimation of tannase activity the reaction mixture (4 ml) contained 1.0 ml of 1.0% tannic acid (prepared in citrate-phosphate buffer, pH 5.0), 2.0 ml of citrate-phosphate buffer (pH 5.0) and 1.0 ml of appropriately diluted culture supernatant. The reaction mixture was incubated at 40°C for 30 min in a water bath. The reaction was stopped by adding 4.0 ml of 2.0% BSA solution. In the control reaction, BSA was added prior to incubation. Now the tubes were left for 20 min,at room temperature, for precipitating the residual tannins and subsequently centrifuged at 10,000 rpm for 20 min. The end product, gallic acid thus formed was estimated by diluting 20 μl of the supernatant to 10 ml with DDW. Now, the absorbance at 260 nm was read against a blank (DDW) in a UV spectrophotometer (1601, Shimadzu Corporation, Japan). One unit of tannase: One tannase unit is defined as the amount of enzyme that releases 1 μmol of gallic acid from the substrate (tannic acid) per ml per min under standard assay conditions
-
In this method, tannase activity was estimated through spectrophotometric method by determining the concentration of the end product i.e., gallic acid, by estimating the absorbance at 260 nm. Reagents: •Tannic acid (1.0%): The solution was prepared by dissolving 1.0 g of tannic acid in 100 ml of citrate-phosphate buffer of the desired pH.•Bovine serum albumin (BSA): BSA (2.0%) was prepared in citrate phosphate buffer (pH 5.0)
-
Estimation of tannase activity (Deschamp et. al., 1983)
-
For bacterial isolates, a single colony from a nutrient agar slant was inoculated into 50 ml of nutrient broth in a 250 ml Erlenmeyer flask. These flasks were incubated at 37±1°C in a incubator shaker till an optical density of 0.6 at 660nm. Now these cultures were used to inoculate 50 ml of the tannase production medium in 250 ml Erlenmeyer flasks using 2% v/v inoculum. These flasks were incubated at 37±1°C in an incubator shaker (Multitron AG-27; Switzerland) at 200 rpm for 72h. The experiments were carried out in triplicates. Samples (2.0 ml for bacteria and same for fungi) were withdrawn at regular intervals of 12h upto 72 h. The samples thus obtained were centrifuged at 10,000 rpm in a refrigerated centrifuge (SIGMA 4K15 Germany) for 10 min at 4°C. The supernatant/s were analyzed for tannase activity
-
For fungal cultures, spores were harvested from 72 hour old cultures grown on PDA/Tannic acid agar slants by adding 10 ml of sterilized normal saline and a few drops of sterilized Tween-80 followed by vortexing. The spore suspension was filtered through sterile cotton filter to ensure that mycelial filaments are removed. The spores were counted using a haemocytometer (Neubaeur). Approximately, 5X106 spores were inoculated in 50 ml of tannase production medium in 250 ml Erlenmeyer flasks. These flasks were then incubated at 30±1 and 37±1°C in an incubator shaker (model G25KC, New Brunswick Scientific, NJ, USA) at 200 rpm
-
Quantitative assay
-
was observed by the formation of a clear zone of hydrolysis around the bacterial/fungal colony. Tannase production, in terms of the diameter of the zone of hydrolysis around the colony, was measured (in mm) after 24 (bacteria) and 48 hours (fungi) of incubation. The diameter of the hydrolytic zone was measured at three points and the average was calculated. The microorganisms showing a zone of tannic acid hydrolysis were considered as tannase producers. The potent tannase producers were further tested quantitatively for the amount of enzyme produced in broth.
-
The procedure of Bradoo et al. (1996), involving point inoculation of the microorganisms on tannic acid agar plates was followed. The plates were incubated at 37 and 30±1°C for bacterial and fungal isolates. The presence of tannase activity
-
Qualitative screening for tannase producer/s
-
A total of 150 fungal and 150 bacterial isolates were screened qualitatively and quantitatively for their ability to produce the enzyme, tannase.
-
Screening and selection of potential tannase producers
-
Microorganisms were isolated from the above mentioned sources using direct plating method. Serial dilution of the different soil samples with normal saline was carried out and the different dilutions were spread plated on to potato dextrose agar (PDA) for isolation of fungi and on to nutrient agar (NA) for the isolation of bacteria. The plates were incubated at either 30 or 37±1°C in a bacteriological incubator so that the different organisms could grow and form visible colonies. The different fungal and bacterial colonies isolated by the procedure mentioned above were purified by subculturing on respective media, and subsequently screened for tannase production. The new isolates, alongwith different cultures obtained from laboratory stock culture collection, were revived on potato dextrose agar (PDA) slants. These cultures were regularly subcultured and stored at 8±1°C in a BOD incubator. Their purity was periodically checked by microscopic examination.
-
In the present investigation, microorganisms including both bacteria and fungi were isolated from soil samples collected from different geographical locations in India. Microorganisms were also isolated from the bark of trees as well as from the soil near the roots of those trees. Some cultures were also procured from the laboratory stock culture collection.
-
Collection of samples
-
Isolation of tannase producing microorganism/s
Tags
- method--1-method-9
- method-1-method-6
- method-1-method-10-detail
- method-1-method-11
- method-1-method-7
- method-1-method-3-detail
- method-1-method-7-detail
- method-1-method-8-material
- method-1-method-4-detail
- method-1-method-4
- method-1-method-3
- method-1-method-7-material
- method-1-method-9-material
- method--1-method-6-detail
- method-1-method-1
- method-1-method-5
- method-1
- method--1-metthod-8
- method-1-method-10-material
- method-1-method-10
- method-1-method-6-material
- method--1-method-5-material-2
- method-1-method-9-detail
- method-1-method-1 detail
- method-1method-5-material-1
- method-1-method-8-detail
- method-1-method-2 detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Fresh overnight cultures grown in LB containing appropriate antibiotics to select for plasmids were sub-cultured 1:100(or lower dilutions for some strains)in the same medium. The cells from these cultures weretaken for microscopy at exponential phase of growth(A600 of 0.5-0.6), as such or after concentrating the cells 10-fold
-
Sample preparation
-
vii.RNA buffer II from Ambion(1-2X Xylene cyanol + Bromophenol blue)used for loading the samples. RNA isolation for Northern blotting for lacZtranscript was done aftergrowing cultures till A600of 0.6 in LB in the presence or absence of 1mM IPTG at 30oC while for lacZ-lacYʹ-tRNA(U73)Arg5or lacZʹ-tRNA(U73)Arg5transcripts, cultures were grown in LBupto A600of 0.3 and induced with 1mM IPTG for 30 min followed by RNA extraction.30ml of 10% polyacrylamide gels of 1.5mm thickness were cast in the Broviga slab vertical gel electrophoresis apparatus. Gels were polymerizedby the addition of TEMED and APS (1/100th volume of gel mix). The gel was pre-runat 300V for 15-20 minutes prior to loading.Sample preparation for gel loading was done as follows. The normalizedamounts of RNA samplesto be analyzed were mixed with the equal volumes of 2X gel loadingbuffer II(Ambion)making a final concentration of 1X. The samples were then heated at 80 degrees in a thermoblock (eppendorf) for 10 minutes and loaded on the gel when still warm. The gel was run at constant voltage of 300Vfor 3-4 hours till xylene cynol covered 2/3rddistance
-
The following solutions were used to cast and run denaturing PAGE gels:i.40% acrylamidestock solution ii.7.5M Ureaiii.5X TBEiv.Ammonium persulphate (APS) stock: 10% (w/v) solution made fresh v.TEMED (N,N,N′, N′-tetramethyl ethylene diamine) vi.Gel running buffer (0.5X TBE)
-
Denaturing polyacrylamide gel electrophoresis of RNA
-
For high fidelity PCR, Herculase II fusion DNA polymerase (AgilentTechnologies)was used. Approximately 0.5μg of chromosomal DNAwas used as a template in a 50μl reaction volume
-
The PCRs were normally performed using Taqpolymerasefrom Roche or Fermentas. Approximately 1-5ng of plasmid or 5-100ng of chromosomal DNA was used as a template in a50μlreaction volume containing 200μM of each dNTP, 20pM each of the forward and reverse primers and 1 unit of Taq DNA polymerase. For colony PCR E. coli cells from a freshly grown plate were resuspended in 10μl of sterile Milli-Q water to get a cell suspension and this was used as a template in a PCR reaction at a final volume of 50μl. The samples were typically subjected to 30 cycles of amplification with the following general conditions: Initial denaturation 95ºC5minutes Denaturation 95ºC 1 minute Annealing 55ºC 1 minute Extension 72ºC 1 minute/kb of DNA template to be amplified Final extension 72ºC 10 minutes
-
Polymerase Chain Reaction (PCR)
-
following the manufacturer’s instructions. For genomic DNA, 1ml culture was used for DNA isolationusing Qiagen or Invitrogen kits. The quality of plasmid/genomic DNApreparations was assessed following electrophoresis on 0.8% agarose gels
-
3ml (for high copy number)or 10 ml (for low-copy number) of cells from an overnight culture were pelleted by centrifuging for 5 minutes at 6000rpm forthe plasmid isolation which was carried out with the commercially available kits (Qiagen or Invitrogen)
-
Isolation of plasmid and chromosomal DNA
-
Growth curves were generated to compare the growth rates of E. coli test strains with control strains manually. The appropriate dilutions of the overnight cultures in desired media were made and allowed to grow at required temperature till faint turbidity was visible. At this point samples were collected every 30 minutes until stationary phase was attained. The growth curves weregenerated using Microsoft Excel or SigmaPlot software and growth rates were calculated from the slope of the graph which, in turn, was used to calculate generation time
-
Estimation of growth rates
-
β-Galactosidase assay was performed according to(Miller, 1992).Cultures were grown to A600 of 0.4-0.6 from a 1:100 dilution of overnight cultures. Around 0.1-0.5 ml of culture was made up to 1 ml with Z-buffer and lysed with the addition of 100μl of chloroform and 50μl of 0.01% SDS solution. 0.2ml of freshly prepared 4mg/ml ONPG was added to start the reaction and incubated at 28oCtill the colour of the reaction mixture turned yellow. 0.5ml of 1M Na2CO3 was added to stop the reaction and the time duration from initial addition of ONPG to the stopping of the reaction was noted. The absorbance of reaction mix was taken at 420 nm (A420) afterspinning down the mix at 12000rpm for 3 minutes. The A600of the culturesused was also noted. The enzyme’sspecific activity (in Miller units) was calculated using the following equation: β-Galactosidase specific activity (Miller units) = (1000 ×A420) / t × v ×A600Where,‘t’ is the time period in minutes and ‘v’, the volume of culture used in ml
-
white colonies were recovered and purified to give growth. If the mutation caused synthetic lethality then white colonies (that lack the shelter plasmid) would not be observed since plasmid loss would result in growth arrest. Therefore, lethality was inferred when either white colonies were not recoveredor were recovered but failed to purify further
-
To determine whether a particular mutation conferred lethality in the ppGpp0or ΔdksAbackground, an assay was devised based on the use of an unstable, easy to cure shelter plasmidpRC7, similar to that described previously(Bernhardt & de Boer, 2004). In the wild-type strain carrying pRC7, this plasmid can be lost at a frequency of 20-30% in the absence of the selection. However, this will not be seen if the plasmid loss leads to cell death. Since the plasmid pRC7 confers a lac+phenotype, in the absence of the selection plasmid loss can be visualized on X-gal IPTG containing plates as white colonies in a Δlac strain whereas the colonies that retain the plasmid will appear blue.In order to carry outsynthetic lethal screen in the ppGpp0or ΔdksAstrains, the spoT or dksAgenes cloned in pRC7 under the control of lacpromoter were used. Theseshelter plasmids,namely,pRCspoT or pRCdksA, respectivelywere transformed into the ppGpp0or ΔdksAstrain. To test the synthetic growth phenotypes, the mutations of the genes to be tested were introduced by phageP1 transductions. The resultingstrains were grown overnight in LBcontaining the antibiotic selection for the shelter plasmid and IPTG for expression of spoTor dksA, subsequently washedin minimal A medium and dilutions(usually 10−5or 10−6) of these cultureswere spreadon X-gal and IPTG containing plates without antibiotic selection for the shelter plasmid. The phenotypes of the white colonies in comparison with the blue colonies were noted. Viability of the strains was inferred when
-
Blue-white screening for viability or lethality phenotype
-
or absence of a metabolite or a particular temperature. An EOP of ≤0.01 suggests lethality of the strain on the test medium. For strains carrying IPTG-dependent plasmids, EOP was determined by growing the strains overnight in medium containing IPTG and appropriate antibiotic,and spottingserial dilutions (100or 10–1to 10–6) on +IPTG (permissive) and –IPTG (test) plates to observe growth. Theviability is scored by takingratio of the colony forming units per ml (cfu/ml = No. of colonies × dilution factor × 1000/volume of culture spotted (in μl) obtained on the –IPTG plate to that on the +IPTG plate and determinesthe EOP. Likewise, strains carrying Ts plasmids were cultured overnight at 30°C with the appropriate antibioticand the serial dilutions of this culture were spottedat two temperatures 30°C (permissive) and 42°C (non-permissive or test). The ratio of cfu/mlobtained on the test temperature to that on the permissive temperature determined the efficiency of plating at the test temperature
-
Efficiency of plating (EOP) is a measure of the ratio of number of colonies (obtained from a given volume of a suitable culture dilution) on a test medium to those on a control or permissive medium, and is a measure of cell viability on the former. It is a very sensitive test and is often used for determining the viability of a strain in the presence
-
Efficiency of plating (EOP)
-
C. LBON temperature-sensitivityStrains were streaked on LBON agar plates and after an overnight incubation at42°C, growth was monitored (compared to that on LBON at 30°C as control). Absence of single colony growth was taken to reflect temperature sensitivity. D. In vivotranscription termination phenotypes The rationale for each phenotype is described in the relevant section. SMG-sensitivityThe E. coli relA mutants exhibit SMG-sensitive (SMGs) phenotype,that is,growth-inhibition in the presence of serine, methionine and glycine at 1mM concentration each(Uzan & Danchin, 1978)and is proposed to be a consequence of transcriptional polarity exerted by a frameshift mutation in the ilvG gene on the expression of downstream genes of the ilvGMEDA operon(Lopes & Lawther, 1989).This test was therefore used to distinguish relA+from relA−strains. Growth in the presence of amino acids serine, methionine, and glycine (SMG) was scored on glucose-minimal A plates supplemented with each of the amino acids at 40μg/ml and compared with the growth on non-supplemented glucose-minimal A plates to score for SMG phenotype. galEp3assayThis assay was used to test for relief of transcriptional polarity in the rho and nusG mutants. The galEp3 (galE490*) mutation represents a 1.3kb IS2 insertion in the gal leader region (between the promoter and structural genes of the galETKM operon). The mutation causes transcriptional polarity on the structural genes due to Rho-dependent transcription termination within IS2. In this assay, the gal operon expression in a galEp3 mutant or its derivatives was monitored by usingMacConkey galactose indicator plates (with 1% galactose), where Gal+colonies are red, and Gal−colonies are white. Therefore, the depth of color serves as an indicator of relative levels of gal expression, i.e., the extent of transcriptional polarity relief
-
A.lacZphenotype lacZ+colonies were distinguished from lacZ–colonies on X-gal containing plate or MacConkey lactose plate. X-gal is non-inducing colourless substrate of β-galactosidase enzyme which upon hydrolysis yields dark blue indolyl group and hence the lacZ+colonies on X-gal plate appear as dark blue colonies. Similarly, on the MacConkey agar plateslacZ+colonies appear dark pink whereas lacZ–colonies remain colourless. B. UV-sensitivityTo check the UV-sensitivity of the strains qualitatively, the strains were streaked on duplicate LB-agar plates and one of the plates was UV-irradiatedwith a 15-W UV-germicidal lamp at a distance of 70cm for 30 seconds. The UV-exposed and unexposed plates were incubated overnight in the dark after wrapping with aluminium foil and then growth was scored. This test could differentiate a recA–strain (UVs) from a recA+strain (UVr)
-
Scoring for Phenotypes
-
desired temperaturefor 45 minutes and plated on an appropriate selective medium at various dilutions. An aliquot of cell suspension to which plasmid DNA was not added served as a negative control. B. Inoue method i. Preparation of high efficiency competent cells Competent cells for high efficiency transformation were prepared by the method of (Inoueet al., 1990)with few modifications. An overnight culture of the strain (routinely DH5α) was subculturedinto fresh sterile LB broth in 1:100 dilutions and grown at 18ºC to anA600of 0.55. The cells were harvested by centrifugation at 2500rpm for 10 minutes at4ºC. Thesecells wereresuspended in0.4 volumes of INOUE buffer andincubated in ice for 10 minutes. The cells were recovered by centrifugation at 2500rpm at 4ºC for 10 minutes and finally resuspended in 0.01 volume of the same buffer. Sterile DMSO was added to a final concentration of 7%. After incubating for 10 minutes in ice, the cells were aliquoted in 100μl volumes, snap frozen in liquid nitrogen and stored at –80ºC. ii. Transformation protocolFor transformation, the required number of vials wasthawed on ice and the transformation protocol as described for CaCl2method was employed
-
A. Calcium chloride(CaCl2)method For routine plasmid transformation, following method which is a modification of that described by(Cohenet al.,1972)was used. An overnight culture of recipient strain was subcultured 1:100 in fresh LB medium and grown till mid-exponential phase. The culture was chilled on ice for 20 minutes, and the steps thereafter performed at 4ºC. 10 ml of culture was centrifuged and pelletwas resuspended in 5 ml of 0.1M CaCl2. After 5 minutes of incubation on ice, the cells were again centrifuged and resuspended in 1ml of 0.1M CaCl2. The suspension was incubated onice for 45 minutes. To the 100μl aliquot of the cellsuspension plasmid DNA (20-200ng in less than 10μl volumes) was added, incubated for 30-40 minutes on ice and given a heat shock for 90 seconds at 42ºC. The cultures were rapidly chilled for 1 minute, mixed with 0.9ml of LB broth and incubated at
-
Transformation
-
To 2 ml of fresh overnight culture of recipient strain, 108 pfu equivalent of phage lysate was added and incubated at 37ºC without shaking for 30 minutes to facilitate phage adsorption. The unadsorbed phage particles were removed by centrifugation at 6000 rpm for 5 minutes and the pellet ofbacterial cells was resuspended in 5 ml of LB broth containing 20 mM sodium citrate to prevent further phage adsorption. This was incubated for 25-60 minutes at desired temperaturewithout shaking to allow the phenotypic expression of the antibiotic resistance gene. The mixture was then centrifuged and the pellet was resuspended in 300 μl of 0.1M citrate buffer. 100 μl aliquots were spreadon appropriate antibiotic containing plates supplemented with 2.5 mM sodium citrate. A control tube without addition of P1 lysate was also processed in the same way. In the case of selection of nutritional requirement, the infection mixture was centrifuged, resuspended in 300 μl of 0.1M citrate buffer and plated without phenotypic expression
-
10–6)were mixed with 0.1 ml of fresh culture grown in Z-broth. After 30 min of adsorption at 37ºC without shaking, each mixture was added on a soft agar overlay of Z-agar plates and incubated overnight at 37ºC. The phage titrewas calculated from the number of plaques obtained on the plates as follows: Phage titre(pfu) per ml = No. of plaques ×dilution factor ×1000/vol.of lysate added (in μl)
-
Phage P1 lysate preparation by broth method
-
Phage P1 transduction
-
0.3 ml of overnight culture of the donor strain in Z-broth was mixed with 107plaque forming units (pfu) of a stock P1 phage lysate prepared on strain MG1655. Adsorption was allowed to occur at 37ºC for 30 minutes and the lysate was prepared by broth method. To 0.3 ml of infection mixture, 8-10 ml of Z-broth was added and incubated at 37ºC with slow shakinguntil the visible lysis of the culture occurred (in 4-6 hours). The lysate was treated with 0.2ml of chloroform, centrifuged and the clear lysate wasstored at 4ºC with chloroform.Quantitation of Plaque forming units (pfu)To quantitate the titreof P1 lysate preparation, titration was done using P1 phage sensitive indicator strain such as MG1655. 100 μleach of dilution of phage (typically 10–5,
-
Genetic Techniques
Tags
- Method-1-Method-5
- Method-1-Method-8
- Method-3-Method-1-detail
- Method-1-Method-7-detail
- Method-1-Method-2-detail
- Method-1-Method-4-detail
- Method-2-Method-1
- Method-1-Method-1
- Method-1
- Method-3-Method-1
- Method-1-Method-6
- Method-1-Method-5-detail
- Method-4-Method-1
- Method-1-Method-3
- Method-1-Method-2
- Method-1-Method-4
- Method-1-Method-8-detail
- Method-4-Method-1-detail
- Method-1-Method-1-detail
- Method-7-Method-1
- Method-7-Method-1-detail
- Method-2-Method-1-detail
- Method-1-Method-6-detail
- Method-1-Method-3-detail
Annotators
URL
-