10,000 Matching Annotations
  1. Aug 2024
    1. Reviewer #2 (Public Review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects. While the authors address an important question, more rigor is required to understand the full behavior of the model.

      Major Points

      (1) The authors compare DIPx to the winning method of the DREAm challenge, TAJI to show that from molecular features alone they retrain TAJI to create TAJI-M without the monotherapy data inputs. They mention that "of course, we could also use such data in DIPx...", but they never show the behaviour of DIPx with these data. The authors need to demonstrate that this statement holds true or else compare it to the full TAJI.

      (2) It would be neat to see how the DIPx feature importance changes with monotherapy input. For most realistic scenarios in which these models are used robust monotherapy data do exist.

      (3) In Figure 2, the authors compare DIPx and TAJI-M on various test sets. If I understood correctly, they also bootstrapped the training set with n=100 and reported all the model variants in many of the comparisons. While this is a nice way of showing model robustness, calculating p-values with bootstrapped data does not make sense in my opinion as by increasing the value of n, one can make the p-value arbitrarily small. The p-value should only be reported for the original models.

      (4) From Figures 2 and 3, it appears DIPx is overfit on the training set with large gaps in Spearman correlations between Test Set 2/ONeil set and Test Set 1. It also features much better in cases where it has seen both compounds. Could the authors also compare TAJI on the ONeil dataset to show if it is as much overfit?

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Guayasamin et al. show that early-life stress (ELS) can induce a shift in fear generalisation in mice. They took advantage of a fear conditioning paradigm followed by a discrimination test and complemented learning and memory findings with measurements for anxiety-like behaviors. Next, astrocytic dysfunction in the lateral amygdala was investigated at the cellular level by combining staining for c-Fos with astrocyte-related proteins. Changes in excitatory neurotransmission were observed in acute brains slices after ELS suggesting impaired communication between neurons and astrocytes. To confirm the causality of astrocytic-neuronal dysfunction in behavioral changes, viral manipulations were performed in unstressed mice. Occlusion of functional coupling with a dominant negative construct for gap junction connexin 43 or reduction in astrocytic calcium with CalEx mimicked the behavioral changes observed after ELS suggesting that dysfunction of the astrocytic network underlies ELS-induced memory impairments.

      Strengths:

      Overall, this well-written manuscript highlights a key role for astrocytes in regulating stress-induced behavioral and synaptic deficits in the lateral amygdala in the context of ELS. Results are innovative, and methodological approaches relevant to decipher the role of astrocytes in behaviors. As mentioned by the authors, non-neuronal cells are receiving increasing attention in the neuroscience, stress, and psychiatry fields.

      Weaknesses:

      I do have several suggestions and comments to address that I believe will improve the clarity and impact of the work. For example, there is currently a lack of information on the timeline for behavioral experiments, tissue collection, etc.

    1. The South Florida influencers, for instance, heard a rumor circulating that the government had put microchips in the coronavirus vaccine so it could track people.

      Notice that many fake news stories begin from a place of fear. This fear hijacks our brains and triggers fight or flight options in our system I circuitry and actively prevent the use of the rational parts of system II which would quickly reveal problems in the information.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors use a combination of transgenic animals, intersectional viruses, retrograde tracing, and ex-vivo slice electrophysiology to show that VTA projection neurons synapse locally. First, the authors injected a cre-dependent channelrhodopsin into the VTA of PV, SST, MOR, and NTS-Cre mice. Importantly, PV, SST, MOR, and NTS are molecular markers previously used to describe VTA interneurons. Imaging of known VTA target regions identified that these neurons are not localized to the VTA and instead project to the PFC, NAc, VP, and LHb. Next, the authors used an intersectional viral strategy to label projection neurons with both GFP (membrane localized) and Syn:Ruby (release sites). These experiments identified that VTA projection neurons also make intra-VTA synapses. Finally, the authors use a combination of optogenetics and ex-vivo slice electrophysiology to show that neurons projecting from the VTA to the NAc/VP/PFC also synapse locally. Overall, most of the conclusions seem to be well supported by the data.

      Strengths:

      Previous literature has described Pvalb, Sst, Oprm1, and Nts as selective markers of VTA interneurons. Here, the authors make use of cre driver lines to show that neurons defined by these genes are not interneurons and project to known VTA target regions. Additionally, the authors convincingly use intersectional viral approaches and slice electrophysiology to show that projection neurons synapse onto neighboring cells within the VTA

      Weaknesses:

      While the authors use several cre driver lines to identify GABAergic projection neurons, they then use wild-type mice to show that projection neurons synapse onto neighboring cells within the VTA. This does not seem to lend evidence to the idea that previously described "interneurons" are projection neurons that collateralize within the VTA.

    1. Reviewer #2 (Public Review):

      Summary:

      Franke et al. characterize the representation of color in the primary visual cortex of mice, highlighting how this changes across the visual field. Using calcium imaging in awake, head-fixed mice, they characterize the properties of V1 neurons (layer 2/3) using a large center-surround stimulation where green and ultra-violet colors were presented in random combinations. Clustering of responses revealed a set of functional cell-types based on their preference to different combinations of green and UV in their center and surround. These functional types were demonstrated to have different spatial distributions across V1, including one neuronal type (Green-ON/UV-OFF) that was much more prominent in the posterior V1 (i.e. upper visual field). Modelling work suggests that these neurons likely support the detection of predator-like objects in the sky.

      Strengths:

      The large-scale single-cell resolution imaging used in this work allows the authors to map the responses of individual neurons across large regions of the visual cortex. Combining this large dataset with clustering analysis enabled the authors to group V1 neurons into distinct functional cell types and demonstrate their relative distribution in the upper and lower visual fields. Modelling work demonstrated the different capacity of each functional type to detect objects in the sky, providing insight into the ethological relevance of color opponent neurons in V1.

      Weaknesses:

      It is unfortunate the authors were unable to provide stronger mechanistic insights into how color opponent neurons in V1 are formed.

      Overall, this study will be a valuable resource for researchers studying color vision, cortical processing, and the processing of ethologically relevant information. It provides a useful basis for future work on the origin of color opponency in V1 and its ethological relevance.

    1. Reviewer #3 (Public Review):

      Summary:<br /> Animals can evaluate food quality in many ways. In contrast to the rapid sensory evaluation with smell and taste, the mechanism of slow nutrient sensation and its impact on food choice is unexplored. The authors utilize C. elegans larvae and their bacterial food as an elegant model to tackle this question and reveal the detailed molecular mechanism to avoid nutrient-poor foods.

      Strength:<br /> The strength of this study is that they identified the molecular identities of the critical players in bacterial food and C. elegans using unbiased approaches, namely metabolome analysis, E. coli mutant screening, and RNA sequencing. Furthermore, they strengthened their findings by thorough experiments combining multiple methods such as genetics, fluorescent reporter analysis, and Western blot.

      Weakness:<br /> The major caveat of this study is the reporter genes; specifically, transcriptional reporters used to monitor the UPRER and immune responses in the intestine of C. elegans. However, their tissue-specific rescue experiments suggest that the genes in the UPRER and immune response function in the neurons. Thus, we should carefully interpret the results of the reporter genes. Another point to be aware of is that although they show that lack of carbohydrates elicits the response to "low-quality" food, carbohydrate supplementation with heat-killed E. coli was insufficient to support animal growth.

      Overall, this work provides convincing data to support their model. In the C. elegans field, the behaviors of larvae are not well studied compared to adults. This work will pose an interesting question about the difference between larvae and adults in nutrition sensing in C. elegans and provide a framework and candidate molecules to be studied in other organisms.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

      (1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      (6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      (7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

    1. Reviewer #2 (Public Review):

      Li and colleagues investigate the enzymatic activity-independent function of IDH1 in regulating erythropoiesis. This manuscript reveals that IDH1 deficiency in the nucleus leads to the redistribution of histone marks (especially H3K79me3) and chromatin state reprogramming. Their findings suggest a non-typical localization and function of the metabolic enzyme, providing new insights for further studies into the non-metabolic roles of metabolic enzymes. However, there are still some issues that need addressing:

      (1) Could the authors show the RNA and protein expression levels (without fractionation) of IDH1 on different days throughout the human CD34+ erythroid differentiation?

      (2) Even though the human CD34+ erythroid differentiation protocol was published and cited in the manuscript, it would be helpful to specify which erythroid stages correspond to cells on days 7, 9, 11, 13, and 15.

      (3) It is important to mention on which day the lentiviral knockdown of IDH1 was performed. Will the phenotype differ if the knockdown is performed in early vs. late erythropoiesis? In Figures 1C and 1D, on which day do the authors begin the knockdown of IDH1 and administer NAC and GSH treatments?

      (4) The authors validate that IDH1 regulates erythropoiesis in an enzymatic activity-independent manner by adding ROS scavengers or α-KG. Given the complexity of metabolic pathways, these two strategies may not suffice. Mutating the enzymatic active site could provide a clearer explanation for this point.

      (5) While the cell phenotype of IDH1 deficiency is quite dramatic, yielding cells with larger nuclei and multi-nuclei, the authors only attribute this phenotype to defects in chromatin condensation. Is it possible that IDH1-knockdown cells also exhibit primary defects in mitosis/cytokinesis (not just secondary to the nuclear condensation defect)?), given the function of H3K79Me in cell cycle regulation?

      (6) Why are there two bands of Histone H3 in Figure 4A?

      (7) Are the density and localization of histone modifications (not just H3K79me3) in Sg-NEG-IDH1 HuDEP2 cells similar to those in IDH1-shRNA erythroid cells compared to control cells?

      (8) Displaying a heatmap and profile plots in Figure 5A between control and IDH1-deficient cells will help illustrate changes in H3K79me3 density in the nucleus after IDH1 knockdown.

      (9) Are the distribution and intensity of H3K79me3 in primary healthy erythroid cells in the bone marrow similar to or distinct from those in AML and MDS cells? The authors could present at least one sample of healthy donor cells for comparison.

      (10) In Figure 7E, why are the bands of Luciferase-shRNA in the input and probe both light, while the bands of IDH1-shRNA are both dark? This suggests that the expression of KLF1 is much higher in IDH1-shRNA cells than in control cells. Therefore, this result may not strongly support the increased binding of KLF1 at the SIRT1 promoter after IDH1 knockdown.

    1. Reviewer #2 (Public Review):

      The authors present a computational methodology for de-biasing/denoising high-throughput genomic signals using optimal transport techniques, thus allowing disparate datasets to be merged and jointly analysed. They apply this methodology on liquid biopsy data and they demonstrate improved performance (compared to simpler bias-correcting approaches) for cancer detection using common machine learning algorithms. This is a theoretically interesting and potentially useful approach for addressing a very common practical problem in computational genomics.

      I have the following recommendations:

      (1) When comparing performance metrics between different approaches (e.g., tables 3 and 4), 95% confidence intervals should also be provided and a pairwise statistical test should be applied to establish whether the observed difference in each performance metric between the proposed method and the alternatives is statistically significant, thus justifying the claim that the proposed method offers an improvement over existing methodologies.

      (2) The commonly used center-and-scale and GC debias approaches presented by the authors are fairly simple. How does their methodology compare to more elaborate approaches, such as tangent normalisation (https://academic.oup.com/bioinformatics/article/38/20/4677/6678978) and robust PCA (https://github.com/mskilab-org/dryclean)?

      (3) What is the computational cost of the proposed methodology and how does it compare to the alternatives?

      (4) The proposed approach relies on a reference dataset, against which a given dataset is adapted. What are the implications for cross-validation experiments (which are essential for assessing the out-of-sample error of every methodology), particularly with regards to the requirement to avoid information leakage between training and validation/test data sets?

      In conclusion, this is an interesting and potentially useful paper and I would like to encourage the authors to address the above points, which hopefully will strengthen their case.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors investigated whether a salticid spider, Phidippus regius, recognizes other individuals of the same species. The authors placed each spider inside a container from which it could see another spider for 7 minutes, before having its view of the other spider occluded by an opaque barrier for 3 minutes. The spider was then either presented with the same individual again (habituation trial) or a different individual (dishabituation trial). The authors recorded the distance between the two spiders during each trial. In habituation trials, the spiders were predicted to spend more time further away from each other and, in dishabituation trials, the spiders were predicted to spend more time closer to each other. The results followed these predictions, and the authors then considered whether the spiders in habituation trials were generally fatigued instead of being habituated to the appearance of the other spider, which may have explained why they spent less time near the other individual. The authors presented the spiders with a different (novel) individual after a longer period of time (which they considered to be a long-term dishabituation trial), and found that the spiders switched to spending more time closer to the other individual again during this trial. This suggested that the spiders had recognized and had habituated to the individual that they had seen before and that they became dishabituated when they encountered a different individual.

      Strengths:

      It is interesting to consider individual recognition by Phidippus regius. Other work on individual recognition by an invertebrate has been, for instance, known for a species of social wasp, but Phidippus regius is a different animal. Importantly and more specifically, P. regius is a salticid spider, and these spiders are known to have exceptional eyesight for animals of their size, potentially making them especially suitable for studies on individual recognition. In the current study, the results from experiments were consistent with the authors' predictions, suggesting that the spiders were recognizing each other by being habituated to individuals they had encountered before and by being dishabituated to individuals they had not encountered before. This is a good start in considering individual recognition by this species.

      Weaknesses:

      The experiments in this manuscript (habituation/dishabituation trials) are a good start for considering whether individuals of a salticid species recognize each other. I am left wondering, however, what features the spiders were specifically paying attention to when recognizing each other. The authors cited Sheehan and Tibbetts (2010) who stated that "Individual recognition requires individuals to uniquely identify their social partners based on phenotypic variation." Also, recognition was considered in a paper on another salticid by Tedore and Johnsen (2013).

      Tedore, C., & Johnsen, S. (2013). Pheromones exert top-down effects on visual recognition in the jumping spider Lyssomanes viridis. The Journal of Experimental Biology, 216, 1744-1756. doi: 10.1242/jeb.071118

      In this elegant study, the authors presented spiders with manipulated images to find out what features matter to these spiders when recognizing individuals.

      Part of the problem with using two living individuals in experiments is that the behavior of one individual can influence the behavior of the other, and this can bias the results. However, this issue can be readily avoided because salticids are well known, for example, to be highly responsive to lures (e.g. dead prey glued in lifelike posture onto cork disks) and to computer animation. These methods have already been successful and helpful for standardizing the different stimuli presented during many different experiments for many different salticid spiders, and they would be helpful for better understanding how Phidippus regius might recognize another individual on the basis of phenotypic variation. There are all sorts of ways in which a salticid might recognize another individual. Differences in face or body structure, or body size, or all of these, might have an important role in recognition, but we won't know what these are using the current methods alone. Also, I didn't see any details about whether body size was standardized in the current manuscript.

      For another perspective, my thoughts turn to a paper by Cross et al.

      Cross, F. R., Jackson, R. R., & Taylor, L. A. (2020). Influence of seeing a red face during the male-male encounters of mosquito-specialist spiders. Learning & Behavior, 48, 104-112. doi: 10.3758/s13420-020-00411-y

      These authors found that males of Evarcha culicivora, another salticid species that is known to have a red face, become less responsive to their own mirror images after having their faces painted with black eyeliner than if their faces remained red. In all instances, the spiders only saw their own mirror images and never another spider, and these results cannot be interpreted on the basis of habituation/dishabituation because the spiders were not responding differently when they simply saw their mirror image again. Instead, it was specifically the change to the spider's face which resulted in a change of behavior. The findings from this paper and from Tedore and Johnsen can help give us additional perspectives that the authors might like to consider. On the whole, I would like the authors to further consider the features that P. regius might use to discern and recognize another individual.

    1. Reviewer #2 (Public Review):

      Summary:

      The present article by Tesler et al proposes a 3-population model of the striatum input-output function including the direct pathway (D1) striatal projection neurons (dSPNs), the indirect pathway (D2) striatal projection neurons (iSPNs), and the fast-spiking striatal interneurons. The authors derive a mean-field version of the model where the firing rate of each population follows the transfer function obtained from a spiking (AdEx) neuron model for each cell population. They report the response of the mean-field circuit to oscillatory inputs from the cortex, the effect of dopamine on dSPNs and iSPNs, and how a simple reinforcement learning rule at cortico-striatal synapses would adapt the model's output in the face of 2 distinct inputs.

      Strengths:

      The model is simple and easy to understand.

      Weaknesses:

      Feedforward inhibition from FSI and interconnections between dSPNs and iSPNs does not seem to have any significant impact on the input-output response of dSPNs and iSPNs to cortical inputs. Therefore, all of the results shown can be derived relatively easily from the basic knowledge we have about mean-field neuronal models and their responses to external inputs: all populations have an output that linearly follows the input. Concerning the reinforcement learning paradigm, showing that 2 distinct inputs can be associated with opposite outputs based on a tri-partite synaptic learning rule does not appear new either. As it is, it's unclear to me how this model contributes to new knowledge concerning striatal neuronal activity. Moreover, the assumptions made concerning the effect of dopamine and the synaptic plasticity rules appear rather simplistic and relatively outdated.

      Many of the goals set in the introduction do not appear met:

      "understanding and modelling the complex dynamics and functions of the striatum constitutes a very relevant and challenging task".<br /> I'm not sure if the authors aim to understand and model the complex dynamics of the striatum here: there are no complex dynamics that are revealed or explained in the model, as the dSPNs and iSPNs mainly appear to have a linear relationship to their inputs (with added noise) in 3 for example. I did not find any non-trivial dynamics highlighted in the presentation of the results either.

      "modelling and studying the functions of the striatum and its associated neuronal dynamics requires to investigate these cellular/microcircuits mechanisms, and how the small-scale mechanisms affect large-scale behavior"<br /> I also did not find a statement about the effect of cellular/microcircuit mechanisms on behavior or large-scale activity in the results or discussion. The effects of micro-circuits are rather transparent as dSPNs and iSPNs do not seem to differ from feedforward responses to cortical inputs.

      "existing mean-fields are based on generic models (sometimes inspired by cortical circuits) [7, 8], which do not consider the rich and specific cellular and synaptic variability observed along brain regions."<br /> The authors argue here that specific input-output relationships of striatal neurons may contribute to the circuit dynamics. However, the input-output they derive from a spiking neuron model (AdEx) in Figure 2, are very typical IF curves used in most mean-field models. Apart from a slight saturation effect at large rates (which is incorporated in many mean-field models and may not even be relevant here given the max firing of these cells), the I-F curve looks exactly like what is expected from the most basic rate model neuron with a rectifying transfer function in the presence of synaptic noise. What cellular or synaptic properties would the authors like to highlight here? Linking to molecular and cellular parameters, as advertised in the intro, seems much beyond the current achievements of the present model.

      "This approach permits an efficient transition between scales and, furthermore, it allows to explore the effects of cellular parameters at the network level, as we will show for the case of dopaminergic effects in the striatum."<br /> If the authors mean the excitation of D1 SPNS and the inhibition of D2 SPNs by dopamine, this statement seems slightly oversold. It's very well known that dopaminergic effects cannot simply be resumed by a change in excitability as it acts on non-linear currents and complex synaptic parameters. They model it as follows: "To model these effects of dopamine in dSPN cells we will assume the increase of excitability due to D1 activation in dPSNs can be described as an increase in the glutamatergic conductance (Qe in our model) together with the action of a depolarizing current" Which basically means an additional excitatory input and a depolarizing current. The expected effect on the firing rate of these 2 effects is rather simple and does not require circuit modelling I believe.

      This effect of dopamine is referred to in the discussion as: "This analysis allowed us to show how modifications at the cellular level can be incorporated within the mean-field model which can in turn predict and capture the emergent changes at the network level generated by them, and in addition has provided further validation to our model."<br /> Again, I don't see any emergent property or model validation here. Maybe the authors can be a bit more precise about what emergent property they refer to.

      "In addition it illustrates how changes at the cellular level can lead to emerging effects at the network level, which can be captured by the mean-field model"<br /> I did not find any description of 'emerging effects at the network level" in the results or discussion. Maybe the authors could elaborate on what they mean here.

      "shows the capabilities of the model to reproduce specific brain functions"<br /> The capacity of a network to associate stim A to a positive output and stim B to a negative one through reward-driven synaptic plasticity is rather well described and is a bit far from 'specific brain functions'. Concerning the discussion, it highlights how the model 'could be useful' rather than highlighting any strength of the model or relation to existing work. In particular, the (large) literature on circuit modelling in the striatum and BG circuits is not cited at all beyond self-citations, except in one book chapter (Houk et al, 1995) and one paper (Bogacz, 2020).

      "The RL model proposed can very easily be improved to capture more biologically complex scenarios"<br /> Why did the authors not implement such an 'easy' improvement?

    1. Reviewer #2 (Public Review):

      Summary:

      In the manuscript "Metabolic heterogeneity of colorectal cancer as a prognostic factor: insights gained from fluorescence lifetime imaging" by Komarova et al., the authors used fluorescence lifetime imaging and quantitative analysis to assess the metabolic heterogeneity of colorectal cancer. Generally, this work is logically well-designed, including in vitro and in vivo animal models and ex vivo patient samples. Although the key parameter (BI index) used in this study was already published by this group, it was shown that heterogeneity of patients' samples had associations with clinical characteristics of tumors. Additional samples from 8 patients were added to the data pool during the revision process, which is helpful and important for the conclusions that the authors are trying to draw. Overall, the revisions that the authors have made greatly strengthen this study.

      Strengths:

      (1) Solid experiments are performed and well-organized, including in vitro and in vivo animal models and ex vivo patient samples;

      (2) Attempt and efforts to build the association between the metabolic heterogeneity and prognosis for colorectal cancer.

      Weaknesses:

      (1) Although additional data acquired from 8 patients were collected, maybe more patients should be involved in the future for reliable diagnosis and prognosis.

    1. Reviewer #2 (Public Review):

      This work makes substantial progress towards understanding physical aspects of formation locomotion, notably the hydrodynamic stability of groups of flappers and the modifications to energy costs associated with flow interactions.

      Major strengths pertain to the fact that this topic is timely, interesting and complex, and the authors have advanced the understanding through their characterizations.

      The weaknesses may relate to the many idealizations employed in the simulations and models, which may raise questions about how to interpret their results and whether the outcomes hold generally. But given the complexity of the problem, simplifications are necessary. The authors have certainly provided a clear presentation with appropriate details and caveats that will help the reader extract the main messages and form their own conclusions.

      Overall, the work is a positive addition to the growing set of studies into schooling, flocking and related problems where unsteady flow interactions lead to interesting collective effects.

    1. Reviewer #2 (Public Review):

      A limitation in using SNPs to understand recent histories of genomes is their low mutation frequency. Tellier et al. explore the possibility of adding hypermutable markers to SNP based methods for better resolution over short time frames. In particular, they hypothesize that epimutations (CG methylation and demethylation) could provide a useful marker for this purpose. Individual CGs in Arabidopsis tends to be either close to 100% methylated or close to 0%, and are inherited stably enough across generations that they can be treated as genetic markers. Small regions containing multiple CGs can also be treated as genetic markers based on their cumulative methylation level. In this manuscript, Tellier et al develop computational methods to use CG methylation as a hypermutable genetic marker and test them on theoretical and real data sets. They do this both for individual CGs and small regions. My review is limited to the simple question of whether using CG methylation for this purpose makes sense at a conceptual level, not at the level of evaluating specific details of the methods. I have a small concern in that it is not clear that CG methylation measurements are nearly as binary in other plants and other eukaryotes as they are in Arabidopsis. However, I see no reason why the concept of this work is not conceptually sound. Especially in the future as new sequencing technologies provide both base calling and methylating calling capabilities, using CG methylation in addition to SNPs could become a useful and feasible tool for population genetics in situations where SNPs are insufficient.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Ziegler et al, entitled 'Structural characterization and dynamics of AdhE ultrastructure from Clostridium thermocellum: A containment strategy for toxic intermediates?" presents the atomic resolution cryo-EM structure of C. thermocellum AdhE showing that it show dominantly an extended form while E.coli AdhE shows dominantly a compact form. With comparative analysis of their C. thermocellum structure and the previous E.coli AdhE structure, they tried to reveal the mechanism by which C.thermocellum and E.coli show different dominant conformations. In addition, they also analyzed the substrate channel by comparative and computational approaches. Lastly, their computational analysis using CryoDRGN reveals conformational heterogeneity in the sample. Despite this the manuscript is very descriptive and does not provide a mechanistic understanding by which AdhE works, this work will provide structural frame works to further investigate the function and mechanism of AdhE dynamics.

      Strengths:

      This manuscript provides the first C. thermocellum (Ct) AdhE structure and comparatively analyzed this structure with E.coli AdhE.

      Weaknesses:

      This work is very descriptive and does not provide mechanistic understanding of the function and dynamics of AdhE.

    1. Reviewer #2 (Public Review):

      Summary:

      Peled et al identified HER2 mutations in connection with resistance to the anti-HER2 antibody Pertuzumab-mediated therapy. After constructing a yeast display library of Pertuzumab variants with 3.86×10^11 sequences for targeted screening of variant combinations in chosen 6 out of 14 residues, the authors performed experimental screening to obtain the clones that bind to HER2 WT and/or mutants (S310Y and S310F), and then combined new variations to obtain antibodies with a broad spectrum binding to both WT and two HER2 mutants. These are interesting studies of clinical impact and translational potential.

      Strengths:

      (1) Deep computational analyses of large datasets of clinical data provide useful information about HER2 mutations and their potential relevance to antibody therapy resistance.

      (2) There is valuable information analyzing the residues within or near the interface between the antigen HER2 and the Pertuzumab antibody (heavy chain).<br /> The experimental antibody library screening obtained 90+ clones from 3.86×10^11 sequences for further functional validation.

      Weaknesses:

      (1) There is lack of assessment for antibody variant functions in cancer cell phenotypes in vitro (proliferation, cell death, motility) or in vivo (tumor growth and animal survival). The only assay was the western blotting of phosphopho-HER3 in Figure 4. However, HER2 levels and phosphor-HER2 were not analyzed.

      (2) There is misleading impression from the title of computational engineering of a therapeutic antibody and the statement in the abstract "we designed a multi-specific version of Pertuzumab that retains original function while also bindings these HER2 variants" for a few reasons:

      a. The primary method used for variant antibody identification for HER2 mutant binding is rather traditional experimental screening based on yeast display instead of computational design of a multi-specific version of Pertuzumab.

      b. There is insufficient or lack of computational power in the antibody design or prioritization in choosing variant residues for the library construction of 3.86×1011 sequences. It seems random combinations from 6 residues out of 4 groups with 20 amino acid options.<br /> c. The final version of tri-binding variant is a combination of screened antibody clones instead of computation design from scratch.<br /> d. There is incomplete experimental evidence about the therapeutic values of newly obtained antibody clones.

      Comments on revised version:

      Two major comments remain and have not been well addressed. Comment 1 is expecting any cellular phenotypic analysis if not in vivo. Comment 2 requires some modifications to avoid overstating.

    1. Reviewer #2 (Public Review):

      This manuscript explores the utility of AlphaFold2 (AF2) and the author's own AF2-RAVE method for drug discovery. As has been observed elsewhere, the predictive power of docking against AF2 structures is quite limited, particularly for proteins like kinases that have non-trivial conformational dynamics. However, using enhanced sampling methods like RAVE to explore beyond AF2 starting structures leads to a significant improvement.

      Comments on revised version:

      I'm happy with the changes made.

    1. Reviewer #2 (Public Review):

      Vangl2, a core planar cell polarity protein involved in Wnt/PCP signaling, cell proliferation, differentiation, homeostasis, and cell migration. Vangl2 malfunctioning has been linked to various human ailments, including autoimmune and neoplastic disorders. Interestingly, it was shown that Vangl2 interacts with the autophagy regulator p62, and autophagic degradation limits the activity of inflammatory mediators, such as p65/NF-κB. However, the possible role of Vangl2 in inflammation has not been investigated. In this manuscript, Lu et al. describe that Vangl2 expression is upregulated in human sepsis-associated PBMCs and that Vangl2 mitigates experimental sepsis in mice by negatively regulating p65/NF-κB signaling in myeloid cells. Their mechanistic studies further revealed that Vangl2 recruits the E3 ubiquitin ligase PDLIM2 to promote K63-linked poly-ubiquitination of p65. Vangl2 also facilitated the recognition of ubiquitinated p65 by the cargo receptor NDP52. These molecular processes caused selective autophagic degradation of p65. Indeed, abrogation of PDLIM2 or NDP52 functions rescued p65 from autophagic degradation, leading to extended p65/NF-κB activity in myeloid cells. Overall, the manuscript presents convincing evidence for novel Vangl2-mediated control of inflammatory p65/NF-kB activity. The proposed pathway may expand interventional opportunities restraining aberrant p65/NF-kB activity in human ailments.

      IKK is known to mediate p65 phosphorylation, which instructs NF-kB transcriptional activity. In this manuscript, Vangl2 deficiency led to an increased accumulation of phosphorylated p65 and IKK also at 30 minutes post-LPS stimulation; however, autophagic degradation of p-p65 may not have been initiated at this early time point. Therefore, this set of data put forward the exciting possibility that Vangl2 could also be regulating the immediate early phase of inflammatory response involving the IKK-p65 axis - a proposition that may be tested in future studies.

    1. Reviewer #2 (Public Review):

      Summary:<br /> I believe the authors have done a wonderful job at dissecting a very complex topic, starting with basic building blocks of locomotion and introducing a powerful simulation approach to the exploring the landscape of growth and form in intelligent behavior.

      Strengths:<br /> This is a very original, timely, and robust piece of work that I believe can inspire further computational studies in evo-devo-etho.

      Weaknesses:<br /> More detail on the simulations and also greater clarity regarding the generalizability of their claims would improve the message and further studies.

    1. Reviewer #2 (Public Review):

      Panel 2N and 2O should have been done with and without SCRV treatment, so that the reader can assess whether SCRV induces additional IFN activation (on top of MDA5 and STING autoactivation). I would recommend the authors include a sentence in the text to explain that ectopic expression of MDA5 or STING (i.e. overexpression from a plasmid) induces autoactivation of these proteins. Therefore, the IFN induction that is seen in panel 2N is likely due to MDA5/STING overexpression. SCRV treatment may further boost IFN induction, but this cannot be assessed without the 'mock' conditions. This information will help the readers to interpret Fig. 2N and 2O correctly.

    1. Reviewer #2 (Public Review):

      The authors characterized the activity of the dorsal periaqueductal gray (dPAG) - basolateral amygdala (BLA) circuit. They show that BLA cells that are activated by dPAG stimulation are also more likely to be activated by a robot predator. These same cells are also more likely to display synchronous firing.

      The authors also replicate prior results showing that dPAG stimulation evokes fear and the dPAG is activated by a predator.

      Lastly, the report performs anatomical tracing to show that the dPAG may act on the BLA via the paraventricular thalamus (PVT). Indeed, the PVT receives dPAG projections and also projects to the BLA. However, the authors do not show if the PVT mediates dPAG to BLA communication with any functional behavioral assay.

      The major impact in the field would be to add evidence to their prior work, strengthening the view that the BLA can be downstream of the dPAG.

    1. Reviewer #2 (Public Review):

      Summary:<br /> This work identifies two variants in CAPSL in two generation familial exudative vitreoretinopathy (FEVR) pedigrees, and using a knockout mouse model, they link CAPSL to retinal vascular development and endothelial proliferation through the MYC pathway. Together, these findings suggest that the identified variants may be causative and that CAPSL is a new FEVR-associated gene.

      Strengths:<br /> The authors data provides compelling evidence that loss of the poorly understood protein CAPSL can lead to reduced endothelial proliferation in mouse retina and suppression of MYC signaling, consistent with the disease seen in FEVR patients. The paper is clearly written, and the data generally support the author's hypotheses.

      Weaknesses:<br /> (1) Both pedigrees described suggest autosomal dominant inheritance in humans, but no phenotype was observed in Capsl heterozygous mice. Additional studies would be needed to determine the cause of this disparity.

      (2) Additional discussion of the hypothesized functional mechanism of the p.L83F variant would have improved the manuscript. While the human genetic data is compelling, it remains unclear how this variant may effect CAPSL function. In vitro, p.L83F protein appears to be normally localized within the cell and it is unclear why less mutant protein was detected in transfected cells. Was the modified protein targeted for degradation?

      (3) Authors did not describe how the new crispr-generated Capsl-loxp mouse model was screened for potential off-target gene editing, raising the possibility that unrelated confounding mutations may have been introduced.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In their manuscript, Multi-dimensionality of tree communities structure host-parasitoid networks and their phylogenetic composition, Wang et al. examine the effects of tree diversity and environmental variables on communities of reed-nesting insects and their parasitoids. Additionally, they look for the correlations in community composition and network properties of the two interacting insect guilds. They use a data set collected in a subtropical tree biodiversity experiment over five years of sampling. The authors find that the tree species, functional, and phylogenetic diversity as well as some of the environmental factors have varying impacts on both host and parasitoid communities. Additionally, the communities of the host and parasitoid showed correlations in their structures. Also, the network metrices of the host-parasitoid network showed patterns against environmental variables.

      Strengths:<br /> The main strength of the manuscript lies in the massive long-term data set collected on host-parasitoid interactions. The data provides interesting opportunities to advance our knowledge on the effects of environmental diversity (tree diversity) on the network and community structure of insect hosts and their parasitoids in a relatively poorly known system.

      Weaknesses:<br /> To me, there are no major issues regarding the manuscript, though sometimes I disagree with the interpretation of the results and some of the conclusions might be too far-fetched given the analyses and the results (namely the top-down control in the system). Additionally, the methods section (especially statistics) was lacking some details, but I would not consider it too concerning. Sometimes, the logic of the text could be improved to better support the studied hypotheses throughout the text. Also, the results section cannot be understood as a stand-alone without reading the methods first. The study design and the rationale of the analyses should be described somewhere in the intro or presented with the results.

    1. Reviewer #2 (Public Review):

      Summary:

      This study examines how local DNA features around the amino acid permease gene GAP1 influence adaptation to glutamine-limited conditions through changes in GAP1 Copy Number Variation (CNV). The study is well motivated by the observation of numerous CNVs documented in many organisms, but difficulty in distinguishing the mechanisms by which they are formed, and whether or how local genomic elements influence their formation. The main finding is convincing and is that a nearby Autonomous Replicating Sequence (ARS) influences the formation of GAP1 CNVs and this is consistent with a predominate mechanism of Origin Dependent Inverted Repeat Amplification (ODIRA). These results along with finding and characterizing other mechanisms of GAP1 CNV formation will be of general interest to those studying CNVs in natural systems, experimental evolution, and in tumor evolution. While the results are limited to a single CNV of interest (GAP1), the carefully controlled experimental design and quantification of CNV formation will provide a useful guide to studying other CNVs and CNVs in other organisms.

      Strengths:

      The study was designed to examine the effects of two flanking genomic features next to GAP1 on CNV formation and adaptation during experimental evolution. This was accomplished by removing two Long Terminal Repeats (LTRs), removing a downstream ARS, and removing both LTRs and the ARS. Although there was some heterogeneity among replicates, later shown to include the size and breakpoints of the CNV and the presence of an unmarked CNV, both marker-assisted tracking of CNV formation and modeling of CNV rate and fitness effects showed that deletion of the ARS caused a clear difference compared to the control and the LTR deletion.

      The consequence of deletion of local features (LTR and ARS) was quantified by genome sequencing of adaptive clones to identify the CNV size, copy number and infer the mechanism of CNV formation. This greatly added value to the study as it showed that i) ODIRA was the most common mechanism but ODIRA is enhanced by a local ARS, ii) non-allelic homologous recombination (NAHR) is also used but depends on LTRs, and iii) de novo insertion of transposable elements mediate NAHR in strains with both ARS and LTR deletions. Together, these results show how local features influence the mechanism of CNV formation, but also how alternative mechanisms can substitute when primary ones are unavailable.

      Weaknesses:

      The CNV mutation rate and its effect on fitness are hard to disentangle. The frequency of the amplified GFP provides information about mutation rate differences as well as fitness differences. The data and analysis show that each evolved population has multiple GAP1 CNV lineages within it, with some being unmarked by GFP. Thus, estimates of CNV fitness are more of a composite view of all CNV amplifications increasing in frequency during adaptation. Another unknown but potential complication is whether the local (ARS, LTR) deletions influence GAP1 expression and thus the fitness gain of GAP1 CNVs. The neural network simulation-based inference does a good job at estimating both mutation rates and fitness effects, while also accounting for unmarked CNVs. However, the model does not account for the population heterogeneity of CNVs and their fitness effects. Despite these limitations of distinguishing mutation rate and fitness differences, the authors' conclusions are well supported in that the LTR and ARS deletions have a clear impact on the CNV-mediated evolutionary outcome and the mechanism of CNV formation.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors aim to address the clinical challenge of treating endometriosis, a debilitating condition with limited and often ineffective treatment options. They propose that inhibiting KMO could be a novel non-hormonal therapeutic approach. Their study focuses on:<br /> • Characterising KMO expression in human and mouse endometriosis tissues.<br /> • Investigating the effects of KMO inhibitor KNS898 on inflammation, lesion volume, and pain in a mouse model of endometriosis.<br /> • Demonstrating the efficacy of KMO blockade in improving histological and symptomatic features of endometriosis.

      Strengths:

      • Novelty and Relevance: The study addresses a significant clinical need for better endometriosis treatments and explores a novel therapeutic target.<br /> • Comprehensive Approach: The authors use both human biobanked tissues and a mouse model to study KMO expression and the effects of its inhibition.<br /> • Clear Biochemical Outcomes: The administration of KNS898 reliably induced KMO blockade, leading to measurable biochemical changes (increased kynurenine, increased kynurenic acid, reduced 3-hydroxykynurenine).

      Weaknesses:

      • Limited Mechanistic Insight: The study does not thoroughly investigate the mechanistic pathways through which KNS898 affects endometriosis. Specifically, the local vs. systemic effects of KMO inhibition are not well differentiated.<br /> • Statistical Analysis Issues: The choice of statistical tests (e.g., two-way ANOVA instead of repeated measures ANOVA for behavioral data) may not be the most appropriate, potentially impacting the validity of the results.<br /> • Quantification and Comparisons: There is insufficient quantitative comparison of KMO expression levels between normal endometrium and endometriosis lesions, and the systemic effects of KNS898 are not fully explored or quantified in various tissues.<br /> • Potential Side Effects: The systemic accumulation of kynurenine pathway metabolites raises concerns about potential side effects, which are not addressed in the study.

      Achievement of Aims:

      • The authors successfully demonstrated that KMO is expressed in endometriosis lesions and that KNS898 can induce KMO blockade, leading to biochemical changes and improvements in endometriosis symptoms in a mouse model.

      Support of Conclusions:

      • While the data supports the potential of KMO inhibition as a therapeutic strategy, the conclusions are somewhat overextended given the limitations in mechanistic insights and statistical analysis. The study provides promising initial evidence but requires further exploration to firmly establish the efficacy and safety of KNS898 for endometriosis treatment.

      Impact on the Field:

      • The study introduces a novel therapeutic target for endometriosis, potentially leading to non-hormonal treatment options. If validated, KMO inhibition could significantly impact the management of endometriosis.

      Utility of Methods and Data:

      • The methods used provide a foundation for further research, although they require refinement. The data, while promising, need more rigorous statistical analysis and deeper mechanistic exploration to be fully convincing and useful to the community.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In agriculture, nitrogen fertilizers are used to allow for optimum growth and yield of crops. The use of these fertilizers has a large negative impact on the environment and climate. In this report McMahon et al. have inoculated maize seeds with a nitrogen fixing bacterium: Gluconacetobacter diazotrophicus. It has been demonstrated before that nitrogen fixed by this bacterium can be incorporated in a plant. In this study the spatial distribution of the incorporated nitrogen was revealed using NanoSIMS. The nitrogen was strongly enriched in the chloroplasts and especially the stromal region where the Calvin-Benson cycle enzymes are located.

      Strengths:<br /> The topic is very interesting as nitrogen supply is of great importance for agriculture. The study is well designed, and the data convincingly show enrichment of 15N (fixed by the bacterium) in the chloroplasts.

      Weaknesses:<br /> Some of the data that is discussed is not presented in the (supplement) of the paper. First, in the abstract it is mentioned "help explain the observation of enhanced growth rates in plants containing this nitrogen fixing bacterium". It is unclear if this refers to literature or to this study. Either, it should be mentioned in the introduction, or the data should be shown in the paper. Second, it is mentioned that the chloroplast had a significantly higher nitrogen isotope ratio value compared to the nuclei and the xylem cell walls. Please provide the numbers of the ratios (preferably also an image of the xylem cell wall) and the type of statistical analysis that has been performed.

      The paper could benefit from a more in-depth analysis of why the nitrogen isotope ratio is higher in the chloroplast. It seems to be correlated with the local nitrogen abundance, did the authors plot the two against each other? What would it mean if it is correlated? What minimal nitrogen concentration/signal should there be to make a reliable estimate of the ratio? Does the higher ratio mean that the turnover rate of the Calvin-Benson cycle enzymes is higher than for other proteins?

      For the small structures that could be the nitrogen fixing bacteria the 15N enrichment is up to 270x the natural ratio. Does this mean that 100% (270*0.0036=1) of their nitrogen is fixed from the provided atmosphere?

      Could one also provide the absolute ratio in the chloroplasts? It would be nice if the authors discuss, based on their data, the potential of using nitrogen fixing bacteria to provide nitrogen to crops.

    1. Reviewer #2 (Public Review):

      Fuchs et al. propose a framework for action recognition based on pose estimation. They integrate functions from DeepLabCut and MMAction2, two popular machine-learning frameworks for behavioral analysis, in a new package called ASBAR.

      They test their framework by

      - Running pose estimation experiments on the OpenMonkeyChallenge (OMC) dataset (the public train + val parts) with DeepLabCut.

      - Annotating around 320 image pose data in the PanAf dataset (which contains behavioral annotations). They show that the ResNet-152 model generalizes best from the OMC data to this out-of-domain dataset.

      - They then train a skeleton-based action recognition model on PanAf and show that the top-1/3 accuracy is slightly higher than video-based methods (and strong), but that the mean class accuracy is lower - 33% vs 42%. Likely due to the imbalanced class frequencies. This should be clarified. For Table 1, confidence intervals would also be good (just like for the pose estimation results, where this is done very well).

    1. Reviewer #1 (Public Review):

      This is a very relevant study, clearly with the potential of having a high impact on future research on the evolution of chemical defense mechanisms in animals. The authors present a substantial number of new and surprising experimental results, i.e., the presence in low quantities of alkaloids in amphibians previously deemed to lack these toxins. These data are then combined with literature data to weave the importance of passive accumulation mechanisms into a 4-phases scenario of the evolution of chemical defense in alkaloid-containing poison frogs.

      In general, the new data presented in the manuscript are of high quality and high scientific interest, the suggested scenario compelling, and the discussion thorough. Also, the manuscript has been carefully prepared with a high quality of illustrations and very few typos in the text. Understanding that the majority of dendrobatid frogs, including species considered undefended, can contain low quantities of alkaloids in their skin provides an entirely new perspective to our understanding of how the amazing specializations of poison frogs evolved. Although only a few non-dendrobatids were included in the GCMS alkaloid screening, some of these also included minor quantities of alkaloids, and the capacity of passive alkaloid accumulation may therefore characterize numerous other frog clades, or even amphibians in general.

      While the overall quality of the work is exceptional, major changes in the structure of the submitted manuscript are necessary to make it easier for readers to disentangle scope, hypotheses, evidence and newly developed theories.

    1. Reviewer #2 (Public Review):

      Summary:

      Yamawaki et al., conducted a series of neuroanatomical tracing and whole-cell recording experiments to elucidate and characterise a relatively unknown pathway between the endopiriform (EN) and CA1 of the ventral hippocampus (vCA1) and to assess its functional role in social and object recognition using fibre photometry and dual vector chemogenetics. The main findings were that the EN sends robust projections to the vCA1 that colateralise to the prefrontal cortex, lateral entorhinal cortex, and piriform cortex, and these EN projection neurons terminate in the stratum lacunosum-moleculare (SLM) layer of distal vCA1, synapsing onto GABAergic neurons that span across the Pyramidal-Stratum Radiatum (SR) and SR-SML borders. It was also demonstrated that EN input disynaptically inhibits vCA1 pyramidal neurons. vCA1 projecting EN neurons receive afferent input from the piriform cortex, and from within EN. Finally, fibre photometry experiments revealed that vCA1 projecting EN neurons are most active when mice explore novel objects or conspecifics, and pathway-specific chemogenetic inhibition led to an impairment in the ability to discriminate between novel vs. familiar objects and conspecifics.

      This is an interesting mechanistic study that provides valuable insights into the function and connectivity patterns of afferent input from the endopiriform to the CA1 subfield of the ventral hippocampus. The authors propose that the EN input to the vCA1 interneurons provides a feedforward inhibition mechanism by which novelty detection could be promoted. The experiments appear to be carefully conducted, and the methodological approaches used are sound. The conclusions of the paper are supported by the data presented on the whole.

      However, some aspects of methodology and data interpretation will need to be clarified and further evidence provided to enhance the utility of the data to the rest of the field.

      The authors used dual retrograde tracing and observed that the highest percentage (~30%) of vCA1 projecting EN cells also projected to the PFC. They then employed an intersectional approach to show the presence of collaterals in other cortical areas such as the entorhinal cortex and piriform cortex in addition to the PFC. However, they state that 'Projection to prefrontal cortex was sparse relative to other areas, as expected based on the retrograde labeling data' (referring to Figure 2K) and subsequently appear to dismiss the initial data set indicating strong axonal projections to the PFC.

      Since this is a relatively unknown connection, it would be helpful if some evidence/discussion is provided for whether the EN projects to other subfields (CA3, DG) of the ventral hippocampus. This is important, as the retrograde tracer injections depicted in Figure 1B clearly show a spread of the tracer to vCA3 and potentially vDG and it is not possible to ascertain the regional specificity of the pathway.

      The vCA1 projecting EN cells appear to originate from an extensive range along the AP axis. Is there a topographical organization of these neurons within the vCA1? A detailed mapping of this kind would be valuable.

      Given this extensive range in the location of vCA1 EN originating cells, how were the targets (along the AP axis) in EP selected for the calcium imaging?

      The vCA1 has extensive reciprocal connections with the piriform cortex as well, which is in close proximity to the EN. How certain are the authors that the chemogenetic targeting was specific to the EN-vCA1 connection?

      Raw data for the sociability and discrimination indices should be provided so that the readers can gain further insight into the nature of the impairment.

      Line 222: It is unclear how locomotor activity informs anxiety in the behavioral tests.

      Figure 7 title; It is stated that activity of EN neurons 'predict' social/object discrimination performance. However, caution must be exercised with this interpretation as the correlational data are underpowered (n=5-8). Furthermore, the results show a significant correlation between calcium event ratios and the discrimination index in the social discrimination test but not the object discrimination test.

      While both male and female mice were included in the anatomical tracing and recording experiments, only male mice were used for behavioral tests.

  2. Jul 2024
    1. Reviewer #2 (Public Review):

      Summary:

      The paper considers a recurrent network with neurons driven by external input. During the external stimulation predictive synaptic plasticity adapts the forward and recurrent weights. It is shown that after the presentation of constant stimuli, the network spontaneously samples the states imposed by these stimuli. The probability of sampling stimulus x^(i) is proportional to the relative frequency of presenting stimulus x^(i) among all stimuli i=1,..., 5.

      Methods:

      Neuronal dynamics:

      For the main simulation (Figure 3), the network had 500 neurons, and 5 non-overlapping stimuli with each activating 100 different neurons where presented. The voltage u of the neurons is driven by the forward weights W via input rates x, the inhibitory recurrent weights G, are restricted to have non-negative weights (Dale's law), and the other recurrent weights M had no sign-restrictions. Neurons were spiking with an instantaneous Poisson firing rate, and each spike-triggered an exponentially decaying postsynaptic voltage deflection. Neglecting time constants of the postsynaptic responses, the expected postsynaptic voltage reads (in vectorial form) as

      u = W x + (M - G) f (Eq. 5)

      where f =; phi(u) represents the instantaneous Poisson rate, and phi a sigmoidal nonlinearity. The rate f is only an approximation (symbolized by =;) of phi(u) since an additional regularization variable h enters (taken up in Point 4 below). The initialisation of W and M is Gaussian with mean 0 and variance 1/sqrt(N), N the number of neurons in the network. The initial entries of G are all set to 1/sqrt(N).

      Predictive synaptic plasticity:

      The 3 types of synapses were each adapted so that they individually predict the postsynaptic firing rate f, in matrix form

      ΔW ≈ (f - phi( W x ) ) x^T<br /> ΔM ≈ (f - phi( M f ) ) f^T<br /> ΔG ≈ (f - phi( M f ) ) f^T but confined to non-negative values of G (Dale's law).

      The ^T tells us to take the transpose, and the ≈ again refers to the fact that the ϕ entering in the learning rule is not exactly the ϕ determining the rate, only up to the regularization (see Point 4).

      Main formal result:

      As the authors explain, the forward weight W and the unconstrained weight M develop such that, in expectations,

      f =; phi( W x ) =; phi( M f ) =; phi( G f ) ,

      consistent with the above plasticity rules. Some elements of M remain negative. In this final state, the network displays the behaviour as explained in the summary.

      Major issues:

      Point 1: Conceptual inconsistency

      The main results seem to arise from unilaterally applying Dale's law only to the inhibitory recurrent synapses G, but not to the excitatory recurrent synapses M.

      In fact, if the same non-negativity restriction were also imposed on M (as it is on G), then their learning rules would become identical, likely leading to M=G. But in this case, the network becomes purely forward, u = W x, and no spontaneous recall would arise. Of course, this should be checked in simulations.

      Because Dale's law was only applied to G, however, M and G cannot become equal, and the remaining differences seem to cause the effect.

      Predictive learning rules are certainly powerful, and it is reasonable to consider the same type of error-correcting predictive learning rule, for instance for different dendritic branches that both should predict the somatic activity. Or one may postulate the same type of error-correcting predictive plasticity for inhibitory and excitatory synapses, but then the presynaptic neurons should not be identical, as it is assumed here. Both these types of error-correcting and error-forming learning rules for same-branches and inhibitory/excitatory inputs have been considered already (but with inhibitory input being itself restricted to local input, for instance).

      Point 2: Main result as an artefact of an inconsistently applied Dale's law?

      The main result shows that the probability of a spontaneous recall for the 5 non-overlapping stimuli is proportional to the relative time the stimulus was presented. This is roughly explained as follows: each stimulus pushes the activity from 0 up towards f =; phi( W x ) by the learning rule (roughly). Because the mean weights W are initialized to 0, a stimulus that is presented longer will have more time to push W up so that positive firing rates are reached (assuming x is non-negative). The recurrent weights M learn to reproduce these firing rates too, while the plasticity in G tries to prevent that (by its negative sign, but with the restriction to non-negative values). Stimuli that are presented more often, on average, will have more time to reach the positive target and hence will form a stronger and wider attractor. In spontaneous recall, the size of the attractor reflects the time of the stimulus presentation. This mechanism so far is fine, but the only problem is that it is based on restricting G, but not M, to non-negative values.

      Point 3: Comparison of rates between stimulation and recall.

      The firing rates with external stimulations will be considerably larger than during replay (unless the rates are saturated).

      This is a prediction that should be tested in simulations. In fact, since the voltage roughly reads as<br /> u = W x + (M - G) f,<br /> and the learning rules are such that eventually M =; G, the recurrences roughly cancel and the voltage is mainly driven by the external input x. In the state of spontaneous activity without external drive, one has<br /> u = (M - G) f ,<br /> and this should generate considerably smaller instantaneous rates f =; phi(u) than in the case of the feedforward drive (unless f is in both cases at the upper or lower ceiling of phi). This is a prediction that can also be tested.

      Because the figures mostly show activity ratios or normalized activities, it was not possible for me to check this hypothesis with the current figures. So please show non-normalized activities for comparing stimulation and recall for the same patterns.

      Point 4: Unclear definition of the variable h.<br /> The formal definition of h = hi is given by (suppressing here the neuron index i and the h-index of tau)

      tau dh/dt = -h if h>u, (Eq. 10)<br /> h = u otherwise.

      But if it is only Equation 10 (nothing else is said), h will always become equal to u, or will vanish, i.e. either h=u or h=0 after some initial transient. In fact, as soon as h>u, h is decaying to 0 according to the first line. If u is >0, then it stops at u=h according to the second line. No reason to change h=u further. If u<=0 while h>u, then h is converging to 0 according to the first line and will stay there. I guess the authors had issues with the recurrent spiking simulations and tried to fix this with some regularization. However as presented, it does not become clear how their regulation works.

      BTW: In Eq. 11 the authors set the gain beta to beta = beta0/h which could become infinite and, putatively more problematic, negative, depending on the value of h. Maybe some remark would convince a reader that no issues emerge from this.

      Added from discussions with the editor and the other reviewers:

      Thanks for alerting me to this Supplementary Figure 8. Yes, it looks like the authors did apply there Dale's law for both the excitatory and inhibitory synapses. Yet, they also introduced two types of inhibitory pathways converging both to the excitatory and inhibitory neurons. For me, this is a confirmation that applying Dale's law to both excitatory and inhibitory synapses, with identical learning rules as explained in the main part of the paper, does not work.

      Adding such two pathways is a strong change from the original model as introduced before, and based on which all the Figures in the main text are based. Supplementary Figure 8 should come with an analysis of why a single inhibitory pathway does not work. I guess I gave the reason in my Points 1-3. Some form of symmetry breaking between the recurrent excitation and recurrent inhibition is required so that, eventually, the recurrent excitatory connection will dominate.

      Making the inhibitory plasticity less expressive by applying Dale's law to only those inhibitory synapses seems to be the answer chosen in the Figures of the main text (but then the criticism of unilaterally applying Dale's law).

      Applying Dale's law to both types of synapses, but dividing the labor of inhibition into two strictly separate and asymmetric pathways, and hence asymmetric development of excitatory and inhibitory weights, seems to be another option. However, introducing such two separate inhibitory pathways, just to rescue the fact that Dale's law is applied to both types of synapses, is a bold assumption. Is there some biological evidence of such two pathways in the inhibitory, but not the excitatory connections? And what is the computational reasoning to have such a separation, apart from some form of symmetry breaking between excitation and inhibition? I guess, simpler solutions could be found, for instance by breaking the symmetry between the plasticity rules for the excitatory and inhibitory neurons. All these questions, in my view, need to be addressed to give some insights into why the simulations do work.

      Overall, Supplementary Figure 8 seems to me too important to be deferred to the Supplement. The reasoning behind the two inhibitory pathways should appear more prominently in the main text. Without this, important questions remain. For instance, when thinking in a rate-based framework, the two inhibitory pathways twice try to explain the somatic firing rate away. Doesn't this lead to a too strong inhibition? Can some steady state with a positive firing rate caused by the recurrence, in the absence of an external drive, be proven? The argument must include the separation into Path 1 and Path 2. So far, this reasoning has not been entered.

      In fact, it might be that, in a spiking implementation, some sparse spikes will survive. I wonder whether at least some of these spikes survive because of the other rescuing construction with the dynamic variable h (Equation 10, which is not transparent, and that is not taken up in the reasoning either, see my Point 4).

      Perhaps it is helpful for the authors to add this text in the reply to them.

    1. Reviewer #3 (Public Review):

      Summary: The authors investigate the effect of high concentrations of the lipid aldehyde trans-2-hexadecenal (t-2-hex) in a yeast deletion strain lacking the detoxification enzyme. Transcriptomic analyses as global read out reveal that a large range of cellular functions across all compartments are affected (transcriptomic changes affect 1/3 of all genes). The authors provide additional analyses, from which they built a model that mitochondrial protein import caused by modification of Tom40 is blocked.

      Strengths:<br /> Global analyses (transcriptomic and functional genomics approach) to obtain an overview of changes upon yeast treatment with high doses of t-2-hex.

      Weaknesses:<br /> The use of high concentrations of t-2-hex in combination with a deletion of the detoxifying enzyme Hfd1 limits the possibility to identify physiological relevant changes. From the hundreds of identified targets the authors focus on mitochondrial proteins, which are not clearly comprehensible from the data. The main claim of the manuscript that t-2-hex targets the TOM complex and inhibits mitochondrial protein import is not supported by experimental data as import was not experimentally investigated. The observed accumulation of precursor proteins could have many other reasons (e.g. dissipation of membrane potential, defects in mitochondrial presequence proteases, defects in cytosolic chaperones, modification of mitochondrial precursors by t-2-hex rendering them aggregation prone and thus non-import competent). However, none of these alternative explanations have been experimentally addressed or discussed in the manuscript.<br /> Furthermore, many of the results have been reported before (interaction of Tom22 and Tom70 with Hfd1) or observed before (TOM40 as target of t-2-hex in human cells).

    1. Reviewer #3 (Public Review):

      Summary:

      In this manuscript, the authors extend previous work on the role of predator interference in species coexistence. Previous theoretical work (for example, using the Beddington-DeAngelis model) has shown that predator interference allows for multiple predators to coexist on the same prey. While the Beddington-DeAngelis has been influential in theoretical ecology, it has also been criticized at times for several unusual assumptions, most critically, that predators interfere with each other regardless of whether they are already engaged in another interaction. There has been considerable work since then which has sought either to find sets of assumptions that lead to the B-D equation or to derive alternative equations from a more realistic set of assumptions (Ruxton et al. 1992; Cosner et al. 1999; Broom et al. 2010; Geritz and Gyllenberg 2012). This paper represents another effort to more rigorously derive a model of predator interference by borrowing concepts from chemical reaction kinetics (the approach is similar to previous work: Ruxton et al. 1992). The main point of difference is that the model in the current manuscript allows for 'chasing pairs', where a predator and prey engage with one another to the exclusion of other interactions, a situation Ruxton et al. (1992) do not consider. While the resulting functional response is quite complex, the authors show that under certain conditions, one can get an analytical expression for the functional response of a predator as a function of predator and resource densities. They then go on to show that including intraspecific interference allows for the coexistence of multiple species on one or a few resources, and demonstrate that this result is robust to demographic stochasticity. This work provides additional support for the idea that predator interference allows multiple predators to persist with a shared resource.

      Strengths:

      I appreciate the effort to rigorously derive interaction rates from models of individual behaviors. As currently applied, functional responses (FRs) are estimated by fitting equations to feeding rate data across a range of prey or predator densities. In practice, such experiments are only possible for a limited set of species. This is problematic because whether a particular FR allows stability or coexistence depends on not just its functional form, but also its parameter values. The promise of the approach taken here is that one might be able to derive the functional response parameters of a particular predator species from species traits or more readily measurable behavioural data.

      Weaknesses:

      The main weakness of this paper is that while it is technically sound, it doesn't change the fundamental intuition gained from more phenomenological models of predator interference: as one species becomes more common, it limits its own growth (manifested by less time spent searching for/handing resources due to interference), such that it does not exclude the existence of a competitor species. However, given the authors use a different model formulation that has been used in past studies, it suggests that predator interference will likely tend to promote coexistence regardless of some of the technical details in how it is formulated in a model.

      The formulation of chasing-pair engagements assumes that prey being chased by a predator are unavailable to other predators. While this may hold in some predator-prey, it does not hold for many others, perhaps limiting some results' generality.

      Summary:

      The manuscript by Kang et al investigates how the consideration of pairwise encounters (consumer-resource chasing, intraspecific consumer pair, and interspecific consumer pair) influences the community assembly results. To explore this, they presented a new model that considers pairwise encounters and intraspecific interference among consumer individuals, which is an extension of the classical Beddington-DeAngelis (B-D) phenomenological model, incorporating detailed considerations of pairwise encounters and intraspecific interference among consumer individuals. Later, they connected with several experimental datasets.

      Strengths:

      They found that the negative feedback loop created by the intraspecific interference allows a diverse range of consumer species to coexist with only one or a few types of resources. Additionally, they showed that some patterns of their model agree with experimental data, including time-series trajectories of two small in-lab community experiments and the rank-abundance curves from several natural communities. The presented results here are interesting and present another way to explain how the community overcomes the competitive exclusion principle.

      Weaknesses:

      The authors did a great job of satisfactorily addressing each of my concerns raised in the previous round. I did not detect additional weaknesses.

    1. Reviewer #2 (Public Review):

      The neural dynamics underlying decision-making have long been studied across different species (e.g., primates and rodents) and brain areas (e.g., parietal cortex, frontal eye fields, striatum). The key question is to what extent neural firing rates covary with evidence accumulation processes as proposed by evidence accumulation models. It is often assumed that the evidence-accumulation process at the neural level should mirror the evidence-accumulation process at the behavioral level. The current paper shows that the neural dynamics of three rat brain regions (the FOF, ADS, and PCC) all show signatures of evidence accumulation, but in distinct ways. Especially the role of the FOF appears to be distinct, due to its dependence on early evidence compared to the other regions. This sheds new light and a new interpretation of the role of the FOF in decision-making - previously, it has been described as a region encoding the choice that is currently being committed to; this new analysis suggests it is instead strongly influenced by early evidence.

      A major strength of the paper is that the results are achieved through joint modelling of the behavioral and neural data, combined with information on the physical stimulus at hand. Joint models were shown to provide more information on the underlying processes compared to behavioral or neural models alone. Especially the inclusion of the neural data seemed to have greatly improved the quality of inferences. This is a key contribution that illustrates that the sophisticated modelling of multiple sources of data at the same time, pays off in terms of the quality of inferences. Yet, it should be added here, that due to the nature of the task, the behavioral data contained only choices, and not response times, which tend to contain more information regarding the evidence accumulation process than choice alone. It would be interesting to additionally discuss how choice decision times can be modeled with the proposed modelling framework.

      A main limitation of the paper is that it does not appear to address a seemingly logical follow-up question: If these three brain regions individually accumulate evidence in distinct manners, how do these multiple brain regions then each contribute to a final choice? The joint models fit each region's data separately, so how well does each region individually 'explain' or 'predict' behavior, and how does the combined neural activity of the regions lead to manifest behavior? I would be very interested in the authors' perspectives on these questions.

      There are some remaining questions regarding the specific models used, that I was hoping the authors could clarify. Specifically, in equations 10-11, I was wondering to what extent there might be a collinearity issue. Equation 10 proposes that the firing rates of neurons can vary across time due to two mechanisms: (1) The dependence of the firing rate on the accumulated evidence, and (2) a time-varying trial average (as detailed in Equation 11). If firing rates of the neuron indeed covary with the accumulated evidence and therefore increase across time, how can the effects of mechanisms 1 and 2 be disentangled? Relatedly, the independent noise models model each neuron separately and thereby include many more parameters, each informed by less data. Is it possible that the relatively poor cross-validation of the independent noise model may be a consequence of the overfitting of the independent noise model?<br /> Another related question is how robust the parameter recovery properties of these models are under a wider range of data-generating parameter settings. I greatly appreciate the inclusion of a parameter recovery study (Figure S1C) using a single synthetic dataset, but it could be made even stronger by simulating multiple datasets with a wider range of parameter settings. Such a simulation study would help understand how robust and reliable the estimated parameters of all models are. Similarly, it would be helpful if also the \theta_{y} parameters are shown, which aren't shown in Figure S1C.

      An aspect of the paper that initially raised confusion with me is that the models fit on the choice data and stimulus information alone, make different predictions for the evidence accumulation dynamics in different regions (e.g., Figure 5A, 6A) and also led to different best-fitting parameters in different regions (Figure S9A). It took me a while to realize that this is due to the data being pooled across different rats and sessions - as such, the behavioral choice data are not the same across regions, and neither is the resulting fit models. This could easily be clarified by adding a few notes in the captions of the relevant figures.

      Combined, this manuscript represents an interesting and welcome contribution to an ongoing debate on the neural dynamics of decision-making across different brain regions. It also introduced new joint modelling techniques that can be used in the field and raised new questions on how the concurrent activity of neurons across different brain regions combined leads to behavior.

    1. Reviewer #2 (Public Review):

      Summary:

      Schmidlin & Apodaca et al. aim to distinguish mutants that resist drugs via different mechanisms by examining fitness tradeoffs across hundreds of fluconazole-resistant yeast strains. They barcoded a collection of fluconazole-resistant isolates and evolved them in different environments with a view to having relevance for evolutionary theory, medicine, and genotype-phenotype mapping.

      Strengths:

      There are multiple strengths to this paper, the first of which is pointing out how much work has gone into it; the quality of the experiments (the thought process, the data, the figures) is excellent. Here, the authors seek to induce mutations in multiple environments, which is a really large-scale task. I particularly like the attention paid to isolates with are resistant to low concentrations of FLU. So often these are overlooked in favour of those conferring MIC values >64/128 etc. What was seen is different genotype and fitness profiles. I think there's a wealth of information here that will actually be of interest to more than just the fields mentioned (evolutionary medicine/theory).

      Weaknesses:

      Not picking up low fitness lineages - which the authors discuss and provide a rationale as to why. I can completely see how this has occurred during this research, and whilst it is a shame I do not think this takes away from the findings of this paper. Maybe in the next one!

      In the abstract the authors focus on 'tradeoffs' yet in the discussion they say the purpose of the study is to see how many different mechanisms of FLU resistance may exist (lines 679-680), followed up by "We distinguish mutants that likely act via different mechanisms by identifying those with different fitness tradeoffs across 12 environments". Whilst I do see their point, and this is entirely feasible, I would like a bit more explanation around this (perhaps in the intro) to help lay-readers make this jump. The remainder of my comments on 'weaknesses' are relatively fixable, I think:

      In the introduction I struggle to see how this body of research fits in with the current literature, as the literature cited is a hodge-podge of bacterial and fungal evolution studies, which are very different! So example, the authors state "previous work suggests that mutants with different fitness tradeoffs may affect fitness through different molecular mechanisms" (lines 129-131) and then cite three papers, only one of which is a fungal research output. However, the next sentence focuses solely on literature from fungal research. Citing bacterial work as a foundation is fine, but as you're using yeast for this I think tailoring the introduction more to what is and isn't known in fungi would be more appropriate. It would also be great to then circle back around and mention monotherapy vs combination drug therapy for fungal infections as a rationale for this study. The study seems to be focused on FLU-resistant mutants, which is the first-line drug of choice, but many (yeast) infections have acquired resistance to this and combination therapy is the norm.

      Methods: Line 769 - which yeast? I haven't even seen mention of which species is being used in this study; different yeast employ different mechanisms of adaptation for resistance, so could greatly impact the results seen. This could help with some background context if the species is mentioned (although I assume S. cerevisiae). In which case, should aneuploidy be considered as a mechanism? This is mentioned briefly on line 556, but with all the sequencing data acquired this could be checked quickly?

      I think the authors could be bolder and try and link this to other (pathogenic) yeasts. What are the implications of this work on say, Candida infections?

    1. Reviewer #2 (Public Review):

      In this work, Kashefi et al. investigate the planning of sequential reaching movements and how the additional information about future reaches affects planning and execution. This study, carried out with human subjects, extends a body of research in sequential movements to ask important questions: How many future reaches can you plan in advance? And how do those future plans interact with each other?

      The authors designed several experiments to address these questions, finding that information about future targets makes reaches more efficient in both timing and path curvature. Further, with some clever target jump manipulations, the authors show that plans for a distant future reach can influence plans for a near future reach, suggesting that the planning for multiple future reaches is not independent. Lastly, the authors show that information about future targets is acquired parafoveally--that is, subjects tend to fixate mainly on the target they are about to reach to, acquiring future target information by paying attention to targets outside the fixation point.

      The study opens up exciting questions about how this kind of multi-target planning is implemented in the brain. As the authors note in the manuscript, previous work in monkeys showed that preparatory neural activity for a future reaching movement can occur simultaneously with a current reaching movement, but that study was limited to the monkey only knowing about two future targets. It would be quite interesting to see how neural activity partitions preparatory activity for a third future target, given that this study shows that the third target's planning may interact with the second target's planning.

      [Editors' note: The authors fully addressed the reviewers' comments on the original manuscript.]

    1. Reviewer #2 (Public Review):

      Summary:

      Numerous studies by the authors and other groups have demonstrated an important role for HIV gene expression kidney cells in promoting progressive chronic kidney disease, especially HIV associated nephropathy. The authors had previously demonstrated a role for protein kinase R (PKR) in a non-HIV transgenic model of kidney disease (Okamoto, Commun Bio, 2021). In this study, the authors used innovative techniques including bulk and single nuclear RNAseq to demonstrate that mice expressing a replication-incompetent HIV transgene have prominent dysregulation of mitochondrial gene expression and activation of PKR and that treatment of these mice with a small molecule PKR inhibitor ameliorated the kidney disease phenotype in HIV-transgenic mice. They also identified STAT3 as a key upstream regulator of kidney injury in this model, which is consistent with previously published studies. Other important advances include identifying the kidney cell types that express the HIV transgene and have dysregulation of cellular pathways.

      Strengths:

      Major strengths of the study include the use of a wide variety of state-of-the-art molecular techniques to generate important new data on the pathogenesis of kidney injury in this commonly used model of kidney disease and the identification of PKR as a potential druggable target for the treatment of HIV-induced kidney disease. The authors also identify a potential novel cell type within the kidney characterized by high expression of mitochondrial genes.

      Weaknesses:

      Though the HIV-transgenic model used in these studies results in a phenotype that is very similar to HIV-associated nephropathy in humans, the model has several limitations that may prevent direct translation to human disease, including the fact that mice lack several genetic factors that are important contributors to HIV and kidney pathogenesis in humans. Additional studies are therefore needed to confirm these findings in human kidney disease.

    1. Reviewer #2 (Public Review):

      Summary:

      Most polymerases and nucleases use two or three divalent metal ions in their catalytic functions. The family of His-Me nucleases, however, use only one divalent metal ion, along with a conserved histidine, to catalyze DNA hydrolysis. The mechanism has been studied previously but, according to the authors, it remained unclear. By use of time resolved X-ray crystallography, this work convincingly demonstrated that only one M2+ ion is involved in the catalysis of the His-Me I-PpoI 19 nuclease, and proposed concerted functions of the metal and the histidine.

      Strengths:

      This work performs mechanistic studies, including the number and roles of metal ion, pH dependence, and activation mechanism, all by structural analyses, coupled with some kinetics and mutagenesis. Overall, it is a highly rigorous work. This approach was first developed in Science (2016) for a DNA polymerase, in which Yang Cao was the first author. It has subsequently been applied to just 5 to 10 enzymes by different labs, mainly to clarify two versus three metal ion mechanisms. The present study is the first one to demonstrate a single metal ion mechanism by this approach.<br /> Furthermore, on the basis of the quantitative correlation between the fraction of metal ion binding and the formation of product, as well as the pH dependence, and the data from site specific mutants, the authors concluded that the functions of Mg2+ and His are a concerted process. A detailed mechanism is proposed in Figure 6.<br /> Even though there are no major surprises in the results and conclusions, the time-resolved structural approach and the overall quality of the results represent a significant step forward for the Me-His family of nucleases. In addition, since the mechanism is unique among different classes of nucleases and polymerases, the work should be of interest to readers in DNA enzymology, or even mechanistic enzymology in general.

      Weaknesses:

      Two relatively minor issues are raised here for consideration by the authors:

      p. 4, last para, lines 1-2: "we next visualized the entire reaction process by soaking I-PpoI crystals in buffer....". This is a little over-stated. The structures being observed are not reaction intermediates. They are mixtures of substrates and products in the enzyme-bound state. The progress of the reaction is limited by the progress of soaking of the metal ion. Crystallography is just been used as a tool to monitor the reaction (and provide structural information about the product). It would be more accurate to say that "we next monitored the reaction progress by soaking...."

      p. 5, beginning of the section. The authors on one hand emphasized the quantitative correlation between Mg ion density and the product density. On the other hand, they raised the uncertainty in the quantitation of Mg2+ density versus Na+ density, thus they repeated the study with Mn2+ which has distinct anomalous signals. This is a very good approach. However, still no metal ion density is shown in the key figure 2A. It will be clearer to show the progress of metal ion density in a figure (in addition to just plots), whether it is Mg or Mn.

      Revised version: The authors have properly revised the paper in response to both questions raised in the weakness section. The first issue is an important clarification for others working on similar approaches also. For the second issue, the metal ion density is nicely shown in Fig. S4 now.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript entitled "Decoupling of the Onset of Anharmonicity between a Protein and Its Surface Water around 200 K" by Zheng et al. presents a neutron scattering study trying to elucidate if at the dynamical transition temperature water and protein motions are coupled. The origin of the dynamical transition temperature has been debated for decades, specifically its relation to hydration.

      The study is rather well conducted, with a lot of effort to acquire the perdeuterated proteins, and some results are interesting.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The manuscript by Zhu et al. describes phenotypes associated with the loss of the gene ifc using a Drosophila model. The authors suggest their findings are relevant to understanding the molecular underpinnings of a neurodegenerative disorder, HLD-18, which is caused by mutations in the human ortholog of ifc, DEGS1.<br /> The work begins with the authors describing the role for ifc during fly larval brain development, demonstrating its function in regulating developmental timing, brain size, and ventral nerve cord elongation. Further mechanistic examination revealed that loss of ifc leads to depleted cellular ceramide levels as well as dihydroceramide accumulation, eventually causing defects in ER morphology and function. Importantly, the authors showed that ifc is predominantly expressed in glia and is critical for maintaining appropriate glial cell numbers and morphology. Many of the key phenotypes caused by the loss of fly ifc can be rescued by overexpression of human DEGS1 in glia, demonstrating the conserved nature of these proteins as well as the pathways they regulate. Interestingly, the authors discovered that the loss of lipid droplet formation in ifc mutant larvae within the cortex glia, presumably driving the deficits in glial wrapping around axons and subsequent neurodegeneration, potentially shedding light on mechanisms of HLD-18 and related disorders.

      Strengths:<br /> Overall, the manuscript is thorough in its analysis of ifc function and mechanism. The data images are high quality, the experiments are well controlled, and the writing is clear.

      Weaknesses:<br /> (1) The authors clearly demonstrated a reduction in number of glia in the larval brains of ifc mutant flies. What remains unclear is whether ifc loss leads to glial apoptosis or a failure for glia to proliferate during development. The authors should distinguish between these two hypotheses using apoptotic markers and cell proliferation markers in glia.

      (2) It is surprising that human DEGS1 expression in glia rescues the noted phenotypes despite the different preference for sphingoid backbone between flies and mammals. Though human DEGS1 rescued the glial phenotypes described, can animal lethality be rescued by glial expression of human DEGS1? Are there longer-term effects of loss of ifc that cannot be compensated by the overexpression of human DEGS1 in glia (age-dependent neurodegeneration, etc.)?

      (3) The mechanistic link between the loss of ifc and lipid droplet defects is missing. How do defects in ceramide metabolism alter triglyceride utilization and storage? While the author's argument that the loss of lipid droplets in larval glia will lead to defects in neuronal ensheathment, a discussion of how this is linked to ceramides needs to be added.

      (4) On page 10, the authors use the words "strong" and "weak" to describe where ifc is expressed. Since the use of T2A-GAL4 alleles in examining gene expression is unable to delineate the amount of gene expression from a locus, the terms "broad" and "sparse" labeling (or similar terms) should be used instead.

    1. Reviewer #2 (Public Review):

      Summary:

      This theoretical paper examines genetic drift in scenarios deviating from the standard Wright-Fisher model. The authors discuss Haldane's branching process model, highlighting that the variance in reproductive success equates to genetic drift. By integrating the Wright-Fisher model with the Haldane model, the authors derive theoretical results that resolve paradoxes related to effective population size.

      Strengths:

      The most significant and compelling result from this paper is perhaps that the probability of fixing a new beneficial mutation is 2s/V(K). This is an intriguing and potentially generalizable discovery that could be applied to many different study systems.

      The authors also made a lot of effort to connect theory with various real-world examples, such as genetic diversity in sex chromosomes and reproductive variance across different species.

      Weaknesses:

      One way to define effective population size is by the inverse of the coalescent rate. This is where the geometric mean of Ne comes from. If Ne is defined this way, many of the paradoxes mentioned seem to resolve naturally. If we take this approach, one could easily show that a large N population can still have a low coalescent rate depending on the reproduction model. However, the authors did not discuss Ne in light of the coalescent theory. This is surprising given that Eldon and Wakeley's 2006 paper is cited in the introduction, and the multiple mergers coalescent was introduced to explain the discrepancy between census size and effective population size, superspreaders, and reproduction variance - that said, there is no explicit discussion or introduction of the multiple mergers coalescent.

      The Wright-Fisher model is often treated as a special case of the Cannings 1974 model, which incorporates the variance in reproductive success. This model should be discussed. It is unclear to me whether the results here have to be explained by the newly introduced WFH model, or could have been explained by the existing Cannings model.

      The abstract makes it difficult to discern the main focus of the paper. It spends most of the space introducing "paradoxes".

      The standard Wright-Fisher model makes several assumptions, including hermaphroditism, non-overlapping generations, random mating, and no selection. It will be more helpful to clarify which assumptions are being violated in each tested scenario, as V(K) is often not the only assumption being violated. For example, the logistic growth model assumes no cell death at the exponential growth phase, so it also violates the assumption about non-overlapping generations.

      The theory and data regarding sex chromosomes do not align. The fact that \hat{alpha'} can be negative does not make sense. The authors claim that a negative \hat{alpha'} is equivalent to infinity, but why is that? It is also unclear how theta is defined. It seems to me that one should take the first principle approach e.g., define theta as pairwise genetic diversity, and start with deriving the expected pair-wise coalescence time under the MMC model, rather than starting with assuming theta = 4Neu. Overall, the theory in this section is not well supported by the data, and the explanation is insufficient.

    1. Reviewer #2 (Public Review):

      The study presented by Paoli et al. explores temporal aspects of neuronal encoding of odors and their perception, using bees as a general model for insects. The neuronal encoding of the presence of an odor is not a static representation; rather, its neuronal representation is partly encoded by the temporal order in which parallel olfactory pathways participate and are combined. This aspect is not novel, and its relevance in odor encoding and recognition has been discussed for more than the past 20 years.

      The temporal richness of the olfactory code and its significance have traditionally been driven by results obtained based on electrophysiological methods with temporal resolution, allowing the identification and timing of the action potentials in the different populations of neurons whose combination encodes the identity of an odor. On the other hand, optophysiological methods that enable spatial resolution and cell identification in odor coding lack the temporal resolution to appreciate the intricacies of olfactory code dynamics.

      (1) In this context, the main merit of Paoli et al.'s work is achieving an optical recording that allows for spatial registration of olfactory codes with greater temporal detail than the classical method and, at the same time, with greater sensitivity to measure inhibitions as part of the olfactory code.

      The work clearly demonstrates how the onset and offset of odor stimulation triggers a dynamic code at the level of the first interneurons of the olfactory system that changes at every moment as a natural consequence of the local inhibitory interactions within the first olfactory neuropil, the antennal lobe. This gives rise to the interesting theory that each combination of activated neurons along this temporal sequence corresponds to the perception of a different odor. The extent to which the corresponding postsynaptic layers integrate this temporal information to drive the perception of an odor, or whether this sequence is, in a sense, a journey through different perceptions, is challenging to address experimentally.

      In their work, the authors propose a computational approach and olfactory learning experiments in bees to address these questions and evaluate whether the sequence of combinations drives a sequence of different perceptions. In my view, it is a highly inspiring piece of work that still leaves several questions unanswered.

      (2) In my opinion, the detailed temporal profile of the response of projection neurons and their respective probabilities of occurrence provide valuable information for understanding odor coding at the level of neurons transferring information from the antennal lobes to the mushroom bodies. An analysis of these probabilities in each animal, rather than in the population of animals that were measured, would aid in better comprehending the encoding function of such temporal profiles. Being able to identify the involved glomeruli and understanding the extent to which the sequence of patterns and inhibitions is conserved for each odor across different animals, as it is well known for the initial excitatory burst of activity observed in previous studies without the fine temporal detail, would also be highly significant.

      In my view, the computational approach serves as a useful tool to inspire future experiments; however, it appears somewhat simplistic in tackling the complexity of the subject. One question that I believe the researchers do not address is to what extent the inhibitions recorded in the projection neurons are integrated by the Kenyon cells and are functional for generating odor-specific patterns at that level.

      Lastly, the behavioral result indicating a difference in conditioned response latency after early or delayed learning protocol is interesting. However, it does not align with the expected time for the neuronal representation that was theoretically rewarded in the delayed protocol. This final result does not support the authors' interpretation regarding the existence of a smell and an after-smell as separate percepts that can serve as conditioned stimuli.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In "Speech-induced suppression and vocal feedback sensitivity in human cortex", Ozker and colleagues use intracranial EEG to understand audiomotor feedback during speech production using a speech production and delayed auditory feedback task. The purpose of the paper is to understand where and how speaker induced suppression occurs, and whether this suppression might be related to feedback monitoring. First, they identified sites that showed auditory suppression during speech production using a single word auditory repetition task and a visual reading task, then observed whether and how these electrodes show sensitivity to auditory feedback using a DAF paradigm. The stimuli were single words played auditorily or shown visually and repeated or read aloud by the participant. Neural data were recorded from regular- and high-density grids from the left and right hemisphere. The main findings were:<br /> • Speaker induced suppression is strongest in the STG and MTG, and enhancement is generally seen in frontal/motor areas except for small regions of interest in dorsal sensorimotor cortex and IFG, which can also show suppression.<br /> • Delayed auditory feedback, even when simultaneous, induces larger response amplitudes compared to the typical auditory word repetition and visual reading tasks. The authors presume this may be due to effort and attention required to perform the DAF task.<br /> • The degree of speaker induced suppression is correlated with sensitivity to delayed auditory feedback, and is strongest for ~200 ms of delayed auditory feedback.<br /> • pSTG (behind TTS) is more strongly modulated by DAF than mid-anterior STG

      Strengths:<br /> Overall, I found the manuscript to be clear, the methodology and statistics to be solid, and the findings mostly quite robust. The large number of participants with high density coverage over both the left and right lateral hemispheres allows for a greater dissection of the topography of speaker induced suppression and changes due to audiomotor feedback. The tasks were well-designed and controlled for repetition suppression and other potential caveats.

      Weaknesses:<br /> I am happy with the changes the authors made in response to my first round of comments.

      The authors addressed my comments relating to plotting relative to the onset of articulation in Figure 1 and also addressed whether the amount of suppression varies according to more interfering delayed auditory feedback (though the correlations between sensitivity and suppression are a little noisy, they are positive). Finally, I am also satisfied with the inclusion of more group data in Figure 4.

    1. Reviewer #2 (Public Review):

      Summary:

      The study tries to connect energy metabolism with immune tolerance during bacterial infection. The mechanism details the role of pyruvate transporter expression via ERRalpha-PGC1 axis, resulting in pro-inflammatory TNF alpha signalling responsible for acquired infection tolerance.

      Strengths:

      Overall, the study is an excellent addition to the role of energy metabolism during bacterial infection. The mechanism-based approach in dissecting the roles of metabolic coactivator, transcription factor, mitochondrial transporter and pro-inflammatory cytokine during acquired tolerance towards infections indicates a detailed and well-written study. The in vivo studies in mice nicely corroborate with the cell line-based data, indicating the requirement for further studies in human infections with another bacterial model system.

      Weakness:

      Revised version doesn't have much weakness as authors have performed some of the critical experiments to answer the concerns. Moreover, authors promted that a few concerns like public data sets, etc are out of scope of this work or they will perform such experiments in future.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors investigated how neuronal activity and metrics of plasticity using local electrical stimulation in the GPi were different between Parkinson's disease and dystonia patients.

      Strengths:

      The authors achieved their aims of comparing the dynamics related to stimulation induced metrics of plasticity in GPi between dystonia and PD, which has not been previously explored. These results could directly inform DBS protocols to improve treatment. The methods are clearly described and results are strong with measurements from a large population of patients for each disease group, and with distinct findings for each group. These results also may help provide insight as to the differences in terms of dynamics of therapeutic stimulation effects in the different disease groups.

      Weaknesses:

      After the revisions, the discussion contains many more details and comparisons to relevant literature, which will be helpful for readers to appreciate the importance of the results. The conclusion could have been strengthened as well, as it seems to be a very general summary of their findings without consideration of their clinical implications and importance. However, this may be a minor issue.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The work by Klaassen & Rasch investigates the influence of word learning difficulty on sleep-associated consolidation and reactivation. They elicited reactivation during sleep by applying targeted memory reactivation (TMR) and manipulated word learning difficulty by creating words more similar (easy) or more dissimilar (difficult) to our language.<br /> In one group of participants, they applied TMR of easy words and in another group of participants, they applied TMR of difficult words (between-subjects design).<br /> They showed that TMR leads to higher memory benefits in the easy compared to the difficult word group. On a neural level, they showed an increase in spindle power (in the up-state of an evoked response) when easy words were presented during sleep.

      Strengths:<br /> The authors investigate a research question relevant to the field, that is, which experiences are actually consolidated during sleep. To address this question, they developed an innovative task and manipulated difficulty in an elegant way.

      Overall, the paper is clearly structured, results and methods are described in an understandable way. The analyses approach is solid.

      Weaknesses:<br /> (1) Sample size<br /> For a between-subjects design, the sample size is too small (N = 22). The main finding (also found in the title "Difficulty in artificial word learning impacts targeted memory reactivation") is based on an independent samples t-test with 11 participants/group.<br /> The authors explicitly mention the small sample size and the between-subjects design as a limitation in their discussion. Nevertheless, making meaningful inferences based on studies with such a small sample size is difficult.

      (2) Choice of task<br /> Even though the task itself is innovative, there would have been tasks better suited to address the research question. The main disadvantage the task and the operationalisation of memory performance (d') have is that single-trial performance cannot be calculated. Consequently, choosing individual items for TMR is not possible.<br /> Additionally, TMR of low vs. high difficulty is conducted between subjects (and independently of pre-sleep memory performance) which is a consequence of the task design.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper reports that mechanical stress from egg accumulation is a biological stimulus that drives the formation of extruded vesicles from the neurons of C. elegans ALMR touch neurons. Using powerful genetic experiments only readily available in the C. elegans system, the authors manipulate oocyte production, fertilization, embryo accumulation, and egg-laying behavior, providing convincing evidence that exopher production is driven by stretch-dependent feedback of fertilized, intact eggs in the adult uterus. Shifting the timing of egg production and egg laying alters the onset of observed exophers. Pharmacological manipulation of egg laying has the predicted effects, with animals retaining fewer eggs having fewer exophers and animals with increased egg accumulation having more. The authors show that egg production and accumulation have dramatic consequences to the viscera, and moving the ALMR process away from eggs prevents the formation of exophers. This effect is not unique to ALMR but is also observed in other touch neurons, with a clear bias toward neurons whose cell bodies are adjacent to the filled uterus. Embryos lacking an intact eggshell with reduced rigidity have impaired exopher production. Acute injection into the uterus to mimic the stretch that accompanies egg production causes a similar induction of exopher release. Together these results are consistent with a model where stretch caused by fertilized embryo accumulation, and not chemical signals from the eggs themselves or egg release, underlies ALMR exopher production seen in adult animals.

      Strengths:

      Overall, the experiments are very convincing, using a battery of RNAi and mutant approaches to distinguish direct from indirect effects. Indeed, these experiments provide a model generally for how one would methodically test different models for exopher production. The source and factors influencing exopher production had previously been unclear. This study addresses how and when they form in the animal using physiologically meaningful manipulations. The stage is now set to address at a cellular level how exophers like these are made and what their functions are.

      Weaknesses:

      Not many. The experiments are about as good as could be done. Some of the n's on the more difficult to work strains or experiments are comparatively low, but this is not a significant concern because the number of different, complementary approaches used. The microinjection experiment is very interesting, and the authors have added additional details on how these experiments were conducted in the revised manuscript. The authors have now included data from strains bearing a single-copy transgene that expresses mKate2 in the same neurons, showing that induced egg accumulation drives a similar degree of exopher production. This indicates that exposers seen are generated in response to specific biological conditions and not merely an artifact of mCherry protein over-expression.

    1. Reviewer #2 (Public Review):

      Kwon et al. used several conditional KO mice for the deletion of ric8a or app in different cell types. Some of them exhibited pial basement membrane breaches leading to neuronal ectopia in the neocortex.

      They first investigated ric8a, a Guanine Nucleotide Exchange Factor for Heterotrimeric G Proteins. They observed the above-mentioned phenotype when ric8a is deleted from microglia and neural cells (ric8a-emx1-cre or dual deletion with cre combination cx3cr1 (in microglia) and nestin (in neural cells)) but not in microglia alone or neural cells alone (whether it is in CR cells (ric8a-Wnt3a-cre), post-mitotic neurons (nex-cre or dlx5/6-cre), or in progenitors and their progeny (nestin-cre or foxg1-cre). They also show that ric8a KO mutant microglia cells stimulated in vitro by LPS exhibit an increased TNFa, IL6 and IL1b secretion compared to controls (Fig 2). They therefore injected LPS in vivo and observed the neuronal ectopia phenotype in the ric8a-cx3cr1-cre (microglial deletion) cortices at P0 (Fig 2). They suggest that ric8a KO in neuronal cells mimics immune stimulation (but we have no clue how ric8a KO in neural cells would induce immune stimulation).

      The authors then turned their attention on APP. They observed neuronal ectopia into the marginal zone when APP is deleted in microglia (app-cxcr3-cre) + intraperitoneal LPS injection (they did not show it, but we have to assume there would not be a phenotype without the injection of LPS) (Fig 3). (The phenotype is similar but not identical to ric8a-cx3cr1-cre + LPS. They suggest that the reason is because they had to inject 3 times less LPS due to enhanced immune sensitivity in this genetic background but it is only a hypothesis). After in vitro stimulation by LPS, app mutant microglia show a reduced secretion of TNFa and IL6 but not IL1b (this is the opposite to ric8a-cx3cr1-cre microglia cells) while peritoneal macrophages in culture show increased secretion of TNFa, IL1, IL6 and IL23 (fig 3 and Suppl. Fig 9).

      Amyloid beta (Ab) being one of the molecules binding to APP, the authors showed that Ab40 monomers (they did not test Ab40 oligomers) partially inhibit cytokines (TNFa, IL6, IL1b, MCP-1, IL23a, IL10) secretion in vitro by microglia stimulated by LPS but does not affect secretion by microglia from app-cx3cr1-cre (tested for TNFa, IL6, IL1b, IL23a, IL10) (Fig 4, Suppl fig 10) (but still does it in aplp2-cx3cr1-cre) and does not affect secretion by ric8a-cx3cr1-cre microglia (tested for TNFa and IL6 but still suppress IL1b) (Therefore here is another difference between app and ric8a KO microglia).

      The authors injected inhibitors of Akt or Stat3 in the ric8a-emx1-cre cortex and found it suppressed neuronal ectopia (Fig 5, Suppl fig 11). It is not clear whether it suppresses immune stimulation from neuronal cells or immune reaction from microglia cells.

      Finally, the authors examined the activities of MMP2 and MMP9 in the developing cortex using gelatin gel zymography. The activity and protein levels of MMP9 but not MMP2 in the ric8a-emx1-cre cortex were claimed significantly increased (Fig 5, Suppl fig 12). Unfortunately, they did not show it in the app-cx3cr1-cre +LPS mouse. They make a connection between ric8a deletion and MMP9 but unfortunately do not make the connection between app deletion and MMP9, which is at the center of the pathway claimed to be important here). Then they injected BB94, a broad-spectrum inhibitor of MMPs or an inhibitor specific for MMP9 and 13. They both significantly suppress the number and the size of the ectopia in ric8a mutants (Fig5).

      After reading the manuscript, I still do not know how ric8a in neural cells is involved in the immune inhibition. Is it through the control of Ab monomers? In addition, the authors did not show in vivo data supporting that Ab monomers are the key players here. As the authors said, this is not the only APP interactor. Finally, I still do not know how ric8a is linked to APP in microglia in the model.

      While several of the findings presented in this manuscript are of potential interest, there are a number of shortcomings. Here are some suggestions that could improve the manuscript and help substantiate the conclusions:

      (1) As the title suggests it, the focus is on Ab and APP functions in microglia. However, the analysis is more focused on ric8a. The connection between ric8a and APP in this study is not investigated, besides the fact that their deletion induces somewhat similar but not identical phenotypes. Showing a similar phenotype is not enough to conclude that they are working on the same pathway. The authors should find a way to make that connection between ric8a and app in the cells investigated here.

      (2) This would help to show the appearance of breaches in the pial basement membrane leading to neuronal ectopia; to investigate laminin debris, cell identity, Wnt pathway for app-cxcr3-cre + LPS injection as you did for ric8a-emx1-cre.

      (3) As a control, this would help to show that app-cxcr3-cre without the LPS injection does not display the phenotype.

      (4) This would help to show the activity and protein levels of MMP9 and MMP2 and perform the rescue experiments with the inhibitors in the app-cx3cr1-cre cortex +LPS.

      (5) Is MMP9 secreted by microglia cells or neural cells?

      (6) The in vitro evidence indicates that one of the multiple APP interactors, ie Ab40 monomers, is less effective in suppressing the expression of some cytokines by microglia cells mutants for ric8a (TNFa and IL6 but still suppress IL1b) or APP (TNFa, IL6, IL1b, IL23a, IL10) when compared to WT. But there are other interactors for APP. In order to support the claim, it seems crucial to have in vivo data to show that Ab40 monomers are the molecules involved in preventing the breach in the pial basement membrane.

      (7) In order to claim that this is specific to Ab40 monomers and not oligomers, it is necessary to show that the Ab40 oligomers do not have the same effect in vitro and in vivo. Also, an assay should be done to show that your Ab preparations are pure monomers or oligomers.

      (8) Most of the cytokine secretion assays used microglia cells in culture. Two results draw my attention. Ric8a deletion increases TNFa and IL6 secretion after LPS stimulation in vitro on microglia cells while app deletion decreases their secretion. Then later, papers show that the decrease in IL1b induced by Ab on microglia cells is prevented by APP deletion but not ric8a deletion. Those two pieces of data suggest that ric8a and APP might not be in the same pathway. In addition, the phenotype from app-cxcr3-cre + LPS injection and ric8a-cxcr3-cre + LPS injection are not exactly the same. It could be due to the level of LPS as the author suggests or it might not be. More experiments are needed to prove they are in the same pathway.

      (9) How do the authors reconcile the reduced TNFa and IL6 secretion upon stimulation of app mutant microglia with the model where app is attenuating immune response in vivo? Line 213 says that microglia exhibit attenuated immune response following chronic stimulation but I don't know if 3 hours of LPS in vitro is a chronic stimulation.

      (10) Line 119: In their model, the authors suggest that there is a breach in pial basement membrane but that the phenotype is different from the retraction of the radial fibers due to reduced adhesion. So, could the author discuss to what substrate the radial fibers are attached to, in their model where the pial surface is destroyed?

      (11) The authors should show that the increased cytokine secretion observed in vitro is also happening in vivo in ric8a-emx1-cre compared to WT mice and compared to ric8a-nestin-cre mice. Or when app is deleted in microglia (app-cxcr3-cre) + LPS injection compared to WT mice +LPS.

      (12) The authors injected inhibitors of Akt or Stat3 in the ric8a-emx1-cre cortex and found that it suppressed neuronal ectopia (Fig 5, Suppl fig 11). Does it suppress immune stimulation from neuronal cells or immune reaction from microglia cells?

      (13) Fig 5 and Supplementary fig 12: Please show a tubulin loading control in Fig 5i as you did in suppl fig 12 d (gel zymography). Please provide a gel zymography showing side by side Control, mutant and mutant +DM/S3I treatment. The same request for the MMP9 staining. Please provide statistics for control vs mutant for suppl fig 12c and d.

      (14) Please provide the name and the source of the MMP9/13 inhibitor used in this study.

      (15) The results show that deletion of ric8a in microglia and neural cells induced pia membrane breaches but no phenotype is apparent in ric8a deletion in microglia or neural cells alone. Then, the results showed that intraperitoneal injection of LPS induced the phenotype in ric8a-cxcr3-cre mutants. It would be beneficial as a control supporting the model to show that the insult induced by LPS injection does not induce the phenotype in the ric8a-foxg1-cre mice.

    1. Reviewer #2 (Public Review):

      Summary: This manuscript describes the creation and curation of a collection of genetic driver lines that specifically label small numbers of neurons, often just a single to handful of cell types, in the central nervous system of the fruit fly, Drosophila melanogaster. The authors screened over 77,000 split hemidriver combinations to yield a collection of 3060 lines targeting a range of cell types in the adult Drosophila central nervous system and 1373 lines characterized in third-instar larvae. These genetic driver lines have already contributed to several important publications and will no doubt continue to do so. It is a truly valuable resource that represents the cooperation of several labs throughout the Drosophila community.

      Strengths:<br /> The authors have thoughtfully curated and documented the lines that they have created, so that they may be maximally useful to the greater community. This documentation includes confocal images of neurons labeled by each driver line and when possible, a list of cell types labeled by the genetic driver line and their identity in an EM connectome dataset. The authors have also made available some information from the other lines they created and tested but deemed not specific or strong enough to be included as part of the collection. This additional resource will be a valuable aid for those seeking to label cell types that may not be included in the main collection.

      Weaknesses:<br /> None, this is a valuable set of tools that took many years of effort by several labs. This collection will continue to facilitate important science for years to come.

    1. Reviewer #2 (Public Review):

      Rodent studies of claustrum are complicated by the tube-like shape of this nucleus. As such, judicious viral strategies alone or in combination with existing Cre driver lines (Egr2, Gnb4, Slc17a6, and Tbx21) represent the current gold standard for claustrum structure and function investigation. Any improvement in tools that would allow better genetic access to the claustrum are always desired, as with any nucleus in brain. This paper describes the expression pattern of the gene Smim32 and characterization of new mouse transgenic lines expressing Cre/Flp recombinase driven by the Smim32 promoter. The authors should be applauded for the work to develop these new tools presented in the study. Overall, the strengths of the paper lie in the development of new mouse lines that are well-characterized in comparison to other molecular markers of the claustrum. Weaknesses lie in poor anatomical definitions of the claustrum (and endopiriform nucleus). Smim32 expression is used to define claustrum anatomical boundaries, rather than first using several structural, molecular, and connectivity lines of evidence to define the claustrum anatomically and then to assess whether Smim32 expression fits within this anatomical definition. Another major weakness is the fact that Cre/Flp expression driven by the Smim32 promoter is present in non-claustrum regions, including the neighboring cortex, striatum, and endopiriform nucleus as well as the more distant thalamic reticular nucleus. Despite this, the conclusion of the study, as communicated by the authors, is that selective interrogation of the claustrum is now possible with these Smim32-based tools. Therefore, the data do not support the claims and conclusions.

      Very concerning is problematic language in the abstract and introduction sections that diminish the impact of several published studies (not cited) that have led to important findings regarding claustrum function. The authors Create an argument that all the research performed thus far on the claustrum is unreliable because targeting the structure has been sub-optimal. This is definitely not the case for several studies from multiple labs. If investigators new to the claustrum were to read this paper, they would conclude that all previous data hold little-to-no value and that using these tools set forth the possibility, at long last, to solve claustrum structural and functional queries. Here is an example from the abstract of the problematic language: "However, research on the CLA has been challenging due to difficulties in specifically and comprehensively targeting its neuronal populations. In various cases, this limitation has led to inconsistent findings and a lack of reliable data." (no references cited). Since Smim32 driven recombinase (in 61 or 62lrod) is not exclusively expressed in the claustrum, it is not clear how Smim32 is an advantage over possible Nr4a2 or, the more selective, GNB4 Cre driver lines. Taken together, the goal of the study as articulated in the Introduction: "Our goal was here to generate genetic tools capable of targeting the majority of mouse CLA projection neurons without affecting other brain cell populations, or tissues outside the brain" has not been met and, therefore, the conclusion of the study based on the data "With these genetic tools in hand, the comprehensive targeting and functional probing of the densely connected CLA is now possible" is unfortunately also unmet.

      The manuscript does convincingly show that Smim32 targets excitatory neurons in the claustrum as evidenced by exclusive overlap of Smim32 expression with Vglut2 and not GAD (fig 1 and suppl fig 1). Additionally, the manuscript provides sufficient evidence that neurons in the claustrum area expressing Smim32 further co-express a number of other molecular markers of claustrum, including Nr4a2 (fig1), Lxn, Gnb4, and Oprk1 (fig 2), and Slc17a6 (suppl fig 1). The authors further show that Smim32 is not co-expressed with molecular markers of layer VI cortex like Ctgf and Rprm (fig 2). However, by limiting the line of evidence to molecular expression, the study fails to escape the limitations of molecular markers, which cannot by themselves be used to define the anatomical boundary of the claustrum. The expression of several of these markers in the neighboring endopiriform nucleus, including Smim32, is evidence that using molecular markers as a sole indicator of the anatomy of the claustrum is not warranted.

      While the anatomical boundaries of the claustrum remain somewhat debated, several standards have emerged to delineate claustrum boundaries. These include immunoreactivity against Gng2 (or PV, especially in rat) to indicate claustrum or against Crym to counter-indicate claustrum. In addition, injection of retrograde tracers into the anterior cingulate cortex or retrosplenial cortex, for example, results in selective targeting of (large) subpopulations of claustrum neurons that help define claustrum location. Further targeting of neurons projecting to the anterior insula or thalamus has been used to delineate the boundaries of what some consider the claustrum shell and others consider the deep layers of the insula. The use of any of these approaches to delineate the claustrum anatomy should be used to describe the spatial distribution of Smim32 and Cre or FlpO in the transgenic lines.

      The manuscript provides a description of Smim32 promoter-driven tdTomato in the three transgenic Cre lines during development. This shows strong expression in claustrum and not in surrounding regions. However, as the claustrum borders are not distinct without markers, the anatomical boundary of claustrum for this analysis is deemed arbitrary - an issue that is exacerbated when looking at the developing brain where atlases are less precise and boundaries of the claustrum are ill-defined.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors previously demonstrated that anterior-located a-Wave neurons (neuromeres A1-A3) extend axons anteriorly to connect to circuits inducing backward locomotion, while p-Wave axon (neuromeres A4-A7) project posteriorly to promote forward locomotion in Drosophila larvae. In the manuscript, the authors aim to determine the molecular mechanisms involved in wiring the segmentally homologous Wave neurons distinctively and thus are functionally different in modulating forward or backward locomotion. The genetic screen focused on Wnt/Fz-signaling due to its known anterior-to-posterior guidance roles in mammals and nematodes.

      Strengths:

      Knock-down (KD) DFz2 with two independent RNAi-lines caused ectopic posterior axon and dendrite extension for all a- and p-Wave neurons, with a-Wave axon extending into regions where p-Wave axons normally project. Both behavioral assays (optogenetic stimulation of all Wave neurons or tactile stimuli on heads using a von Frey filament) show that backward movement is reduced or absent and that the speed of evoked fast-forward locomotion is increased. This demonstrates that altered projections of Wave do alter behavior and the DFz2 KD phenotype is consistent with the potential aberrant wiring of a-Wave neurons to forward locomotion-promoting circuits instead of to backward locomotion-promoting circuits.

      The main conclusion, that Wnt/Fz-signaling is essential for the guidance of Wave neurons and in diversifying their protection pattern in a segment-specific manner, is further supported by the results showing that DFz2 gain of function causes shortening of a-Wave but not p-Wave axon extensions towards the posterior end and that KD of DFz4 causes axonal shortening only in A6-p-Wave neurons but does not affect dendrites or processes of other Wave neurons. A role for ligand Wnt4 is demonstrated by results indicating that WNT4 mutants' posterior extension of a-Wave axons was elongated similar to DFz2 KD animals and p-Wave axon extension towards the posterior end was shortened similar to DFz2 KD animals. Finally, a DWnt4 gradient decreasing from the posterior (A8) to the anterior end (A2), similar to that described in other species, is supported by analyses of DWnt4 gene expression (using Wnt4 Trojan-Gal4) and protein expression (using antibodies). In contrast, DFz2 receptor levels seemed to decrease from the anterior (A2) to the posterior end (A5/6). Together the results support the conclusion that opposing Wnt/Fz ligand-receptor gradients contribute to the diversification of Wave neurons in a location-dependent manner and that DFz2 and DFz4 have opposing effects on axon extension.

      Weaknesses:

      Wave axon and dendrite projections are not exclusively determined by Wnt4, DFz2, and DFz4, and are likely to involve other Fz receptors, Wt ligands, and other types of receptor-ligand signaling pathways. This is in part supported by the fact that Wnt4 loss of function also resulted in phenotypes that do not mimic DFz2 KD or DFz4 KD (Figures 3D, E, and F) and that other Fz/Wnt mutants caused wave neuron phenotypes (Figure 1-supplement 2, D+E). This is not a weakness per se, since it doesn't affect the main conclusion of the manuscript. However, the description and analyses of the data in particular for Figure 1-supplement 2 D should be clarified in the legend. The number within the bars and the asterisks are not defined. It's presumed they refer to numbers of animals assessed and the asterisk next to DFz2 and DFz4 indicate statistically significant differences. However, only one p-value is provided in the legend. It is also unclear if p-values for the other mutants have not been determined or are non-significant. At least for mutants like Corin, which also exhibit altered axon projections, the p-values should be provided.

      Figure 4 D, F. The gradient for Wnt4 was determined by comparison of expression levels of other segments to A8 but the gradient for DFz2 was by comparison to A2 and the data supports opposing gradients. However, for DFz2 (Figure 4, F) it seems that the gradient is bi-directional with the lowest being in A5 and increasing towards A2 as well as A8. Analysis should be performed in reference to A8 as well to determine if it is indeed bi-directional. While such a finding would not affect the interpretation of a-Wave neurons, it may impact conclusions about p-Wave neuron projections.

      As discussed above, the DFz2 KD phenotypes are consistent with the potential aberrant wiring of a-Wave neurons to forward locomotion-promoting circuits instead of to backward locomotion-promoting circuits. However, since the axon and dendrites of a-Wave and p-Wave are affected the actual dendritic and axonal contributions for the altered behavior remain elusive. The authors certainly considered a potential contribution of altered dendrite projection of a-Wave neurons to the phenotype and their conclusion that altered axonal projections are involved is supported by the optogenetic experiment "bypassing" sensory input (albeit it seems unlikely that all Wave neurons are activated simultaneously when perceiving natural stimuli). However, the author should also consider that altered perception and projection of p-Wave neuron may directly (e.g. extended P-wave axon projections increase forward locomotion input thereby overriding backward locomotion) or indirectly (e.g. feedback loops between forward and backward circuits) contribute to the altered behavioral phenotypes in both assays. It is probably noteworthy that the more complex behavioral alterations observed with mechanical stimulation are likely to also be caused by altered dendritic projections.

      Presynaptic varicosities of a-Wave neurons in DFz2 KD animals are indicated by orange arrows in Figure 1. However, no presynaptic markers have been used to confirm actual ectopic synaptic connections. At least the authors should more clearly define what parameters they used to "visually" define potential presynaptic varicosities. Some arrows seem to point to more "globular structures" but for several others, it's unclear what they are pointing at.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript examines the role of the dopamine receptor, Dop1R2, in memory formation. This receptor has complex roles in supporting different stages of memory, and the neural mechanisms for these functions are poorly understood. The authors are able to localize Dop1R2 function to the vertical lobes of the mushroom body, revealing a role in later (presumably middle-term) aversive and appetitive memory. In general, the experimental design is rigorous, and statistics are appropriately applied. While the manuscript provides a useful tool, it would be strengthened further by additional mechanistic studies that build on the rich literature examining the roles of dopamine signaling in memory formation. The claim that Dop1R2 is involved in memory formation is strongly supported by the data presented, and this manuscript adds to a growing literature revealing that dopamine is a critical regulator of olfactory memory. However, the manuscript does not necessarily extend much beyond our understanding of Dop1R2 in memory formation, and future work will be needed to fully characterize this reagent and define the role of Dop1R2 in memory.

      Strengths:

      (1) The FRT lines generated provide a novel tool for temporal and spatially precise manipulation of Dop1R2 function. This tool will be valuable to study the role of Dop1R2 in memory and other behaviors potentially regulated by this gene.

      (2) Given the highly conserved role of Dop1R2 in memory and other processes, these findings have a high potential to translate to vertebrate species.

      Weaknesses:

      (1) The authors state Dop1R2 associates with two different G-proteins. It would be useful to know which one is mediating the loss of aversive and appetitive memory in Dop1R2 knockout flies.

      (2) It would be interesting to examine 24hr aversive memory, in addition to 24hr appetitive memory.

      (3) The manuscript would be strengthened by added functional analysis. What are the DANs that signal through Dop1R. How do these knockouts impact MBONs?

      (4) Also in Figure 2, the lobe-specific knockouts might be moved to supplemental since there is no effect. Instead, consider moving the control sensory tests into the main figure.

      (5) Can the single-cell atlas data be used to narrow down the cell types in the vertical lobes that express Dop1R2? Is it all or just a subset?

    1. Reviewer #2 (Public Review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, they provide convincing evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing valuable guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. I have some suggestions on how to improve the clarity and completeness of the paper.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. (I have some suggestions for how the authors could push this understanding further.) It is not easy to find the right balance between biologically detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      Weaknesses:

      (1) The fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state. I think the authors should have emphasized this limitation more strongly and possibly included some additional analyses to show that their conclusions extend to the chaotic dynamical regimes in which cortical circuits often live.

      (2) The authors could have discussed -- even somewhat speculatively -- how SST interneurons fit into this picture. Their absence from this modelling framework stands out as a missed opportunity.

      (3) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important consideration.

    1. Reviewer #2 (Public Review):

      Summary:

      This study, based on their previous findings that TFH cells can be converted into TR1 cells, conducted a highly detailed and comprehensive epigenetic investigation to answer whether TR1 differentiation from TFH is driven by epigenetic changes. Their evidence indicated that the downregulation of TFH-related genes during the TFH to TR1 transition depends on chromatin closure, while the upregulation of TR1-related genes does not depend on epigenetic changes.

      Strengths:

      A significant advantage of their approach lies in its detailed and comprehensive assessment of epigenetics. Their analysis of epigenetics covers chromatin open regions, histone modifications, DNA methylation, and using both single-cell and bulk techniques to validate their findings. As for their results, observations from different epigenetic perspectives mutually supported each other, lending greater credibility to their conclusions. This study effectively demonstrates that (1) the TFH-to-TR1 differentiation process is associated with massive closure of OCRs, and (2) the TR1-poised epigenome of TFH cells is a key enabler of this transdifferentiation process. Considering the extensive changes in epigenetic patterns involved in other CD4+ T lineage commitment processes, the similarity between TFH and TR1 in their epigenetics is intriguing.

      They performed correlation analysis to answer the association between "pMHC-NP-induced epigenetic change" and "gene expression change in TR1". Also, they have made their raw data publicly available, providing a comprehensive epigenomic database of pMHC-NP-induced TR1 cells. This will serve as a valuable reference for future research.

      Weaknesses:

      A major limitation is that this study heavily relies on a premise from the previous studies performed by the same group on pMHC-NP-induced T-cell responses. This significantly limits the relevance of their conclusion to a broader perspective. Specifically, differential OCRs between Tet+ and naïve T cells were limited to only 821, as compared to 10,919 differential OCRs between KLH-TFH and naïve T cells (Figure 2A), indicating that the precursors and T cell clonotypes that responded to pMHC-NP were extremely limited. This limitation should be clearly discussed in the Discussion section.

      This article uses peak calling to determine whether a region has histone modifications, claiming that the regions with histone modifications in TFH and TR1 are highly similar. However, they did not discuss the differences in histone modification intensities measured by ChIP-seq. For example, as shown in Figure 6C, IL10 H3K27ac modification in Tet+ cells showed significantly higher intensity than KLH-TFH, while in this article, it may be categorized as "possessing same histone modification region". This will strengthen their conclusions.

      Last, the key findings of this study are clear and convincing, but some results and figures are unnecessary and redundant. Some results are largely a mere confirmation of the relationship between histone marks and chromatin status. I propose to reduce the number of figures and text that are largely confirmatory. Overall, I feel this paper is too long for its current contents.

    1. Reviewer #3 (Public Review):

      (1) Throughout the manuscript, hMT+ connectivity with the frontal cortex has been treated as an a priori hypothesis/space. However, there is no such motivation or background literature mentioned in the Introduction. Can the authors clarify the necessity of functional connectivity? In other words, can BOLD activity of hMT+ in the localizer task substitute for functional connectivity between hMT+ and the frontal cortex?

      (2) There is an obvious mismatch between the in-text description and the content of the figure:

      "In contrast, there was no correlation between BDT and GABA levels in V1 voxels (figure supplement 1a). Further, we show that SI significantly correlates with GABA levels in hMT+ voxels (r = 0.44, P = 0.01, n = 31, Figure 3d). In contrast, no significant correlation between SI and GABA concentrations in V1 voxels was observed (figure supplement 1b)."

      (3) The authors' response to my previous round of review indicated that the "V1 ROIs" covered a substantial amount of V3 (32%). Therefore, it would no longer be appropriate to call these "V1 ROIs". I'd suggest renaming them as "Early Visual Cortex (EVC) ROIs" to be more accurate. Can the authors justify why choosing the left hemisphere for visual intelligence task, which is typically believed to be right lateralized?

      (4) "Small threshold" and "large threshold" are neither standard descriptions, and it is unclear what "small threshold" refers to in the following figure caption. Additionally, the unit (ms) is confusing. Does it refer to timing?

      "(f) Peason's correlation showing significant negative correlations between BDT and small threshold."

      (5) In the response letter, the authors mentioned incorporating the neural efficiency hypothesis in the Introduction, but the revised Introduction does not contain such information.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript uses cell lines representative of germ line cells, somatic cells and pluripotent cells to address the question of how the endocrine disrupting compound BPS affects these various cells with respect to gene expression and DNA methylation. They find a relationship between the presence of estrogen receptor gene expression and the number of DNA methylation and gene expression changes. Notably, PGCLCs do not express estrogen receptors and although they do have fewer changes, changes are nevertheless detected, suggesting a nonconical pathway for BPS-induced perturbations. Additionally, there was a significant increase in the occurrence of BPS-induced epimutations near EREs in somatic and pluripotent cell types compared to germ cells. Epimutations in the somatic and pluripotent cell types were predominantly in enhancer regions whereas that in the germ cell type was predominantly in gene promoters.

      Strengths:

      The strengths of the paper include the use of various cell types to address sensitivity of the lineages to BPS as well as the observed relationship between the presence of estrogen receptors and changes in gene expression and DNA methylation.

      Weaknesses:

      The weakness, which has been addressed by the authors, includes the fact that exposures are more complicated in a whole organism than in an isolated cell line.

    1. Reviewer #2 (Public Review):

      Summary:

      Kan et al. present the discovery of oxydifficidin as a potential antimicrobial against N. gonorrhoeae, including multi-drug resistant strains. The authors show the role of DedA flippase-assisted uptake and the specificity of RplL in the mechanism of action for oxydifficidin. This novel mode of action could potentially offer a new therapeutic avenue, providing a critical addition to the limited arsenal of antibiotics effective against gonorrhea.

      Strengths:

      This study underscores the potential of revisiting natural products for antibiotic discovery of modern-day-concerning pathogens and highlights a new target mechanism that could inform future drug development. Indeed there is a recent growing body of research utilising AI and predictive computational informatics to revisit potential antimicrobial agents and metabolites from cultured bacterial species. The discovery of oxydifficidin interaction with RplL and its DedA-assisted uptake mechanism opens new research directions in understanding and combating antibiotic-resistant N. gonorrhoeae. Methodologically, the study is rigorous employing various experimental techniques such as genome sequencing, bioassay-guided fractionation, LCMS, NMR, and Tn-mutagenesis.

      Weaknesses:

      The scope is somewhat narrow, focusing primarily on N. gonorrhoeae. This limits the generalizability of the findings and leaves questions about its broader antibacterial spectrum. Moreover, while the study demonstrates the in vitro effectiveness of oxydifficidin, there is a lack of in vivo validation (i.e., animal models) for assessing pre-clinical potential of oxydifficidin. Potential SNPs within dedA or RplL raise concerns about how quickly resistance could emerge in clinical settings.

    1. Reviewer #2 (Public Review):

      Summary:

      Directional migration is an integral aspect of sprouting angiogenesis and requires a cell to change its shape and sense a chemotactic or growth factor stimulus. Kondrychyn I. et al. provide data that indicate a requirement for zebrafish aquaporins 1 and 8, in cellular water inflow and sprouting angiogenesis. Zebrafish mutants lacking aqp1a.1 and aqp8a.1 have significantly lower tip cell volume and migration velocity, which delays vascular development. Inhibition of actin formation and filopodia dynamics further aggravates this phenotype. The link between water inflow, hydrostatic pressure, and actin dynamics driving endothelial cell sprouting and migration during angiogenesis is highly novel.

      Strengths:

      The zebrafish genetics, microscopy imaging, and measurements performed are of very high quality. The study data and interpretations are very well-presented in this manuscript.

      Weaknesses:

      Some of the findings and interpretations could be strengthened by additional measurements and further discussion. Also, a better comparison and integration of the authors' findings, with other previously published findings in mice and zebrafish would strengthen the paper.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors used 2-photon Ca2+-imaging to study the activity of ventral tegmental area (VTA) and locus coeruleus (LC) axons in the CA1 region of the dorsal hippocampus in head-fixed male mice moving on linear paths in virtual reality (VR) environments.

      The main findings were as follows:<br /> - In a familiar environment, activity of both VTA axons and LC axons increased with the mice's running speed on the Styrofoam wheel, with which they could move along a linear track through a VR environment.<br /> - VTA, but not LC, axons showed marked reward position-related activity, showing a ramping-up of activity when mice approached a learned reward position.<br /> - In contrast, activity of LC axons ramped up before initiation of movement on the Styrofoam wheel.<br /> - In addition, exposure to a novel VR environment increased LC axon activity, but not VTA axon activity.

      Overall, the study shows that the activity of catecholaminergic axons from VTA and LC to dorsal hippocampal CA1 can partly reflect distinct environmental, behavioral and cognitive factors. Whereas both VTA and LC activity reflected running speed, VTA, but not LC axon activity reflected the approach of a learned reward and LC, but not VTA, axon activity reflected initiation of running and novelty of the VR environment.

      I have no specific expertise with respect to 2-photon imaging, so cannot evaluate the validity of the specific methods used to collect and analyse 2-photon calcium imaging data of axonal activity.

      Strengths:

      (1) Using a state-of-the-art approach to record separately the activity of VTA and LC axons with high temporal resolution in awake mice moving through virtual environments, the authors provide convincing evidence that activity of VTA and LC axons projecting to dorsal CA1 reflect partly distinct environmental, behavioral and cognitive factors.

      (2) The study will help a) to interpret previous findings on how hippocampal dopamine and norepinephrine or selective manipulations of hippocampal LC or VTA inputs modulate behavior and b) to generate specific hypotheses on the impact of selective manipulations of hippocampal LC or VTA inputs on behavior.

      Weaknesses:

      (1) The findings are correlational and do not allow strong conclusions on how VTA or LC inputs to dorsal CA1 affect cognition and behavior. However, as indicated above under Strengths, the findings will aid the interpretation of previous findings and help to generate new hypotheses as to how VTA or LC inputs to dorsal CA1 affect distinct cognitive and behavioral functions.

      (2) Some aspects of the methodology would benefit from clarification.<br /> First, to help others to better scrutinize, evaluate and potentially to reproduce the research, the authors may wish to check if their reporting follows the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines for the full and transparent reporting of research involving animals (https://arriveguidelines.org/). For example, I think it would be important to include a sample size justification (e.g., based on previous studies, considerations of statistical power, practical considerations or a combination of these factors). The authors should also include the provenance of the mice. Moreover, although I am not an expert in 2-photon imaging, I think it would be useful to provide a clearer description of exclusion criteria for imaging data (see below, Recommendations for the authors).<br /> Second, why were different linear tracks used for studies of VTA and LC axon activity (from line 362)? Could this potentially contribute to the partly distinct activity correlates that were found for VTA and LC axons?<br /> Third, the authors seem to have used two different criteria for defining immobility. Immobility was defined as moving at <5 cm/s for the behavioral analysis in Fig. 3a, but as <0.2 cm/s for the imaging data analysis in Fig. 4 (see legends to these figures and also see Methods, from line 447, line 469, line 498)? I do not understand why, and it would be good if the authors explained this.

      (3) In the Results section (from line 182) the authors convincingly addressed the possibility that less time spent immobile in the novel environment may have contributed to the novelty-induced increase of LC axon activity in dorsal CA1 (Fig. 4). In addition, initially (for the first 2-4 laps), the mice also ran more slowly in the novel environment (Fig. 3aIII, top panel). Given that LC and VTA axon activity were both increasing with velocity (Fig. 1F), reduced velocity in the novel environment may have reduced LC and VTA axon activity, but this possibility was not addressed. Reduced LC axon activity in the novel environment could have blunted the novelty-induced increase. More importantly, any potential novelty-induced increase in VTA axon activity could have been masked by decreases in VTA axon activity due to reduced velocity. The latter may help to explain the discrepancy between the present study and previous findings that VTA neuron firing was increased by novelty (see Discussion, from line 243). It may be useful for the authors to address these possibilities based on their data in the Results section, or to consider them in their Discussion.

      (4) Sensory properties of the water reward, which the mice may be able to detect, could account for reward-related activity of VTA axons (instead of an expectation of reward). Do the authors have evidence that this is not the case? Occasional probe trials, intermixed with rewarded trials, could be used to test for this possibility.

      REVIEW OF THE REVISED MANUSCRIPT<br /> I thank the authors for their responses addressing some of the weaknesses I raised in my original comments.

      Regarding their clarification of some methodological issues [Point 2) above], I have a few additional comments:<br /> - I appreciate that the authors clearly state the sample sizes contributing to the data. However, sample size justifications (e.g. based on previous studies, considerations of statistical power, practical considerations or a combination of these factors) are still lacking.<br /> - It is good that the authors have now clearly indicated how many mice they excluded due to lack of GCaMP expression or due to failure to reach the behavioral criteria. They also indicated that they discarded some of the collected datasets, based on the visual assessment of imaging sessions and the registration metrics output by suite2p. I appreciate that this may be common practice (although I am not using 2-photon imaging myself). However, I note that to minimize the risk of experimenter bias and improve reproducibility, it would be preferable to have more clearly defined quantitative criteria for such exclusions.<br /> - The authors clarified in their response why they used two different linear tracks for their studies of VTA and LC axon activity. I would encourage them to include this clarification in the manuscript. From the authors' response, I understand that they chose the different track lengths to facilitate comparison to previous studies involving LC and VTA axon recordings. However, given that the present paper aimed to compare LC and VTA axon recordings, the use of different track lengths for LC and VTA axon recordings remains a limitation of the present paper.

    1. Reviewer #3 (Public Review):

      Nitta et al. use a fly model of autosomal dominant optic atrophy to provide mechanistic insights into distinct disease-causing OPA1 variants. It has long been hypothesized that missense OPA1 mutations affecting the GTPase domain, which are associated with more severe optic atrophy and extra-ophthalmic neurologic conditions such as sensorineural hearing loss (DOA plus), impart their effects through a dominant negative mechanism, but no clear direct evidence for this exists particularly in an animal model. The authors execute a well-designed study to establish their model, demonstrating a mitochondrial phenotype and optic atrophy measured as axonal degeneration. They leverage this model to provide the first direct evidence for a dominant negative mechanism for 2 mutations causing DOA plus by expressing these variants in the background of a full hOPA1 complement.

      Strengths of the paper include well-motivated objectives and hypotheses, and overall solid design and execution. There is a thorough discussion of the interpretation and context of the findings. The results technically support their primary conclusions with minor limitations. First, while only partial rescue of the most clinically relevant metric for optic atrophy in this model is now acknowledged, the result nevertheless hamstrings the mechanistic experiments that follow. Second, the results statistically support a dominant negative effect of DOA plus-associated variants, yet the data show a marginal impact on axonal degeneration for these variants. In added experiments, the ability of WT hOPA1 and I382M but not 2708del, D438V or R445H to rescue ROS levels or mitophagy in the context of dOPA1 knockdown serves to support axonal number as a valid measure of mitochondrial function in this context. However, the critical experiment demonstrating a dominant negative effect was performed in the context of expressing WT hOPA1 along with a pathogenic variant, in which no differences in ROS, COXII expression or mitophagy were seen. This makes it difficult to conclude that the dominant negative effect of D438V and R445H on axon number is related to mitochondrial function.

      As an animal model of DOA that may serve for rapid assessment of suspected OPA1 variants, the results overall support utility of this model in identifying pathogenic variants but not in distinguishing haploinsufficiency from dominant negative mechanisms among those variants. The impact of this work in providing the first direct evidence of a dominant negative mechanism is under-stated considering how important this question is in development of genetic treatments for dominant optic atrophy.

      Comments on revised version:

      The authors have addressed the comments in my initial review. Through these modification and those related to the comments from the other reviewers, the manuscript is strengthened.

      Comments on author responses to each of the reviews:

      Reviewer 1:

      Interpretation of data has been appropriately reorganized in the discussion.

      Quantified mitochondria in the model show no difference in number. There is reduced size and structural abnormalities on electron microscopy.

      Application of mito-QC revealed increased mitophagy.

      Regarding partial rescue of axonal number in the mutant model, statistical significance between control and rescue is still not depicted in Figure 4D. Detailing possible explanations for this has been addressed in the discussion. However, only partial rescue of the most clinically relevant metric for optic atrophy in this model hamstrings subsequent mechanistic experiments that follow.

      Discussion regarding variant I382M has been improved.

      While reviewer 1's concerns about axonal number as a biomarker for OPA1 function are valid, it is worth noting that this is the most clinically relevant marker in the context of DOA. That said, I agree that the mechanistic DN/HI studies needed support using other measures of mitochondrial function, and the authors have done this. The ability of WT hOPA1 and I382M but not 2708del, D438V or R445H to rescue ROS levels or mitophagy in the context of dOPA1 knockdown serves to support axonal number as a valid measure of mitochondrial function in this context. However, the critical experiment demonstrating a dominant negative effect was performed in the context of expressing WT hOPA1 along with a pathogenic variant, in which no differences in ROS, COXII expression or mitophagy were seen. This makes it difficult to conclude that the (marginal) DN effect of D438V and R445H on axon number is related to mitochondrial function, and serves as a minor weakness of the paper.

      Which exons are included in the transcript, and therefore, which isoforms are expressed in the model, has been addressed.

      Reviewer 2:

      The authors have addressed the need to include greater methodological details.

      Language concerning the clinical utility of the model in informing treatment decisions has been appropriately modified. As pointed out by Reviewer 1, additional studies were needed to better establish the potential clinical utility of this model in screening DOA variants. The authors have completed those experiments, and the results overall support utility of this model in identifying pathogenic variants but not in distinguishing HI/DN mechanisms among those variants.

      Reviewer 3:

      The author has addressed the partial rescue effect as above.

      The authors have not modified the text to acknowledge the marginal effect sizes in the critical experiment of the study that demonstrates a DN effect. Statistically, the results indeed support a dominant negative effect of DOA plus-associated variants, yet the data show a marginal impact on axonal degeneration for these variants. This remains a weakness of the study.

    1. Reviewer #2 (Public Review):

      In this manuscript, Cai et al use a combination of mouse transgenic lines to re-examine the question of the embryonic origin of telencephalic oligodendrocytes (OLs). Their tools include a novel Flp mouse for labelling mature oligodendrocytes and a number of pre-existing lines (some previously generated by the last author in Josh Huang's lab) that allowed combinatorial or subtractive labelling of oligodendrocytes with different origins. The conclusion is that cortically-derived OLs are the predominant OL population in the motor and somatosensory cortex and underlying corpus callosum, while the LGE/CGE generates OLs for the piriform cortex and anterior commissure rather than the cerebral cortex. Small numbers of MGE-derived OLs persist long-term in the motor, somatosensory and piriform cortex.

      Strengths:

      The strength and novelty of the manuscript lie in the elegant tools generated and used. These have enabled the resolution of the issue regarding the contribution of different telencephalic progenitor zones to the cortical oligodendrocyte population.

      Comments on latest version:

      The revised manuscript by Cai et al has addressed all the issues raised. I have some minor comments:

      Figure 2: The y axis in figure 2L should be the same as the y axis in 2M to make the contribution to Mo and SS more clear.

      Figure 3: Although this is clear in the figure, A an B should be labelled as classical model and new model to help the reader understand immediately what the two figures show.

      Suppl Fig 2: It is not clear what 1-7 represent. It should be made clear in the legend which areas have been pooled into the different bins. The X axis should be labelled.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Otero-Coronel and colleagues use a combination of acoustic stimuli and electrical stimulation of the tectum to study MSI in the M-cells of adult goldfish. They first perform a necessary piece of groundwork in calibrating tectal stimulation for maximal M-cell MSI, and then characterize this MSI with slightly varying tectal and acoustic inputs. Next, they quantify the magnitude and timing of FFI that each type of input has on the M-cell, finding that both the tectum and the auditory system drive FFI, but that FFI decays more slowly for auditory signals. These are novel results that would be of interest to a broader sensory neuroscience community. By then providing pairs of stimuli separated by 50ms, they assess the ability of the first stimulus to suppress responses to the second, finding that acoustic stimuli strongly suppress subsequent acoustic responses in the M-cell, that they weakly suppress subsequent tectal stimulation, and that tectal stimulation does not appreciably inhibit subsequent stimuli of either type. Finally, they show that M-cell physiology mirrors previously reported behavioural data in which stronger stimuli underwent less integration.

      The manuscript is generally well-written and clear. The discussion of results is appropriately broad and open-ended. It's a good document. Our major concerns regarding the study's validity are captured in the individual comments below. In terms of impact, the most compelling new observation is the quantification of the FFI from the two sources and the logical extension of these FFI dynamics to M-cell physiology during MSI. It is also nice, but unsurprising, to see that the relationship between stimulus strength and MSI is similar for M-cell physiology to what has previously been shown for behavior. While we find the results interesting, we think that they will be of greatest interest to those specifically interested in M-cell physiology and function.

      Strengths:

      The methods applied are challenging and appropriate and appear to be well executed. Open questions about the physiological underpinnings of M-cell function are addressed using sound experimental design and methodology, and convincing results are provided that advance our understanding of how two streams of sensory information can interact to control behavior.

      Weaknesses:

      Our concerns about the manuscript are captured in the following specific comments, which we hope will provide a useful perspective for readers and actionable suggestions for the authors.

      Comment 1 (Minor):

      Line 124. Direct stimulation of the tectum to drive M-cell-projecting tectal neurons not only bypasses the retina, it also bypasses intra-tectal processing and inputs to the tectum from other sources (notably the thalamus). This is not an issue with the interpretation of the results, but this description gives the (false) impression that bypassing the retina is sufficient to prevent adaptation. Adding a sentence or two to accurately reflect the complexity of the upstream circuitry (beyond the retina) would be welcome.

      Comment 2 (Major):

      The premise is that stimulation of the tectum is a proxy for a visual stimulus, but the tectum also carries the auditory, lateral line, and vestibular information. This seems like a confound in the interpretation of this preparation as a simple audio-visual paradigm. Minimally, this confound should be noted and addressed. The first heading of the Results should not refer to "visual tectal stimuli".

      Comment 3 (Major):

      Figure 1 and associated text.

      It is unclear and not mentioned in the Methods section how phasic and tonic responses were calculated. It is clear from the example traces that there is a change in tonic responses and the accumulation of subthreshold responses. Depending on how tonic responses were calculated, perhaps the authors could overlay a low-passed filtered trace and/or show calculations based on the filtered trace at each tectal train duration.

      Comment 4 (Minor):

      Figure 3 and associated text.<br /> This is a lovely experiment. Although it is not written in text, it provides logic for the next experiment in choosing a 50ms time interval. It would be great if the authors calculated the first timepoint at which the percentage of shunting inhibition is not significantly different from zero. This would provide a convincing basis for picking 50ms for the next experiment. That said, I suspect that this time point would be earlier than 50m s. This may explain and add further complexity to why the authors found mostly linear or sublinear integration, and perhaps the basis for future experiments to test different stimulus time intervals. Please move calculations to Methods.

      Comment 5 (Major):

      Figure 4C and lines 398-410.<br /> These are beautiful examples of M-cell firing, but the text suggests that they occurred rarely and nowhere close to significantly above events observed from single modalities. We do not see this as a valid result to report because there is insufficient evidence that the phenomenon shown is consistent or representative of your data.

    1. Reviewer #3 (Public Review):

      In their article "The Geometric Basis of Epithelial Convergent<br /> Extension", Brauns and colleagues present a physical analysis of drosophila axis extension that couples in toto imaging of cell contours (previously published dataset), force inference, and theory. They seek to disentangle the respective contributions of active vs passive T1 transitions in the convergent extension of the lateral ectoderm (or germband) of the fly embryo.

      The revision made by the authors has greatly improved their work, which was already very interesting, in particular the use of force inference throughout intercalation events to identify geometric signatures of active vs passive T1s, and the tension/isogonal decomposition. The new analysis of the Snail mutant adds a lot to the paper and makes their findings on the criteria for T1s very convincing.

      About the tissue scale issues raised during the first round of review. Although I do not find the new arguments fully convincing (see below), the authors did put a lot of effort to discuss the role of the adjacent posterior midgut (PMG) on extension, which is already great. That will certainly provide the interested readers with enough material and references to dive into that question.

      I still have some issues with the authors' interpretation on the role of the PMG, and on what actually drives the extension. Although it is clear that T1 events in the germ band are driven by active local tension anisotropy (which the authors show but was already well-established), it does not show that the tissue extension itself is powered by these active T1s. Their analysis of "fence" movies from Collinet et al 2015 (Tor mutants and Eve RNAi) is not fully convincing. Indeed, as the authors point out themselves, there is no flow in Tor mutant embryos, even though tension anisotropy is preserved. They argue that in Tor embryos the absence of PMG movement leaves no room for the germband to extend properly, thus impeding the flow. That suggests that the PMG acts as a barrier in Tor mutants - What is it attached to, then? The authors also argue that the posterior flow is reduced in "fenced" Eve RNAi embryos (which have less/no tension anisotropy), to justify their claim that it is the anisotropy that drives extension. However, previous data, including some of the authors' (Irvine and Wieschaus, 1994 - Fig 8), show that the first, rapid phase of germband extension is left completely unaffected in Eve mutants (that lack active tension anisotropy). Although intercalation in Eve mutants is not quantified in that reference, this was later done by others, showing that it is strongly reduced. Similarly, the Cyto-D phenotype from Clement et al 2017, in which intercalation is also strongly reduced, also displays normal extension.

    1. Reviewer #2 (Public Review):

      Summary:

      The study reported by Trutti et al. uses high-field fMRI to test the hypothesized involvement of subcortical structure, particularly striatum, in WM updating. Specifically, participants were scanned while performing the Reference Back task (e.g., Rac-Lubashevsky and Kessler, 2016), which tests constructs like working memory gate opening and closing and substitution. While striatal activation was involved in substitution, it was not observed in gate opening. This observation is cited as a challenge to cortico-striatal models of WM gating, like PBWM (Frank and O'Reilly, 2005).

      Strengths:

      While there have been prior fMRI studies of the reference back task (Nir-Cohen et al., 2020), the present study overcomes limitations in prior work, particularly with regard to subcortical structures, by applying high-field imaging with a more precise definition of ROIs. And, the fMRI methods are careful and rigorous, overall. Thus, the empirical observations here are useful and will be of interest to specialists interested in working memory gating or the reference back task specifically.

      Weaknesses:

      I am less persuaded by the more provocative points regarding the challenge it presents to models like PBWM, made in several places by the paper. As detailed below, issues with conceptual clarity of the main constructs and their connection to models, like PBWM, along with some incomplete aspects of the results, make this stronger conclusion less compelling.

      (1) The relationship of the Nir-Cohen et al. (2020) task analysis of the reference back task, with its contrasts like gate opening and closing, and the predictions of PBWM is far from clear to me for several reasons.

      First, contrasts like gate opening and gate closing make strong finite state assumptions. As far as I know, this is not an assumption of PBWM, certainly not for gate opening. At a minimum, PBWM is default closed because of the tonic inhibition of cortico-thalamic dynamics by the globus pallidus. Indeed, this was even noted in the discussion of this paper, which seems to acknowledge this discrepancy, but then goes on to conclude that they have challenged the PBWM model anyway.

      Second, as far as I know, PBWM emphasizes go/no-go processes around constructs of input- and output-gating, rather than state shifts between gate opening and closing. While this relationship is less clear in reference back, substituting task-relevant items into working memory does appear to be an example of input gating, as modeled by PBWM. Thus, it is not clear to me why the substitution contrast would not be more of a test of input gating than the gate opening contrast, which requires assumptions that are not clear are required by the model, as noted above.

      Third, PBWM relies on striatal mechanisms to solve the problem of selective gating, inputting, or outputting items in memory while also holding on to others. Selective gating contrasts with global gating, in which everything in memory is gated or nothing. The reference back task is a test of global gating. It is an important distinction because non-striatal mechanisms that can solve global gating, cannot solve selective gating. Indeed, this limitation of non-striatal mechanisms was the rationale for PBWM adding striatum. The connectivity of the striatum with the cortex permits this selectivity. It is not clear that the reference back task tests these selective demands in the first place. That limitation in this task was the rationale behind the recent Rac-Lubashevsky and Frank (2022) paper using the reference back 2 procedure that modifies the original reference back for selective gating.

      So, if the primary contribution of the paper is to test PBWM, as suggested by the first line of the abstract, then it is not clear that the reference back task in general, or the gate opening contrast in particular, is the best test of these predictions. Other contrasts (substitution), or indeed, tasks (reference back 2) would have been better suited.

      (2) In general, observations of univariate activity in the striatum have been notoriously variable in the context of WM. Indeed, Chatham et al. (2014) who tested working memory output gating - notably in a direct test of the predictions of PBWM - noted this variability. They too did not observe univariate activation in the striatum associated with selective output gating. Rather they found evidence of increased connectivity between the striatum and cortex during selective output gating. They argued that one account of this difference is that striatal gating dynamics emerge from the balance between the firing of both Go and NoGo cell populations that decide whether to gate or not. It is not always clear how this balance should relate to univariate activation in the striatum. Thus, the present study might also test cortico-striatal connectivity, rather than relying exclusively on univariate activation, in their test of striatal involvement in these WM constructs.

      (3) It is concerning that there was no behavioral cost for comparison switch vs. repeat trials. This differs from with prior observations from the reference back (e.g., Nir-Cohen et al., 2020), and in general, is odd given the task switch/cue interpretation component. This failure to observe a basic behavioral effect raises a concern about how participants approached this task and how that might differ from prior reports of the reference back. If they were taking an unusual strategy, it further complicates the interpretation of these results and the implications they hold for theory.

      In summary, the present observations are useful, particularly for those interested in the reference back task. For example, they might call into question verbal theories and task analyses of the reference back task that tie constructs like gate-opening to striatal mechanisms. However, given the ambiguities noted above, the broader implications for models like PBWM, or indeed, other models of working memory gating, are less clear.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors designed an EEG experiment to investigate how listeners use temporal structure to optimise sensory detection. Listeners heard 2 seconds of noise and had to detect a faint tone in one of 3 temporal locations (equally spaced in time). In a minority of trials, no tone was presented. Focussing on these 'no tone' trials, the authors show that the EEG 'temporally tracks' the expected tone locations. This temporal tracking behaviour is also shown in a recurrent neural network trained on the same task. The authors interpret these findings as evidence of neural gain control in the service of sequential temporal anticipation.

      Strengths:

      The study uses an elegant experimental design and sophisticated EEG analyses. It is striking how clear the neural signatures are (of sequential expectation in the absence of sensory input). A further strength is the use of neural network modelling to elucidate the possible neural computations.

      Weaknesses:

      My first major comment concerns the theoretical implications of the study. An account based on gain control and temporal anticipation seems highly plausible. But are there other plausible accounts that the current data argue against? Or are there specific versions of gain control / temporal anticipation theories that the data supports and others that the data doesn't support? To develop the manuscript, I think the authors could relate their results in a more specific way to existing accounts, outlining not only what accounts their results favor but also which accounts their data falsify. In doing so I think the study will have a stronger influence on shaping the field.

      My second major comment concerns the consistent lag that is observed between tone location and neural/model responses. This would seem to be inconsistent with an anticipation account, which would instead predict zero or a negative lag. This should be discussed. While I agree the decrease in response magnitude that occurs with tone location is inconsistent with expectation violation, the positive lag that is observed seems more consistent with expectation violation than temporal anticipation/gain control.

      My third major comment is a suggestion to present some further analyses that I think will be informative. First is reporting more extensively the ERP results. This currently appears in one of the panels but there are no statistical tests reported in the main text and only the tone present data is shown. Given that expectation violation has been observed most consistently with ERPs, is there evidence of this in the 'no tone' trials and if so, does it correlate over participants with the power modulation effect or rate of false alarms? Doing this analysis will possibly be informative for assessing the plausibility of different functional accounts of the data e.g. expectation violation/prediction error. My second suggestion is to report the tone present trial data. When the tone is for example presented in the first location, does the response during tone locations 2 and 3 get suppressed? And does the same occur in the neural network model? If so, this would speak to a highly dynamic form of gain control (if the gain control account is correct).

    1. Reviewer #2 (Public Review):

      Summary:

      Spargo and colleagues present an analysis of the shared genetic architectures of Schizoprehnia and several late-onset neurological disorders. In contrast to many polygenic traits for which global genetic correlation estimates are substantial, global genetic correlation estimates for neurological conditions are relatively small, likely for several reasons. One is that assortative mating, which will spuriously inflate genetic correlation estimates, is likely to be less salient for late-onset conditions. Another, which the authors explore in the current manuscript, is that some loci affecting two or more conditions (i.e., pleiotropic loci) may have effects in opposite directions, or shared loci are sparse, such that the global genetic correlation signal washes out.

      The authors apply a local genetic correlation approach that assesses the presence and direction of pleiotropy in much smaller spatial windows across the genome. Then, within regions evidencing local genetic correlations for a given trait pair, they apply fine-mapping and colocalization methods to attempt to differentiate between two scenarios: that the two traits share the same causal variant in the region or that distinct loci within the region influence the traits. Interestingly, the authors only discover one instance of the former: an SNP in the HLA region appearing to confer risk for both AD and ALS. This is in contrast to six regions with distinct causal loci, and twenty regions with no clear shared loci.

      Finally, the authors have published their analysis pipeline such that other researchers might easily apply the same techniques to other collections of traits.

      Strengths:<br /> - All such analysis pipelines involve many decision points where there is often no clear correct option. Nonetheless, the authors clearly present their reasoning behind each such decision.<br /> - The authors have published their analytic pipeline such that future researchers might easily replicate and extend their findings.

      Weaknesses:<br /> - The majority of regions display no clear candidate causal variants for the traits, whether shared or distinct. Further, despite the potential of local genetic correlation analysis to identify regions with effects in opposing directions, all of the regions for causal variants were identified for both traits evidenced positive correlations. The reasons for this aren't clear and the authors would do well to explore this in greater detail.<br /> - The authors very briefly discuss how their findings differ from previous analyses because of their strict inclusion for "high-quality" variants. This might be the case, but the authors do not attempt to demonstrate this via simulation or otherwise, making it difficult to evaluate their explanation.

      These concerns were addressed in the revised version of this manuscript.

    1. Reviewer #2 (Public Review):

      Steinemann, Stine, and their co-authors studied the noisy accumulation of sensory evidence during perceptual decision-making using Neuropixels recordings in awake, behaving monkeys. Previous work has largely focused on describing the neural underpinnings through which sensory evidence accumulates to inform decisions, a process which on average resembles the systematic drift of a scalar decision variable toward an evidence threshold. The additional order of magnitude in recording throughput permitted by the methodology adopted in this work offers two opportunities to extend this understanding. First, larger-scale recordings allow for the study of relationships between the population activity state and behavior without averaging across trials. The authors' observation here of covariation between the trial-to-trial fluctuations of activity and behavior (choice, reaction time) constitutes interesting new evidence for the claim that neural populations in LIP encode the behaviorally-relevant internal decision variable. Second, using Neuropixels allows the authors to sample LIP neurons with more diverse response properties (e.g. spatial RF location, motion direction selectivity), making the important question of how decision-related computations are structured in LIP amenable to study. For these reasons, the dataset collected in this study is unique and potentially quite valuable. This revised manuscript addresses a number of questions regarding analyses which were unclear in the original manuscript, and as a result the study is a strong contribution toward our understanding of neural mechanisms of decision making.

    1. Reviewer #2 (Public Review):

      Summary:

      Turning behavior plays a crucial role in animal exploration and escape responses, regardless of the presence or absence of environmental cues. These turns can be broadly categorized into two categories: strong reorientations, characterized by sudden changes in path directionality, and smooth turns, which involve gradual changes in the direction of motion, leading to sinuosity and looping patterns. One of the key model animals to study these behaviors is the nematode Caenorhabditis elegans, in which the role of strong reorientations has been thoroughly studied. Despite their impact on trajectories, smooth turns have received less attention and remain poorly understood. This study addresses this gap in the literature, by studying the interplay between smooth turns and strong reorientations in nematodes moving in a uniform environment, surrounded by an aversive barrier. The authors use this set-up to study both exploration behavior (when the worm is far from the aversive barrier) and avoidance behavior (when the worm senses the aversive barrier). The main claims of the paper are that (1) during exploratory behavior, the parameters governing strong reorientations are optimized to compensate for the effect of smooth turns, increasing exploration efficiency, and (2) during avoidance, strong reorientations are biased towards the side that maximizes escape success. To support these two claims, the paper presents a detailed quantitative characterization of the statistics of smooth turns and strong reorientations. These results offer insights that may interest a diverse audience, including those in movement ecology, animal search behavior, and the study of Caenorhabditis elegans. In our opinion, the experimental work and data analysis are of the highest quality, resulting in a very clean characterization of C. elegans' turning behavior. However, the experimental design and data analyses presented are not fully aligned with some of the central conclusions drawn, and in particular, we believe that further work is needed to fully support the claim that strong reorientations are optimized to increase exploration efficiency.

      Strengths:

      The authors have addressed important questions in movement ecology through hypothesis-driven experiments. The choice of C. elegans as a model organism to investigate the impact of turning dynamics on escape and exploration is well-justified by its limited repertoire of strong reorientation behaviors and consistent turning bias across strains and individuals. The quality of the experimental data is very high, using state-of-the-art techniques, and a set-up where a robust and reproducible avoidance response can be studied. The data analysis benefits from state-of-the-art techniques and a deep understanding of C. elegans' behavior, resulting in a very clean and very clear set of results. We particularly appreciated the use of a ventral/dorsal reference system (rather than a left/right one), which is more natural and insightful. As a result, the paper presents one of the best characterizations of C. elegans sharp turning behavior published to date. We find that the claim that strong reorientations are chosen in a way that optimizes avoidance behavior is solid and well-supported. The manuscript is well-written and maintains a coherent line of reasoning throughout.

      Weaknesses:

      Our primary concerns revolve around the significance and rigor of the research on exploratory behavior. First, we believe that the experimental arena was too small for accurately observing the unfolding of exploration. The movement of assayed animals was clearly impaired by boundary effects, which obscured key elements of C. elegans exploratory behavior such as the mean square displacement or large-scale trajectory structures emerging from curvature bias. Second, we think that the proof that strong reorientations are optimized to maximize exploration performance is too indirect: it relies on a particular model with some unrealistic assumptions and lacks a quantification of the gains provided by the optimization to the individuals. We believe that a more thorough and direct analysis would be needed to fully support the claim.

    1. Reviewer #2 (Public Review):

      Summary:

      Several publications during the past years provided evidence that NMD protects tumor cells from being recognized by the immune system by suppressing the display of neoantigens, and hence NMD inhibition is emerging as a promising anti-cancer approach. However, the lack of an efficacious and specific small molecule NMD inhibitor with suitable pharmacological properties is currently a major bottleneck in the development of therapies that rely on NMD inhibition. In this manuscript, the authors describe their screen for identifying NMD inhibitors, which is based on isogenic cell lines that either express wild-type or NMD-sensitive transcript isoforms of p53 and STAG2. Using this setup, they screened a library of 2658 FDA-approved or late-phase clinical trial drugs and had 8 hits. Among them they further characterized LY3023414, showing that it inhibits NMD in cultured cells and in a mouse xenograft model, where it, however, was very toxic. Because LY3023414 was originally developed as a PI3K inhibitor, the authors claim that it inhibits NMD by inhibiting SMG1. While this is most likely true, the authors do not provide experimental evidence for this claim. Instead, they use this statement to switch their attention to another previously developed SMG1 inhibitor (SMG1i-11), of which they design and test several derivatives. Of these derivatives, KVS0001 showed the best pharmacological behavior. It upregulated NMD-sensitive transcripts in cultured cells and the xenograft mouse model, and two predicted neoantigens could indeed be detected by mass spectrometry when the respective cells were treated with KVS0001. A bispecific antibody targeting T cells to a specific antigen-HLA complex led to increased IFN-gamma release and killing of cancer cells expressing this antigen-HLA complex when they were treated with KVS0001. Finally, the authors show that renal (RENCA) or lung cancer cells (LLC) were significantly inhibited in tumor growth in immunocompetent mice treated with KVS0001. Overall, this establishes KVS0001 as a novel and promising ant-cancer drug that by inhibiting SMG1 (and therewith NMD) increases the neoantigen production in the cancer cells and reveals them to the body's immune system as "foreign".

      Strengths:

      The novelty and significance of this work consist in the development of a novel and - judging from the presented data - very promising NMD inhibiting drug that is suitable for applications in animals. This is an important advance for the field, as previous NMD inhibitors were not specific, lacked efficacy, or were very toxic and hence not suitable for animal application. It will be still a long way with many challenges ahead towards an efficacious NMD inhibitor that is safe for use in humans, but KVS0001 appears to be a molecule that bears promise for follow-up studies. In addition, while the idea of inhibiting NMD to trigger neoantigen production in cancer cells and so reveal them to the immune system has been around for quite some time, this work provides ample and compelling support for the feasibility of this approach, at least for tumors with a high mutational burden.

      Main weaknesses:

      There is a disconnect between the screen and the KVS0001 compound, that they describe and test in the second part of the manuscript since KVS0001 is a derivative of the SMG1 inhibitors developed by Gopalsamy et al. in 2012 and not of the lead compound identified in the screen (LY3023414). Because of high toxicity in the mouse xenograft experiments, the authors did not follow up LY3023414 but instead switched to the published SMG1i-11 drug of Gopalsamy and colleagues, a molecule that is widely used among NMD researchers for NMD inhibition in cultured cells. Therefore, in my view, the description of the screen is obsolete, and the paper could just start with the optimization of the pharmacological properties of SMG1i-11 and the characterization of KVS0001. Even though the screen is based on an elegant setup and was executed successfully, it was ultimately a failure as it didn't reveal a useful lead compound that could be further optimized.

      Additional points:

      - Compared to SMG1i-11, KVS0001 seems less potent in inhibiting SMG1 (higher IC50). It would therefore be important to also compare the specificity of both drugs for SMG1 over other kinases at the actually applied concentrations (1 uM for SMG1i-11, 5 uM for KVS0001). The Kinativ Assay (Fig. S13) was performed with 100 nM KVS0001, which is 50-fold less than the concentration used for functional assays and hence not really meaningful. In addition, more information on the pharmacokinetic properties and toxicology of KVS0001 would allow a better judgment of the potential of this molecule as a future therapeutic agent.<br /> - On many figures, the concentrations of the used drugs are missing. Please ensure that for every experiment that includes drugs, the drug concentration is indicated.<br /> - Do the authors have an explanation for why LY3023414 has a much stronger effect on the p53 than on the STAG2 nonsense allele (Fig. 1B, S8), whereas emetine upregulates the STAG2 nonsense alleles more than the p53 nonsense allele (Fig. S5). I find this curious, but the authors do not comment on it.<br /> - While it is a strength of the study that the NMD inhibitors were validated on many different truncation mutations in different cell lines, it would help readers if a table or graphic illustration was included that gives an overview of all mutant alleles tested in this study (which gene, type of mutation, in which cell type). In the current version, this information is scattered throughout the manuscript.<br /> - Lines 194 and 302: That SMG1i-11 was highly insoluble in the hands of the authors is surprising. It is unclear why they used variant 11j, since variant 11e of this inhibitor is widely used among NMD researchers and readily dissolves in DMSO.<br /> - Line 296: The authors claim that they were able to show that LY3023414 inhibited the SMG1 kinase, which is not true. To show this, they would have for example to show that LY3023414 prevents SMG1-mediated UPF1 phosphorylation, as they did for KVS0001 and SMG1i-11 in Fig. 3F. Unless the authors provide this data, the statement should be deleted or modified.

      Comments on the revised version:

      - The authors have satisfactorily addressed all my "Additional points" listed above.

      - With the new publishing model of Life, the authors ultimately decide on whether or not to follow reviewers suggestions, and in this case, the authors decided (against my suggestion) to leave the screening part in the manuscript, although it did not result in a useful lead compound. They argue it helped them define in an unbiased way SMG1 as the ideal target for NMD disruption. I would counterargue that this has been known in the field for quite a while.

      - One last suggestion I have to the authors would be to modify the statement in the abstract "This led to the design of a novel SMG1 inhibitor", because what they call "novel" is, in reality, a chemical improvement of the pharmacological properties of a previously reported SMG1 inhibitor (Gopalsamy et al., 2012).

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors of this study have sought to better understand the timing and location of the attachment of the lpp lipoprotein to the peptidoglycan in E. coli, and to determine whether YafK is the hydrolase that cleaves lpp from the peptidoglycan.

      Strengths:<br /> The method is relatively straightforward. The authors are able to draw some clear conclusions from their results, that lpp molecules get cleaved from the peptidoglycan and then re-attached, and that YafK is important for that cleavage.

      Weaknesses:<br /> Figure 3 and 4 - why are the data shown here only two biological replicates, when there are 3-5 replicates shown in table S1 and S2? This makes it seem like you are cherry picking your favorite replicates. Please present the data as the mean of all the replicates performed, with error shown on the graph.

      This work will have a moderate impact on the field of research in which the connections between the OM and peptidoglycan are being studied in E. coli. Since lpp is not widely conserved in gram negatives, the impact across species is not clear. The authors do not discuss the impact of their work in depth.

    1. Reviewer #2 (Public Review):

      Summary:

      In this work, the authors present a biologically plausible, efficient E-I spiking network model and study various aspects of the model and its relation to experimental observations. This includes a derivation of the network into two (E-I) populations, the study of single-neuron perturbations and lateral-inhibition, the study of the effects of adaptation and metabolic cost, and considerations of optimal parameters. From this, they conclude that their work puts forth a plausible implementation of efficient coding that matches several experimental findings, including feature-specific inhibition, tight instantaneous balance, a 4 to 1 ratio of excitatory to inhibitory neurons, and a 3 to 1 ratio of I-I to E-I connectivity strength. It thus argues that some of these observations may come as a direct consequence of efficient coding.

      Strengths:

      While many network implementations of efficient coding have been developed, such normative models are often abstract and lacking sufficient detail to compare directly to experiments. The intention of this work to produce a more plausible and efficient spiking model and compare it with experimental data is important and necessary in order to test these models.

      In rigorously deriving the model with real physical units, this work maps efficient spiking networks onto other more classical biophysical spiking neuron models. It also attempts to compare the model to recent single-neuron perturbation experiments, as well as some long-standing puzzles about neural circuits, such as the presence of separate excitatory and inhibitory neurons, the ratio of excitatory to inhibitory neurons, and E/I balance. One of the primary goals of this paper, to determine if these are merely biological constraints or come from some normative efficient coding objective, is also important.

      Though several of the observations have been reported and studied before (see below), this work arguably studies them in more depth, which could be useful for comparing more directly to experiments.

      Weaknesses:

      Though the text of the paper may suggest otherwise, many of the modeling choices and observations found in the paper have been introduced in previous work on efficient spiking models, thereby making this work somewhat repetitive and incremental at times. This includes the derivation of the network into separate excitatory and inhibitory populations, discussion of physical units, comparison of voltage versus spike-timing correlations, and instantaneous E/I balance, all of which can be found in one of the first efficient spiking network papers (Boerlin et al. 2013), as well as in subsequent papers. Metabolic cost and slow adaptation currents were also presented in a previous study (Gutierrez & Deneve 2019). Though it is perfectly fine and reasonable to build upon these previous studies, the language of the text gives them insufficient credit.

      Furthermore, the paper makes several claims of optimality that are not convincing enough, as they are only verified by a limited parameter sweep of single parameters at a time, are unintuitive and may be in conflict with previous findings of efficient spiking networks. This includes the following. Coding error (RMSE) has a minimum at intermediate metabolic cost (Figure 5B), despite the fact that intuitively, zero metabolic cost would indicate that the network is solely minimizing coding error and that previous work has suggested that additional costs bias the output. Coding error also appears to have a minimum at intermediate values of the ratio of E to I neurons (effectively the number of I neurons) and the number of encoded variables (Figures 6D, 7B). These both have to do with the redundancy in the network (number of neurons for each encoded variable), and previous work suggests that networks can code for arbitrary numbers of variables provided the redundancy is high enough (e.g., Calaim et al. 2022). Lastly, the performance of the E-I variant of the network is shown to be better than that of a single cell type (1CT: Figure 7C, D). Given that the E-I network is performing a similar computation as to the 1CT model but with more neurons (i.e., instead of an E neuron directly providing lateral inhibition to its neighbor, it goes through an interneuron), this is unintuitive and again not supported by previous work. These may be valid emergent properties of the E-I spiking network derived here, but their presentation and description are not sufficient to determine this.

      Alternatively, the methodology of the model suggests that ad hoc modeling choices may be playing a role. For example, an arbitrary weighting of coding error and metabolic cost of 0.7 to 0.3, respectively, is chosen without mention of how this affects the results. Furthermore, the scaling of synaptic weights appears to be controlled separately for each connection type in the network (Table 1), despite the fact that some of these quantities are likely linked in the optimal network derivation. Finally, the optimal threshold and metabolic constants are an order of magnitude larger than the synaptic weights (Table 1). All of these considerations suggest one of the following two possibilities. One, the model has a substantial number of unconstrained parameters to tune, in which case more parameter sweeps would be necessary to definitively make claims of optimality. Or two, parameters are being decoupled from those constrained by the optimal derivation, and the optima simply corresponds to the values that should come out of the derivation.

    1. Reviewer #2 (Public Review):

      Many prey animals have eyespot-like markings (called eyespots) which have been shown in experiments to hinder predation. However, why eyespots are effective against predation has been debated. The authors attempt to use a meta-analytical approach to address the issue of whether eye-mimicry or conspicuousness makes eyespots effective against predation. They state that their results support the importance of conspicuousness. However, I am not convinced by this.

      There have been many experimental studies that have weighed in on the debate. Experiments have included manipulating target eyespot properties to make them more or less conspicuous, or to make them more or less similar to eyes. Each study has used its own set of protocols. Experiments have been done indoors with a single predator species, and outdoors where, presumably, a large number of predator species predated upon targets. The targets (i.e, prey with eyespot-like markings) have varied from simple triangular paper pieces with circles printed on them to real lepidopteran wings. Some studies have suggested that conspicuousness is important and eye-mimicry is ineffective, while other studies have suggested that more eye-like targets are better protected. Therefore, there is no consensus across experiments on the eye-mimicry versus conspicuousness debate.

      The authors enter the picture with their meta-analysis. The manuscript is well-written and easy to follow. The meta-analysis appears well-carried out, statistically. Their results suggest that conspicuousness is effective, while eye-mimicry is not. I am not convinced that their meta-analysis provides strong enough evidence for this conclusion. The studies that are part of the meta-analysis are varied in terms of protocols, and no single protocol is necessarily better than another. Support for conspicuousness has come primarily from one research group (as acknowledged by the authors), based on a particular set of protocols.

      Furthermore, although conspicuousness is amenable to being quantified, for e.g., using contrast or size of stimuli, assessment of 'similarity to eyes' is inherently subjective. Therefore, manipulation of 'similarity to eyes' in some studies may have been subtle enough that there was no effect.

      There are a few experiments that have indeed supported eye-mimicry. The results from experiments so far suggest that both eye-mimicry and conspicuousness are effective, possibly depending on the predator(s). Importantly, conspicuousness can benefit from eye-mimicry, while eye-mimicry can benefit from conspicuousness.

      Therefore, I argue that generalizing based on a meta-analysis of a small number of studies that conspicuousness is more important than eye-mimicry is not justified. To summarize, I am not convinced that the current study rules out the importance of eye-mimicry in the evolution of eyespots, although I agree with the authors that conspicuousness is important.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors present a software package "aTrack" for identification of motion types and parameter estimation in single-particle tracking data. The software is based on maximum likelihood estimation of the time-series data given an assumed motion model and likelihood ratio tests for model selection. They characterized the performance of the software mostly on simulated data and showed that it is applicable to experimental data.

      Strengths:

      A potential advantage of the presented method is its wide applicability to different motion types.

      Weaknesses:

      (1) There has been a lot of similar work in this field. Even though the authors included many relevant citations in the introduction, it is still not clear what this work uniquely offers. Is it the first time that direct MLE of the time-series data was developed? Suggestions to improve would include (a) better wording in the introduction section, (b) comparing to other popular methods (based on MSD, step-size statistics (Spot-On, eLife 2018;7:e33125), for example) using the simulated dataset generated by the authors, (c) comparing to other methods using data set in challenges/competitions (Nat. Comm (2021) 12:6253).

      (2) The Hypothesis testing method presented here has a number of issues: first, there is no definition of testing statistics. Usually, the testing statistics are defined given a specific (Type I and/or Type II) error rate. There is also no discussion of the specificity and sensitivity of the testing results (i.e. what's the probability of misidentification of a Brownian trajectory as directed? etc). Related, it is not clear what Figure 2e (and other similar plots) means, as the likelihood ratio is small throughout the parameter space. Also, for likelihood ratio tests, the authors need to discuss how model complexity affects the testing outcome (as more complex models tend to be more "likely" for the data) and also how the likelihood function is normalized (normalization is not an issue for MLE but critical for ratio tests).

      (3) Relating to the mathematical foundation (Figure 1b). The measured positions are drawn as direct arrows from the real position states: this infers instantaneous localization. In reality, there is motion blur which introduces a correlation of the measured locations. Motion blur is known to introduce bias in SPT analysis, how does it affect the method here?

      (4) The authors did not go through the interpretation of the figure. This may be a matter of style, but I find the figures ambiguous to interpret at times.

      (5) It is not clear to me how the classification of the 5 motion types was accomplished.

      (6) Figure 3. Caption: what is ((d_{est}-0.1)/0.1)? Also panel labeled as "d" should be "e".

    1. Reviewer #2 (Public Review):

      Summary:

      Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to using humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

      In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

      Strengths:

      (1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debatable, these description is valuable knowledge for this field of research.

      (2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

      Weaknesses:

      (1) In this manuscript, for example in Figure 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

      (2) The definition of "Disease" discussed after Figure 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

      (3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Figure 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

    1. Reviewer #2 (Public Review):

      Summary:

      This is an important study characterizing striatal dysfunction and behavioral deficits in Cntnap2-/- mice. There is growing evidence suggesting that striatal dysfunction underlies core symptoms of ASD but the specific cellular and circuit level abnormalities disrupted by different risk genes remain unclear. This study addresses how the deletion of Cntnap2 affects the intrinsic properties and synaptic connectivity of striatal spiny projection neurons (SPN) of the direct (dSPN) and indirect (iSPN) pathways. Using Thy1-ChR2 mice and optogenetics the authors found increased firing of both types of SPNs in response to cortical afferent stimulation. However, there was no significant difference in the amplitude of optically-evoked excitatory postsynaptic currents (EPSCs) or spine density between Cntnap2-/- and WT SPNs, suggesting that the increased corticostriatal coupling might be due to changes in intrinsic excitability. Indeed, the authors found Cntnap2-/- SPNs, particularly dSPNs, exhibited higher intrinsic excitability, reduced rheobase current, and increased membrane resistance compared to WT SPNs. The enhanced spiking probability in Cntnap2-/- SPNs is not due to reduced inhibition. Despite previous reports of decreased parvalbumin-expressing (PV) interneurons in various brain regions of Cntnap2-/- mice, the number and function (IPSC amplitude and intrinsic excitability) of these interneurons in the striatum were comparable to WT controls.

      This study also includes a comprehensive behavioral analysis of striatal-related behaviors. Cntnap2-/- mice demonstrated increased repetitive behaviors (RRBs), including more grooming bouts, increased marble burying, and increased nose poking in the holeboard assay. MoSeq analysis of behavior further showed signs of altered grooming behaviors and sequencing of behavioral syllables. Cntnap2-/- mice also displayed cognitive inflexibility in a four-choice odor-based reversal learning assay. While they performed similarly to WT controls during acquisition and recall phases, they required significantly more trials to learn a new odor-reward association during reversal, consistent with potential deficits in corticostriatal function.

      Strengths:

      This study provides significant contributions to the field. The finding of altered SPN excitability, the detailed characterization of striatal inhibition, and the comprehensive behavioral analysis are novel and valuable to understanding the pathophysiology of Cntnap2-/- mice.

      Weaknesses:

      (1) The approach based on Thy-ChR2 mice has the advantage of overcoming issues caused by injection efficiency and targeting variability. However, the spread of oEPSC amplitudes across mice shown in panels of Figure 1 G/I is very high with almost one order of magnitude difference between some mice. Given this is one of the most important points of the study it will be important to further analyze and discuss what this variability might be due to. Typically, in acute slice recordings, the within-animal variability is larger than the variability across animals. From the sample sizes reported it seems the authors sampled a large number of animals, but with a relatively low number of neurons per animal (per condition). Could this be one of the reasons for this variability?

      (2) This is particularly important because the analysis of corticostriatal evoked APs in panels C and E is performed on pooled data without considering the variability in evoked current amplitudes across animals shown in G and I. Were the neurons in panels C/E recorded from the same mice as shown in G/I? If so, it would be informative to regress AP firing data (say at 20% LED) to the average oEPSC amplitude recorded on those mice at the same light intensity. However, if the low number of neurons recorded per mouse is due to technical limitations, then increasing the sample size of these experiments would strengthen the study.

      (3) On a similar note, there is no discussion of why iSPNs also show increased corticostriatal evoked firing in Figure 1E, despite the difference in intrinsic excitability shown in Figure 3. This suggests other potential mechanisms that might underlie altered corticostriatal responses. Given the role of Caspr2 in clustering K channels in axons, altered presynaptic function or excitability could also contribute to this phenotype, but potential changes in PPR have not been explored in this study.

      (4) Male and female SPNs have different intrinsic properties but the number and/or balance of M/F mice used for each experiment is not reported.

      (5) There is no mention of how membrane resistance was calculated, and no I/V plots are shown.

      (6) It would be interesting to see which behavior transitions most contribute to the decrease in entropy. Are these caused by repeated or perseverative grooming bouts? Or is this inflexibility also observed across other behaviors? The transition map in Figure S5 shows the overall number of syllables and transitions but not their sequence during behavior. Can this be analyzed by calculating the ratio of individual 𝑢𝑖 × 𝑝𝑖,𝑗 × log2 𝑝𝑖,𝑗 factors across genotypes?

    1. Reviewer #2 (Public Review):

      Summary:

      Boldt et al. investigated whether previously established relationships between transdiagnostic psychiatric symptom dimensions and confidence distortions would result in downstream influences on the confidence-related behaviour of reminder setting. 600 individuals from the general population completed a battery of psychiatric symptom questionnaires and an online reminder-setting task. In line with previous studies, individuals high in compulsivity (CIT) showed over-confidence in their task performance, whereas individuals high in anxious depression (AD) tended to be under-confident. Crucially, the over-confidence associated with CIT partially mediated a decreased tendency to use external reminders during task performance, whereas the under-confidence associated with AD did not result in any alteration in the external reminder setting. The authors suggest that metacognitive monitoring is impaired in CIT which has a knock-on effect on reminder setting behaviour, but that a direct link also exists between CIT and reduced reminder setting independently of confidence.

      Strengths:

      The study combines the latest advances in transdiagnostic approaches to psychopathology with a cleverly designed external reminder-setting task. The approach allows for investigation of what some of the downstream consequences associated with impaired metacognition in sub-clinical psychopathology may be.

      The experimental design and hypotheses were pre-registered prior to data collection.

      The manuscript is well written and rigorous analysis approaches are used throughout.

      Weaknesses:

      Participants only performed a single task so it remains unclear if the observed effects would generalise to reminder-setting in other cognitive domains.

      The sample consisted of participants recruited from the general population. Future studies should investigate whether the effects observed extend to individuals with the highest levels of symptoms (including clinical samples).

    1. Reviewer #2 (Public Review):

      Summary:

      This paper attempts to examine how rare, extreme events impact decision-making in rats. The paper used an extensive behavioural study with rats to evaluate how the probability and magnitude of outcomes impact preference. The paper, however, provides limited evidence for the conclusions because the design did not allow for the isolation of the rare, extreme events in choice. There are many confounding factors, including the outcome variance and presence of less-rare, and less-extreme outcomes in the same conditions.

      Strengths:

      (1) The major strength of the paper is the significant volume of behavioural data with a reasonable sample size of 20 rats.

      (2) The paper attempts to examine losses with rats (a notoriously tricky problem with non-human animals) by substituting time-outs as a proxy for losses. This allows for mixed gambles that have both gain and loss possible outcomes.

      (3) The paper integrates both a behavioural and a modelling approach to get at the factors that drive decision-making.

      (4) The paper takes seriously the question of what it means for an event to be rare, pushing to less frequent outcomes than usually used with non-human animals.

      Weaknesses:

      (1) The primary issue with this work is that the primary experimental manipulation fails to isolate the rare, extreme events in choice. As I understand the task, in all the conditions with a rare extreme event (e.g., 80 pellets with probability epsilon), there is also a less-rare, less-extreme event (e.g., 12 pellets with probability 5). In addition, the variance differs between the two conditions. So, any impact attributable to the rare, extreme event could be due to the less rare event or due difference in the variance. The design does not support the conclusions. Finally, by deliberately confounding rarity and extremity, the design does not allow for assessing the impact of either aspect.

      (2) The RL-modelling work also fails to show a specific impact of the rare extreme event. As best as I can understand Eq 2, the model provides a free parameter that adds a bonus to the value of either the two options with high-variance gains (A and V in the paper) or to the two options with high-variance losses (F and V in the paper). This parameter only depends on whether this option could have possibly yielded the rare, extreme outcome (i.e., based on the generative probability) and was not connected to its actual appearance. That makes it a free parameter that just bumps up (or down) the probability of selecting a pair of options. In the case of the "black swan" or high-variance loss conditions, this seems very much like a loss aversion parameter, but an additive one instead of a multiplicative one.

      (3) The paper presented the methods and results with lots of neologisms and fairly obscure jargon (e.g., fragility, total REE sensitivity). That made it very hard to decipher exactly what was done and what was found. For example, on p. 4, the use of concave and convex was very hard to decipher; the text even has to repeat itself 3 times (i.e., "to repeat" and "in other words") and is still not clear. It would be much clearer (and probably accurate) to say that the options varied along the variance dimension, separately for gains and losses. Option A was low-variance gains and losses. Option B was low-variance losses and high-variance gains. Option C was high-variance losses and low-variance gains, and Option D was high-variance losses and gains. That tells much more clearly what the animals experienced without the reader having to master a set of new terminologies around fragility and robustness, which brings a set of theoretical assumptions unnecessarily into the description of the experimental design. In terms of results, "Black Swan" avoidance is more simply known as risk aversion for losses.

      (4) Were the probabilities shuffled or truly random (seem to be fixed sequences, so neither)? What were the experienced probabilities? Given the fixed sequences, these experienced ("ex-post") probabilities, could differ tremendously from the scheduled ("ex ante") probabilities. It's quite possible that an animal never experienced the rare, extreme event for a specific option. It's even possible (if they only picked it on the 10th/60th choices by chance), that they only ever experienced that rare extreme event. This cannot be known given the information provided. The Supplemental info on p.55 only gives gross overall numbers but does not indicate what the rats experienced for each choice/option-which is what matters here. A simple table that indicates for each of the 4 options, how often they were selected, and how often the animals experienced each of the 6-8 possible outcome would make it much clearer how closely the experience matched the planned outcomes. In addition, by restricting the rare outcome to either the 10th or 60th activations in a session, these are not random. Did the animals learn this association?

      (5) The choice data are only presented in an overprocessed fashion with a sum and a difference (in both figures and tables). The basic datum (probability/frequency of selecting each of the 4 options) is not provided directly, even if it can theoretically be inferred from the sum and the difference. To understand what the rats actually do, we first need to see how often they select each option, without these transformations.

      (6) There is insufficient detail provided on the inferential statistical tests (e.g., no degrees of freedom or effect sizes), and only limited information on exactly what tests were run and how (bootstrapping, but little detail). Without code or data (only summary information is provided in the supplement), this is difficult to evaluate. In addition, the studies seem not to be pre-registered in any way, leaving many researchers with degrees of freedom. Were any alternative analysis pipelines attempted? Similarly, there were many sub-groupings of the animals, and then comparisons between them - were these post-hoc?

      (7) On p. 17, there is an attempt to look at the impact of a rare, extreme event by plotting a measure of preference for the 10 trials before/after the rare, extreme event. In the human literature, the main impact of experiencing a rare, extreme event is what is known as the wavy recency effect (See Plonsky et al. 2015 in Psych Review for example). What this means is that there tends to be some immediate negative recency (e.g., avoiding a rare gain) followed by positive recency (e.g., chasing the rare gain). Using a 10-trial window would thus obscure any impact of this rare, extreme event. An analysis that looks at a time course trial-by-trial could reveal any impact.

      (8) As I understood the method (p. 31), the assignment of options to physical locations was not random or counterbalanced, but deliberately biased to have one of the options in the preferred location. This would seem to create a bias towards a particular option and a bias away from the other options, which confounds the preference data in subsequent analyses.

      (9) Are delays really losses? This is a big assumption. Magnitude and delay are different aspects of experience, which are not necessarily commensurable and can be manipulated independently. And, for the model, how were these delays transformed into outcomes for the model? Eq 1 skips over that. Is there an assumption of linearity? In addition, I was not wholly clear if the delays meant fewer trials in a session or if the delays merely extended the session and meant longer delays until the next choice period.

      (10) The paper does not sufficiently accurately represent the existing literature on human risky decision-making (with and without rare events). Here are a few examples of misrepresented and/or missing literature:<br /> -Most studies on decision-making do not only rely on p > 10% (as per p. 2). Maybe that is true with animals, but not a fair statement generally. Some do, and some don't. There is substantial literature looking at rarer events in both descriptions (most famously with Kahneman & Tversky's work), but also in experience (which is alluded to in reference 19). That reference is not only about the situation when choices are not repeated (e.g. the sampling paradigm), but also partial feedback and full-feedback situations.

      The literature on learning from rewarding experiences in humans is obliquely referenced but not really incorporated. In short, there are two main findings - firstly people underweight rare events in experience; second, people overweight extreme outcomes in experience (both contrary to description). Some related papers are cited, but their content is not used or incorporated into the logic of the manuscript.

      One recent study systematically examined rarity and extremity in human risky decision-making, which seems very relevant here: Mason et al. (2024). Rare and extreme outcomes in risky choice. Psychonomic Bulletin & Review, 31, 1301-1308.

      There is a fair bit of research on the human perception of the risk of rare events (including from experience) and important events like climate. One notable paper is Newell et al (2015) in Nature Climate Change.

    1. Reviewer #2 (Public Review):

      The manuscript investigates the relationship between sleep, DNA damage, and aging in the Mexican cavefish (Astyanax mexicanus), a species that exhibits significant differences in sleep patterns between surface-dwelling and cave-dwelling populations. The authors aim to understand whether these evolved sleep differences influence the DNA damage response (DDR) and oxidative stress levels in the brain and gut of the fish.

      Summary of the Study:

      The primary objective of the study is to determine if the reduced sleep observed in cave-dwelling populations is associated with increased DNA damage and altered DDR. The authors compared levels of DNA damage markers and oxidative stress in the brains and guts of surface and cavefish. They also analyzed the transcriptional response to UV-induced DNA damage and evaluated the DDR in embryonic fibroblast cell lines derived from both populations.

      Strengths of the Study:

      Comparative Approach:<br /> The study leverages the unique evolutionary divergence between surface and cave populations of A. mexicanus to explore fundamental biological questions about sleep and DNA repair.

      Multifaceted Methodology:<br /> The authors employ a variety of methods, including immunohistochemistry, RNA sequencing, and in vitro cell line experiments, providing a comprehensive examination of DDR and oxidative stress.

      Interesting Findings:

      The study presents intriguing results showing elevated DNA damage markers in cavefish brains and increased oxidative stress in cavefish guts, alongside a reduced transcriptional response to UV-induced DNA damage.

      Weaknesses of the Study:

      Link to Sleep Physiology:<br /> The evidence connecting the observed differences in DNA damage and DDR directly to sleep physiology is not convincingly established. While the study shows distinct DDR patterns, it does not robustly demonstrate that these are a direct result of sleep differences.

      Causal Directionality:<br /> The study fails to establish a clear causal relationship between sleep and DNA damage. It is possible that both sleep patterns and DDR responses are downstream effects of a common cause or independent adaptations to the cave environment.

      Environmental Considerations:<br /> The lab conditions may not fully replicate the natural environments of the cavefish, potentially influencing the results. The impact of these conditions on the study's findings needs further consideration.

      Photoreactivity in Albino Fish:<br /> The use of UV-induced DNA damage as a primary stressor may not be entirely appropriate for albino, blind cavefish. Alternative sources of genotoxic stress should be explored to validate the findings.

      Assessment of the Study's Achievements:

      The authors partially achieve their aims by demonstrating differences in DNA damage and DDR between surface and cavefish. However, the results do not conclusively support the claim that these differences are driven by or directly related to the evolved sleep patterns in cavefish. The study's primary claims are only partially supported by the data.

      Impact and Utility:

      The findings contribute valuable insights into the relationship between sleep and DNA repair mechanisms, highlighting potential areas of resilience to DNA damage in cavefish. While the direct link to sleep physiology remains unsubstantiated, the study's data and methods will be useful to researchers investigating evolutionary biology, stress resilience, and the molecular basis of sleep.

    1. Reviewer #2 (Public Review):

      Summary:

      Gu and Liang et. al investigated how auditory information is mapped and transformed as it enters and exits an auditory cortex. They use anterograde transsynaptic tracers to label and perform calcium imaging of thalamorecipient neurons in A1 and retrograde tracers to label and perform calcium imaging of corticothalamic output neurons. They demonstrate a degradation of tonotopic organization from the input to output neurons.

      Strengths:

      The experiments appear well executed, well described, and analyzed.

      Weaknesses:

      (1) Given that the CT and TR neurons were imaged at different depths, the question as to whether or not these differences could otherwise be explained by layer-specific differences is still not 100% resolved. Control measurements would be needed either by recording (1) CT neurons in upper layers, (2) TR in deeper layers, (3) non-CT in deeper layers and/or (4) non-TR in upper layers.

      (2) What percent of the neurons at the depths are CT neurons? Similar questions for TR neurons?

      (3) V-shaped, I-shaped, or O-shaped is not an intuitively understood nomenclature, consider changing. Further, the x/y axis for Figure 4a is not labeled, so it's not clear what the heat maps are supposed to represent.

      (4) Many references about projection neurons and cortical circuits are based on studies from visual or somatosensory cortex. Auditory cortex organization is not necessarily the same as other sensory areas. Auditory cortex references should be used specifically, and not sources reporting on S1, and V1.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, "Cryo-EM structure of the bicarbonate receptor GPR30," the authors aimed to enrich our understanding of the role of GPR30 in pH homeostasis by combining structural analysis with a receptor function assay. This work is a natural development and extension of their previous work (PMID: 38413581). In the current body of work, they solved the first cryo-EM structure of the human GPR30-G-protein (mini-Gsqi) complex in the presence of bicarbonate ions at 3.21 Å resolution. From the atomic model built based on this map, they observed the overall canonical architecture of class A GPCR and also identified 4 extracellular pockets created by extracellular loops (ECLs) (Pockets A-D). Based on the polarity, location, and charge of each pocket, the authors hypothesized that pocket D is a good candidate for the bicarbonate binding site. To verify their structural observation, on top of the 10 mutations they generated in the previous work, the authors introduced another 11 mutations to map out the essential residues for the bicarbonate response on hGPR30. In addition, the human GPR30-G-protein complex model also allowed the authors to untangle the G-protein coupling mechanism of this special class A GPCR that plays an important role in pH homeostasis.

      Strengths:

      As a continuation of their recent Nature Communication publication (PMID: 38413581), this study was carefully designed, and the authors used mutagenesis and functional studies to confirm their structural observations. This work provided high-resolution structural observations for the receptor in complex with G-protein, allowing us to explore its mechanism of action, and will further facilitate drug development targeting GPR30. There were 4 extracellular pockets created by ECLs (Pockets A-D). The authors were able to filter out 3 of them and identified that pocket D was a good candidate for the bicarbonate binding site based on the polarity, location, and charge of each pocket. From there, the authors identified the key residues on GPR30 for its interaction with the substrate, bicarbonate. Together with their previous work, they carefully mapped out nine amino acids that are critical for receptor reactivity.

      Weaknesses:

      It is unclear how novel the aspects presented in the new paper are compared to the most recent Nature Communications publication (PMID: 38413581). Some areas of the manuscript appear to be mixed with the previous publication. The work is still impactful to the field. The new and novel aspects of this manuscript could be better highlighted.

      I also have some concerns about the TGFα shedding assay the authors used to verify their structural observation. I understand that this assay was also used in the authors' previous work published in Nature Communications. However, there are still several things in the current data that raised concerns:

      (1) The authors confirmed the "similar expression levels of HA-tagged hGPR30" mutants by WB in Supplemental Figure 1A and B. However, compared to the hGPR30-HA (~6.5 when normalized to the housekeeping gene, Na-K-ATPase), several mutants of the key amino acids had much lower surface expression: S134A, D210A, C207A had ~50% reduction, D125A had ~30% reduction, and Q215A and P71A had ~20% reduction. This weakens the receptor reactivity measured by the TGFα shedding assay.

      (2) In the previous work, the authors demonstrated that hGPR30 signals through the Gq signaling pathway and can trigger calcium mobilization. Given that calcium mobilization is a more direct measurement for the downstream signaling of hGPR30 than the TGFα shedding assay, pairing the mutagenesis study with the calcium assay will be a better functional validation to confirm the disruption of bicarbonate signaling.

      (3) It was quite confusing for Figure 4B that all statistical analyses were done by comparing to the mock group. It would be clearer to compare the activity of the mutants to the wild-type cell line.

      Additional concerns about the structural data include:

      (1) E218 was in close contact with bicarbonate in Figure 4D. However, there is no functional validation for this observation. Including the mutagenesis study of this site in the cell-based functional assay will strengthen this structural observation.

      (2) For the flow chart of the cryo-EM data processing in Supplemental data 2, the authors started with 10,148,422 particles after template picking, then had 441,348 Particles left after 2D classification/heterogenous refinement, and finally ended with 148,600 particles for the local refinement for the final map. There seems to be a lot of heterogeneity in this purified sample. GPCRs usually have flexible and dynamic loop regions, which explains the poor resolution of the ECLs in this case. Thus, a solid cell-based functional validation is a must to assign the bicarbonate binding pocket to support their hypothesis.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Fujita et al. characterized the neutrality indexes of several protein mutants in S. cerevisiae and uncovered that mox-YG and Gpm1-CCmut can be expressed as abundant as 40% of total proteins without causing severe growth defects. The authors then looked at the transcriptome and proteome of cells expressing excess mox-YG to investigate how protein burden affects yeast cells. Based on RNA-seq and mass-spectrometry results, the authors uncover that cells with excess mox-YG exhibit nitrogen starvation, respiration increase, inactivated TORC1 response, and decreased ribosomal abundance. The authors further showed that the decreased ribosomal amount is likely due to nucleoli defects, which can be partially rescued by nuclear exosome mutations.

      Strengths:

      Overall, this is a well-written manuscript that provides many valuable resources for the field, including the neutrality analysis on various fluorescent proteins and glycolytic enzymes, as well as the RNA-seq and proteomics results of cells overexpressing mox-YG. Their model on how mox-YG overexpression impairs the nucleolus and thus leads to ribosomal abundance decline will also raise many interesting questions for the field.

      Weaknesses:

      The authors concluded from their RNA-seq and proteomics results that cells with excess mox-YG expression showed increased respiration and TORC1 inactivation. I think it will be more convincing if the authors can show some characterization of mitochondrial respiration/membrane potential and the TOR responses to further verify their -omic results.

      In addition, the authors only investigated how overexpression of mox-YG affects cells. It would be interesting to see whether overexpressing other non-toxic proteins causes similar effects, or if there are protein-specific effects. It would be good if the authors could at least discuss this point considering the workload of doing another RNA-seq or mass-spectrum analysis might be too heavy.

    1. Reviewer #2 (Public Review):

      Satouh et al report the presence of spherical structures composed of endosomes, lysosomes, and autophagosomes within immature mouse oocytes. These endolysosomal compartments have been named as Endosomal-LYSosomal organellar Assembly (ELYSA). ELYSAs increase in size as the oocytes undergo maturation. ELYSAs are distributed throughout the oocyte cytoplasm of GV stage immature oocytes but these structures become mostly cortical in the mature oocytes. Interestingly, they tend to avoid the region which contains metaphase II spindle and chromosomes. They show that the endolysosomal compartments in oocytes are less acidic and therefore non-degradative but their pH decreases and becomes degradative as the ELYSAs begin to disassemble in the embryos post-fertilization. This manuscript shows that lysosomal switching does not happen during oocyte development, and the formation of ELYSAs prevents lysosomes from being activated. Structures similar to these ELYSAs have been previously described in mouse oocytes (Zaffagnini et al, 2024) and these vesicular assemblies are important for sequestering protein aggregates in the oocytes but facilitate proteolysis after fertilization. The current manuscript, however, provides further details of endolysosomal disassembly post-fertilization. Specifically, the V1-subunit of V-ATPase targeting the ELYSAs increases the acidity of lysosomal compartments in the embryos. This is a well-conducted study and their model is supported by experimental evidence and data analyses.

    1. Reviewer #2 (Public Review):

      Summary:

      Adhikari and colleagues developed a new technique, rapamycin-induced proximity assay (RiPA), to identify E3-ubiquitin (ub) ligases of a protein target, aiming at identifying additional E3 ligases that could be targeted for PROTAC generation or ligases that may degrade a protein target. The study is timely, as expanding the landscape of E3-ub ligases for developing targeted degraders is a primary direction in the field.

      Strengths:

      The study's strength lies in its practical application of the FRB:FKBP12 system. This system is used to identify E3-ub ligases that would degrade a target of interest, as evidenced by the reduction in luminescence upon the addition of rapamycin. This approach effectively mimics the potential action of a PROTAC.

      Weaknesses:

      (1) While the technique shows promise, its application in a discovery setting, particularly for high-throughput or unbiased E3-ub ligase identification, may pose challenges. The authors should provide more detailed insights into these potential difficulties to foster a more comprehensive understanding of RiPA's limitations.

      (2) While RiPA will help identify E3 ligases, PROTAC design would still be empirical. The authors should discuss this limitation. Could the technology be applied to molecular glue generation?

      (3) Controls to verify the intended mechanism of action are missing, such as using a proteasome inhibitor or VHL inhibitors/siRNA to verify on-target effects. Verification of the target E3 ligase complex after rapamycin addition via orthogonal approaches, such as IP, should be considered.

      Minor concern:

      The graphs in Figure 1E are missing.

    1. Reviewer #2 (Public Review):

      Summary:

      The investigation provides computational as well as biochemical insights into the (un)binding mechanisms of a pair of psychoactive substances into cannabinoid receptors. A combination of molecular dynamics simulation and a set of state-of-the art statistical post-processing techniques were employed to exploit GPCR-ligand dynamics.

      Strengths:

      The strength of the manuscript lies in the usage and comparison of TRAM as well as Markov state modelling (MSM) for investigating ligand binding kinetics and thermodynamics. Usually, MSMs have been more commonly used for this purpose. But as the authors have pointed out, implicit in the usage of MSMs lies the assumption of detailed balance, which would not hold true for many cases especially those with skewed binding affinities. In this regard, the author's usage of TRAM which harnesses both biased and unbiased simulations for extracting the same, provides a more appropriate way out.

      Weaknesses:

      (1) While the authors have used TRAM (by citing MSM to be inadequate in these cases), the thermodynamic comparisons of both techniques provide similar values. In this case, one would wonder what advantage TRAM would hold in this particular case.

      (2) The initiation of unbiased simulations from previously run biased metadynamics simulations would almost surely introduce hysteresis in the analysis. The authors need to address these issues.

      (3) The choice of ligands in the current work seems very forced and none of the results compare directly with any experimental data. An ideal case would have been to use the seminal D.E. Shaw research paper on GPCR/ligand binding as a benchmark and then show how TRAM, using much lesser biased simulation times, would fare against the experimental kinetics or even unbiased simulated kinetics of the previous report

      (4) The method section of the manuscript seems to suggest all the simulations were started from a docked structure. This casts doubt on the reliability of the kinetics derived from these simulations that were spawned from docked structure, instead of any crystallographic pose. Ideally, the authors should have been more careful in choosing the ligands in this work based on the availability of the crystallographic structures.

      (5) The last part of using a machine learning-based approach to analyse allosteric interaction seems to be very much forced, as there are numerous distance-based more traditional precedent analyses that do a fair job of identifying an allosteric job.

      (6) While getting busy with the methodological details of TRAM vs MSM, the manuscript fails to share with sufficient clairty what the distinctive features of two ligand binding mechanisms are.

    1. Reviewer #2 (Public Review):

      Summary of goals:

      The aims of the study were to identify new lineage trajectories for the cardiac lineages of the heart, and to use computational and cell and animal studies to identify and validate new gene regulatory mechanisms involved in these trajectories.

      Strengths:

      The study addresses the long-standing yet still not fully answered questions of what drives the earliest specification mechanisms of the heart lineages. The introduction demonstrates a good understanding of the relevant lineage trajectories that have been previously established, and the significance of the work is well described. The study takes advantage of several recently published data sets and attempts t use these in combination to uncover any new mechanisms underlying early mesoderm/cardiac specification mechanisms. A strength of the study is the use of an in vitro model system (mESCs) to assess the functional relevance of the key players identified in the computational analysis, including innovative technology such as CRISPR-guided enhancer modulations. Lastly, the study generates mesoderm-specific Hand1 LOF embryos and assesses the differentiation trajectories in these animals, which represents a strong complementary approach to the in vitro and computational analysis earlier in the paper. The manuscript is clearly written and the methods section is detailed and comprehensive.

      Comments and Weaknesses:

      Overall: The computational analysis presented here integrates a large number of published data sets with one new data point (E7.0 single cell ATAC and RNA sequencing). This represents an elegant approach to identifying new information using available data. However, the data presentation at times becomes rather confusing, and relatively strong statements and conclusions are made based on trajectory analysis or other inferred mechanisms while jumping from one data set to another. The cell and in vivo work on Hand1 and Foxf1 is an important part of the study. Some additional experiments in both of these model systems could strongly support the novel aspects that were identified by the computational studies leading into the work.

      (1) Definition of MJH and PSH trajectory:<br /> The study uses previously published data sets to identify two main new differentiation trajectories: the MJH and the PSH trajectory (Figure 1). A large majority of subsequent conclusions are based on in-depth analysis of these two trajectories. For this reason, the method used to identify these trajectories (WTO, which seems a highly biased analysis with many manually chosen set points) should be supported by other commonly used methods such as for example RNA velocity analysis. This would inspire some additional confidence that the MJH and PSH trajectories were chosen as unbiased and rigorous as possible and that any follow-up analysis is biologically relevant.

      (2) Identification of MJH and PSH trajectory progenitors:<br /> The study defines various mesoderm populations from the published data set (Figure 1A-E), including nascent mesoderm, mixed mesoderm, and extraembryonic mesoderm. It further assigns these mesoderm populations to the newly identified MJH/PSH trajectories. Based on the trajectory definition in Figure 1A it appears that both trajectories include all 3 mesoderm populations, albeit at different proportions and it seems thus challenging to assign these as unique progenitor populations for a distinct trajectory, as is done in the epigenetic study by comparing clusters 8 (MJH) and s (PSH)(Figure 2). Along similar lines, the epigenetic analysis of clusters 2 and 8 did not reveal any distinct differences in H3K4m1, H3K27ac, or H3K4me3 at any of the time points analyzed (Figure 2F). While conceptually very interesting, the data presented do not seem to identify any distinct temporal patterns or differences in clones 2 and 8 (Figure 2H), and thus don't support the conclusion as stated: "the combined transcriptome and chromatin accessibility analysis further supported the early lineage segregation of MJH and the epigenetic priming at gastrulation stage for early cardiac genes".

      (3) Function of Hand1 and Foxf1 during early cardiac differentiation:<br /> The study incorporated some functional studies by generating Hand1 and Foxf1 KO mESCs and differentiated them into mesoderm cells for RNA sequencing. These lines would present relevant tools to assess the role of Hand1 and Foxf1 in mesoderm formation, and a number of experiments would further support the conclusions, which are made for the most part on transcriptional analysis. For example, the study would benefit from quantification of mesoderm cells and subsequent cardiomyocytes during differentiation (via IF, or more quantitatively, via flow cytometry analysis). These data would help interpret any of the findings in the bulk RNAseq data, and help to assess the function of Hand1 and Foxf1 in generating the cardiac lineages. Conclusions such as "the analysis indicated that HAND1 and FOXF1 could dually regulate MJH specification through directly activating the MJH specific genes and inhibiting PSH specific genes" seem rather strong given the data currently provided.

      (4) Analysis of Hand1 cKO embryos:<br /> Adding a mouse model to support the computational analysis is a strong way to conclude the study. Given the availability of these early embryos, some of the findings could be strengthened by performing a similar analysis to Figure 7B&C and by including some of the specific EEM markers found to be differentially regulated to complement the structural analysis of the embryos.

      (5) Current findings in the context of previous findings:<br /> The introduction carefully introduces the concept of lineage specification and different progenitor pools. Given the enormous amount of knowledge already available on Hand1 and Foxf1, and their role in specific lineages of the early heart, some of this information should be added, ideally to the discussion where it can be put into context of what the present findings add to the existing understanding of these transcription factors and their role in early cardiac specification.

    1. Reviewer #2 (Public Review):

      Summary:

      James et al, in this study, build on their previous work investigating tau as a drug target. The authors identify tryptanthrin (TA) and its analogs as powerful inhibitors of tau4RD aggregation, even at low concentrations (nanomolar range). Interestingly, these analogs specifically target the initial stages of aggregation, where tau self-association first begins. This targeted approach effectively explains why such small amounts of tryptanthrin analogs are sufficient for inhibition. The study further shows that slight modifications to the structure of these molecules can significantly impact their effectiveness.

      Strengths:

      The experiments are well-designed and executed. The reviewer, in particular, appreciates the authors for the simple yet intelligent study design to understand the mechanism of aggregation inhibition by TA analogs.

      Weaknesses:

      Certain areas in the manuscript need clarifications, revisions, or additional supporting studies to strengthen the outcomes. For example, the authors mostly apply a single approach to assess tau aggregation or aggregation inhibition. Using additional techniques as suggested below will be helpful.

    1. Reviewer #2 (Public Review):

      The authors addressed the question of how mitochondrial proteins that are dually localized or only to a minor fraction localized to mitochondria can be visualized on the whole genome scale. For this, they used an established and previously published method called BiG split-GFP, in which GFP strands 1-10 are encoded in the mitochondrial DNA and fused the GFP11 strand C-terminally to the yeast ORFs using the C-SWAT library. The generated library was imaged under different growth and stress conditions and yielded positive mitochondrial localization for approximately 400 proteins. The strength of this method is the detection of proteins that are dually localized with only a minor fraction within mitochondria, which so far has hampered their visualization due to strong fluorescent signals from other cellular localizations. The weakness of this method is that due to the localization of the GFP1-10 in the mitochondrial matrix, only matrix proteins and IM proteins with their C-termini facing the matrix can be detected. Also, proteins that are assembled into multimeric complexes (which will be the case for probably a high number of matrix and inner membrane-localized proteins) resulting in the C-terminal GFP11 being buried are likely not detected as positive hits in this approach. Taking these limitations into consideration, the authors provide a new library that can help in the identification of eclipsed protein distribution within mitochondria, thus further increasing our knowledge of the complete mitochondrial proteome. The approach of global tagging of the yeast genome is the logical consequence after the successful establishment of the BiG split-GFP for mitochondria. The authors also propose that their approach can be applied to investigate the topology of inner membrane proteins, however, for this, the inherent issue remains that it cannot be excluded that even the small GFP11 tag can impact on protein biogenesis and topology. Thus, the approach will not overcome the need to assess protein topology analysis via biochemical approaches on endogenous untagged proteins.

    1. Reviewer #2 (Public Review):

      The manuscript by Harry and Zakas determined the extent to which gene expression differences contribute to developmental divergence by using a model that has two distinct developmental morphs within a single species. Although the authors did collect a valuable dataset and trends in differential expression between the two morphs of S. benedicti were presented, we found limitations about the methods, system, and resources that the authors should address.

      We have two major points:

      (1) Background information about the biological system needs to be clarified in the introduction of this manuscript. The authors stated that F1 offspring can have intermediate larval traits compared to the parents (Line 81). However, the authors collected F1 offspring at the same time as the mother in the cross. If offspring have intermediate larval traits, their developmental timeline might be different than both parents and necessitate the collection of offspring at different times to obtain the same stages as the parents. Could the authors (1) explain why they collected offspring at the same time as parents given that other literature and Line 81 state these F1 offspring develop at intermediate rates, and (2) add the F1 offspring to Figure 1 to show morphological and timeline differences in development?

      Additionally, the authors state (Lines 83-85) that they detail the full-time course of embryogenesis for both the parents and the F1 crosses. However, we do not see where the authors have reported the full-time course for embryogenesis of the F1 offspring. Providing this information would shape the remaining results of the manuscript.

      (2) We have several concerns about the S. benedicti genome and steps regarding the read mapping for RNA-seq:

      The S. benedicti genome used (Zakas et al. 2022) was generated using the PP morph. The largest scaffolds of this assembly correspond to linkage groups, showing the quality of this genome. The authors should point out in the Methods and/or Results sections that the quality of this genome means that PP-specific gene expression can be quantified well. However, the challenges and limitations of mapping LL-specific expression data to the PP genome should be discussed.

      It is possible that the authors did not find exclusive gene expression in the LL morph because they require at least one gene to be turned on in one morph as part of the data-cleaning criteria. Because the authors are comparing all genes to the PP morph, they could be missing true exclusive genes responsible for the biological differences between the two morphs. Did they make the decision to only count genes expressed in one stage of the other morph because the gene models and mapping quality led to too much noise?

      The authors state that the mapping rates between the two morphs are comparable (Supplementary Figure 1). However, there is a lot of variation in mapping the LL individuals (~20% to 43%) compared to the PP individuals. What is the level of differentiation within the two morphs in the species (pi and theta)? The statistical tests for this comparison should be added and the associated p-value should be reported. The statistical test used to compare mapping rates between the two morphs may be inappropriate. The authors used Salmon for their RNA alignment and differential expression analysis, but it is possible that a different method would be more appropriate. For example, Salmon has some limitations as compared to Kallisto as others have noted. The chosen statistical test should be explained, as well as how RNA-seq data are processed and interpreted.

      What about the read mapping rate and details for the F1 LP and PL individuals? How did the offspring map to the P genome? These details should be included in Supplementary Figure 1. Could the authors also provide information about the number of genes expressed at each stage in the F1 LP and PL samples in S Figure 2? How many genes went into the PCA? Many of these details are necessary to evaluate the F1 RNA-seq analyses.

      Generally, the authors need to report the statistics used in data processing more thoroughly. The authors need to report the statistics used to (1) process and evaluate the RNA-seq data and (2) determine the significance between the two morphs (Supplementary Figures 1 and 2).

    1. Reviewer #2 (Public Review):

      Summary:

      The endocannabinoid system (ECS) regulates many critical functions, including reproductive function. Recent evidence indicates that dysregulated ECS contributes to endometriosis pathophysiology and microenvironment. Therefore, the authors further examined the dysregulated ECS and its mechanisms in endometriosis lesion establishment and progression using two different endometrial sources of mouse models of endometriosis with CNR1 and CNR2 knockout mice. The authors presented differential gene expressions and altered pathways, especially those related to the adaptive immune response in CNR1 and CNR2 ko lesions. Interstingly, the T-cell population was dramatically reduced in the peritoneal cavity lacking CNR2, and the loss of proliferative activity of CD4+ T helper cells. Imaging mass cytometry analysis provided spatial profiling of cell populations and potential relationships among immune cells and other cell types. This study provided fundamental knowledge of the endocannabinoid system in endometriosis pathophysiology.

      Strengths:

      Dysregulated ECS and its mechanisms in endometriosis pathogenesis were assessed using two different endometrial sources of mouse models of endometriosis with CNR1 and CNR2 knockout mice. Not only endometriotic lesions but also peritoneal exudate (and splenic) cells were analyzed to understand the specific local disease environment under the dysregulated ECS.

      Providing the results of transcriptional profiles and pathways, immune cell profiles, and spatial profiles of cell populations support altered immune cell population and their disrupted functions in endometriosis pathogenesis via dysregulation of ECS.

      L386: Role of CNR2 in T cells: Finding nearly absent CD3+ T cells in the peritoneal cavity of CNR2 ko mice is intriguing.

      Interpretation of the results is well-described in discussion.

      Weaknesses:

      The study was terminated and characterized 7 days after EM induction surgery without the details for selecting the time point to perform the experiments.

      The authors also mentioned that altered eutopic endometrium contributes to the establishment and progression of endometriosis. This reviewer agrees L324-325. If so, DEGs are likely identified between eutopic endometrium (with/without endometriosis lesion induction) and ectopic lesions. It would be nice to see the data (even though using publicly available data sets).

      Figure 7 CDEF. Please add the results of the statistical analyses and analyzed sample numbers. L444-450 cannot be reviewed without them.

      This reviewer agrees L498-500. In contrast, retrograded menstrual debris is not decidualized. The section could be modified to avoid misunderstanding.

      The authors addressed all my concerns. I do not have any comments.

    1. Reviewer #2 (Public Review):

      The manuscript by Zhang et al. explores the effect of autophagy regulator ATG6 on NPR1-mediated immunity. The authors propose that ATG6 directly interacts with NPR1 in the nucleus to increase its stability and promote NPR1-dependent immune gene expression and pathogen resistance. This novel role of ATG6 is proposed to be independent of its role in autophagy in the cytoplasm. The authors demonstrate through biochemical analysis that ATG6 interacts with NPR1 in yeast and very weakly in vitro. They further demonstrate using overexpression transgenic plants that in the presence of ATG6-mcherry the stability of NPR1-GFP and its nuclear pool is increased.

      Comments on revised version:

      The authors demonstrate the correlation between overexertion of atg6 and higher stability and activity of npr1. They claim a novel activity of atg6 in the nucleus.<br /> Overall, the experimental scope of the study is solid, however, the over-interpretation of the results substantially reduces the significance and value of this study for the target plant immunity readership.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to determine which lipid transfer proteins impact the lipids of Golgi apparatus, and they identified a reasonable number of "hits" where the lack of one lipid transfer protein affected a particular Golgi lipid or class of lipids. They then carried out something close to a "proof of concept" for one lipid (sphingomyelin) and two closely related lipid transfer proteins (ORP9/ORP11). They looked into that example in great detail and found a previous unknown relationship between the level of phosphatidylserine in the Golgi (presumably trans-Golgi, trans-Golgi Network) and function of the sphingomyelin synthase enzyme. This was all convincingly done - results support their conclusions - showing that the authors achieved their aims.

      Impact:

      There are likely to be 2 types of impact:

      (I) cell biology: sphoingomyelin synthase, ORP9/11 will be studied in future in more informed ways to understand (a) the role of different Golgi lipids - this work opens that out and produces a to more questions than answers (b) the role of different ORPs: what distinguishes ORP11 from its paralogy ORP10?

      (ii) molecular biochemistry: combining knockdown miniscreen with organelle lipidomics must be time-consuming, but here it is shown to be quite a powerful way to discover new aspects of lipid-based regulation of protein function. This will be useful to others as an example, and if this kind of workflow could be automated, then the possible power of the method could be widely applied.

      Strengths:

      Nicely controlled data;

      Wide-ranging lipidomics dataset with repeats and SDs - all data easily viewed.

      Simple take home message that PS traffic to the TGN by ORP9/11 is required for some aspect of SMS1 function.

      Weaknesses:

      Model and Discussion:

      Despite the authors saying that this has been addressed in their rebuttal, I still struggle to find any ideas about the aspect of SMS1 function that is being affected.

      As I mentioned before, even if no further experiments were carried out the authors could discuss possibilities. one might speculate what the PS is being used for. For example, is it a co-factor for integral membrane proteins, such as flippases? Is it a co-factor for peripheral membrane proteins, such as yet more LTPs? The model could include the work of Peretti et al (2008), which linked Nir2 activity exchanging PI:PA (Yadav et al, 2015) to the eventual function of CERT. Could the PS have a role in removing/reducing DAG produced by CERT?

    1. Reviewer #2 (Public Review):

      Salt stress is a significant and growing concern for agriculture in some parts of the world. While the effects of sodium excess have been studied in Arabidopsis and (many) crop species, most studies have focused on Na uptake, toxicity, and overall effects on yield, rather than on developmental responses to excess Na, per se. The work by Ishka and colleagues aims to fill this gap.

      Working from an existing dataset that exposed a diverse panel of A. thaliana accessions to control, moderate, and severe salt stress, the authors identify candidate loci associated with altering the root:shoot ratio under salt stress. Following a series of molecular assays, they characterize a DUF247 protein which they dub SR3G, which appears to be a negative regulator of root growth under salt stress.

      Overall, this is a well-executed study that demonstrates the functional role played by a single gene in plant response to salt stress in Arabidopsis.

      The abstract and beginning of the Discussion section highlight the "new tool" developed here for measuring biomass accumulation. I feel that this distracts from the central aims of the study, which is really about the role of a specific gene in root development under salt stress. I would suggest moving the tool description to less prominent parts of the manuscript.

    1. Reviewer #2 (Public Review):

      Summary:

      This study integrated single-cell sequencing and spatial transcriptome data from mouse heart tissue at different time points post-MI. They identified four transcriptionally distinct subtypes of lymphatic endothelial cells and localized them in space. They observed that LECs subgroups are localized in different zones of infarcted heart with functions. Specifically, they demonstrated that LEC ca III may be involved in directly regulating myocardial injuries in the infarcted zone concerning metabolic stress, while LEC ca II may be related to the rapid immune inflammatory responses of the border zone in the early stage of MI. LEC ca I and LEC collection mainly participate in regulating myocardial tissue edema resolution in the middle and late stages post-MI. Finally, cell trajectory and Cell-Chat analyses further identified that LECs may regulate myocardial edema through Aqp1, and likely affect macrophage infiltration through the galectin9-CD44 pathway. The authors concluded that their study revealed the dynamic transcriptional heterogeneity distribution of LECs in different regions of the infarcted heart and that LECs formed different functional subgroups that may exert different bioeffects in myocardial tissue post-MI.

      Strengths:

      The study addresses a significant clinical challenge, and the results are of great translational value. All experiments were carefully performed, and their data support the conclusion.

      Weaknesses:

      (1) Language expression must be improved. Many incomplete sentences exist throughout the manuscript. A few examples: Lines 70-71: In order to further elucidate the effects and regulatory mechanisms of the lymphatic vessels in the repair process of myocardial injury following MI. Lines 71-73: This study, integrated single-cell sequencing and spatial transcriptome data from mouse heart tissue at different time points after MI from publicly available data (E-MTAB-7895, GSE214611) in the ArrayExpress and gene expression omnibus (GEO) databases. Line 88-89: Since the membrane protein LYVE1 can present lymphatic vessel morphology more clearly than PROX1.

      (2) The type of animal models (i.e., permeant MI or MI plus reperfusion) included in ArrayExpress and gene expression omnibus (GEO) databases must be clearly defined as these two models may have completely different effects on lymphatic vessel development during post-MI remodeling.

      (3) Lines 119-120: Caution must be taken regarding Cav1 as a lymphocyte marker because Cav1 is expressed in all endothelial cells, not limited to LEC.

      (4) Figure 1 legend needs to be improved. RZ, BZ, and IZ need to be labeled in all IF images. Day 0 images suggest that RZ is the tissue section from the right ventricle. Was RZ for all other time points sampled from the right ventricular tissue section?

      (5) The discussion section needs to be improved and better focused on the findings from the current study.

    1. Reviewer #2 (Public Review):

      Summary:

      Transcriptomics technologies play important roles in biological studies. Technologies based on second-generation sequencing, such as mRNA-seq, face some serious obstacles, including isoform analysis, due to short read length. Third-generation sequencing technologies perfectly solve these problems by having long reads, but they are much more expensive. The authors presented a useful real-time strategy to minimize the cost of sequencing with Oxford Nanopore Technologies (ONT). The authors performed three sets of experiments to illustrate the utility of the real-time strategy. However, due to the problems in experimental design and analysis, their aims are not completely achieved. If the authors can significantly improve the experiments and analysis, the strategy they proposed will guide biologists to conduct transcriptomics studies with ONT in a fast and cost-effective way and help studies in both basic research and clinical applications.

      Strengths:

      The authors have recently developed a computational tool called NanopoReaTA to perform real-time analysis when cDNA/RNA samples are sequenced with ONT (Wierczeiko et al., 2023). The advantage of real-time analysis is that the sequencing can be stopped once enough data is collected to save cost. Here, they described three sets of experiments: a comparison between two human cell lines, a comparison among RNA preparation procedures, and a comparison between genetically modified yeasts. Their results show that the real-time strategy works for different species and different RNA preparation methods.

      Weaknesses:

      However, especially considering that the computational tool NanopoReaTA is their previous work, the authors should present more helpful guidelines to perform real-time ONT analysis and more advanced analysis methods. There are four major weaknesses:

      (1) For all three sets of experiments, the authors focused on sample clustering and gene-level differential expression analysis (DEA), and only did little analysis on isoform level and even nothing in any figures in the main text. Sample clustering and gene-level DEA can be easily and well done using mRNA-seq at a much cheaper cost. Even for initial data quality checking, mRNA-seq can be first done in Illumina MiSeq/NextSeq which is quick, before deep sequencing in HiSeq/NovaSeq. The real power of third-generation RNA sequencing is the isoform analysis due to the long read length. At least for now, PacBio Iso-seq is very expensive and one cannot analyze the data in real-time. Thus, the authors should focus on the real-time isoform analysis of ONT to show the advantages.

      (2) The sample sizes are too small in all three sets of experiments: only two for sets 1 and 2, and three for set 3. For DEA, three is the minimal number for proper statistics. But a sample size of three always leads to very poor power. Nowadays, a proper transcriptomics study usually has a larger sample size. Besides the power issue, biological samples always contain many outliers due to many reasons. It is crucial to show whether the real-time analysis also works for larger sample sizes, such as 10, i.e., 20 samples in total. Will the performance still hold when the sample number is increasing? What is the maximum sample number for an ONT run? If the samples need to be split into multiple runs, how the real-time analysis will be adjusted? These questions are quite useful for researchers who plan to use ONT.

      (3) According to the manuscript, real-time analysis checks the sequencing data in a few time points, this is usually called sequential analysis or interim analysis in statistics which is usually performed in clinical trials to save cost. Care must be taken while performing these analyses, as repeated checks on the data can inflate the type I error rate. Thus, the authors should develop a sequential analysis procedure for real-time RNA sequencing.

      (4) The experimental set 1 (comparison between two completely different human cell lines) and experimental set 2 (comparison among RNA preparation procedures) are not quite biologically meaningful. If it is possible, it is better for the authors to perform an experiment more similar to a real situation for biological discovery. Then the manuscript can attract more researchers to follow its guidelines.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript the authors have generated a single-cell atlas of the miracidium, the first free-living stage of an important human parasite, Schistosoma mansoni. Miracidia develop from eggs produced in the mammalian (human) host and are released into freshwater, where they can infect the parasite's intermediate snail host to continue the life cycle. This study adds to the growing single-cell resources that have already been generated for other life-cycle stages and, thus, provides a useful resource for the field.

      Strengths:

      Beyond generating lists of genes that are differentially expressed in different cell types, the authors validated many of the cluster-defining genes using in situ hybridization chain reaction. In addition to providing the field with markers for many of the cell types in the parasite at this stage, the authors use these markers to count the total number of various cell types in the organism. Because the authors realized that their cell isolation protocols were biasing the cell types they were sequencing, they applied a second method to help them recover additional cell types.

      Schistosomes have ZW sex chromosomes and the authors make the interesting observation that the stem cells at this stage are already expressing sex (i.e. W)-specific genes.

      Comments on revised version:

      The manuscript has been improved after revisions. The methods, data and analyses broadly support the claims with only minor weaknesses.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors investigated the release properties of glutamate/GABA co-transmission at the supramammillary nucleus (SuM)-granule cell (GC) synapses using in vitro electrophysiology and anatomical approaches at the light and electron microscopy level. They found that SuM to dentate granule cell synapses, which co-release glutamate and GABA, exhibit distinct differences in paired-pulse ratio, Ca2+ sensitivity, presynaptic receptor modulation, and Ca2+ channel-vesicle coupling configuration for each neurotransmitter. The study shows that glutamate/GABA co-release produces independent glutamatergic and GABAergic synaptic responses, with postsynaptic targets segregated. They show that most SuM boutons form distinct glutamatergic and GABAergic synapses in close proximity, characterized by GluN1 and GABAAα1 receptor labeling, respectively. Furthermore, they demonstrate that glutamate/GABA co-transmission exhibits distinct short-term plasticity, with glutamate showing frequency-dependent depression and GABA showing frequency-independent stable depression.

      Their findings suggest that these distinct modes of glutamate/GABA co-release by SuM terminals serve as frequency-dependent filters of SuM inputs.

      Strengths:

      The conclusions of this paper are mostly well supported by the data.

      Weaknesses:

      Some aspects of Supplementary Figure 1A and the table need clarification. Specifically, the claim that the authors have stimulated an axon fiber rather than axon terminals is not convincingly supported by the diagram of the experimental setup. Additionally, the antibody listed in the primary antibodies section recognizes the gamma2 subunit of the GABAA receptor, not the alpha1 subunit mentioned in the results and Figure 4.

    1. Reviewer #3 (Public Review):

      Summary:

      This paper presents a new formulation of a computational model of adaptive learning amid environmental volatility. Using a behavioral paradigm and data set made available by the authors of an earlier publication (Gagne et al., 2020), the new model is found to fit the data well. The model's structure consists of three weighted controllers that influence decisions on the basis of (1) expected utility, (2) potential outcome magnitude, and (3) habit. The model offers an interpretation of psychopathology-related individual differences in decision-making behavior in terms of differences in the relative weighting of the three controllers.

      Strengths:

      The newly proposed "mixture of strategies" (MOS) model is evaluated relative to the model presented in the original paper by Gagne et al., 2020 (here called the "flexible learning rate" or FLR model) and two other models. Appropriate and sophisticated methods are used for developing, parameterizing, fitting, and assessing the MOS model, and the MOS model performs well on multiple goodness-of-fit indices. Parameters of the model show decent recoverability and offer a novel interpretation for psychopathology-related individual differences. Most remarkably, the model seems to be able to account for apparent differences in behavioral learning rates between high-volatility and low-volatility conditions even with no true condition-dependent change in the parameters of its learning/decision processes. This finding calls into question a class of existing models that attribute behavioral adaptation to adaptive learning rates.

      Weaknesses:

      The authors have responded to the weaknesses noted previously.

    1. Reviewer #2 (Public Review):

      Summary:

      In their study titled "Recent evolutionary origin and localized diversity hotspots of mammalian coronaviruses," authors Benoît Perez-Lamarque, Renan Maestri, Anna Zhukova, and Hélène Morlon investigate the complex evolutionary history of coronaviruses, particularly those affecting mammals, including humans. The study focuses on unraveling the evolutionary trajectory of these viruses, which have shown a high propensity for causing pandemics, as evidenced by the SARS-CoV2 outbreak.<br /> The research addresses a significant gap in our understanding of the evolutionary dynamics of coronaviruses, particularly their history, patterns of host-to-host transmission, and geographical spread. These aspects are important for predicting and managing future pandemic scenarios.

      Historically, studies have employed cophylogenetic tests to explore virus-host relationships within the Coronaviridae family, often suggesting a long history of virus-host codiversification spanning millions of years. However, the team led by Perez-Lamarque proposes a novel phylogenetic framework that contrasts this traditional view. Their approach, which involves adapting gene tree-species tree reconciliation, is designed to robustly test the validity of two competing scenarios: an ancient origination and codiversification versus a more recent emergence and diversification through host switching.

      Upon applying this innovative framework to the study of coronaviruses and their mammalian hosts, the authors' findings challenge the prevailing notion of a deep evolutionary history. Instead, their results strongly support a scenario where coronaviruses have a more recent origin, likely in bat populations, followed by diversification predominantly through host-switching events. This diversification, interestingly, seems to occur preferentially within mammalian orders.

      A critical aspect of their findings is the identification of hotspots of coronavirus diversity, particularly in East Asia and Europe. These regions align with the proposed scenario of a relatively recent origin and subsequent localized host-switching events. The study also highlights the rarity of spillovers from bats to other species, yet underscores the relatively higher likelihood of such spillovers occurring towards humans, suggesting a significant role for humans as an intermediate host in the evolutionary journey of these viruses.

      The research also points out the high rates of host-switching within mammalian orders, including between humans, domesticated animals, and non-flying wild mammals.<br /> In conclusion, the study by Perez-Lamarque and colleagues presents an important quantitative advance in our understanding of the evolutionary history of mammalian coronaviruses. It suggests that the long-held belief in extensive virus-host codiversification may have been substantially overestimated, paving the way for a reevaluation of how we understand, predict, and potentially control the spread of these viruses.

      Strengths:

      The study is conceptually robust, and its conclusions are convincing.

      Weaknesses:

      The authors could only use the "undated" model in ALE, with the dated method (which only allows time-consistent transfers) failing on their dataset. The authors did attempt to address this issue in the revision, albeit with limited success.

    1. Reviewer #2 (Public Review):

      Summary:

      This article explores the regenerative effects of recombinant PTH analogues on osteogenesis.

      Strengths:

      Although PTH has known to induce the activity of osteoclasts, accelerating bone resorption, paradoxically its intermittent use has become a common treat for osteoporosis. Previous studies successfully demonstrated this phenomenon in vivo, but most of them used rodent animal models, inevitably having a limitation. In this article, the authors tried to address this, using a beagle model, and assessed the osseointegrative effect of recombinant PTH analogues. As a result, the authors clearly observed the regenerative effects of PTH analogues, and compared the efficacy, using histologic, biochemical, and radiologic measurement for surgical-endocrinal combined large animal models. The data seem to be solid, and has potential clinical implications.

      Weaknesses:

      All the issues that I raised have been resolved in the revision process.

      Overall, this paper is well-written and has clarity and consistency for a broader readership.

    1. Reviewer #2 (Public Review):

      Summary:

      The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

      Strengths:

      Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

      Provides relevant information on the multivariate organization of serotoninergic system in the brain.

      Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

      Weaknesses:

      While the study protocol is referenced in the paper, it would be useful to at least report whether the study uses bolus, constant infusion, or a combination of the two and the duration of the frames chosen for reconstruction. Minimal details on anesthesia should also be reported, clarifying whether an interaction between the pharmacological agent for anesthesia and MDMA can be expected (whole-brain or in specific regions).

      Some terminology is used in a bit unclear way. E.g. "seed-based" usually refers to seed-to-voxel and not ROI-to-ROI analysis, or e.g. it is a bit confusing to have IC1 called SERT network when in fact all ICs derived from DASB data are SERT networks. Perhaps a different wording could be used (IC1 = SERT xxxxx network; IC2= SERT salience network) .

      The limited sample size for the rats undergoing pharmacological stimulation which might make the study (potentially) not particularly powerful. This could not be a problem if the MDMA effect observed is particularly consistent across rats. Information on inter-individual variability of FC, MC, and BPND could be provided in this regard.

    1. Reviewer #2 (Public Review):

      In this study, the authors leverage a large public dataset of intracranial EEG (the University of Pennsylvania RAM repository) to examine electrophysiologic network dynamics involving the participation of salience, frontoparietal, and default mode networks in the completion of several episodic memory tasks. They do this through a focus on the anterior insula (AI; salience network), which they hypothesize may help switch engagement between the DMN and FPN in concert with task demands. By analyzing high-gamma spectral power and phase transfer entropy (PTE; a putative measure of information "flow"), they show that the AI shows higher directed PTE towards nodes of both the DMN and FPN, during encoding and recall, across multiple tasks. They further demonstrate that high-gamma power in the PCC/precuneus is decreased relative to the AI during memory encoding. They interpret these results as evidence of "triple-network" control processes in memory tasks, governed by a key role of the AI.

      I commend the authors on leveraging this large public dataset to help contextualize network models of brain function with electrophysiological mechanisms - a key problem in much of the fMRI literature. I also appreciate that the authors emphasized replicability across multiple memory tasks, in an effort to demonstrate conserved or fundamental mechanisms that support a diversity of cognitive processes. However, I believe that their strong claims regarding causal influences within circumscribed brain networks cannot be supported by the evidence as presented. In my efforts to clearly communicate these inadequacies, I will suggest several potential analyses for the authors to consider that might better link the data to their central hypotheses.

      (1) As a general principle, the effects that the authors show - both in regards to their high-gamma power analysis and PTE analysis - do not offer sufficient specificity for a reader to understand whether these are general effects that may be repeated throughout the brain, or whether they reflect unique activity to the networks/regions that are laid out in the Introduction's hypothesis. This lack of specificity manifests in several ways, and is best communicated through examples of control analyses.

      First, the PTE analysis is focused solely on the AI's interactions with nodes of the DMN and FPN; while it makes sense to focus on this putative "switch" region, the fact that the authors report significant PTE from the AI to nodes of both networks, in encoding and retrieval, across all tasks and (crucially) also at baseline, raises questions about the meaningfulness of this statistic. One way to address this concern would be to select a control region that would be expected to have little/no directed causal influence on these networks and repeat the analysis. Alternatively (or additionally), the authors could examine the time course of PTE as it evolves throughout an encoding/retrieval interval, and relate that to the timing of behavioral events or changes in high-gamma power. This would directly address an important idea raised in their own Discussion, "the AI is well-positioned to dynamically engage and disengage with other brain areas."

      Second, the authors state that high-gamma suppression in the PCC/precuneus relative to the AI is an anatomically specific signature that is not present in the FPN. This claim does not seem to be supported by their own evidence as presented in the Supplemental Data (Figures S2 and S3), which to my eye show clear evidence of relative suppression in the MFG and dPPC (e.g. S2a and S3a, most notably) which are notated as "significant" with green bars. I appreciate that the magnitude of this effect may be greater in the PCC/precuneus, but if this is the claim it should be supported by appropriate statistics and interpretation.

      (2) I commend the authors on emphasizing replicability, but I found their Bayes Factor (BF) analysis to be difficult to interpret and qualitatively inconsistent with the results that they show. For example, the authors state that BF analysis demonstrates "high replicability" of the gamma suppression effect in Figure 3a with that of 3c and 3d. While it does appear that significant effects exist across all three tasks, the temporal structure of high gamma signals appears markedly different between the two in ways that may be biologically meaningful. Moreover, it appears that the BF analysis did not support replicability between VFR and CATVFR, which is very surprising; these are essentially the same tasks (merely differing in the presence of word categories) and would be expected to have the highest degree of concordance, not the lowest. I would suggest the authors try to analytically or conceptually reconcile this surprising finding.

      To aid in interpretability, it would be extremely helpful for the authors to assess across-task similarity in high-gamma power on a within-subject basis, which they are well-powered to do. For example, could they report the correlation coefficient between HGP timecourses in paired-associates versus free-recall tasks, to better establish whether these effects are consistent on a within-subject basis? This idea could similarly be extended to the PTE analysis. Across-subject correlations would also be a welcome analysis that may provide readers with better-contextualized effect sizes than the output of a Bayes Factor analysis.

    1. Reviewer #2 (Public Review):

      This paper investigates an interesting question: how do fish react to and avoid thermal disturbances from the optimum that occur on fast timescales? Previous work has identified potential strategies for warm avoidance in fish on short timescales while strategies for cold avoidance are far more elusive. The work combines a clever experimental paradigm with careful analysis to show that trout parr avoid cold water by limiting excursions across a warm-cold thermal interface. While I found the paper interesting and convincing overall, there are a few omissions and choices in the presentation that limit interpretability and clarity.

      A main question concerns the thermal interface itself. The authors track this interface using a blue dye that is mixed in with either colder or warmer water before a gate is opened that leads to gravitational flow overlaying the two water temperatures. The dye likely allows to identify convective currents which could lead to rapid mixing of water temperatures. However, it is less clear whether it accurately reflects thermal diffusion. This is problematic as the authors identify upward turning behavior around the interface which appears to be the behavioral strategy for avoiding cold water but not warm water. Without knowing the extent of the gradient across the interface, it is hard to know what the fish are sensing. The authors appear to treat the interface as essentially static, leading them to the conclusion that turning away before the interface is reached is likely related to associative learning. However, thermal diffusion could very likely create a gradient across centimeters which is used as a cue by the fish to initiate the turn. In an ideal world, the authors would use a thermal camera to track the relationship between temperature and the dye interface. Absent that, the simulation that is mentioned in passing in the methods section should be discussed in detail in the main text, and results should be displayed in Figure 1. Error metrics on the parameters used in the simulation could then be used to identify turns in subsequent figures that likely are or aren't affected by a gradient formed across the interface.

      The authors assume that the thermal interface triggers the upward-turning behavior. However, an alternative explanation, which should be discussed, is that cold water increases the tendency for upward turns. This could be an adaptive strategy since for temperatures > 4C turning swimming upwards is likely a good strategy to reach warmer water.

      The paper currently also suffers from a lack of clarity which is largely created by figure organization. Four main and 38 supplemental figures are very unusual. I give some specific recommendations below but the authors should decide which data is truly supplemental, versus supporting important points made in the paper itself. There also appear to be supplemental figures that are never referenced in the text which makes traversing the supplements unnecessarily tedious.<br /> The N that was used as the basis for statistical tests and plots should be identified in the figures to improve interpretability. To improve rigor, the experimental procedures should be expanded. Specifically, the paper uses two thermal models which are not detailed at all in the methods section.

    1. Reviewer #2 (Public Review):

      Summary:

      Burdge, Juhmka, et al describe the development and validation of a new automated system for applying plantar stimuli in rodent somatosensory behavior tasks. This platform allows the users to run behavior experiments remotely, removing experimenter effects on animals and reducing variability in the manual application of stimuli. The system integrates well with other automated analysis programs that the lab has developed, providing a complete package for standardizing behavior data collection and analysis. The authors present extensive validations of the system against manual stimulus application. Some proof of concept studies also show how the system can be used to better understand the effect of experimenters on behavior and the effects of how stimuli are presented on the micro features of the animal withdrawal response.

      Strengths:

      If widely adopted, ARM has the potential to reduce variability in plantar behavior studies across and within labs and provide a means to standardize results. The system is well-validated and results clearly and convincingly presented. Most claims are well supported by experimental evidence.

      Weaknesses:

      ARM seems like a fantastic system that could be widely adopted, but no details are given on how a lab could build ARM, thus its usefulness is limited.

      The ARM system appears to stop short of hitting the desired forces that von Frey filaments are calibrated toward (Figure 2). This may affect the interpretation of results.

      The authors mention that ARM generates minimal noise; however, if those sounds are paired with stimulus presentation they could still prompt a withdrawal response. Including some 'catch' trials in an experiment could test for this.

      The experimental design in Figure 2 is unclear- did each experimenter have their own cohort of 10 mice, or was a single cohort of mice shared? If shared, there's some concern about repeat testing.

    1. Reviewer #2 (Public Review):

      This is a nice paper illustrating the use of equilibrium/non-equilibrium MD simulations to explore allosteric communication in the Spike protein. The results are described in detail and suggest a complex network of signal transmission patterns. The topic is not completely novel as it has been studied before by the same authors and the impact of glycosylation is moderated and localized at the furin site, so not many new conclusions emerge here. It is suggested that mutations are commonly found in the communication pathway which is interesting, but the authors fail to provide evidence that this is related to a positive selection and not simply to a random effect related to mutations at points that are not crucial for stability or function. One interesting point is the connection of the FA site with an additional site binding heme group. It will be interesting to see reversibility, i.e. removal of the ligand at this site is producing perturbation at the FA site?, does it produce other effects suggesting a cascade of allosteric effects? Finally, the paper lacks details to help reproducibility, in particular, I do not see details on D-NEMD calculations. One interesting point is the connection of the FA site with an additional site binding heme group.

    1. Reviewer #2 (Public Review):

      Summary:

      In this paper, the authors describe a novel function involving the cell cycle protein kinase CDK2, which binds to TBK1 (an essential component of the innate immune response) leading to its degradation in a ubiquitin/proteasome-dependent manner. Moreover, the E3 ubiquitin ligase, Dtx4, is implicated in the process by which CDK2 increases the K48-linked ubiquitination of TBK1. This paper presents intriguing findings on the function of CDK2 in lower vertebrates, particularly its regulation of IFN expression and antiviral immunity.

      Strengths:

      (1) The research employs a variety of experimental approaches to address a single question. The data are largely convincing and appear to be well executed.

      (2) The evidence is strong and includes a combination of in vivo and in vitro experiments, including knockout models, protein interaction studies, and ubiquitination analyses.

      (3) This study significantly impacts the field of immunology and virology, particularly concerning the antiviral mechanisms in lower vertebrates. The findings provide new insights into the regulation of IFN expression and the broader role of CDK2 in immune responses. The methods and data presented in this paper are highly valuable for the scientific community, offering new avenues for research into antiviral strategies and the development of therapeutic interventions targeting CDK2 and its associated pathways.

      Weaknesses:

      (1) While the study focuses on fish, the broader implications for other lower vertebrates and higher vertebrates are not extensively discussed.

      (2) The study heavily relies on specific fish models, which may limit the generalizability of the findings across different species.

    1. Reviewer #2 (Public Review):

      The study by Bajohr investigates the important question of whether astrocytes can generate oligodendrocytes by direct lineage conversion (DLR). The authors ectopically express three transcription factors - Sox10, Olig2 and Nkx6.2 - in cultured postnatal mouse astrocytes and use a combination of Aldh1|1-astrocyte fate mapping and live cell imaging to demonstrate that Sox10 converts astrocytes to MBP+ oligodendrocytes, whereas Olig2 expression converts astrocytes to PDFRalpha+ oligodendrocyte progenitor cells. Nkx6.2 does not induce lineage conversion. The authors use single-cell RNAseq over 14 days post-transduction to uncover molecular signatures of newly generated iOLs.

      The potential to convert astrocytes to oligodendrocytes has been previously analyzed and demonstrated. Despite the extensive molecular characterization of the direct astrocyte-oligodendrocyte lineage conversion, the paper by Bajohr et al. does not represent significant progress. The entire study is performed in cultured cells, and it is not demonstrated whether this lineage conversion can be induced in astrocytes in vivo, particularly at which developmental stage (postnatal, adult?) and in which brain region. The authors also state that generating oligodendrocytes from astrocytes could be relevant for oligodendrocyte regeneration and myelin repair, but they don't demonstrate that lineage conversion can be induced under pathological conditions, particularly after white matter demyelination. Specific issues are outlined below.

      (1) The authors perform an extensive characterization of Sox10-mediated DLR by scRNAseq and demonstrate a clear trajectory of lineage conversion from astrocytes to terminally differentiated MBP+ iOLCs. A similar type of analysis should be performed after Olig2 transduction, to determine whether transcriptomics of OPC induction overlaps with any phase of MBP+ oligodendrocyte induction.

      (2) A complete immunohistochemical characterization of the cultures should be performed at different time points after Sox10 and Olig2 transduction to confirm OL lineage cell phenotypes.

    1. Reviewer #2 (Public Review):

      In this manuscript, Moyse et. al. investigated the origins and potential functions of distinct populations of mononuclear phagocytes (MNPS) in the heart of developing and adult zebrafish. First, the authors demonstrate that the embryonic zebrafish heart contains macrophages early in development and that mpeg1.1 and csf1ra expressing macrophages vary across time and location and present that cardiac tissue macrophages (cTMs) in the juvenile heart are derived by primitive hematopoiesis. By combining the two transgenes, the authors demonstrate that there are 3 distinct (later determined to be 4) subpopulations of MNPs in adult hearts and that the distribution of these subtypes is distinct within the heart consistent with differing distributions of primitive and definitive macrophages in mammalian hearts. Further analysis of these populations demonstrates distinct morphologies of the subpopulations and analysis of markers conserved in mammals demonstrates distinct expression profiles as well. The authors go on to demonstrate that these subpopulations also demonstrate distinct behaviors via ex-vivo imaging. Lastly, the authors investigated the roles of these subpopulations in a model of cardiac injury in adult zebrafish and demonstrated that primitive-derived cTMs proliferate after injury consistent with mammalian models and that the proliferation of these macrophages likely results in reduced scarring in csf1ra mutants which have reduced recruitment of pro-inflammatory definitive macrophages. The data presented in this manuscript provides solid evidence that zebrafish MNPs behave consistently with those in mammals and further solidifies the use of zebrafish models as a useful tool in studying the role of these cells in cardiac repair and regeneration.

      The data presented in this manuscript strongly supports the conclusions made by the authors and utilizes novel techniques. The authors appear to have achieved the goals they set out to investigate. The use of ex-vivo imaging to visualize the movement of these macrophage populations within the heart is especially compelling. The combined use of commonly used transgenic reporters for zebrafish macrophages is a very nice use of existing tools to address new questions and highlight the distinct populations of macrophages. While the overall manuscript is very strong and is likely to have a great impact on the field, there are a few weaknesses that should be addressed prior to acceptance:

      (1) The reasoning for N used in many of these experiments is not addressed, nor is the question of the number of times experiments were performed. For purposes of rigor and reproducibility, these questions should be addressed in the methods.

      (2) In investigating homologs of zebrafish and mammalian genes, the inclusion of additional classical markers and novel markers of subpopulations highlighted in numerous recent studies using single-cell RNA sequencing would greatly add to the impact.

      (3) The description of the RT-PCR experiment is not included in the methods. Detailed methods should be provided including probe sequences. Additionally, a quantitative method of presenting this data would strengthen the conclusions presented here as well as the inclusion of additional markers as discussed previously.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Liu et al. explore the interplay between G-quadruplexes (G4s) and R-loops. The authors developed novel techniques, HepG4-seq and HBD-seq, to capture and map these nucleic acid structures genome-wide in human HEK293 cells and mouse embryonic stem cells (mESCs). They identified dynamic, cell-type-specific distributions of co-localized G4s and R-loops, which predominantly localize at active promoters and enhancers of transcriptionally active genes. Furthermore, they assessed the role of helicase Dhx9 in regulating these structures and their impact on gene expression and cellular functions.

      The manuscript provides a detailed catalogue of the genome-wide distribution of G4s and R-loops. However, the conceptual advance and the physiological relevance of the findings are not obvious. Overall, the impact of the work on the field is limited to the utility of the presented methods and datasets.

      Strengths:

      (1) The development and optimization of HepG4-seq and HBD-seq offer novel methods to map native G4s and R-loops.

      (2) The study provides extensive data on the distribution of G4s and R-loops, highlighting their co-localization in human and mouse cells.

      (3) The study consolidates the role of Dhx9 in modulating these structures and explores its impact on mESC self-renewal and differentiation.

      Weaknesses:

      (1) The specificity of the biotinylation process and potential off-target effects are not addressed. The authors should provide more data to validate the specificity of the G4-hemin.

      (2) Other methods exploring a catalytic dead RNAseH or the HBD to pull down R-loops have been described before. The superior quality of the presented methods in comparison to existing ones is not established. A clear comparison with other methods (BG4 CUT&Tag-seq, DRIP-seq, R-CHIP, etc) should be provided.

      (3) Although the study demonstrates Dhx9's role in regulating co-localized G4s and R-loops, additional functional experiments (e.g., rescue experiments) are needed to confirm these findings.

      (4) The manuscript would benefit from a more detailed discussion of the broader implications of co-localized G4s and R-loops.

      (5) The manuscript lacks appropriate statistical analyses to support the major conclusions.

      (6) The discussion could be expanded to address potential limitations and alternative explanations for the results.

    1. Reviewer #2 (Public Review):

      In their manuscript, Medina and colleagues investigate transcriptional differences between mild and severe SARS-CoV-2 infections. Their analyses are very comprehensive incorporating a multitude of bioinformatics tools ranging from PCA plots, GSEA and DEG analysis, protein-protein interaction network, and weighted correlation network analyses. They conclude that in mild COVID-19 infection NK cell functionality is compromised and this is connected to cytokine interactions and Th1/Th2 cell differentiation pathways cross-talk, bridging the innate and the adaptive arms of the immune system. The authors successfully recruited participants with both mild and severe COVID-19 between November 2020 to May 2021. The analyzed cohort is gender and acceptably age-matched and the results reported are promising. Signatures associated with NK cell cytotoxicity in mild and neutrophil functions in the severe group during acute infection are the chief findings reported in this manuscript.

      Comments on revised version:

      The authors responded appropriately to the previous review critiques.

    1. Reviewer #4 (Public Review):

      Summary:

      Knecht et al. elucidate a Type VI Secretion System (T6SS) effector-immunity pair in Proteus mirabilis. They demonstrate that the effector protein RdnE exhibits DNase activity in vitro and induces toxicity when ectopically expressed in cells, the latter being neutralized by the cognate immunity protein RdnI. The authors identify major regions within RdnI necessary for the interaction and neutralization of RdnE. Notably, they report cross-talk where both cognate and non-cognate RdnI proteins can neutralize RdnE, mitigating its fitness advantage in bacterial co-swarm assays. A comprehensive metagenomic analysis revealed an abundance of rdnI over rdnE genes in most gut samples, suggesting a potential role of rdnI in providing a fitness advantage against bacteria encoding for RdnE effector.

      Strengths:

      The authors successfully combined biochemical and microbiological experiments with bioinformatics analysis to advance the understanding of the T6SS-mediated population dynamics in bacteria. The co-swarm functional assay is of particular interest as it demonstrates how bacterial strains carrying only rdnI immunity genes could potentially compete in the same niche with other species armed with toxic rdnE effector genes. The manuscript is well-written, and the figures are self-explanatory.

      Weaknesses:

      (1) How would the authors explain the discrepancy observed in Figure 4 G and Figure 4 S3 B where two RdnI proteins from Prevotella and Pseudomonas genera do not bind to RdnE_Proteus in BACTH, whereas they co-elute with a RdnE_Proteus-FLAG with efficiency comparable to the cross-neutralizing RdnI_Rothia? Similarly, the interaction results obtained in BACTH with RdnI truncate (Figure 4E) or chimeric RdnI (Figure 4I, lane 4) could be a result of an overexpressed T18-fusion variant.<br /> Alternative in vitro protein binding assay would be beneficial.

      (2) Based on the bioinformatic analysis the Rothia and Prevotella species harboring rdnE/I genes co-occurred in 5% of metagenomes tested, suggesting that these bacteria could come into contact. The manuscript would benefit greatly if authors demonstrated that RdnI proteins from Rothia or Prevotella could cross-neutralize its own and its 'neighbor' RdnE effectors, for example in an E. coli viability assay. The cross-neutralizing co-swarming results (Figure 4F) could also be further validated in viability assay as shown in Figure 2 S1.

      (3) Little is known about whether RdnE is delivered via T6SS as a full-length protein or as the shorter C-terminal fragment. There is a possibility that immunity proteins could recognize RdnE regions beyond the C-terminal 138 amino acids that authors used in their in vitro assays.

    1. Reviewer #2 (Public Review):

      This is an interesting manuscript where a CA-only CG model (Mpipi) was used to examine the critical temperature (Tc) of phase separation of a set of 140 variants of prion-like low complexity domains (PLDs). The key result is that Tc of these PLDs seems to have a linear dependence on substitutions of various sticker and space residues. This is potentially useful for estimating the Tc shift when making novel mutations of a PLD. However, I have strong reservations about the significance of this observation as well as some aspects of the technical detail and writing of the manuscript.

      (1) Writing of the manuscript: The manuscript can be significantly shortened with more concise discussions. The current text reads as very wordy in places. It even appears that the authors may be trying a bit too hard to make a big deal out of the observed linear dependence.

      The manuscript needs to be toned done to minimize self-promotion throughout the text. Some of the glaring examples include the wording "unprecedented", "our research marks a significant milestone in the field of computational studies of protein phase behavior ..", "Our work explores a new framework to describe, quantitatively, the phase behavior ...", and others.

      There is really little need to emphasize the need to manage a large number of simulations for all 140 variants. Yes, some thoughts need to go into designing and managing the jobs and organizing the data, but it is pretty standard in computational studies. For example, large-scale protein ligand-free energy calculations can require one to a few orders of magnitude larger number of runs, and it is pretty routine.

      When discussing the agreement with experimental results on Tm, it should be noted that the values of R > 0.93 and RMSD < 14 K are based on only 16 data points. I am not sure that one should refer to this as "extended validation". It is more like a limited validation given the small data size.

      Results of linear fitting shown in Eq 4-12 should be summarized in a single table instead of scattering across multiple pages.

      The title may also be toned down a bit given the limited significance of the observed linear dependence.

      (2) Significance and reliability of Tc: Given the simplicity of Mpipi (a CA-only model that can only describe polymer chain dimension) and the low complexity nature of PLDs, the sequence composition itself is expected to be the key determinant of Tc. This is also reflected in various mean-field theories. It is well known that other factors will contribute, such as patterning (examined in this work as well), residual structures, and conformational preferences in dilute and dense phases. The observed roughly linear dependence is a nice confirmation but really unsurprising by itself. It appears how many of the constructs deviate from the expected linear dependence (e.g., Figure 4A) may be more interesting to explore.

      The assumption that all systems investigated here belong to the same universality class as a 3D Ising model and the use of Eqn 20 and 21 to derive Tc is poorly justified. Several papers have discussed this issue, e.g., see Pappu Chem Rev 2023 and others. Muthukumar and coworkers further showed that the scaling of the relevant order parameters, including the conserved order parameter, does not follow the 3D Ising model. More appropriate theoretical models including various mean field theories can be used to derive binodal from their data, such as using Rohit Pappu's FIREBALL toolset. Imposing the physics of the 3D Ising model as done in the current work creates challenges for equivalence relationships that are likely unjustified.

      While it has been a common practice to extract Tc when fitting the coexistence densities, it is not a parameter that is directly relevant physiologically. Instead, Csat would be much more relevant to think about if phase separation could occur in cells.

    1. Reviewer #2 (Public Review):

      Summary:

      This field experiment aimed to assess what motivates macaque monkeys to clean food items prior to consumption and the relative costs and benefits of different cleaning approaches (manually brushing sand from food versus dousing food items in water). The experiment teases apart if/how the benefits of these approaches are mediated by the amount of debris on food and the monkeys' rank in terms of the costs of consuming sand versus the time and energy required to remove it. The authors not only examined the behavioral responses of wild macaques to three conditions of food sand contamination but also tested the relative costs of consuming different levels and sizes of sand particulates. Through this, the authors propose considerations of the macaques' motivations to clean food and the balance they take in energetic gains from consuming food versus the costs of cleaning food and consuming sand. Their data reveal that food washing is more effective in removing sand, but more costly than manually brushing off sand. This study also revealed that only mid-ranked monkeys washed their food, while high and low-ranked monkeys were more likely to remove sand via brushing it off food with their hands.

      Strengths:

      This study provides a very in-depth consideration of the motivations of macaques to clean their food, and the relative costs and benefits of different food cleaning techniques. Not only did the study test the behavior of wild macaques via a simple yet elegant field study, but they also performed a detailed analysis of the sand particulates to understand the level of potential tooth wear that consuming it could result in. By relying on a wild group of macaques that have been part of a long-term study site, the team also had detailed behavioral data on the population to allow for rank assessments of the animals. This comprehensive study provides important foundational information for a better understanding of how and why macaques clean food, that inform existing and future considerations of this as a potential cultural behavior.

      Weaknesses:

      As currently written, the paper does not provide sufficient background on this population of animals and their prior demonstrations of food-cleaning behavior or other object-handling behaviors (e.g., stone handling). Moreover, the authors' conclusions focus on the behavior of high-ranked animals, but subordinate animals also showed similar behavioral patterns and they should be considered in more detail too.

    1. Reviewer #2 (Public Review):

      Summary:

      The paper sets out to understand the mechanisms underlying the colonization and degradation of marine particles using a natural Vibrio isolate as a model. The data are measurements of motility and gene expressing using microfluidic devices and RNA sequencing. The results reveal that degradation products of alginate do stimulate motility but not chemotaxis. In contrast, alginate itself (the polymer) does stimulate chemotaxis. Further, the dispersal from degrading alginate is density dependent, increasing at higher density. The evidence for these claims are strong. From these the authors propose a narrative (Fig. 6) for growth and dispersal cycles in this system. The idea is that cells colonize and degrade alginate, this degradation stimulates motility and dispersal followed by chemotaxis to a new alginate source. This complete narrative has modest support in the data. A quantitative description of these dynamics awaits future studies.

      Strengths:

      The microfluidic measurements are the central strength of the paper. The density dependence claim is qualitatively supported by the data. The motility and chemotaxis claims are also well supported by the data. The presentation of the experiment and results are well done. The study serves to motivate a unifying picture of growth and dispersal in marine systems. This is a key process in the global carbon cycle.

      Weaknesses:

      Perhaps not a weakness, but a glimmer that this is not yet the full story. The RNA expression data show alginate lyase expression in response to digested alginate which is unexpected given the narrative articulated above. Why express lyases while leaving the polymer patch via motility? This question is addressed in the Discussion. A holistic and quantitative picture of the proposed process in Figure 6 awaits additional studies.

    1. Reviewer #2 (Public Review):

      Kislinger et al. present a method permitting a targeted, multi-scale ultrastructural imaging approach to bridge the resolution gap between large-scale scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The key methodological development consists of an approach to recover sections of resin-embedded material produced by Automated Tape Collecting Ultramicrotomy (ATUM), thereby permitting regions of interest identified by serial section SEM (ATUM-SEM) screening to be subsequently re-examined at higher resolution by TEM tomography (ATUM-Tomo). The study shows that both formvar and permanent marker coatings are in principle compatible with solvent-based release of pre-screened sections from ATUM tape (carbon nanotubule or Kapton tape). However, a comparative analysis of potential limitations and artifacts introduced by these respective coatings revealed permanent marker to provide a superior coating; permanent marker coatings are more easily and reliably applied to tape with only minor contaminants affecting the recovered section-tape interface with negligible influence on tomogram interpretation. Convincing proof-of-principle is provided by integrating this novel ATUMTomo technique into a technically impressive correlated light and electron microscopy (CLEM) approach specifically tailored to investigate ultrastructural manifestations of trauma-induced changes in blood-brain barrier permeability.

      Strengths

      Schematics and figures are very well-constructed, illustrating the workflow in a logical and easily interpretable manner. Light and electron microscope image data are of excellent quality, and the efficacy of the ATUM-Tomo approach is evidenced by a qualitative assessment of ATUM-SEM performance using coated tape variants and a convincing correlation between scanning and transmission electron microscopy imaging modalities. Potential ultrastructural artifacts induced via solvent exposure and any subsequent mechanical stress incurred during section detachment were thoroughly and systematically investigated using appropriate methods and reported with commendable transparency. In summary, the presented data convincingly support the claims of the study. A major strength of this work includes its general applicability to a broad range of biological questions and ultrastructural targets demanding resolutions exceeding that obtained via serial section and destructive block-face imaging approaches alone. The level of methodological detail provided is sufficient for replication of the ATUM-Tomo technique in other laboratories. Consequently, this relatively simple and cost-effective technique is widely adoptable by electron microscopy laboratories, and its integration into existing ATUM-SEM workflows supports a versatile and non-destructive imaging regime enabling high-resolution details of targeted structures to be interpreted within anatomical and subcellular contexts.

      Weaknesses

      I find no significant weaknesses in the current version of the manuscript.

    1. Reviewer #2 (Public Review):

      Sex peptide (SP) transferred during mating from male to female induces various physiological responses in the receiving female. Among those, the increase in oviposition and decrease in sexual receptivity are very remarkable. Naturally, a long standing and significant question is the identity of the underlying sex peptide target neurons that express the SP receptor and are underlying these responses. Identification of these neurons will eventually lead to the identification of the underlying neuronal circuitry.

      The Soller lab has addressed this important question already several years ago (Haussmann et al. 2013), using relevant GAL4-lines and membrane-tethered SP. The results already showed that the action of SP on receptivity and oviposition is mediated by different neuronal subsets and hence can be separated. The GAL4-lines used at that time were, however, broad, and the individual identity of the relevant neurons remained unclear.

      In the present paper, Nallasivan and colleagues carried this analysis one step further, using new intersectional approaches and transsynaptic tracing.

      Strength:

      The intersectional approach is appropriate and state-of-the art. The analysis is a very comprehensive tour-de-force and experiments are carefully performed to a high standard. The authors also produced a useful new transgenic line (UAS-FRTstopFRT mSP). The finding that neurons in the brain (head) mediate the SP effect on receptivity, while neurons in the abdomen and thorax (ventral nerve cord or peripheral neurons) mediate the SP effect on oviposition, is a significant step forward in the endavour to identify the underlying neuronal networks and hence a mechanistic understanding of SP action. Though this result is not entirely unexpected, it is novel as it was not shown before.

      Weakness:

      Though the analysis identifies a small set of neurons underlying SP responses, it does not go the last step to individually identify at least a few of them. The last paragraph in the discussion rightfully speculates about the neurochemical identity of some of the intersection neurons (e.g. dopaminergic P1 neurons, NPF neurons). At least these suggested identities could have been confirmed by straight-forward immunostainings agains NPF or TH, for which antisera are available. Moreover, specific GAL4 lines for NPF or P1 or at least TH neurons are available which could be used to express mSP to test whether SP activation of those neurons is sufficient to trigger the SP effect.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors show that leaf exposure to leafhopper males is required for female attraction in the SAP54-expressing plant. They clarify how SAP54, by degrading SVP, suppresses biotic stress response pathways in leaves exposed to the males, thus facilitating female attraction and plant colonization.

      Strengths:

      This study suggests the possibility that the attraction of insect vectors to leaves is the major function of SAP54, and the induction of the leaf-like flowers may be a side-effect of the degradation of MTFs and SVP. It is a very surprising discovery that only male insect vectors can effectively suppress the plant's biotic stress response pathway. Although there has been interest in the phyllody symptoms induced by SAP54, the purpose, and advantage of secreting SAP54 were unknown. The results of this study shed light on the significance of secreted proteins in the phytoplasma life cycle and should be highly evaluated.

      Weaknesses:

      One weakness of this study is that the mechanisms by which male and female leafhoppers differentially affect plant defense responses remain unclear, although I understand that this is a future study.

      The authors show that female feeding suppresses female colonization on SAP54-expressing plants. This is also an intriguing phenomenon but this study doesn't explain its molecular mechanism (Figure 7).

    1. Reviewer #2 (Public Review):

      Summary:

      This is a fascinating study about the behavioral kinematics of prey capture in larvae of several fish species (zebrafish, four cichlid species, and medaka). The authors describe in great detail swimming kinematics, hunting movement, eye movement as well as prey capture kinematics across these species. One striking finding is that cichlids and zebrafish use binocular vision to hunt for prey whereas medaka uses a monocular hunting style with a sideways motion to capture prey. The behavioral variation described in this study forms a strong foundation for future studies on the mechanisms underlying variation in hunting styles.

      Strengths:

      In general, the paper is well-written and documents very interesting data. The authors used sophisticated analyses that help appreciate the complexity of the behaviors examined. The discussion attempts to place the paper in a broader, comparative context. Overall, this paper reveals novel insight into an important behavior across different teleost species and lays a foundation for future studies on the neural and genetic basis of these distinct swimming and hunting behaviors.

      Weaknesses:

      The paper is rather descriptive in nature, although more context is provided in the discussion. Most figures are great, but I think the authors could add a couple of visual aids in certain places to explain how certain components were measured.

    1. Reviewer #2 (Public Review):

      Summary:

      Using a suite of techniques (e.g., RNA seq, proteomics, and functional experiments ex vivo) this paper extensively focuses on the role of PIM1/2 kinases during CD8 T-cell activation and cytokine-driven (i.e., IL-2 or IL-15) differentiation. The authors' key finding is that PIM1/2 enhances protein synthesis in response to IL-2 stimulation, but not IL-15, in CD8+ T cells. Loss of PIM1/2 made T cells less 'effector-like', with lower granzyme and cytokine production, and a surface profile that maintained homing towards secondary lymphoid tissue. The cytokines the authors focus on are IL-15 and Il-2, which drive naïve CD8 T cells towards memory or effector states, respectively. Although PIM1/2 are upregulated in response to T-cell activation and cytokine stimulation (e.g., IL-15, and to a greater extent, IL-2), using T cells isolated from a global mouse genetic knockout background of PIM1/2, the authors find that PIM1/2 did not significantly influence T-cell activation, proliferation, or expression of anything in the proteome under anti-CD3/CD28 driven activation with/without cytokine (i.e., IL-15) stimulation ex vivo. This is perhaps somewhat surprising given PIM1/2 is upregulated, albeit to a small degree, in response to IL-15, and yet PIM1/2 did not seem to influence CD8+ T cell differentiation towards a memory state. Even more surprising is that IL-15 was previously shown to influence the metabolic programming of intestinal intraepithelial lymphocytes, suggesting cell-type specific effects from PIM kinases. What the authors went on to show, however, is that PIM1/2 KO altered CD8 T cell proteomes in response to IL-2. Using proteomics, they saw increased expression of homing receptors (i.e., L-selectin, CCR7), but reduced expression of metabolism-related proteins (e.g., GLUT1/3 & cholesterol biosynthesis) and effector-function related proteins (e.g., IFNy and granzymes). Rather neatly, by performing both RNA-seq and proteomics on the same IL-2 stimulated WT vs. PIM1/2 KO cells, the authors found that changes at the proteome level were not corroborated by differences in RNA uncovering that PIM1/2 predominantly influence protein synthesis/translation. Effectively, PIM1/2 knockout reduced the differentiation of CD8+ T cells towards an effector state. In vivo adoptive transfer experiments showed that PIM1/2KO cells homed better to secondary lymphoid tissue, presumably owing to their heightened L-selectin expression (although this was not directly examined).

      Strengths:

      Overall, I think the paper is scientifically good, and I have no major qualms with the paper. The paper as it stands is solid, and while the experimental aim of this paper was quite specific/niche, it is overall a nice addition to our understanding of how serine/threonine kinases impact T cell state, tissue homing, and functionality. Of note, they hint towards a more general finding that kinases may have distinct behaviour in different T-cell subtypes/states. I particularly liked their use of matched RNA-seq and proteomics to first suggest that PIM1/2 kinases may predominantly influence translation (then going on to verify this via their protein translation experiment - although I must add this was only done using PIM kinase inhibitors, not the PIM1/2KO cells). I also liked that they used small molecule inhibitors to acutely reduce PIM1/2 activity, which corroborated some of their mouse knockout findings - this experiment helps resolve any findings resulting from potential adaptation issues from the PIM1/2 global knockout in mice but also gives it a more translational link given the potential use of PIM kinase inhibitors in the clinic. The proteomics and RNA seq dataset may be of general use to the community, particularly for analysis of IL-15 or IL-2 stimulated CD8+ T cells.

      Weaknesses:

      It would be good to perform some experiments in human T cells too, given the ease of e.g., the small molecule inhibitor experiment. Would also be good for the authors to include a few experiments where PIM1/2 have been transduced back into the PIM1/2 KO T cells, to see if this reverts any differences observed in response to IL-2 - although the reviewer notes that the timeline for altering primary T cells via lentivirus/CRISPR may be on the cusp of being practical such that functional experiments can be performed on day 6 after first stimulating T cells. Other experiments could also look at how PIM1/2 KO influences the differentiation of T cell populations/states during ex vivo stimulation of PBMCs or in vivo infection models using (high-dimensional) flow cytometry (rather than using bulk proteomics/RNA seq which only provide an overview of all cell combined). Alongside this, performing a PCA of bulk RNA seq/proteomes or Untreated vs. IL-2 vs. IL-15 of WT and PIM1/2 knockout T cells would help cement their argument in the discussion about PIM1/2 knockout cells being distinct from a memory phenotype.

    1. Reviewer #2 (Public Review):

      Summary and strengths:<br /> This massive paper describes the identity and connectivity of neurons reconstructed from a volumetric EM image volume of the ventral nerve cord (VNC) of a male fruit fly. The segmentation of the EM data was described in one companion paper; the classification of the neurons entering the VNC from the brain (descending neurons or DNs) and the motor neurons leaving the VNC was described in a second companion paper. Here, the authors describe a system for annotating the remaining neurons in the VNC, which include intrinsic neurons, ascending neurons, and sensory neurons, representing the vast majority of neurons in the dataset. Another fundamental contribution of this paper is the identification of the developmental origins (hemilineage) of each intrinsic neuron in the VNC. These comprehensive hemilineage annotations can be used to understand the relationship between development and circuit structure, provide insight into neurotransmitter identity, and facilitate comparisons across insect species.Many sensory neurons are also annotated by comparison to past literature. Overall, defining and applying this annotation system provides the field with a standard nomenclature and resource for future studies of VNC anatomy, connectivity, and development. This is a monumental effort that will fundamentally transform the field of Drosophila neuroscience and provide a roadmap for similar connectomic studies in other organisms.

      Weaknesses:<br /> Despite the significant merit of these contributions, the manuscript is challenging to read and comprehend. In some places, it seems to be attempting to comprehensively document everything the authors found in this immense dataset. In other places, there are gaps in scholarship and analysis. As it is currently constructed, I worry that the manuscript will intimidate general readers looking for an entry point to the system, and ostracize specialized readers who are unable to use the paper as a comprehensive reference due to its confusing organization.

      The bulk of the 559 pages of the submitted paper is taken up by a set of dashboard figures for each of ~40 hemilineages. Formatting the paper as an eLife publication will certainly help condense these supplemental figures into a more manageable format, but 68 primary figures will remain, and many of these also lack quality and clarity. Without articulating a clear function for each plot, it is hard to know what the authors missed or chose not to show. As an example, many of the axis labels indicate the hemilineage of a group of neurons, but are ordered haphazardly and so small as to be illegible; if the hemilineage name is too small, and in a bespoke order for that data, then is the reader meant to ignore the specific hemilineage labels?

      The text has similar problems of emphasis. It is often meandering and repetitive. Overlapping information is found in multiple places, which causes the paper to be much longer than it needs to be. For example, the concept of hemilineages is introduced three times before the subtitle "Introduction to hemilineage-based organisation". When cell typing is introduced, it is unclear how this relates to serial motif, hemilineage, etc; "Secondary hemilineages" follow the Cell typing title. Like the overwhelming number of graphical elements, this gives the impression that little attention has been paid to curating and editing the text. It is unclear whether the authors intend for the paper to be read linearly or used as a reference. In addition, descriptions of the naming system are often followed by extensive caveats and exceptions, giving the impression that the system is not airtight and possibly fluid. At many points, the text vacillates between careful consideration of the dataset's limitations and overly grandiose claims. These presentation flaws overshadow the paper's fundamental contribution of describing a reasonable and useful cell-typing system and placing intrinsic neurons within this framework.

      References to past Drosophila literature are inconsistent and references to work from other insects are generally not included; for example, the extensive past work on leg sensory neurons in locusts, cockroaches, and stick insects. Such omissions are understandable in a situation where brevity is paramount. However, this paper adopts a comprehensive and authoritative tone that gives the reader an impression of completeness that does not hold up under careful scrutiny.

      The paper accompanies the release of the MANC dataset (EM images, segmentation, annotations) through a web browser-based tool: clio.janelia.org. The paper would be improved by distilling it down to its core elements, and then encouraging readers to explore the dataset through this interactive interface. Streamlining the paper by removing extraneous and incomplete analyses would provide the reader with a conceptual or practical framework on which to base their own queries of the connectome.

    1. Reviewer #2 (Public Review):

      In this research, Zhang et al. have pioneered the creation of an advanced organoid culture designed to emulate the intricate characteristics of endometrial tissue during the crucial Window of Implantation (WOI) phase. Their method involves the incorporation of three distinct hormones into the organoid culture, coupled with additives that replicate the dynamics of the menstrual cycle. Through a series of assays, they underscore the striking parallels between the endometrial tissue present during the WOI and their crafted organoids. Through a comparative analysis involving historical endometrial tissue data and control organoids, they establish a system that exhibits a capacity to simulate the intricate nuances of the WOI.

      The authors made a commendable effort to address the majority of the statements. Developing an endometrial organoid culture methodology that mimics the window of implantation is a game-changer for studying the implantation process. However, the authors should strive to enhance the results to demonstrate how different WOI organoids are from SEC organoids, ensuring whether they are worth using in implantation studies, or a proper demonstration using implantation experiments.

    1. Reviewer #2 (Public Review):

      The current manuscript undoubtedly demonstrates that JAG1 can induced osteogenesis via non-canonical signaling. In fact, using the mouse-calvarial critical defect model, the authors have clearly shown the anabolic regenerative effect of JAG1 in via non-canonical pathways. Exploring the molecular mechanisms, the authors have shown that non-canonically JAG1 is regulating multiple pathways including STAT5, AKT, P38, JNK, NF-ĸB, and p70 S6K, which together possibly culminate to the activation of p70 S6K. In summary these findings have significant implications in designing new approaches for bone regenerative research.

    1. Reviewer #3 (Public Review):<br /> This study seeks to investigate one aspect of disparity in academia: how gender balance in a discipline is valued in terms of evaluated research quality score and funding success. This is important in understanding disparities within academia.<br /> This study uses publicly available data to investigate covariation between gender balance in an academic discipline and:<br /> individual research quality scores of New Zealand academics as evaluated by one of 14 broader subject panels.<br /> [ii] funding success in Australia, Canada, Europe, UK.

      The authors have addressed the concerns I had about the original version

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript from Lee-Odegard et al reports proteomic profiling of exercise plasma in humans, leading to the discovery of CD300LG as a secreted exercise-inducible plasma protein. Correlational studies show associations of CD300LG with glycemic traits. Lastly, the authors query available public data from CD300LG-KO mice to establish a causal role for CD300LG as a potential link between exercise and glucose metabolism. However, the strengths of this manuscript were balanced by the moderate to major weaknesses. Therefore in my opinion, while this is an interesting study, the conclusions remain preliminary and are not fully supported by the experiments shown so far.

      Strengths:

      (1) Data from a well-phenotyped human cohort showing exercise-inducible increases in CD300LG.

      (2) Associations between CD300LG and glucose and other cardiometabolic traits in humans, that have not previously been reported.

      (3) Correlation to CD300LG mRNA levels in adipose provides additional evidence for exercise-inducible increases in CD300LG.

      Weaknesses:

      (1) CD300LG is by sequence a single-pass transmembrane protein that is exclusively localized to the plasma membrane. How CD300LG can be secreted remains a mystery. More evidence should be provided to understand the molecular nature of circulating CD300LG. Is it full-length? Is there a cleaved fragment? Where is the epitope where the o-link is binding to CD300LG? Does transfection of CD300LG to cells in vitro result in secreted CD300LG?

      (2) There is a growing recognition of specificity issues with both the O-link and somalogic platforms. Therefore it is critical that the authors use antibodies, targeted mass spectrometry, or some other methods to validate that CD300LG really is increased instead of just relying on the O-link data.

      (3) It is insufficient simply to query the IMPC phenotyping data for CD300LG; the authors should obtain the animals and reproduce or determine the glucose phenotypes in their own hands. In addition, this would allow the investigators to answer key questions like the phenotype of these animals after a GTT, whether glucose production or glucose uptake is affected, whether insulin secretion in response to glucose is normal, effects of high-fat diet, and other standard mouse metabolic phenotyping assays.

      (4) I was unable to find the time point at which plasma was collected at the 12-week time point. Was it immediately after the last bout of exercise (an acute response) or after some time after the training protocol (trained state)?

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, van der Kroeg et al have developed a method for creating 3D cortical organoids using iPSC-derived neural progenitor cells in 384-well plates, thus scaling down the neural organoids to adherent culture and a smaller format that is amenable to high throughput cultivation. These adherent cortical organoids, measuring 3 x 3 x 0.2 mm, self-organize over eight weeks and include multiple neuronal subtypes, astrocytes, and oligodendrocyte lineage cells.

      Strengths:

      (1) The organoids can be cultured for up to 10 months, exhibiting mature dendritic spines, axonal myelination, and robust neuronal activity.

      (2) Unlike free-floating organoids, these do not develop necrotic cores, making them ideal for high-throughput drug discovery, neurotoxicological screening, and brain disorder studies.

      (3) The method addresses the technical challenge of achieving higher-order neural complexity with reduced heterogeneity and the issue of necrosis in larger organoids. The method presents a technical advance in organoid culture.

      (4) The method has been demonstrated with multiple cell lines which is a strength.

      (5) The manuscript provides high-quality immunostaining for multiple markers.

      Weaknesses:

      (1) Direct head-to-head comparison with standard organoid culture seems to be missing and may be valuable for benchmarking, ie what can be done with the new method that cannot be done with standard culture and vice versa, ie what are the aspects in which new method could be inferior to the standard.

      (2) It would be important to further benchmark the throughput, ie what is the success rate in filling and successfully growing the organoids in the entire 384 well plate?

      (3) For each NPC line an optimal seeding density was estimated based on the proliferation rate of that NPC line and via visual observation after 6 weeks of culture. It would be important to delineate this protocol in more robust terms, in order to enable reproducibility with different cell lines and amongst the labs.

    1. Reviewer #2 (Public Review):

      Li et al present a method to extract "behaviorally relevant" signals from neural activity. The method is meant to solve a problem which likely has high utility for neuroscience researchers. There are numerous existing methods to achieve this goal some of which the authors compare their method to-thankfully, the revised version includes one of the major previous omissions (TNDM). However, I still believe that d-VAE is a promising approach that has its own advantages. Still, I have issues with the paper as-is. The authors have made relatively few modifications to the text based on my previous comments, and the responses have largely just dismissed my feedback and restated claims from the paper. Nearly all of my previous comments remain relevant for this revised manuscript. As such, they have done little to assuage my concerns, the most important of which I will restate here using the labels/notation (Q1, Q2, etc) from the reviewer response.

      (Q1) I still remain unconvinced that the core findings of the paper are "unexpected". In the response to my previous Specific Comment #1, they say "We use the term 'unexpected' due to the disparity between our findings and the prior understanding concerning neural encoding and decoding." However, they provide no citations or grounding for why they make those claims. What prior understanding makes it unexpected that encoding is more complex than decoding given the entropy, sparseness, and high dimensionality of neural signals (the "encoding") compared to the smoothness and low dimensionality of typical behavioural signals (the "decoding")?

      (Q2) I still take issue with the premise that signals in the brain are "irrelevant" simply because they do not correlate with a fixed temporal lag with a particular behavioural feature hand-chosen by the experimenter. In the response to my previous review, the authors say "we employ terms like 'behaviorally-relevant' and 'behaviorally-irrelevant' only regarding behavioral variables of interest measured within a given task, such as arm kinematics during a motor control task.". This is just a restatement of their definition, not a response to my concern, and does not address my concern that the method requires a fixed temporal lag and continual decoding/encoding. My example of reward signals remains. There is a huge body of literature dating back to the 70s on the linear relationships between neural and activity and arm kinematics; in a sense, the authors have chosen the "variable of interest" that proves their point. This all ties back to the previous comment: this is mostly expected, not unexpected, when relating apparently-stochastic, discrete action potential events to smoothly varying limb kinematics.

      (Q5) The authors seem to have missed the spirit of my critique: to say "linear readout is performed in motor cortex" is an over-interpretation of what their model can show.

      (Q7) Agreeing with my critique is not sufficient; please provide the data or simulations that provides the context for the reference in the fano factor. I believe my critique is still valid.

      (Q8) Thank you for comparing to TNDM, it's a useful benchmark.

    1. Reviewer #2 (Public Review):

      Weng and colleagues investigated the relationship between sustained attention and substance use in a large cohort across three longitudinal visits (ages 14, 19, and 23). They employed a stop signal task to assess sustained attention and utilized the Timeline Followback self-report questionnaire to measure substance use. They assessed the linear relationship between sustained attention-associated functional connections and substance use at an earlier visit (age 14 or 19). Subsequently, they utilized this relationship along with the functional connection profile at a later age (age 19 or 23) to predict substance use at those respective ages. The authors found that connections in association with reduced sustained attention predicted subsequent increases in substance use, a conclusion validated in an external dataset. Altogether, the authors suggest that sustained attention could serve as a robust biomarker for predicting future substance use.

      This study by Weng and colleagues focused on an important topic of substance use prediction in adolescence/early adulthood.

    1. Reviewer #2 (Public Review):

      Schommartz et al. present a manuscript characterizing neural signatures of reinstatement during cued retrieval of middle-aged children compared to adults. The authors utilize a paradigm where participants learn the spatial location of semantically related item-scene memoranda which they retrieve after short or long delays. The paradigm is especially strong as the authors include novel memoranda at each delayed time point to make comparisons across new and old learning. In brief, the authors find that children show more forgetting than adults, and adults show greater engagement of cortical networks after longer delays as well as stronger item-specific reinstatement. Interestingly, children show more category-based reinstatement, however, evidence supports that this marker may be maladaptive for retrieving episodic details. The question is extremely timely both given the boom in neurocognitive research on the neural development of memory, and the dearth of research on consolidation in this age group. Also, the results provide novel insights into why consolidation processes may be disrupted in children.

    1. Reviewer #2 (Public Review):

      Summary:

      To investigate the impact of chemical ischemia induced by blocking mitochondrial function and glycolysis, the authors measured extracellular field potentials, performed whole-cell patch-clamp recordings, and measured glutamate release with optical techniques. They found that shorter two-minutes-lasting blockade of energy production initially blocked synaptic transmission but subsequently caused a potentiation of synaptic transmission due to increased glutamate release. In contrast, longer five-minutes-lasting blockage of energy production caused a sustained decrease of synaptic transmission. A correlation between the increase of extracellular potassium concentration and the response upon chemical ischemia indicates that the severity of the ischemia determines whether synapses potentiate or depress upon chemical ischemia. A subsequent mechanistic analysis revealed that the speed of uptake of glutamate is unchanged. An increase in the duration of the fiber volley reflecting the extracellular voltage of the action potentials of the axon bundle was interpreted as an action potential broadening, which could provide mechanistic explanation. In summary, the data convincingly demonstrate that synaptic potentiation induced by chemical ischemia is caused by increased glutamate release.

      Strengths:

      The manuscript is well written, and the experiments are carefully designed. The results are exciting, novel, and important for the field. The main strength of the manuscript is the combination of electrophysiological recordings and optical glutamate imaging. The main conclusion of increased glutamate release was furthermore supported with an independent approach relying on a low-affinity competitive antagonist of glutamate receptors. The data are of exceptional quality. Several important controls were carefully performed, such as the stability of the recordings and the size of the extracellular space. The number of experiments are sufficient for the conclusions. The careful data analysis justifies the classification of two types of responses, namely synaptic potentiation and depression after chemical ischemia. The data are carefully discussed and the conclusions are justified.

      Weaknesses:

      The weaknesses are minor. The authors measured the fiber volley, which reflects the extracellular voltage of the compound action potential of the fiber bundle. The half-duration of the fiber volley was increased. These results are consistent with action potential broadening in the axons but the action potential broadening was not experimentally demonstrated. However, these results are carefully discussed.

    1. Reviewer #2 (Public Review):

      Summary:

      The study by Kremling et al. describes a study of the nsp16-nsp10 methyl transferase from SARS CoV-2 protein which is aimed at identifying inhibitors by x-ray crystallography-based compound screening.<br /> A set of 234 compounds were screened resulting in a set of adenosine-containing compounds or analogues thereof that bind in the SAM site of nsp16-nsp10. The compound selection was mainly based on similarity to SAM and docking of commercially available libraries. The resulting structures are of good quality and clearly show the binding mode of the compounds. It is not surprising to find that these compounds bind in the SAM pocket since they are structurally very similar to portions of SAM. Nevertheless, the result is novel and may be inspirational for the future design of inhibitors. Following up on the crystallographic screen the identified compounds were tested for antiviral activity and binding to np16-nsp10. In addition, an analysis of similar binding sites was presented.

      Strengths:

      The crystallography is solid and the structures are of good quality. The compound binding constitutes a novel finding.

      Weaknesses:

      The major weakness is the mismatch between antiviral activity and binding to the target protein. Only one of the compounds could be demonstrated to bind to the nsp16-nsp10 protein. By performing a displacement experiment using ITC Sangivamycin is concluded to bind with a Kd > 1mM. However, the same compound displays antiviral activity with an EC50 of 0.01 microM. Even though the authors do not make specific claims that the antiviral effect is due to inhibition of nsp16-nsp10, it is implicit. If the data is included, it should state specifically that the effect is not likely due to nsp16-nsp10 inhibition.

      The structure of the paper and the language needs quite a lot of work to bring it to the expected quality.

      Technical point:

      Refinement of crystallographic occupancies to single digit percentage is not normally supported by electron density.

    1. Reviewer #2 (Public Review):

      Summary:

      The flexibility of the ligand binding domain (LBD) of NRs allows various modes of ligand binding leading to various cellular outcomes. In the case of PPARγ, it's known that two ligands can co-bind to the receptor. However, whether a covalent inhibitor functions by blocking the binding of a non-covalent ligand, or co-bind in a manner that weakens the binding of a non-covalent ligand remains unclear. In this study, the authors first used TR-FRET and NMR to demonstrate that covalent inhibitors (such as GW9662 and T0070907) weaken but do not prevent non-covalent synthetic ligands from binding, likely via an allosteric mechanism. The AF-2 helix can exchange between active and repressive conformations, and covalent inhibitors shift the conformation toward a transcriptionally repressive one to reduce the orthosteric binding of the non-covalent ligands. By co-crystal studies, the authors further reveal the structural details of various non-covalent ligand binding mechanisms in a ligand-specific manner (e.g., an alternate binding site, or a new orthosteric binding mode by alerting covalent ligand binding pose).

      Strengths:

      The biochemical and biophysical evidence presented is strong and convincing.

      Weaknesses:

      However, the co-crystal studies were performed by soaking non-covalent ligands to LBD pre-crystalized with a covalent inhibitor. Since the covalent inhibitors would shift the LBD toward transcriptionally repressive conformation which reduces orthosteric binding of non-covalent ligands, if the sequence was reversed (i.e., soaking a covalent inhibitor to LBD pre-crystalized with a non-covalent ligand), would a similar conclusion be drawn? Additional discussion will broaden the implications of the conclusion.

    1. Reviewer #2 (Public Review):

      Summary:

      Pech et al selected 5 Parkinson's disease-causing genes, and generated multiple Drosophila lines by replacing the Drosophila lrrk, rab39, auxilin (aux), synaptojanin (synj), and Pink1 genes with wild-type and pathogenic mutant human or Drosophila cDNA sequences. First, the authors performed a panel of assays to characterize the phenotypes of the models mentioned above. Next, by using single-cell RNA-seq and comparing fly data with human postmortem tissue data, the authors identified multiple cell clusters being commonly dysregulated in these models, highlighting the olfactory projection neurons. Next, by using selective expression of Ca2+-sensor GCaMP3 in the OPN, the authors confirmed the synaptic impairment in these models, which was further strengthened by olfactory performance defects.

      Strengths:

      The authors overall investigated the functionality of PD-related mutations at endogenous levels and found a very interesting shared pathway through single-cell analysis, more importantly, they performed nice follow-up work using multiple assays.

      Weaknesses:

      While the authors state this is a new collection of five familial PD knock-in models, the AuxR927G model has been published and carefully characterized in Jacquemyn et al., 2023. ERG has been performed for Aux R927G in Jacquemyn et al., 2023, but the findings are different from what's shown in Figure 1b and Supplementary Figure 1d, which the authors should try to explain. Moreover, according to the authors, the hPINK1control was the expression of human PINK1 with UAS-hPINK1 and nsyb-Gal4 due to technical obstacles.  Having PINK1 WT being an overexpression model, makes it difficult to explain PINK1 mutant phenotypes. It will be strengthened if the authors use UAS-hPINK1 and nsyb-Gal4 (or maybe ubiquitous Gal4) to rescue hPink1L347P and hPink1P399L phenotypes. In addition, although the authors picked these models targeting different biology/ pathways, however, Aux and Synj both act in related steps of Clathrin-mediated endocytosis, with LRRK2 being their accessory regulatory proteins. Therefore, is the data set more favorable in identifying synaptic-related defects?

      GH146-GAL4+ PNs are derived from three neuroblast lineages, producing both cholinergic and GABAergic inhibitory PNs (Li et al, 2017). Therefore, OPN neurons have more than "cholinergic projection neurons". How do we know from single-cell data that cholinergic neurons were more vulnerable across 5 models?

      In Figure 1b, the authors assumed that locomotion defects were caused by dopaminergic neuron dysfunction. However, to better support it, the author should perform rescue experiments using dopaminergic neuron-specific Gal4 drivers. Otherwise, the authors may consider staining DA neurons and performing cell counting. Furthermore, the authors stated in the discussion, that "We now place cholinergic failure firmly ahead of dopaminergic system failure in flies", which feels rushed and insufficient to draw such a conclusion, especially given no experimental evidence was provided, particularly related to DA neuron dysfunction, in this manuscript.

      It is interesting to see that different familial PD mutations converge onto synapses. The authors have suggested that different mechanisms may be involved directly through regulating synaptic functions, or indirectly through mitochondria or transport. It will be improved if the authors extend their analysis on Figure 3, and better utilize their single-cell data to dissect the mechanisms. For example, for all the candidates listed in Figure 3C, are they all altered in the same direction across 5 models?

      While this approach is carefully performed, the authors should state in the discussions the strengths and the caveats of the current strategy. For example, what kind of knowledge have we gained by introducing these mutations at an endogenous locus? Are there any caveats of having scRNAseq at day 5 only but being compared with postmortem human disease tissue?

    1. Reviewer #2 (Public Review):

      Summary:

      Hiramatsu et al. investigated how cognate neurotransmitter receptors with antagonizing downstream effects localize within neurons when co-expressed. They focus on mapping the localization of the dopaminergic Dop1R1 and Dop2R receptors, which correspond to the mammalian D1- and D2-like dopamine receptors, which have opposing effects on intracellular cAMP levels, in neurons of the Drosophila mushroom body (MB). To visualize specific receptors in single neuron types within the crowded MB neuropil, the authors use existing dopamine receptor alleles tagged with 7 copies of split GFP to target reconstitution of GFP tags only in the neurons of interest as a read-out of receptor localization. The authors show that both Dop1R1 and Dop2R, with differing degrees, are enriched in axonal compartments of both the Kenyon Cells cholinergic presynaptic inputs and in different dopamine neurons (DANs), which project axons to the MB. Co-localization studies of dopamine receptors with the presynaptic marker Brp suggest that Dop1R1 and, to a larger extent Dop2R, localize in the proximity of release sites. This localization pattern in DANs suggests that Dop1R1 and Dop2R work in dual-feedback regulation as autoreceptors. Finally, they provide evidence that the balance of Dop1R1 and Dop2R in the axons of two different DAN populations is differentially modulated by starvation and that this regulation plays a role in regulating appetitive behaviors.

      Strengths:

      The authors use reconstitution of GFP fluorescence of split GFP tags knocked into the endogenous locus at the C-terminus of the dopamine receptors as a readout of dopamine receptor localization. This elegant approach preserves the endogenous transcriptional and post-transcriptional regulation of the receptor, which is essential for studies of protein localization.

      The study focuses on mapping the localization of dopamine receptors in neurons of the mushroom body. This is an excellent choice of system to address the question posed in this study, as the neurons are well-studied, and their connections are carefully reconstructed in the mushroom body connectome. Furthermore, the role of this circuit in different behaviors and associative memory permits the linking of patterns of receptor localization to circuit function and resulting behavior. Because of these features, the authors can provide evidence that two antagonizing dopamine receptors can act as autoreceptors within the axonal compartment of MB innervating DANs. The differential regulation of the balance of the two receptors under starvation in two distinct DAN innervations provides evidence of the role that regulation of this balance can play in circuit function and behavioral output.

      Weaknesses:

      The approach of using endogenously tagged alleles to study localization is a strength of this study, but the authors do not provide sufficient evidence that the insertion of 7 copies of split GFP to the C terminus of the dopamine receptors does not interfere with the endogenous localization pattern or function. Both sets of tagged alleles (1X Venus and 7X split GFP tagged) were previously reported (Kondo et al., 2020), but only the 1X Venus tagged alleles were further functionally validated in assays of olfactory appetitive memory. Despite the smaller size of the 7X split-GFP array tag knocked into the same location as the 1X venus tag, the reconstitution of 7 copies of GFP at the C terminus of the dopamine receptor, might substantially increase the molecular bulk at this site, potentially impeding the function of the receptor more significantly than the smaller, single Venus tag. The data presented by Kondo et al. 2020, is insufficient to conclude that the two alleles are equivalent.

      The authors' conclusion that the receptors localize to presynaptic sites is weak. The analysis of the colocalization of the active zone marker Brp whole-brain staining with dopamine receptors labeled in specific neurons is insufficient to conclude that the receptors are localized at presynaptic sites. Given the highly crowded neuropil environment, the data cannot differentiate between the receptor localization postsynaptic to a dopamine release site or at a presynaptic site within the same neuron. The known distribution of presynaptic sites within the neurons analyzed in the study provides evidence that the receptors are enriched in axonal compartments, but co-labeling of presynaptic sites and receptors in the same neuron or super-resolution methods are needed to provide evidence of receptor localization at active zones. The data presented in Figures 5K-5L provides compelling evidence that the receptors localize to neuronal varicosities in DANs where the receptors could play a role as autoreceptors.

      Given the highly crowded environment of the mushroom body neuropil, the analysis of dopamine receptor localization in Kenyon cells is not conclusive. The data is sufficient to conclude that the receptors are preferentially localizing to the axonal compartment of Kenyon cells, but co-localization with brain-wide Brp active zone immunostaining is not sufficient to determine if the receptor localizes juxtaposed to dopaminergic release sites, in proximity of release sites in Kenyon cells, or both.

    1. Reviewer #2 (Public Review):

      Summary:

      Yang and colleagues used a Hidden Markov Model (HMM) on whole-night fMRI to isolate sleep and wake brain states in a data-driven fashion. They identify more brain states (21) than the five sleep/wake stages described in conventional PSG-based sleep staging, show that the identified brain states are stable across nights, and characterize the brain states in terms of which networks they primarily engage.

      Strengths:

      This work's primary strengths are its dataset of two nights of whole-night concurrent EEG-fMRI (including REM sleep), and its sound methodology.

      Weaknesses:

      The study's weaknesses are its small sample size and the limited attempts at relating the identified fMRI brain states back to EEG.

      General appraisal:

      The paper's conclusions are generally well-supported, but some additional analyses and discussions could improve the work.

      The authors' main focus lies in identifying fMRI-based brain states, and they succeed at demonstrating both the presence and robustness of these states in terms of cross-night stability. Additional characterization of brain states in terms of which networks these brain states primarily engage adds additional insights.

      A somewhat missed opportunity is the absence of more analyses relating the HMM states back to EEG. It would be very helpful to the sleep field to see how EEG spectra of, say, different N2-related HMM states compare. Similarly, it is presently unclear whether anything noticeable happens within the EEG time course at the moment of an HMM class switch (particularly when the PSG stage remains stable). While the authors did look at slow wave density and various physiological signals in different HMM states, a characterization of the EEG itself in terms of spectral features is missing. Such analyses might have shown that fMRI-based brain states map onto familiar EEG substates, or reveal novel EEG changes that have so far gone unnoticed.

      It is unclear how the presently identified HMM brain states relate to the previously identified NREM and wake states by Stevner et al. (2019), who used a roughly similar approach. This is important, as similar brain states across studies would suggest reproducibility, whereas large discrepancies could indicate a large dependence on particular methods and/or the sample (also see later point regarding generalizability).

      More justice could be done to previous EEG-based efforts moving beyond conventional AASM-defined sleep/wake states. Various EEG studies performed data-driven clustering of brain states, typically indicating more than 5 traditional brain states (e.g., Koch et al. 2014, Christensen et al. 2019, Decat. et al 2022). Beyond that, countless subdivisions of classical sleep stages have been proposed (e.g., phasic/tonic REM, N2 with/without spindles, N3 with global/local slow waves, cyclic alternating patterns, and many more). While these aren't incorporated into standard sleep stage classification, the current manuscript could be misinterpreted to suggest that improved/data-driven classifications cannot be achieved from EEG, which is incorrect.

      More discussion of the limitations of the current sample and generalizability would be helpful. A sample of N=12 is no doubt impressive for two nights of concurrent whole-night EEG-fMRI. Still, any data-driven approach can only capture the brain states that are present in the sample, and 12 individuals are unlikely to express all brain states present in the population of young healthy individuals. Add to that all the potentially different or altered brain states that come with healthy ageing, other demographic variables, and numerous clinical disorders. How do the authors expect their results to change with larger samples and/or varying these factors? Perhaps most importantly, I think it's important to mention that the particular number of identified brain states (here 21, and e.g. 19 in Stevner) is not set in stone and will likely vary as a function of many sample- and methods-related factors.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors proposed a neural network model to explore the spatial representations of the hippocampal CA1 and entorhinal cortex (EC) and the remapping of these representations when multiple environments are learned. The model consists of a recurrent network and output units (a decoder) mimicking the EC and CA1, respectively. The major results of this study are: the EC network generates cells with their receptive fields tuned to a border of the arena; decoder develops neuron clusters arranged in a hexagonal lattice. Thus, the model accounts for entrohinal border cells and CA1 place cells. The authors also suggested the remapping of place cells occurs between different environments through state transitions corresponding to unstable dynamical modes in the recurrent network.

      Strengths:<br /> The authors found a spatial arrangement of receptive fields similar to their model's prediction in experimental data recorded from CA1. Thus, the model proposes a plausible mechanisms to generate hippocampal spatial representations without relying on grid cells. This result is consistent with the observation that grid cells are unnecessary to generate CA1 place cells.

      The suggestion about the remapping mechanism shows an interesting theoretical possibility.

      Weaknesses:<br /> The explicit mechanisms of generating border cells and place cells and those underlying remapping were not clarified at a satisfactory level.

      The model cannot generate entorhinal grid cells. Therefore, how the proposed model is integrated into the entire picture of the hippocampal mechanism of memory processing remains elusive.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors show that a combination of arginine methyltransferase inhibitors synergize with PARP inhibitors to kill ovarian and triple-negative cancer cell lines in vitro and in vivo using preclinical mouse models.

      PARP inhibitors have been the common targeted-therapy options to treat high-grade serous ovarian cancer (HGSOC) and triple-negative breast cancer (TNBC). PRMTs are oncological therapeutic targets and specific inhibitors have been developed. However, due to the insufficiency of PRMTi or PARPi single treatment for HGSOC and TNBC, designing novel combinations of existing inhibitors is necessary. In previous studies, the authors and others developed an "induced PARPi sensitivity by epigenetic modulation" strategy to target resistant tumors. In this study, the authors presented a triple combination of PRMT1i, PRMT5i and PARPi that synergistically kills TNBC cells. A drug screen and RNA-seq analysis were performed to indicate cancer cell growth dependency of PRMT1 and PRMT5, and their CRISPR/Cas9 knockout sensitizes cancer cells to PARPi treatment. It was shown that the cells accumulate DNA damage and have increased caspase 3/7 activity. RNA-seq analysis identified BRCAness genes, and the authors closely studied a top hit ERCC1 as a downregulated DNA damage protein in PRMT inhibitor treatments. ERCC1 is known to be synthetic lethal with PARP inhibitors. Thus, the authors add back ERCC1 and reduce the effects of PRMT inhibitors suggesting PRMT inhibitors mediate, in part, their effect via ERCC1 downregulation. The combination therapy (PRMT/PARP) is validated in 2D cultures of cell lines (OVCAR3, 8 and MDA-MB-231) and has shown to be effective in nude mice with MDA-MB-231 xenograph models.

      Strengths and weaknesses:

      Overall, the data is well-presented. The experiments are well-performed, convincing, and have the appropriate controls (using inhibitors and genetic deletions) and statistics.

      They identify the DNA damage protein ERCC1 to be reduced in expression with PRMT inhibitors. As ERCC1 is known to be synthetic lethal with PARPi, this provides a mechanism for the synergy. They use cell lines only for their study in 2D as well as xenograph models.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Herneisen et al. examines the Toxoplasma SPARK kinase orthologous to mammalian PDK1 kinase. The extracellular signals trigger cascades of the second messengers and play a central role in the apicomplexan parasites' survival. In Toxoplasma, these cascades regulate active replication of the tachyzoites, which manifests as acute toxoplasmosis, or the development into drug-resilient bradyzoites characteristic of the chronic stage of the disease. This study focuses on the poorly understood signaling mechanisms acting upstream of such second messenger kinases as PKA and PKG. The authors showed that similar to PDK1, Toxoplasma SPARK likely regulates several AGC kinases.

      Strengths:

      The study demonstrated a strong association of the SPARK kinase with the SPARKL factor and an uncharacterized AGC kinase. Using a set of standard assays, the authors determined the SPARK /SPARLS role in parasite egress, invasion, and bradyzoite differentiation.

      Weaknesses:

      Although the revised manuscript has significantly improved, the primary concern of incomplete data analysis still needs to be addressed.

    1. Reviewer #2 (Public Review):

      This manuscript reports several interesting observations that invite follow-up. The notion that hubs, and perhaps condensates that may (or may not embrace them) are functionally and physiologically important is an open issue at this time. The authors note that TFIIIC helps to prune extraneous connections from hubs, but do not comment that the connections that are maintained are also reinforced. At the same time only modest changes in gene expression associated with expanded or decreased connections and changes in bound proteins. One interesting possibility might be that standard methods for assessing expression miss changes global or background transcription. It seems that the TFIIIC-MYCN-ER connection has features that would help to suppress such background. The results invite a more global consideration of TFIIIC than as primarily RNAPIII/small RNA transcription factor and of MYCN as an E-box dependent transcription factor. The results use sate of the art methods to develop interesting new ideas that have the potential to instruct further studies that may reveal new mechanisms of action for TFIIIC and MYCN.

      The work is however subject to a couple of caveats. First, the authors should be more cautious when drawing firm conclusions about the dynamics and kinetics of transcription from the static snapshots obtained from most genomic methods. For example, please take a look at Figure 1F of "Transcription elongation defects link oncogenicSF3B1 mutations to targetable alterations in chromatin landscape" by Buddu et al, https://doi.org/10.1016/j.molcel.2024.02.032. Here, an increase in RNAPSer2P is seen in gene bodies and a bit at the TES- superficially inviting the conclusion that expression is increased (a similar erroneous conclusion has been claimed in other genomic studies), but the increase is in fact, not due to increased transcription, rather to impaired elongation-this conclusion required performing TT-Seq which allowed inferences to be made about elongation rates. Acknowledging this qualification would help advise the reader.

      The authors also need to discuss directly what differences between the MYC predominant SH-EP cells and the MYCN-predominant SH-EP-MYCNER+tamoxifen are qualitative versus quantitative. MYCNER indeed associates much more with chromatin than did MYC, but there seems to be a lot more MYCER than there was MYC prior to the addition of tamoxifen. (The true control for this would be to prepare SH-EP-MYCER cells expressed from the same promoter as was MYCNER. Some discussion of qualitative versus quantitative differences should be acknowledged.

      Strengths:

      Use of a variety of methods to assess the genomic response to increased MYCN in the presence or absence of TFIIIC. Clearly establishes in vitro and in vivo the TFIIIC-MYCN complex

      Weaknesses:

      Dynamic inferences are made without kinetic experiments.

    1. Reviewer #2 (Public Review):

      Summary:

      The study is devoted to the deep investigation of the spermatogonial stem cell (SSC) niche in trans women after gender-affirming hormone therapy (GAHT). Both cellular structure and functionality of the niche were studied. The authors evidently demonstrated that all cellular components of SSC niche were affected by hormone therapy. Interestingly, the signs of "rejuvenation" within the niche were also observed indicating the possible reverse to the immature condition.

      Strengths:

      The obtained findings are important for the better understanding of hormonal regulation of testis and SSC niche and provide some clues for using the biomaterials from these specific and even unique donors for biomedical research.

      Weaknesses:

      This study has some limitations. Many studies can't be done using the testes cells of trans women, since their cells are significantly different from adult man cells and less from prepubertal and pubertal cells. The authors themselves identify some of the limitations: this material is suitable only for studying prepubertal processes in the testis. However, the authors also report large variability in data due to different hormonal therapy regimens and, apparently, age. Accordingly, not all material obtained from trans women can also be used for studies of prepubertal processes.

    1. Reviewer #2 (Public Review):

      Summary:

      Golamalamdari, van Schaik, Wang, Kumar Zhang, Zhang, and colleagues study interactions between the speckle, nucleolus, and lamina in multiple cell types (K562, H1, HCT116, and HFF). Their datasets define how interactions between the genome and the different nuclear landmarks relate to each other and change across cell types. They also identify how these relationships change in K562 cells in which LBR and LMNA are knocked out.

      Strengths:

      Overall, there are a number of datasets that are provided, and several "integrative" analyses are performed. This is a major strength of the paper, and I imagine the datasets will be of use to the community to further probed and the relationships elucidated here further studied. An especially interesting result was that specific genomic regions (relative to their association with the speckle, lamina, and other molecular characteristics) segregate relative to the equatorial plane of the cell.

      Weaknesses:

      The experiments are largely descriptive, and it is difficult to draw many cause-and-effect relationships. Similarly, the paper would be very much strengthened if the authors provided additional summary statements and interpretation of their results (especially for those not as familiar with 3D genome organization). The study would benefit from a clear and specific hypothesis.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript from Belato et al. used advanced NMR approaches and a mutagenesis campaign to probe the conformational dynamics of the recognition lobe (Rec) of the CRISPR Cas9 enzyme from G. stearothermophilus (GeoCas9). Using truncated and full-length constructs they assess the impacts of two different point mutations have on the redistribution and timescale of these motions and assess gRNA recognition and specificity. Single point mutations in the Rec domain in a Cas9 from a related species had profound impacts on- and off-target DNA editing, therefore the authors reasoned analogous mutations in GeoCas9 would have similar effects. However, despite a redistribution of local motions and changes in global stability, their chosen mutations had little impact on DNA editing in the context of the full-length enzyme. Their studies highlight the species-specific complexity of interdomain communication and allosteric mechanisms used by these multi-domain endonucleases. Despite these negative results, their study is highly rigorous, and their approach will broadly support understanding how the activity and specificity of these enzymes can be engineered to tune activity and limit off-target cleavage by these enzymes.

      Strengths:

      (1) Atomistic investigation of the conformational dynamics of the GeoCas9 gRNA recognition lobe (GeoRec), probing dynamics on a broad range of timescales from ps to ms using advanced NMR approaches will be broadly interesting to both the structural biology and CRISPR engineering communities.

      (2) Highly rigorous biophysical studies that push the boundaries of current techniques, provide insight into local dynamics of the GeoRec domain that serve to propagate allosteric information and potentially regulate enzymatic activity.

      (3) The study highlights the complexities of understanding interdomain communication in Cas9 enzymes since analogous mutations in different species have different effects on target recognition and cleavage.

      (4) The type of structural and dynamic insights derived from this study design could serve as foundational information to guide a rational design strategy aimed at improving the selectivity and reducing the off-target effects of Cas9 enzymes.

      Weaknesses:

      (1) Despite the rigor of the experiments, the mutations chosen by the authors do not have a profound effect on the overall substrate affinity or activity of GeoCas9 rendering little mechanistic insight into allosteric communication in this particular Cas9. However, the double mutant K267E/R332A has a more pronounced effect on the cleavage of WT and mismatched (at nucleotides 19 and 20) DNA substrates while minimally affecting the cleavage of mismatched (at nucleotides 5 and 6), suggesting more could be learned about the allosteric mechanism from the detailed characterization of this mutant.

      (2) Follow-up experiments with other residues that were identified as being highly dynamic might affect substrate recognition and cleavage activity in different ways providing additional insight.

      (3) Details regarding the authors' experimental approach are incomplete such as a description of the model used to fit the CD data, a detailed explanation of the global fitting of the relaxation dispersion data describing how the best-fit model was selected, and the description of the ModelFree fitting of fast timescale dynamics is incomplete.

    1. Reviewer #3 (Public Review):

      Summary:

      Deng et al. assess neonatal cord blood methylation profiles and the association with (self-reported) maternal smoking in multiple populations, including two European (CHILD, FAMILY) and one South Asian (START), via two approaches: 1) they perform an independent epigenome-wide association study (EWAS) and meta-analysis across the CHILD and FAMILY cohort, during which they also benchmark previously reported maternal-smoking associated sites, and 2) they generate new composite methylation risk scores for maternal smoking, and assess their performance and association with phenotypic characteristics in the three populations, in addition to previously described maternal smoking methylation risk scores.

      Strengths and weaknesses:

      Their meta-analysis across multiple cohorts and comparison with previous findings represents a strength. In particular the inclusion of a South Asian birth cohort is commendable as it may help to bolster generalizability. However, their conclusions are limited by several important weaknesses:

      (1) the low number of (self-reported) maternal smokers in particular their South Asian population, resulting in an inability to conduct benchmarking of maternal smoking sites in this cohort. As such, the inclusion of the START cohort in certain figures is not warranted (e.g., Figure 3) and the overall statement that smoking-associated MRS are portable across populations are not fully supported;<br /> (2) different methylation profiling tools were used: START and CHILD methylation profiles were generated using the more comprehensive 450K array while the FAMILY cohort blood samples were profiled using a targeted array covering only 3,000, as opposed to 450,000 sites, resulting in different coverage of certain sites which affects downstream analyses and MRS, and importantly, omission of potentially relevant sites as the array was designed in 2016 and substantial additional work into epigenetic traits has been conducted since then;<br /> (3) the authors train methylation risk scores (MRS) in CHILD or FAMILY populations based on sites that are associated with maternal smoking in both cohorts and internally validate them in the other cohort, respectively. As START cohort due to insufficient numbers of self-reported maternal smokers, the authors cannot fully independently validated their MRS, thus limiting the strength of their results.

      Overall strength of evidence and conclusions:

      Despite these limitations, the study overall does explore the feasibility of using neonatal cord blood for the assessment of maternal smoking. However, their conclusion on generalizability of the maternal smoking risk score is currently not supported by their data as they were not able to validate their score in a sufficiently large number of maternal smokers and never smokers of South Asian populations.

      While their generalizability remains limited due to small sample numbers and previous studies with methylation risk scores exist, their findings may nonetheless provide the basis for future work into prenatal exposures which will be of interest to the research community. In particular their finding that the maternal smoking-associated MRS was associated with small birth sizes and weights across birth cohorts, including the South Asian birth cohort that had very few self-reported smokers, is interesting and the author suggest these findings could be associated with factors other than smoking alone (e.g., pollution), which warrant further investigation and would be highly novel.<br /> Future exploration should also include a strong focus on more diverse health outcomes, including respiratory conditions that may have long-lasting health consequences.

    1. Reviewer #2 (Public Review):

      The authors investigated the conformational dynamics and energetics of the SthK Clinker/CNBD fragment using both steady-state and time-resolved transition metal ion Förster resonance energy transfer (tmFRET) experiments. To do so, they engineered donor-acceptor pairs at specific sites of the CNBD (C-helix and β-roll) by incorporating a fluorescent noncanonical amino acid donor and metal ion acceptors. In particular, the authors employed two cysteine-reactive metal chelators (TETAC and phenM). This allowed them to coordinate three transition metals (Cu2+, Fe2+, and Ru2+) to measure both short (10-20 Å, Cu2+) and long distances (25-50 Å, Fe2+, and Ru2+). By measuring tmFRET with fluorescence lifetimes, the authors determined intramolecular distance distributions in the absence and presence of the full agonist cAMP or the partial agonist cGMP. The probability distributions between conformational states without and with ligands were used to calculate the changes in free energy (ΔG) and differences in free energy change (ΔΔG) in the context of a simple four-state model.

      Overall, the work is conducted in a rigorous manner, and it is well-written. I greatly enjoyed reading it.

      Nonetheless, I do not see the novelty that the authors claim.

      In terms of methodology, this work provides further support to steady-state and time-resolved tmFRET approaches previously developed by the authors of the present work to probe conformational rearrangements by using a fluorescent noncanonical amino acid donor (Anap) and transition metal ion acceptor (Zagotta et al., eLIfe 2021; Gordon et al., Biophysical Journal 2024; Zagotta et al., Biophysical Journal 2024).

      Regarding cyclic nucleotide-binding domain (CNBD)-containing ion channels, I disagree with the authors when they state that "the precise allosteric mechanism governing channel activation upon ligand binding, particularly the energetic changes within domains, remains poorly understood". On the contrary, I would say that the literature on this subject is rather vast and based on a significantly large variety of methodologies. This is a not exhaustive list of papers: Zagotta et al., Nature 2003; Craven et al., GJP, 2004; Craven et al., JBC, 2008; Taraska et al., Nature Methods, 2009; Puljung et al., JBC, 2013; Saponaro et al., PNAS 2014; Goldschen-Ohm et al., eLife, 2016; Bankston et al., JBC, 2017; Hummert et al., PLoS Comput Biol., 2018; Porro et al., eLife, 2019; Ng et al., JGP, 2019; Porro et al., JGP, 2020; Evans et al., PNAS, 2020; Pfleger et al., Biophys J. 2021; Saponaro et al., Mol Cell, 2021; Dai et al., Nat Commun. 2021; Kondapuram et al., Commun Biol. 2022. These studies were conducted either on the isolated Clinker/CNBD fragments or on the entire full-length proteins. As is evident from the above list, the authors of the present work have significantly contributed to the understanding of the allosteric mechanism governing the ligand-induced activation of CNBD-containing channels, including a detailed description of the energetic changes induced by ligand binding. Particularly relevant are their works based on DEER spectroscopy. In DeBerg et al., JBC 2016, the authors described, in atomic detail, the conformational changes induced by different cyclic nucleotides on the HCN CNBD fragment and derived energetics associated with ligand binding to the CNBD (ΔΔG). In Collauto et al., Phys Chem Chem Phys. 2017, they further detailed the ligand-CNBD conformational changes by combining DEER spectroscopy with microfluidic rapid freeze quench to resolve these processes and obtain both equilibrium constants and reaction rates, thus demonstrating that DEER can quantitatively resolve both the thermodynamics and the kinetics of ligand binding and the associated conformational changes.

      Suggestions:

      - In light of the above, I suggest the authors better clarify the contribution/novelty that the present work provides to the state-of-the-art methodology employed (steady-state and time-resolved tmFRET) and of CNBD-containing ion channels. In particular, it would be nice to have a comparison with the conformational dynamics and energetics reported in the previous works of the authors based on DEER spectroscopy (DeBerg et al., JBC 2016, Collauto et al., Phys Chem Chem Phys. 2017 and Evans et al., PNAS, 2020) and with Goldschen-Ohm et al., eLife, 2016, where single-molecule events (FRET-based) of cAMP binding to HCN CNBD were measured and kinetic rate constants were models in the context of a simple four-state model, reminiscent of the model employed in the present work.

      - Even considering the bacterial SthK channel, cryo-EM has significantly advanced the atomistic understanding of its ligand-dependent regulation (Rheinberger et al., eLife, 2018). More recently, the authors of the present work have elegantly employed DEER on full-length SthK protein to reveal ligand-dependent conformational rearrangements in the Clinker region (Evans et al., PNAS, 2020). In light of the above, what is the contribution/novelty that the present work provides to the SthK biophysics?

      - The authors decided to use the Clinker/CNBD fragment of SthK. On the basis of the above-cited work (Evans et al., PNAS, 2020) the authors should clarify why they have decided to work on the isolated Clinker/CNBD fragment and not on the full-length protein. I assume that the use of the C-licker/CNBD fragment was necessary to isolate tetramers with only one labelled subunit (fSEC and MP were used to confirm this) to avoid inter-subunit crass-talk. However, I am not clear if this is correct.

      - What is the advantage of using the Clinker/CNBD fragment of a bacterial protein and not one of HCN channels, as already successfully employed by the authors (see above citations)?

    1. Reviewer #2 (Public Review):

      Summary:

      Wine et al. describe a framework to view the estimation of gene-context interaction analysis through the lens of bias-variance tradeoff. They show that, depending on trait variance and context-specific effect sizes, effect estimates may be estimated more accurately in context-combined analysis rather than in context-specific analysis. They proceed by investigating, primarily via simulations, implications for the study or utilization of gene-context interaction, for testing and prediction, in traits with polygenic architecture. First, the authors describe an assessment of the identification of context-specificity (or context differences) focusing on "top hits" from association analyses. Next, they describe an assessment of polygenic scores (PGSs) that account for context-specific effect sizes, showing, in simulations, that often the PGSs that do not attempt to estimate context-specific effect sizes have superior prediction performance. An exception is a PGS approach that utilizes information across contexts.

      Strengths:

      The bias-variance tradeoff framing of GxE is useful, interesting, and rigorous. The PGS analysis under pervasive amplification is also interesting and demonstrates the bias-variance tradeoff.

      Weaknesses:

      The weakness of this paper is that the first part -- the bias-variance tradeoff analysis -- is not tightly connected to, i.e. not sufficiently informing, the later parts, that focus on polygenic architecture. For example, the analysis of "top hits" focuses on the question of testing, rather than estimation, and testing was not discussed within the bias-variance tradeoff framework. Similarly, while the PGS analysis does demonstrate (well) the bias-variance tradeoff, the reader is left to wonder whether a bias-variance deviation rule (discussed in the first part of the manuscript) should or could be utilized for PGS construction.

    1. Reviewer #2 (Public Review):<br /> The authors investigate the disparity between spatial extant and temporal variance of electrophysiological-fMRI correlations in a rodent model. They found high correspondence in spatial extent but a disparity in temporal variance. From this, they propose a model of an electrophysiologically-invisible signal affecting temporal variance.

      I remain skeptical about the "electrophysiologically invisible signal" model but the authors have done a much better job of both explaining it and hedging it in this version. Readers can decide for themselves.

      The revision submitted by the authors substantially improves writing and methods.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Chia-Lo Ho et al. study the impact of CD5high CD8 T cells in the pathophysiology of type 1 diabetes (T1D) in NOD mice. The authors used high expression of CD5 as a surrogate of high TCR signaling and self-reactivity and compared the phenotype, transcriptome, TCR usage, function, and pathogenic properties of CD5high vs. CD5low CD8 T cells extracted from the so-called naive T cell pool. The study shows that CD5high CD8 T cells resemble memory T cells poised for a stronger response to TCR stimulation and that they exacerbate disease upon transfer in RAG-deficient NOD mice. The authors attempt to link these features to the thymic selection events of these CD5high CD8 T cells. Importantly, forced overexpression of the phosphatase PTPN22 in T cells attenuated TCR signaling and reduced pathogenicity of polyclonal CD8 T cells but not highly autoreactive 8.3-TCR CD8 T cells.

      Strengths:

      The study is nicely performed and the manuscript is clear and well-written. Interpretation of the data is careful and fair. The data are novel and likely important. However, some issues would need to be clarified through either text changes or the addition of new data.

      Weaknesses:

      The definition of naïve T cells based solely on CD44low and CD62Lhigh staining may be oversimplistic. Indeed, even within this definition, naïve CD5high CD8 T cells express much higher levels of CD44 than CD5low CD8 T cells.

    1. Reviewer #2 (Public Review):

      Summary:

      This study comprehensively presents data from single nuclei sequencing of Heigai pig skeletal muscle in response to conjugated linoleic acid supplementation. The authors identify changes in myofiber type and adipocyte subpopulations induced by linoleic acid at depth previously unobserved. The authors show that linoleic acid supplementation decreased the total myofiber count, specifically reducing type II muscle fiber types (IIB), myotendinous junctions, and neuromuscular junctions, whereas type I muscle fibers are increased. Moreover, the authors identify changes in adipocyte pools, specifically in a population marked by SCD1/DGAT2. To validate the skeletal muscle remodeling in response to linoleic acid supplementation, the authors compare transcriptomics data from Laiwu pigs, a model of high intramuscular fat, to Heigai pigs. The results verify changes in adipocyte subpopulations when pigs have higher intramuscular fat, either genetically or diet-induced. Targeted examination using cell-cell communication network analysis revealed associations with high intramuscular fat with fibro-adipogenic progenitors (FAPs).  The authors then conclude that conjugated linoleic acid induces FAPs towards adipogenic commitment. Specifically, they show that linoleic acid stimulates FAPs to become SCD1/DGAT2+ adipocytes via JNK signaling. The authors conclude that their findings demonstrate the effects of conjugated linoleic acid on skeletal muscle fat formation in pigs, which could serve as a model for studying human skeletal muscle diseases.

      Strengths:

      The comprehensive data analysis provides information on conjugated linoleic acid effects on pig skeletal muscle and organ function. The notion that linoleic acid induces skeletal muscle composition and fat accumulation is considered a strength and demonstrates the effect of dietary interactions on organ remodeling. This could have implications for the pig farming industry to promote muscle marbling. Additionally, these data may inform the remodeling of human skeletal muscle under dietary behaviors, such as elimination and supplementation diets and chronic overnutrition of nutrient-poor diets. However, the biggest strength resides in thorough data collection at the single nuclei level, which was extrapolated to other types of Chinese pigs.

      Weaknesses:

      While the authors generated a sizeable comprehensive dataset, cellular and molecular validation needed to be improved. For example, the single nuclei data suggest changes in myofiber type after linoleic acid supplementation, yet these data are not validated by other methodologies. Similarly, the authors suggest that linoleic acid alters adipocyte populations, FAPs, and preadipocytes; however, no cellular and molecular analysis was performed to reveal if these trajectories indeed apply. Attempts to identify JNK signaling pathways appear superficial and do not delve deeper into mechanistic action or transcriptional regulation. Notably, a variety of single cell studies have been performed on mouse/human skeletal muscle and adipose tissues. Yet, the authors need to discuss how the populations they have identified support the existing literature on cell-type populations in skeletal muscle. Moreover, the authors nicely incorporate the two pig models into their results, but the authors only examine one muscle group. It would be interesting if other muscle groups respond similarly or differently in response to linoleic acid supplementation. Further, it was unclear whether Heigai and Laiwu pigs were both fed conjugated linoleic acid or whether the comparison between Heigai-fed linoleic acid and Laiwu pigs (as a model of high intramuscular fat). With this in mind, the authors do not discuss how their results could be implicated in human and pig nutrition, such as desirability and cost-effectiveness for pig farmers and human diets high in linoleic acid. Notably, while single nuclei data is comprehensive, there needs to be a statement on data deposition and code availability, allowing others access to these datasets. Moreover, the experimental designs do not denote the conjugated linoleic acid supplementation duration. Several immunostainings performed could be quantified to validate statements. This reviewer also found the Nile Red staining hard to interpret visually and did not appear to support the conclusions convincingly. Within Figure 7, several letters (assuming they represent statistical significance) are present on the graphs but are not denoted within the figure legend.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors used a large cohort of patients with metastatic lung cancer pre- and 1-3 weeks post-immunotherapy. The goal was to investigate whether immunotherapy results in changes in CHIP clones (using targeted sequencing and whole exome sequencing) as well as to investigate whether patients with CHIP changed their response to immunotherapy (single-cell RNA sequencing).

      Strengths:

      This represents a large cohort of patients, and comprehensive assays - including targeted sequencing, whole exome sequencing, and single-cell RNA sequencing.

      Weaknesses:

      Findings are not necessarily unexpected. With regards to clonal dynamics, it would be very unlikely to see any changes within a few weeks' time frame. Longer follow-up to assess clonal dynamics would realistically be necessary.

    1. Reviewer #2 (Public Review):

      Summary:

      In this paper, the function of trpγ in lipid metabolism was investigated. The authors found that lipid accumulation levels were increased in trpγ mutants and remained high during starvation; the increased TAG levels in trpγ mutants were restored by the expression of active AMPK in DH44 neurons and oral administration of the anti-diabetic drug metformin. Furthermore, oral administration of lipase, TAG, and free fatty acids effectively restored the survival of trpγ mutants under starvation conditions. These results indicate that TRPv plays an important role in the maintenance of systemic lipid levels through the proper expression of lipase. Furthermore, authors have shown that this function is mediated by DH44R2. This study provides an interesting finding in that the neuropeptide DH44 released from the brain regulates lipid metabolism through a brain-gut axis, acting on the receptor DH44R2 presumably expressed in gut cells.

      Strengths:

      Using Drosophila genetics, careful analysis of which cells express trpγ regulates lipid metabolism is performed in this study. The study supports its conclusions from various angles, including not only TAG levels, but also fat droplet staining and survival rate under starved conditions, and oral administration of substances involved in lipid metabolism.

      Weaknesses:

      Lipid metabolism in the gut of DH44R2-expressing cells should be investigated for a better understanding of the mechanism. Fat accumulation in the gut is not mechanistically linked with fat accumulation in the fat body. The function of lipase in the gut (esp. R2 region) should be addressed, e.g. by manipulating gut-lipases such as magro or Lip3 in the gut in the contest of trpγ mutant. Also, it is not clarified which cell types in the gut DH44R2 is expressed. The study also mentioned only in the text that bmm expression in the gut cannot restore lipid droplet enlargement in the fat body, but this result might be presented as a figure.

    1. Reviewer #2 (Public Review):

      Summary:

      The study investigates the molecular mechanisms underlying chronic pain-related memory impairment by focusing on S1P/S1PR1 signaling in the dentate gyrus (DG) of the hippocampus. Through behavioural tests (Y-maze and Morris water maze) and RNA-seq analysis, the researchers segregated chronic pain mice into memory impairment-susceptible and -unsusceptible subpopulations. They discovered that S1P/S1PR1 signaling is crucial for determining susceptibility to memory impairment, with decreased S1PR1 expression linked to structural plasticity changes and memory deficits.

      Knockdown of S1PR1 in the DG induced a susceptible phenotype, while overexpression or pharmacological activation of S1PR1 promoted resistance to memory impairment and restored normal synaptic structure. The study identifies actin cytoskeleton-related pathways, including ITGA2 and its downstream Rac1/Cdc42 signaling, as key mediators of S1PR1's effects, offering new insights and potential therapeutic targets for chronic pain-related cognitive dysfunction.

      This manuscript consists of a comprehensive investigation and significant findings. The study provides novel insights into the molecular mechanisms of chronic pain-related memory impairment, highlighting the critical role of S1P/S1PR1 signaling in the hippocampal dentate gyrus. The clear identification of S1P/S1PR1 as a potential therapeutic target offers promising avenues for future research and treatment strategies. The manuscript is well-structured, methodologically sound, and presents valuable contributions to the field.

      Strengths:

      (1) The manuscript is well-structured and written in clear, concise language. The flow of information is logical and easy to follow.

      (2) The segregation of mice into memory impairment-susceptible and -unsusceptible subpopulations is innovative and well-justified. The statistical analyses are robust and appropriate for the data.

      (3) The detailed examination of S1PR1 expression and its impact on synaptic plasticity and actin cytoskeleton reorganization is impressive. The findings are significant and contribute to the understanding of chronic pain-related memory impairment.

      Weaknesses:

      (1) Results: While the results are comprehensive, some sections are data-heavy and could be more reader-friendly with summarized key points before diving into detailed data.

      (2) Discussion: There is a need for a more balanced discussion regarding the limitations of the study. For example, addressing potential biases in the animal model or limitations in the generalizability of the findings to humans would strengthen the discussion. Also, providing specific suggestions for follow-up studies would be beneficial.

      (3) Conclusion: The conclusion, while concise, could better highlight the study's broader impact on the field and potential clinical implications.

    1. Reviewer #2 (Public Review):

      Summary:

      The study investigates the brain's functional connectivity (FC) dynamics across different timescales using simultaneous recordings of intracranial EEG/source-localized EEG and fMRI. The primary research goal was to determine which of three convergence/divergence scenarios is the most likely to occur.

      The results indicate that despite similar FC patterns found in different data modalities, the time points were not aligned, indicating spatial convergence but temporal divergence.

      The researchers also found that FC patterns in different frequencies do not overlap significantly, emphasizing the multi-frequency nature of brain connectivity. Such asynchronous activity across frequency bands supports the idea of multiple connectivity states that operate independently and are organized into a multiplex system.

      Strengths:

      The data supporting the authors' claims are convincing and come from simultaneous recordings of fMRI and iEEG/EEG, which has been recently developed and adapted.

      The analysis methods are solid and involve a novel approach to analyzing the co-occurrence of FC patterns across modalities (cross-modal recurrence plot, CRP) and robust statistics, including replication of the main results using multiple operationalizations of the functional connectome (e.g., amplitude, orthogonalized, and phase-based coupling).

      In addition, the authors provided a detailed interpretation of the results, placing them in the context of recent advances and understanding of the relationships between functional connectivity and cognitive states.

      Weaknesses:

      Despite the impressive work, the paper still lacks some analyses to make it complete.

      Firstly, the effect of the window size is unclear, especially in the case of different frequencies where the number of cycles that fall in a window will vary drastically. A typical oscillation lasts just a few cycles (see Myrov et al., 2024), and brain states are usually short-lived because of meta-stability (see Roberts et al., 2019).

      Secondly, the authors didn't examine frequencies lower than 1Hz despite similarities between fMRI and infra-slow oscillations found in prior literature (see Palva et al., 2014; Zhang et al., 2023).

      On a minor note, the phase-locking value (PLV) is positively biased for EEG data (see Palva et al., 2018) and a different metric for phase coupling could be a more appropriate choice (e.g., iPLV/wPLI, see Vinck et al., 2011). The repository with the code is also unavailable.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors evaluate spectral changes in electroencephalography (EEG) data as a function of the congruency of audio and visual information associated with biological motion (BM) or non-biological motion. The results show supra-additive power gains in the neural response to gait dynamics, with trials in which audio and visual information were presented simultaneously producing higher average amplitude than the combined average power for auditory and visual conditions alone. Further analyses suggest that such supra-additivity is specific to BM and emerges from temporoparietal areas. The authors also find that the BM-specific supra-additivity is negatively correlated with autism traits.

      Strengths:

      The manuscript is well-written, with a concise and clear writing style. The visual presentation is largely clear. The study involves multiple experiments with different participant groups. Each experiment involves specific considered changes to the experimental paradigm that both replicate the previous experiment's finding yet extend it in a relevant manner.

      Weaknesses:

      The manuscript interprets the neural findings using mechanistic and cognitive claims that are not justified by the presented analyses and results.

      First, entrainment and cortical tracking are both invoked in this manuscript, sometimes interchangeably so, but it is becoming the standard of the field to recognize their separate evidential requirements. Namely, step and gate cycles are striking perceptual or cognitive events that are expected to produce event-related potentials (ERPs). The regular presentation of these events in the paradigm will naturally evoke a series of ERPs that leave a trace in the power spectrum at stimulation rates even if no oscillations are at play. Thus, the findings should not be interpreted from an entrainment framework except if it is contextualized as speculation, or if additional analyses or experiments are carried out to support the assumption that oscillations are present. Even if oscillations are shown to be present, it is then a further question whether the oscillations are causally relevant toward the integration of biological motion and for the orchestration of cognitive processes.

      Second, if only a cortical tracking account is adopted, it is not clear why the demonstration of supra-additivity in spectral amplitude is cognitively or behaviorally relevant. Namely, the fact that frequency-specific neural responses to the [audio & visual] condition are stronger than those to [audio] and [visual] combined does not mean this has implications for behavioral performance. While the correlation to autism traits could suggest some relation to behavior and is interesting in its own right, this correlation is a highly indirect way of assessing behavioral relevance. It would be helpful to test the relevance of supra-additive cortical tracking on a behavioral task directly related to the processing of biological motion to justify the claim that inputs are being integrated with the service of behavior. Under either framework, cortical tracking or entrainment, the causal relevance of neural findings toward cognition is lacking.

      Overall, I believe this study finds neural correlates of biological motion, and it is possible that such neural correlates relate to behaviorally relevant neural mechanisms, but based on the current task and associated analyses this has not been shown.

    1. Reviewer #2 (Public Review):

      MotorNet aims to provide a unified interface where the trained RNN controller exists within the same TensorFlow environment as the end effectors being controlled. This architecture provides a much simpler interface for the researcher to develop and iterate through computational hypotheses. In addition, the authors have built a set of biomechanically realistic end effectors (e.g., a 2 joint arm model with realistic muscles) within TensorFlow that are fully differentiable.

      MotorNet will prove a highly useful starting point for researchers interested in exploring the challenges of controlling movement with realistic muscle and joint dynamics. The architecture features a conveniently modular design and the inclusion of simpler arm models provides an approachable learning curve. Other state-of-the-art simulation engines offer realistic models of muscles and multi-joint arms and afford more complex object manipulation and contact dynamics than MotorNet. However, MotorNet's approach allows for direct optimization of the controller network via gradient descent rather than reinforcement learning, which is a compromise currently required when other simulation engines (as these engines' code cannot be differentiated through).

      The paper has been reorganized to provide clearer signposts to guide the reader. Importantly, the software has been rewritten atop PyTorch which is increasingly popular in ML and computational neuroscience research.

    1. Reviewer #3 (Public Review):

      Summary:

      In this paper Hajra et al have attempted to identify the role of Sirt1 and Sirt3 in regulating metabolic reprogramming and macrophage host defense. They have performed gene knock down experiments in RAW macrophage cell line to show that depletion of Sirt1 or Sirt3 enhances the ability of macrophages to eliminate Salmonella Typhimurium. However, in mice inhibition of Sirt1 resulted in dissemination of the bacteria but the bacterial burden was still reduced in macrophages. They suggest that the effect they have observed is due to increased inflammation and ROS production by macrophages. They also try to establish a weak link with metabolism. They present data to show that the switch in metabolism from glycolysis to fatty acid oxidation is regulated by acetylation of Hif1a, and PDHA1.

      Strengths:

      The strength of the manuscript is that the role of Sirtuins in host-pathogen interactions has not been previously explored in-depth making the study interesting. It is also interesting to see that depletion of either Sirt1 or Sirt3 results in a similar outcome.

      Weaknesses:

      The major weakness of the paper is the low quality of data, making it harder to substantiate the claims. Also, there are too many pathways and mechanisms being investigated. It would have been better if the authors had focussed on either Sirt1 or Sirt3 and elucidated how it reprograms metabolism to eventually modulate host response against Salmonella Typhimurium. Experimental evidence is also lacking to prove the proposed mechanisms. For instance they show correlative data that knock down of Sirt1 mediated shift in metabolism is due to HIF1a acetylation but this needs to be proven with further experiments.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Hauser et al investigate the role of amphibian (Xenopus laevis) mast cells in cutaneous immune responses to the ecologically important pathogen Batrachochytrium dendrobatidis (Bd) using novel methods of in vitro differentiation of bone marrow-derived mast cells and in vivo expansion of skin mast cell populations. They find that bone marrow-derived myeloid precursors cultured in the presence of recombinant X. laevis Stem Cell Factor (rSCF) differentiate into cells that display hallmark characteristics of mast cells. They inject their novel (r)SCF reagent in the skin of X. laevis and find that this stimulates expansion of cutaneous mast cell populations in vivo. They then apply this model of cutaneous mast cell expansion in the setting of Bd infection and find that mast cell expansion attenuates skin burden of Bd zoospores and pathologic features including epithelial thickness and improves protective mucus production and transcriptional markers of barrier function. Utilizing their prior expertise with expanding neutrophil populations in X. laevis, the authors compare mast cell expansion using (r)SCF to neutrophil expansion using recombinant colony stimulating factor 3 (rCSF3) and find that neutrophil expansion in Bd infection leads to greater burden of zoospores and worse skin pathology. Combining these two observations, they demonstrate that mast cell expansion using rSCF attenuates cutaneous neutrophilic infiltration. They further show that mast cell expansion correlates to cutaneous IL-4 expression, and that treatment with exogenous rIL-4 reduces neutrophilic infiltration and restores markers of epithelial health, offering a mechanism by which mast cell expansion protects from Bd infection.

      Strengths:

      The authors report a novel method of expanding amphibian mast cells utilizing their custom-made rSCF reagent. They rigorously characterize expanded mast cells in vitro and in vivo using histologic, morphologic, transcriptional, and functional assays. This establishes solid footing with which to then study the role of rSCF-stimulated mast cell expansion in the Bd infection model. This appears to be the first demonstration of exogenous use of rSCF in amphibians to expand mast cell populations and may set a foundation for future mechanistic studies of mast cells in the X. laevis model organism. Building on prior work, they are able to contrast mast cell expansion with their neutrophil expansion model, allowing them to infer a mechanistic link between mast cell expansion and IL-4 production and subsequent suppression of neutrophil infiltration and cutaneous dysbiosis.

      Weaknesses:

      The main weaknesses derive from technical limitations inherent to the Xenopus model at this time. For example, in mice a mechanistic study would be expected to use IL-4 knockouts, preferably mast cell-specific, to prove the link between mast cell expansion and IL-4 production being necessary and sufficient to suppress neutrophils. However, the novel reagents in this manuscript present a compelling technical advance and a step forward in the tools available to study amphibian biology.

      In addition to their discussion, one open question from the revised manuscript is how a single treatment with rSCF leads to a peak in mast cell numbers and then decline to baseline in mock-infected frogs, while Bd infection either sustains rSCF-boosted mast cells or leads to steady mast cell increase over time in control-treated frogs. Whether this is mediated by endogenous SCF or some other factor remains unexplored.

    1. Reviewer #2 (Public Review):

      In this study, the authors aim to understand how neurons in the anterior insular cortex (insula) modulate fear behaviors. They report that the activity of a subpopulation of insula neurons is positively correlated with freezing behaviors, while the activity of another subpopulation of neurons is negatively correlated to the same freezing episodes. They then used optogenetics and showed that activation of anterior insula excitatory neurons during tones predicting a footshock increases the amount of freezing outside the tone presentation, while optogenetic inhibition had no effect. Finally, they found that two neuronal projections of the anterior insula, one to the amygdala and another to the medial thalamus, are increasing and decreasing freezing behaviors respectively.

    1. Reviewer #3 (Public Review):

      Summary:

      The manuscript by Ma et al. describes a multi-model (pig, mouse, organoid) investigation into how fecal transplants protect against E. coli infection. The authors identify A. muciniphila and B. fragilis as two important strains and characterize how these organisms impact the epithelium by modulating host signaling pathways, namely the Wnt pathway in lgr5 intestinal stem cells.

      Strengths:

      The strengths of this manuscript include the use of multiple model systems and follow up mechanistic investigations to understand how A. muciniphila and B. fragilis interacted with the host to impact epithelial physiology.

      Weaknesses:

      After revision, the bioinformatics section of the methods is still jumbled and may indicate issues in the pipeline. Important parameters are not included to replicate analyses. Merging the forward and reverse reads may represent a problem for denoising. Chimera detection was performed prior to denoising.

      Potential denoising issues for NovaSeq data was not addressed in the response. The authors did not clarify if multiple testing correction was applied; however, it may be assumed not as written. The raw sequencing data made available through the SRA accession (if for the correct project) indicates it was a MiSeq platform; however, the sample names do not appear to link up to this experimental design and metadata not sufficient to replicate analyses.

    1. Reviewer #2 (Public Review):

      Deciphering the metabolic alterations characterizing the prediabetes-diabetes spectrum could provide early time windows for targeted preventive measures to extend precision medicine while avoiding disproportionate healthcare costs. The authors identified a panel of 9 circulating metabolites combined with basic clinical variables that significantly improved the prediction from prediabetes to diabetes. These findings provided insights into the integration of these metabolites into clinical and public health practice. However, the interpretation of these findings should take account of the following limitations.

      First, the causal relationship between identified metabolites and diabetes or prediabetes deserves to be further examined particularly when the prediabetic status was partially defined. Some metabolites might be the results of prediabetes rather than the casual factors for progression to diabetes.

      Second, the blood samples were taken at random (not all in a non-fasting state) and so the findings were subjected to greater variability. This should be discussed in the limitations.

      Third, the strength of NMR in metabolic profiling compared to other techniques (i.e., mass spectrometry [MS], another commonly used metabolic profiling method) could be added in the Discussion section.

      Fourth, the applied platform focuses mostly on lipid species which may be a limitation as well.

      Fifth, it is a very large group with pre-diabetes, but the results only apply to prediabetes and not to the general population. This should be clear, although the authors have also validated the predictive value of these metabolites in the general population.

    1. Reviewer #2 (Public Review):

      Summary:

      This study explores the fundamental neuroscience question of the stability of neuronal representation. The concept of 'representational-drift' has been put forward after observations made using 2-photon imaging of neuronal activity over many days revealed that neurons contribute in a time-limited manner to population representation of stimuli or experiences. The authors contribute to the still contested concept of 'drifts' by measuring representation across days using electrophysiology and thus with sufficient temporal resolution to characterize the receptive fields of neurons in timescales relevant to the stimuli used. The data obtained from chronic recordings over days combined with nonlinear stimulus-response estimation allows the authors to conclude that both the spectrotemporal receptive fields as well as contextual gain fields dependent on combination sensitivity to complex stimuli were stable over time. This suggests that when a neuron is responsive to experimental parameters across long periods of time (days), its sensory receptive field is stable.

      Strengths:

      The strength of this study lies in the capacity to draw novel conclusions on auditory cortex representation based on the experimentally difficult combination of stable recordings of neuronal activity, behavior, and pupil over days and state-of-the-art analysis of receptive fields.

      Weaknesses:

      It would have been desirable, but too ambitious in the current setting, to be able to assess what proportion if any of the neurons drop out or in to draw a closer parallel with the 2-photon studies.

    1. Reviewer #2 (Public Review):

      Summary:

      This study is an investigation of galanin and galanin receptor signaling on whole-brain activity in the context of recurrent seizure activity or under homeostatic basal conditions. The authors primarily use calcium imaging to observe whole-brain neuronal activity accompanied by galanin qPCR to determine how manipulations of galanin or the galr1a receptor affect the activity of the whole-brain under non-ictal or seizure event conditions. The authors' Eaat2a-/- model (introduced in their Glia 2022 paper, PMID 34716961) that shows recurrent seizure activity alongside suppression of neuronal activity and locomotion in the time periods lacking seizures is used in this paper in comparison to the well-known pentylenetetrazole (PTZ) pharmacological model of epilepsy in zebrafish. Given the literature cited in their Introduction, the authors reasonably hypothesize that galanin will exert a net inhibitory effect on brain activity in models of epilepsy and at homeostatic baseline, but were surprised to find that this hypothesis was only moderately supported in their Eaat2a-/- model. In contrast, under PTZ challenge, fish with galanin overexpression showed increased seizure number and reduced duration while fish with galanin KO showed reduced seizure number and increased duration. These results would have been greatly enriched by the inclusion of behavioral analyses of seizure activity and locomotion (similar to the authors' 2022 Glia paper and/or PMIDs 15730879, 24002024). In addition, the authors have not accounted for sex as a biological variable, though they did note that sex sorting zebrafish larvae precludes sex selection at the younger ages used. It would be helpful to include smaller experiments taken from pilot experiments in older, sex-balanced groups of the relevant zebrafish to increase confidence in the findings' robustness across sexes. A possible major caveat is that all of the various genetic manipulations are non-conditional as performed, meaning that developmental impacts of galanin overexpression or galanin or galr1a knockout on the observed results have not been controlled for and may have had a confounding influence on the authors' findings. Overall, this study is important and solid (yet limited), and carries clear value for understanding the multifaceted functions that neuronal galanin can have under homeostatic and disease conditions.

      Strengths:

      - The authors convincingly show that galanin is upregulated across multiple contexts that feature seizure activity or hyperexcitability in zebrafish, and appears to reduce neuronal activity overall, with key identified exceptions (PTZ model).

      - The authors use both genetic and pharmacological models to answer their question, and through this diverse approach, find serendipitous results that suggest novel underexplored functions of galanin and its receptors in basal and disease conditions. Their question is well-informed by the cited literature, though the authors should cite and consider their findings in the context of Mazarati et al., 1998 (PMID:982276). The authors' Discussion places their findings in context, allowing for multiple interpretations and suggesting some convincing explanations.

      - Sample sizes are robust and the methods used are well-characterized, with a few exceptions (as the paper is currently written).

      - Use of a glutamatergic signaling-based genetic model of epilepsy (Eaat2a-/-) is likely the most appropriate selection to test how galanin signaling can alter seizure activity, as galanin is known to reduce glutamatergic release as an inhibitory mechanism in rodent hippocampal neurons via GalR1a (alongside GIRK activation effects). Given that PTZ instead acts through GABAergic signaling pathways, it is reasonable and useful to note that their glutamate-based genetic model showed different effects than did their GABAergic-based model of seizure activity.

      Weaknesses:

      - The authors do not include behavioral assessments of seizure or locomotor activity that would be expected in this paper given their characterizations of their Eaat2a-/- model in the Glia 2022 paper that showed these behavioral data for this zebrafish model. These data would inform the reader of the behavioral phenotypes to expect under the various conditions and would likely further support the authors' findings if obtained and reported.

      - No assessment of sex as a biological variable is included, though it is understood that these specific studied ages of the larvae may preclude sex sorting for experimental balancing as stated by the authors.

      - The reported results may have been influenced by the loss or overexpression of galanin or loss of galr1a during developmental stages. The authors did attempt to use the hsp70l system to overexpress galanin, but noted that the heat shock induction step led to reduced brain activity on its own (Supplementary Figure 1). Their hsp70l:gal model shows galanin overexpression anyways (8x fold) regardless of heat induction, so this model is still useful as a way to overexpress galanin, but it should be noted that this galanin overexpression is not restricted to post-developmental timepoints and is present during development.

    1. Reviewer #2 (Public Review):

      Summary:

      In the study titled "Functional genomics reveals the mechanism of hypoxic adaptation in nontuberculous mycobacteria" by Tateishi et al., the authors have used TnSeq to identify the common essential and growth-defect-associated genes that represent the genomic diversity of clinical M. intracellulare strains in comparison to the reference type strain. By estimating the frequency of Tn insertion, the authors speculate that genes involved in gluconeogenesis, the type VII secretion system, and cysteine desulfurase are relatively critical in the clinical MAC-PD strains than in the type strain, both for the extracellular survival and in a mouse lung infection model.

      Based on their analysis, the authors proposed to identify the mechanism of hypoxic adaptation in nontuberculous mycobacteria (NTM) which offer promising drug targets in the strains causing clinical Mycobacterium avium-intracellulare complex pulmonary disease (MAC-PD).

      Strengths:

      A major strength of the manuscript is the performance of the exhaustive set of TnSeq experiments with multiple strains of M. intracellulare during in vitro growth and animal infection.

      Weaknesses:

      (1) The study suffers from the authors' preconceived bias toward a small subset of genes involved in hypoxic pellicle formation in ATCC13950.

      (2) An important set of data with the ATCC13950 reference strain is missing in the mouse infection study. In the absence of this, it is difficult to establish whether the identified genes are critical for infection/intracellular proliferation, specifically in the clinical isolates that are relatively more adapted for hypoxia.

      (3) Statistical enrichment analysis of gene sets by GSEA wrongly involves genes required for hypoxic pellicle formation in ATCC13950 together with the gene sets found essential in the clinical MAC-PD strains, to claim that a significant % of genes belong to hypoxia-adaptation pathways. It could be factually incorrect because a majority of these might overlap with those found critical for the in vitro survival of MAC-PD strains (and may not be related to hypoxia).

      (4) Validation of mouse infection experiments with individual mutants is missing.

      (5) Phenotypes with TnSeq and CRISPRi-based KD exhibit poor correlation with misleading justifications by the authors.

      In summary, this study is unable to provide mechanistic insights into why and how different MAC-PD mutant strains exhibit differential survival (in vitro and in animals) and adaptation to hypoxia. It remains to understand why the clinical strains show better adaptation to hypoxia and what is the impact of other stresses on their growth rates.

    1. Reviewer #2 (Public Review):

      The manuscript entitled "Intestinal microbiome dysbiosis increases Mycobacteria pulmonary colonization in mice by regulating the Nos2-associated pathways" by Han et al reported that using clindamycin, an antibiotic to selectively disorder anaerobic Bacteriodetes, intestinal microbiome dysbiosis resulted in Mycobacterium smegmatis (MS) colonization in the mice lungs. The authors found that clindamycin induced damage of the enterocytes and gut permeability and also enhanced the fermentation of cecum contents, which finally increased MS colonization in the mice's lungs. The study showed that gut microbiota dysbiosis up-regulated the Nos2 gene-associated pathways, leading to increased nitric oxide (NO) levels and decreased reactive oxygen species (ROS) and β-defensin 1 (Defb1) levels. These changes in the host's immune response created an antimicrobial and anti-inflammatory environment that favored MS colonization in the lungs. The findings suggest that gut microbiota dysbiosis can modulate the host's immune response and increase susceptibility to pulmonary infections by altering the expression of key genes and pathways involved in innate immunity. The authors reasonably provided experimental data and subsequent gene profiles to support their conclusion. Although the overall outcomes are convincing, there are several issues that need to be addressed:

      (1) In Figure S1, the reviewer suggests checking the image sizes of the pathological sections of intestinal tissue from the control group and the CL-treatment group. When compared to the same intestinal tissue images in Figure S4, they do not appear to be consistently magnified at 40x. The numerical scale bars should be presented instead of just magnification such as "40x".

      (2) In Figure 4d, the ratio of Firmicutes in the CL-FMT group decreased compared to the CON-FMT group, whereas the CL-treatment group showed an increase in Firmicutes compared to the Control group in Figure 3b. The author should explain this discrepancy and discuss its potential implications on the study's findings.

      (3) In Figure 6, did the authors have a specific reason for selecting Nos2 but not Tnf for further investigation? The expression level of the Tnf gene appears to be the most significant in both RT-qPCR and RNA-sequencing results in Figure 5f. Tnf is an important cytokine involved in immune responses to bacterial infections, so it is also a factor that can influence NO, ROS, and Defb1 levels.

    1. Reviewer #2 (Public Review):

      The manuscript by Carbo et al. reports a novel role for the MltG homolog AgmT in gliding motility in M. xanthus. The authors conclusively show that AgmT is a cell wall lytic enzyme (likely a lytic transglycosylase), its lytic activity is required for gliding motility, and that its activity is required for proper binding of a component of the motility apparatus to the cell wall. The data are generally well-controlled. The marked strength of the manuscript includes the detailed characterization of AgmT as a cell wall lytic enzyme, and the careful dissection of its role in motility. Using multiple lines of evidence, the authors conclusively show that AgmT does not directly associate with the motility complexes, but that instead its absence (or the overexpression of its active site mutant) results in the failure of focal adhesion complexes to properly interact with the cell wall.

      An interpretive weakness is the rather direct role attributed to AgmT in focal adhesion assembly. While their data clearly show that AgmT is important, it is unclear whether this is the direct consequence of AgmT somehow promoting bFAC binding to PG or just an indirect consequence of changed cell wall architecture without AgmT. In E. coli, an MltG mutant has increased PG strain length, suggesting that M. xanthus's PG architecture may likewise be compromised in a way that precludes AglR binding to the cell wall. However, this distinction would be very difficult to establish experimentally. MltG has been shown to associate with active cell wall synthesis in E.c oli in the absence of protein-protein interactions, and one could envision a similar model in M. xanthus, where active cell wall synthesis is required for focal adhesion assembly, and MltG makes an important contribution to this process.

    1. Reviewer #2 (Public Review):

      Adjuvants boost antigen-specific immune responses to vaccines. However, whether adjuvants modulate the epitope immunodominance and the mechanisms involved in adjuvant's effect on antigen processing and presentation are not fully characterized. In this manuscript, Li et al report that immunodominant epitopes recognized by antigen-specific T cells are altered by adjuvants.

      Using MPLA, CpG, and MDP adjuvants and H. pylori antigens, the authors screened the dominant epitopes of Th1 responses in mice post-vaccination with different adjuvants and found that adjuvants altered antigen-specific CD4+ T cell immunodominant epitope hierarchy. They show that adjuvants, MPLA and CpG especially, modulate the peptide repertoires presented on the surface of APCs. Surprisingly, adjuvant favored the presentation of low-stability peptides rather than high-stability peptides by APCs. As a result, the low stability peptide presented in adjuvant groups elicits T cell response effectively.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Zheng et al investigated the role of inflammatory cytokines in protecting cells against SARS-CoV-2 infection. They demonstrate that soluble factors in the supernatants of TLR-stimulated THP1 cells reduce fusion events between HEK293 cells expressing SARS-CoV-2 S protein and the ACE2 receptor. Using qRT-PCR and ELISA, they demonstrate that IL-1 cytokines are (not surprisingly) upregulated by TLR treatment in THP1 cells. Further, they convincingly demonstrate that recombinant IL-1 cytokines are sufficient to reduce cell-to-cell fusion mediated by the S protein. Using chemical inhibitors and CRISPR knock-out of key IL-1 receptor signaling components in HEK293 cells, they demonstrate that components of the myddosome (MYD88, IRAK1/4, and TRAF6) are required for fusion inhibition, but that downstream canonical signaling (i.e., TAK1 and NFKB activation) is not required. Instead, they provide evidence that IL-1-dependent non-canonical activation of RhoA/Rock is important for this phenotype. Importantly, the authors demonstrate that expression of a constitutively active RhoA alone is sufficient to inhibit fusion and that chemical inhibition of Rock could reverse this inhibition. The authors followed up these in vitro experiments by examining the effects of IL-1 on SARS-COV-2 infection in vivo and they demonstrate that recombinant IL-1 can reduce viral burden and lung pathogenesis in a mouse model of infection. However, the contribution of the RhoA/Rock pathway and inhibition of fusion to IL-1-mediated control of SARS-CoV-2 infection in vivo remains unclear.

      Strengths:

      (1) The bioluminescence cell-cell fusion assay provides a robust quantitative method to examine cytokine effects on viral glycoprotein-mediated fusion.

      (2) The study identifies a new mechanism by which IL-1 cytokines can limit virus infection.

      (3) The authors tested IL-1 mediated inhibition of fusion induced by many different coronavirus S proteins and several SARS-CoV-2 strains.

      Weaknesses:

      (1) The qualitative assay demonstrating S2 cleavage and IL-1 mediated inhibition of this phenotype is extremely variable across the data figures. Sometimes it appears like S2 cleavage (S2') is reduced, while in other figures immunoblots show that total S2 protein is decreased. Based on the proposed model the expectation would be that S2 abundance would be rescued when cleavage is inhibited.

      (2) The text referencing Figure 1H suggests that TLR-stimulated THP-1 cell supernatants "significantly" reduce syncytia, but image quantification and statistics are not provided to support this statement.

      (3) The authors conclude that because IL-1 accumulates in TLR2-stimulated THP1 monocyte supernatants, this cytokine accounts for the ability of these supernatants to inhibit cell-cell fusion. However, they do not directly test whether IL-1 is required for the phenotype. Inhibition of the IL-1 receptor in supernatant-treated cells would help support their conclusion.

      (4) Immunoblot analysis of IL-1 treated HEK293 cells suggests that this cytokine does not reduce the abundance of ACE2 or total S protein in cells. However, it is possible that IL-1 signaling reduces the abundance of these proteins on the cell surface, which would result in a similar inhibition of cell-cell fusion. The authors should confirm that IL-1 treatment of their cells does not change Ace2 or S protein on the cell surface.

      (5) In Figure 5A, expression of constitutively active RhoA appears to have profound effects on how ACE2 runs by SDS-PAGE, suggesting that RhoA may have additional effects on ACE2 biology that might account for the decreased cell-cell fusion. This phenotype should be addressed in the text and explored in more detail.

      (6) The experiments linking IL-1 mediated restriction of SARS-COV-2 fusion to the control of virus infection in vivo are incomplete. The reported data demonstrate that recombinant IL-1 can restrict virus replication in vivo, but they fall short of confirming that the in vitro mechanism described (reduced fusion) contributes to the control of SARS-CoV2 replication in vivo. A critical piece of data that is missing is the demonstration that the ROCK inhibitor phenocopies IL-1RA treatment of SARS-COV-2 infected mice (viral infection and pathology).

    1. Reviewer #2 (Public Review):

      The factors that influence the differentiation of EBs and RBs during Chlamydial development are not clearly understood. A previous study had shown a redox oscillation during the Chlamydial developmental cycle. Based on this observation, the authors hypothesize that the bacterial redox state may play a role in regulating the differentiation in Chlamydia. To test their hypothesis, they make knock-down and overexpression strains of the major ROS regulator, ahpC. They show that the knock-down of ahpC leads to a significant increase in ROS levels leading to an increase in the production of elementary bodies and overexpression leads to a decrease in EB production likely caused by a decrease in oxidation. From their observations, they present an interesting model wherein an increase in oxidation favors the production of EBs.

      Major concern:

      In the absence of proper redox potential measurements, it is not clear if what they observe is a general oxidative stress response, especially when the knock-down of ahpC leads to a significant increase in ROS levels. Direct redox potential measurement in the ahpC overexpression and knock-down cells is required to support the model. This can be done using the roGFP-based measurements mentioned in the Wang et al. 2014 study cited by the authors.

    1. Reviewer #2 (Public Review):

      Summary:

      The premise of the manuscript by Matteucci et al. is interesting and elaborates on a mechanism via which TNFa regulates monocyte activation and metabolism to promote murine survival during Plasmodium infection. The authors show that TNF signaling (via an unknown mechanism) induces nitrite synthesis, which (via yet an unknown mechanism), and stabilizes the transcription factor HIF1a. Furthermore, HIF1a (via an unknown mechanism) increases GLUT1 expression and increases glycolysis in monocytes. The authors demonstrate that this metabolic rewiring towards increased glycolysis in a subset of monocytes is necessary for monocyte activation including cytokine secretion, and parasite control.

      Strengths:

      The authors provide elegant in vivo experiments to characterize metabolic consequences of Plasmodium infection, and isolate cell populations whose metabolic state is regulated downstream of TNFa. Furthermore, the authors tie together several interesting observations to propose an interesting model.

      Weaknesses:

      The main conclusion of this work - that "Reprogramming of host energy metabolism mediated by the TNF-iNOS-HIF1a axis plays a key role in host resistance to Plasmodium infection" is unsubstantiated. The authors show that TNFa induces GLUT1 in monocytes, but never show a direct role for GLUT1 or glucose uptake in monocytes in host resistance to infection (nor the hypoglycemia phenotype they describe).

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript by Peto et al., the authors describe the impact of different antimicrobials on gut microbiota in a prospective observational study of 225 participants (healthy volunteers, inpatients and outpatients). Both cross-sectional data (all participants) and longitudinal data (a subset of 79 haematopoietic cell transplant patients) were used. Using metagenomic sequencing, they estimated the impact of antibiotic exposure on gut microbiota composition and resistance genes. In their models, the authors aim to correct for potential confounders (e.g. demographics, non-antimicrobial exposures and physiological abnormalities), and for differences in the recency and total duration of antibiotic exposure. I consider these comprehensive models an important strength of this observational study. Yet, the underlying assumptions of such models may have impacted the study findings (detailed below). Other strengths include the presence of both cross-sectional and longitudinal exposure data and the presence of both healthy volunteers and patients. Together, these observational findings expand on previous studies (both observational and RCTs) describing the impact of antimicrobials on gut microbiota.

      Weaknesses:

      (1) The main weaknesses result from the observational design. This hampers causal interpretation and corrects for potential confounding necessary. The authors have used comprehensive models to correct for potential confounders and for differences between participants in duration of antibiotic exposure and time between exposure and sample collection. I wonder if some of the choices made by the authors did affect these findings. For example, the authors did not include travel in the final model, but travel (most importantly, south Asia) may result in the acquisition of AMR genes [Worby et al., Lancet Microbe 2023; PMID 37716364). Moreover, non-antimicrobial drugs (such as proton pump inhibitors) were not included but these have a well-known impact on gut microbiota and might be linked with exposure to antimicrobial drugs. Residual confounding may underlie some of the unexplained discrepancies between the cross-sectional and longitudinal data (e.g. for vancomycin).

      In addition, the authors found a disruption half-life of 6 days to be the best fit based on Shannon diversity. If I'm understanding correctly, this results in a near-zero modelled exposure of a 14-day-course after 70 days (purple line; Supplementary Figure 2). However, it has been described that microbiota composition and resistome (not Shannon diversity!) remain altered for longer periods of time after (certain) antibiotic exposures (e.g. Anthony et al., Cell Reports 2022; PMID 35417701). The authors did not assess whether extending the disruption half-life would alter their conclusions.

      (2) Another consequence of the observational design of this study is the relatively small number of participants available for some comparisons (e.g. oral clindamycin was only used by 6 participants). Care should be taken when drawing any conclusions from such small numbers.

      (3) The authors assessed log-transformed relative abundances of specific bacteria after subsampling to 3.5 million reads. While I agree that some kind of data transformation is probably preferable, these methods do not address the compositional data of microbiome data and using a pseudocount (10-6) is necessary for absent (i.e. undetected) taxa [Gloor et al., Front Microbiol 2017; PMID 29187837]. Given the centrality of these relative abundances to their conclusions, a sensitivity analysis using compositionally-aware methods (such as a centred log-ratio (clr) transformation) would have added robustness to their findings.

      (4) An overall description of gut microbiota composition and resistome of the included participants is missing. This makes it difficult to compare the current study population to other studies. In addition, for correct interpretation of the findings, it would have been helpful if the reasons for hospital visits of the general medical patients were provided.

    1. Reviewer #2 (Public Review):

      Summary:

      This study set out to examine microlithiasis associated with an increased risk of testicular germ cell tumors (TGCT). This reviewer considers this to be an excellent study. It raises questions regarding exactly how aberrant Sertoli cell function could induce osteogenic-like differentiation of germ cells but then all research should raise more questions than it answers.

      Strengths:

      Data showing the link between a disruption in testicular mineral (phosphate) homeostasis, FGF23 expression, and Sertoli cell dysfunction, are compelling.

      Weaknesses:

      Not sure I see any weaknesses here, as this study advances this area of inquiry and ends with a hypothesis for future testing.