1,694 Matching Annotations
  1. Last 7 days
    1. Cornetto enables us to generate highly complete diploid human genome assemblies using only a single LRS platform

      no need to polish assembly with higher accuracy illumina or PacBio?

    1. One other really cool feature of Cursor is automatically generated commit messages with one click.

      This is a very useful feature. Windsurf can also do this now?

    1. To move a window to a display oriented to the right of your current display, press Windows + Shift + Right Arrow.

      use for top display as well

    1. Micromonas has a flagellum and is motile, with an estimated swimming speed of 100mm/s (i.e., 75 body lengths/s) and is strongly phototactic

      Micromonas pusilla

    2. atio impacts the efficiency of nutrient acquisition

      surface area to volume ratio

    3. Because of their low Re picoplanktondo not sink through the water column as individual cells; they can sink only if pack-aged into larger material (e.g., through predation, fecal pellet, and marine snow for-mation)

      Check for similar affirmations from other sources

      due to their tiny size, all picoplankton, whether eukaryotic or prokaryotic, have low Reynolds numbers (Re), indicating that their movement is dominated by viscous forces, rather than inertial force

    Tags

    Annotators

    1. When nutrients run out they will often aggregate into flocs that sink quickly out of the photic zone

      for small celled diatom species ~ 5 - 50 um size range. - What is the physical effect that causes the flocs to sink? - Higher density vs larger size?

      This might work the same for microalgae as well?

  2. Apr 2025
    1. formal equation for the action of coding mutations on fitness

      Action of coding mutation on fitness = evolutionary importance of site \(*\) amino acid similarity

    1. each unique k-mer is stored only once

      Do you also store the counts of each k-mer then?

      k-mer counting is quite resource-intensive, as storing large numbers of k-mers along with their counts is expensive in terms of both memory and time.

    1. Comparing a set of given sequences is a common task

      Find homology, construct phylogenetic tree, overlap detection + graphs (for genome assembly) etc.

      Comparing a set of given sequences is a common task involved in many bioinformatics applications, such as homology detection [1], overlap detection and the construction of overlap graphs [2,3,4], phylogenetic tree reconstruction, and isoform detection from circular consensus sequence (CCS) reads [5], to name a few.

    1. I just love the look of amazement when anyone looks into the Foldscope for the first time, particularly little kids," Pandiarajan says. "When their eyes light up, I know that's the moment they will embrace science and learning for the rest of their lives."
    1. Oxford Nanopore (older chemistry with 90% mean identity)

      is this R9?

    2. We show that sylph’s ANI estimation is accurate and apply it to species-level profiling through a principled 95% ANI cutoff

      Read this paper to figure out why 95% cutoff is called "Principled"

    3. This tool is good for taxonomic assignment of low abundance organisms from metagenome sequencing data. - low abundance makes it harder to assemble genomes, which is the standard way to assign taxonomy confidently?

      Key innovation

      key innovation in sylph is a statistical model based on zero-inflated Poisson statistics to debias containment ANI under low coverage

      How does this differ from kraken2? - Kraken 2 uses short exact matches to a database (causes false positives) which are controlled by abundance cutoffs and confidence thresholds

      Differ from sourmash? - k-mer sketching approaches have ANI estimation bias for low-abundance genomes due to incomplete read coverage - Will need arbitrary thresholds to work for low abundance micro-organisms

    4. ‘marker gene methods’ and not to be confused with 16S sequencing

      I guess universal marker gene methods use shortgun/metagenomic sequencing data so is not comparable to amplicon sequencing of 16S?

    5. However, such methods usually use databases that are difficult to build and hard for users to customize.

      such methods =

      Species-specific or universal marker gene methods (hereafter denoted as ‘marker gene methods’

    1. maximum growth rates were collected

      Is the antibiotic treatment hitting the cells at the maximum growth rate stage? Or can we assume the proportion of current growth rate to maximum observed is the same across all clones?

  3. Mar 2025
    1. Each overlapping primer pair is checked to see if it can be added to any pool other than the leading primer pair’s pool.

      It gives higher primacy to primers of earlier amplicons?

    1. for k-mer-based tools like Kraken 2, there is no single value of k that consistently yields optimal results across all scenarios

      This isn't an issue if k-mer size can be tweaked automatically? Don't know if there is any tool doing this?

    1. our ensemble machine learning model can label protein-coding sequences with FunSoCs

      Functions of Sequences of Concern (FunSoCs)

    1. You have well-curated data, relevant to your task, already labeled with preferred outputs. You need this data for effective fine-tuning.

      Use fine tuning when

    1. the deep learning method D-SCRIPT (a deep learning PPI prediction method shown to have state-of-the-art performance [86] in non-model organisms) to infer the initial, noisy PPI network.

      What is the input to this network?

      requires only the amino acid sequences of two proteins and predicts a probability of interaction

    1. A clear statement of the nature of the intrusive judicial inquiry a parent company could be subjected to in such cases was provided by Lord Bingham when the litigation reached the House of Lords as follows:

      Intrusive Judicial Inquiry into Parent Company Liability Lord Bingham’s statement in the House of Lords highlights the level of scrutiny that a parent company may face in transnational tort claims. Courts assess whether the parent company played an active role in controlling the subsidiary’s operations, particularly in matters of health, safety, and environmental standards. This includes an inquiry into:

      Corporate Oversight – The extent to which the parent company exercised control over subsidiaries. Knowledge and Responsibility – What the parent company’s directors and employees knew or ought to have known about the subsidiary’s activities. Decision-Making and Action – Whether the parent company took positive steps to ensure compliance or failed to act, leading to harm. Documentary Evidence – Courts examine internal company records, including: Board meeting minutes Reports from directors and employees Correspondence related to oversight of the subsidiary Jurisdiction and Access to Justice The House of Lords upheld jurisdiction in the UK by applying the Connelly principle, which states that English courts should hear cases if there is a real risk that justice would not be accessible in the foreign jurisdiction. This was based on:

      The complexity of the litigation, making it difficult to fund and pursue in South Africa. The need for extensive corporate records, which were primarily located in the UK parent company’s offices. Precedents in Parent Company Liability By 2001, English courts had ruled on three key cases affirming parent company liability, establishing that:

      The legal principle was not controversial. UK courts should retain jurisdiction under forum non conveniens grounds when justice could not be obtained abroad. Impact on Transnational Litigation This judicial approach set an important precedent, paving the way for future cases like Chandler v Cape (2012) and Okpabi v Shell (2021), reinforcing the principle that parent companies may owe a duty of care to individuals harmed by the actions of their foreign subsidiaries.

    1. CD8-depletion antibodies

      DOI: 10.1093/infdis/jiad149

      Resource: (NIH Nonhuman Primate Reagent Resource Cat# PR-0817, RRID:AB_2716320)

      Curator: @giovanni.decastro

      SciCrunch record: RRID:AB_2716320


      What is this?

  4. academic.oup.com academic.oup.com
    1. When I began my work, jazz was a stunt,” was Duke Ellington’s later critique of some of this music11Close—but the slick professionalism of the Harlem stride style also served to expand the audience for African American music in the face of discrimination from cultural elites, both within and without the black community, and despite a severe economic downturn.

      for final

    1. within the internal perspective. They are first-order claims about what is right or wrong in specific counterfactual conditions, and can thus be glossed in expressivist terms. This is underpinned by the fact that our moral attitudes respond to natural features of the world. We judge that kicking dogs is wrong because of the pain they suffer when kicked, not because we happen to disapprove of such behaviour. Quasi-realists can therefore hold that kicking dogs remains wrong in worlds at which our counterparts approve of it, for o

      .kjgjjhk

    1. Moreover, just like cognitive disinhibition, schizotypy is correlated with creativity, verbal and visual, with one caveat: Desiring isolation, being introvertive, lacking a capacity for pleasure—these do not predict creativity. They don’t make you more creative, according to the studies.

      ??

    2. hey made themselves schizotypal

      ??

    3. that he purposefully overrode,

      can induce?

    4. with no regard for the truth of the assertion. To others and to himself, he willfully defied reality. He’d reverse himself, too. If particular lines of argument failed to persuade, he’d advocate others. He’d throw people off by adopting their position as his own. He’d say an idea was crazy, then a week later call it great.

      this sounds horrible

    5. And since you can’t connect what never gets in, art is enhanced potential for connectivity.

      !!

    1. Despite the short history of bioinformatics, several software efforts have evolved into a pipeline model

      history of toolchaining for bioinformatics

    2. Seems to be an early paper on toolchaining for bioinformatic workflows. Would be a good reference for introduction when talking about the modern Nextflow and Snakemake workflows

    1. the advantages of computational pipelines over ad hoc scripts, even for simple tasks, are all more apparent with increasingly complex datasets and the use of parallel processing.

      why pipelines vs ad hoc scripts - track dependencies (statically inferred, DAGs) - rules reused for many files (parallelization) - data tracking (rapid development in subsets of pipeline ~ changing parameters,ie. avoid duplicate work when resuming workflows.)

    1. the installation, integration, and tuning of multiple software packages, which is not trivial even for groups with extensive bioinformatics expertise.

      laborious work of setting up multiple packages

    1. capable of identifying the common markers for each cell type and furnishing encyclopedic explanations rooted in domain expertise

      Where is this domain expertise coded? RAG?

    2. obtain scRNAseq bioinformatics analysis use cases

      what does a use case mean?

    3. BIA builds the Anndata from the sequence read data following standard practice, i.e., aligning public FASTQ files with Cell Ranger software

      Would be useful to store the Anndata into some cache for papers that are reused? assuming this generation is an intensive process

    1. Nextflow's advantages are a broad network of integrations

      where do I find these?

    1. healthy individuals contained higher abundances of sugars, myo-inositol, and ellagic acid

      Sugars here is a proxy for vegetable fibres?

    1. says that US tech companies are losing "billions" through having to comply with regulations such as the Digital Markets Act (DMA), and having to obtain user consent for their data to be used for advertising purposes

      These things are more important than billions in the long term

    2. US companies face "substantial financial burdens" due to the European Union's digital regulations

      Can the EU provide something short term to compensate the cost of digital regulations for companies that are smaller/struggling?

    1. How do I use Roadside Assistance? For all vehicles except Motor Homes & Travel Trailers, dial 866.300.8579

      Master tech roadside assistance

    1. Phage T4 was genetically engineered with the optimized nanoluc gene

      "codon-optimized"

    2. The performance of the enhanced bioluminescent reporterphagosensor was carefully evaluated under conditions with target bacteria at differentphases

      Did you mean different "concentrations", because I couldn't find any figure that shows different growth phases of bacteria.

      It might be useful to discuss that coli forms that contaminate drinking water or other low nutrient samples might typically be in the stationary phase. You can cite this paper for evidence of phage T4 infecting stationary phase bacteria -

      Bryan, D., El-Shibiny, A., Hobbs, Z., Porter, J., & Kutter, E. M. (2016). Bacteriophage T4 infection of stationary phase E. coli: life after log from a phage perspective. Frontiers in microbiology, 7, 1391.

    3. (D) Dose-response curves

      fig 6D: did you test without any bacteria or not? Could indicate with a non-detected (ND) label in the chart and clarify in the legend

    4. (B-C) Specificity of reporter phage-based methodsfor the detection of viable E.coli;

      fig 6B: x-axis should list organism names instead of the ATCC numbering for understandability. Organism name could be shortened as P. putida etc. the ATCC numbers can be clarified in the figure legend or methods section as a table/list. Clarify what Mix means in legend

      fig 6C: mention in legend what the non-viable E. coli is such as heat killed E. coli etc.

    5. detection of viable E. coliin juice (1-6), water (7-12), milk (13-18), lettuce (19-24), beef (25-30) samples.

      fig 6H: mention the type of sample in the x-axis label. Clarify the colour map title, is it CFU/ml?

    6. For E.coli, the limit of detection (LOD) was approximately 5 CFU/mL

      mention which figure panel shows the 5 CFU/ml detection limit

    7. 4 Conclusions

      Extensions to this work should be added to the discussions 1. Detecting different concentrations of E. coli among a mixture of other bacteria would be interesting to know about the specificity. 2. Detecting contamination in real samples or when spiked with unknown contaminating source such as sewage wastewater would be a useful extension to this work.

    8. E. coli at various concentrations was subjected to different concentrations of E.coli in food samples.

      fix sentence

    9. samples including water, juice and milk was inoculated with E. coli at variousconcentrations.

      Does the detection depend on the growth phase of E. coli and how does this correspond to the real world scenario?

    10. Therefore,T4 phages with short latency times and high burst sizes are promising reporter phagecandidates.

      For perspective, you could mention an estimate of the quickest possible detection with this method using short latency, high burst size T4 phages with citations

    11. Optimization of (A) capture time, (B)phage concentration, and (C) detection time of reporter phages.

      Fig 5A: figure legend is too short. Add a short one line description of capture efficiency / how it was measured. This is useful to make the figure self explanatory without referring to methods

    12. (B)T4Δsoc::nluc and (C) T4 wild type;

      fig 3B,C: Use bars of a single colour to improve readability and minimize distraction with multiple colours

      fig 3B-E: Describe what the a, b, c, d above the bars are in the figure legend

    13. To quantify E. coli incomplex food matrices, the samples were incubated with phage-magnetic nanocarriers

      need to mention what samples were used

    14. H) Lysis properties of reporter T4 phage.

      ? / fig 3H: Needs a negative control of phage without E. coli cells to confirm that the luminiscence happens only upon infection

    15. A system forassessing EOP value to present the success of infection by the phage:

      fig 2E: explain the 1-72 numbers in the y-axis briefly in the legend

    16. Selection and cleavage efficiency of T4 phage crRNA targeting;

      Fig 2B: Avoid the use of bars on a log plot. Show raw data points with dots and use a line to show the mean. - re-order the x axis in descending order and shorten the x-axis labels to just the numbers to minimize redundancy

    17. Construction of the T4phage CRISPR system in E. coli;

      Fig 1 image could be improved for better understanding 1. Avoid yellow which is hard to see 2. show much fewer particles and phages for more clarity (2-3 only) 3. could merge C, D and E and Zoom into B

    18. nluc gene with twohomologous sequences (S1 and S2)

      need to mention everywhere (except abstract) that editing was carried out by homologous recombination with CRISPR based counter-selection.

    19. Average values are shown foreach experiment. The error bars represent the standard deviations of the data.

      Please show individual data points as well

    Annotators

    1. women are more likely to seek preventive care, visit doctors and follow health recommendations

      This might not be applicable for frugal South Asian women who are likely to spend less on non-essential purchases and delay their health check-ups and anything preventative until things get serious. - Will look for a good citation for this..

    1. Why not instead give each institution a lump sum of money for research and attach reproducibility and replication and scientific integrity requirements to the funds.

      Is this somewhat the German model of funding?

    2. It would put the burden on the institution to figure out the best way to spend the money

      There might be downsides to this too

    1. Graph Neural Networks

      discussion tomorrow / > 11/Mar/25

    Annotators

    1. Practicing is a double-edged sword. Of course, you want to rehearse your talk, but if you rehearse it too much and have a ‘script’ memorized, it can sound robotic. It can also backfire because if you screw up one little bit of the script, it can cause a sort of domino effect and you can end up totally lost.

      I am concerned about this and hence default towards impromptu presentation delivery all the time.

      This works great if there's no hard time constraint, such as in casual settings such as lab meetings, but for talks, there needs to be some hybrid strategy?

  5. Feb 2025
    1. You can change the image dimensions, by adding |640x480 to the link destination, where 640 is the width and 480 is the height.![[Engelbart.jpg|100x145]]

      changing an image size syntax

    1. the joint committee’s report to the National Green Tribunal (NGT) pointed out that the RO purifiers also waste almost double the water that they actually purify as ‘reject water’.

      This seems likely to be inaccurate

    2. RO is a simple, yet effective method for filtering out harmful contaminants like TDS (total dissolved solids), host of toxins, arsenic, fluoride, silica, etc. from water

      TDS is not a harmful substance. This is misleading

    3. reverse osmosis filter (RO filter) channels water through a semi-permeable membrane to remove dissolved solids. These dissolved solids include harmful contaminants like lead, mercury, chromium-6, chlorine, etc

      need to do a pre-test to see if the water actually contains any of these in concerning levels before hasting into an RO setup

    1. Consider using the Mann Whitney U test when your data follow a nonnormal distribution, and you have a small sample size. Learn more about the Normal Distribution.

      small sample size ~ < 30 (source?) - (logic) If the sample size is large, central limit theorem will rescue non-normal data to apply t-test

      If you have more than 15 observations in each group, you might want to use the t-test even when you have nonnormal data. The central limit theorem causes the sampling distributions to converge on normality, making the t-test an appropriate choice.

    1. quick thoughts glancing the paper - Why are you flipping the gene instead of the promoter? :

      Better efficiency with a larger flipping region.. - Why did you choose integrase12?

  6. Jan 2025
    1. Take aways: AI will become cheaper and more efficient. - closed source models can cache responses and save computations for repetitive queries - closed source also has possibility of iterative improvements using constant reinforcement learning. - Prioritizing capabilities and deliberate strategy in data selection, carefully designed training objectives.

    2. We’ve always advocated that our AI processes are orders of magnitude inefficient.

      read this paper. AI improvements

  7. knowledgecafe.rice.edu knowledgecafe.rice.edu
    1. Car Insurance Special offers by AAA. Please see the flyer for more information.

      AAA website has 60% discount right now so it's cheaper to get directly

    1. The court clerk of AI is a process called retrieval-augmented generation, or RAG for short.

      great example! RAG's => special expertise that is domain specific that is retrieved from a well curated library of text.

    1. The low rolling resistance tires tend to transmit road-induced impacts into the cabin

      Does replacing tires improve this? these are fuel efficient though!

      Source: discounttire

    1. Test drive with sellers. Buy cars online. Clean title. No hassle. Free AutoCheck report, fraud protection, financing, vehicle service contracts and GAP insurance available.

      Autotrader private seller exchange

    1. -t sort by time, newest first; see --time

      ls sorted output by time ; use -d for descending order

    1. identical alignments when searching different databases may not receive the same e-value

      difference in the number of sequences across databases

    1. If the battery ever did need to be replaced, it would run between $2,200 and $2,600 from a Toyota dealer, but it's doubtful that anyone would purchase a new battery for such an old car. Most will probably choose to buy a low-mileage unit from a salvage yard, just as they would with an engine or transmission. We found many units available for around $500.

      battery tips,

    1. addition of IPTG should induce high expression of Cas1 and Cas2 in nongrowing bacteria since they have kept a high copy number of pSCRATCH, while growing bacteria should not express the Cas proteins in sufficient quantities for spacer acquisition

      Any issues with expressing new proteins when non-growing?

    1. Your analysis is complex - QIIME 2 records the steps you took to be sure that your work will be reproducible by you or others
      • Does this provenance record the parameters used for reach step?
      • Is there also a way of sharing the whole recipe with others that enables something like a one-click reproducibility?

      Because dadasnake has these features which will make it a better tool for particular NGS sequence analysis

    Annotators

    URL

    1. the brand's novel ProPilot Assist semi-autonomous driving mode is available on SV, SV Plus, and SL trims as part of the Technology package; it's standard on the SL Plus

      2021 Nissan leaf

    1. Locked primary admin user accounts can now be unlocked remotely with respective user ID and aone-time password (OTP) (see Section 5.12.4 Resetting a user password of the QIAcube ConnectUser Manual)

    Tags

    Annotators

    1. This paper is too specific to transcriptomic analysis but it has some inspiration. - This seems more of a substitute for R and python workflows as opposed to a complete tool-chain philosophy that could put together mature command line tools like Nextflow. So this is more relevant for final polishing etc. - They don't mention what backend they are using as the LLM. Is it just making API calls to chatGPT or something they coded themselves? this would be most relevant to know for Omi

    2. users can copy and paste it to create the figures

      can automate running the code too?

    3. advances in prompt engineering1, agents2, retrieval-augmented generation (RAG)3, and fine-tuning4

      LLM advances

    4. result documentation: the copilot now supports the generation of PDFs that include images and detailed analysis

      useful. Need to have customizable sections and added explanations of terms and meanings of measures if user requires.

      How does a html work with clickable/hover hyperlinks for defining key complex terms for first time users?

    1. we demonstrate intragenerational genetic biocontrol, wherein mating with engineered males reduces female lifespan

      how does this persist evolutionarily - would this have higher selective pressure to mutate away?

    1. There are several reporting requirements that apply to you while you are on your STEM extension to ensure that you are maintaining your F-1 status.

      STEM OPT recipients must make a "validation report" to their school every six months starting from the date the 24-month extension begins - Regardless of change in employment

    1. This is usually how forward PCR primers are found in the read in amplicon sequencing, for instance

      anchored 5' adapters

    1. questions about a specific vehicle’s coverageor organization where the vehicle is being reserved, callthe Benefit Administrator at 1-800-825-4062

      Check if Zipcar works as a valid rental car

    2. Trip Cancellation and Interruption benefits pay up to twothousand dollars ($2,000.00) per Insured Person for the non-refundable Common Carrier ticket(s) that You paid for withYour covered Account and/or rewards programs associatedwith Your covered Account.

      only applicable in narrow cases - death, injury, illness or insolvency

    3. Wear and tear, gradual deterioration, or mechanicalbreakdown

      not covered

    1. Damage which is due and confined to freezing, mechanical or electrical breakdownor failure unless such Damage results from a Theft Covered Event

      not covered

    2. Benefits are provided to Eligible Renters up to $50,000 per Rental Agreement forDamage to or Theft of a Rental Vehicle

      Amex, blue cash preferred

    1. Report your covered event to your card’s benefits administrator as soon as possible. To open a claim with Mastercard, go online or call 877-288-6784; with Visa, go online or call 1-800-825-4062.
    1. Roadside Dispatch is a pay-per-use roadside assistance program. The programprovides you with security and convenience wherever your travels take you.For roadside assistance, call 1-800-847-2869.

      is this applicable for visa infinite as well?

  8. Dec 2024
    1. A 2007 study published in PLOS ONE confirmed this unique energy mechanism, showing that fungi exposed to high radiation levels grow faster than those in non-radioactive conditions.

      Find this paper and speculate on the mechanism of energy conversion

    1. Melanin may also be able to help the fungus metabolize radiation, but more evidence and research is still needed.[1]

      Would be interesting to see hypotheses as to the mechanism in which energy could be harvested by melanin and any experiments that could test it?

    1. It is known that all plasmids transmissible by conjugation contain a known relaxase [42].

      This is debatable. OriT is enough if Mob relaxase is supplied in trans.

      Kiara wants a fact-check on this

    1. yeast assembly has been used

      Is there a good way to remove the yeast selection regions and yeast Ori after the assembly?

    2. RP4 plasmid (also known as RK2, RP1, and the Birmingham plasmid) stands not only as a model of bacterial conjugation studied over the past 40 years, but also as one of the most conspicuous, broad-host range conjugative plasmids described in the literature. It mediates mating and plasmid transfer between a wide variety of Gram– donors/recipients (8) and is also capable of efficiently conjugating with Gram+, (9) yeast (10,11) and mammalian cells. (12)
    1. Optimization parameters included: (i) molten agar media temperature, (ii) molten agar media agar concentration, and (iii) volumes of E. coli and S. cerevisiae cell suspensions harvested at various optical densities (ODs)

      Best protocol : 60C, 2% agar ; 100 ul each of donor and recipient at OD of 1. - Use 20 - 60% of the mix for fewer and larger colonies

    2. Some conjugation systems, such as IncF, IncH, and IncI plasmids, transfer DNA efficiently in liquid media, while others, including the IncN, IncM, IncP, and IncW plasmids, achieve higher DNA transfer frequencies on solid media [28]. It is suspected that the ability to transfer DNA in different environmental conditions is related to variation in pilus formation, structure, and stability of cells during the conjugation process.
    3. such a protocol may permit more accurate enumeration of transconjugants by avoiding the use of a spreader while plating cells on selective media

      How will this conjugation protocol allow enumeration of only transconjugants by excluding the donors in the mix?

    4. may enhance the ability to transfer plasmids and chromosomes greater than 100 kbp

      This is testable easily ; with a fluorescence carrying plasmid and flow cytometry counting

    5. we developed a procedure for conjugation within solid media. Such a protocol may expand conjugation as a tool for DNA transfer to species that require semi-solid or solid media for growth

      embedded inside soft agar

  9. Nov 2024
    1. A. thaliana (hereafter referred to as Arabidopsis)

      Good choice instead of an acronym..

    1. Over the last 25 years, shotgun metagenomic sequencing1 and associated computational methods have developed as robust, efficient ways to study the taxonomic composition

      Read to figure out benefits compared to marker genes profiling such as 16S?

    1. MetaPhlAn 4 relies on ~5.1M unique clade-specific marker genes identified from ~1M microbial genomes (~236,600 references and 771,500 metagenomic assembled genomes) spanning 26,970 species-level genome bins

      This same dataset might be handy to find and parse for better universal marker genes across phyla or all bacteria?

    1. Template Buffer should be at 1X inthe final reaction

      effectively, 0.5 ul of the tempalate buffer per 20 ul reaction

  10. Oct 2024
    1. not compatible with real-time PCR due to the presence of unnatural nucleotides in their sequence

      This is an unfounded argument ; Inosine bases are perfectly fine to use in qPCR primers

    1. removal of sequences containing nonsense mutations was found to be a valuable filter in addition to flowgram-based denoising

      stop codons and frameshifts

    1. 1.8 uL diluted ROX per 20 uL

      Note that 20 ul reaction is equivalent to 10 ul of the master mix..

  11. Sep 2024
    1. We found a distinctive wheel-shaped arrangement of the cells

      Is this arrangement dependent on the 100 kb collapse or the UMAP dimensionality reduction algorithm used?

    2. Studying gene–gene correlations on a local scale, we observed the expected high correlations between the expression profiles of genes residing in the same operon

      How did you chose these few operons/ this chromosomal region for this analysis?

    3. Principal component analysis (PCA) at the gene level

      read up: why PCA pattern differs from UMAP?

    4. Two-dimensional projection by uniform manifold approximation and projection (UMAP) of LB-grown E. coli

      why UMAP vs other dimensionality reduction methods? - read methods?

    1. Degenerate consensual pairs of rpoB primers called Univ_rpoB_F_deg (forward primer) and Univ_rpoB_R_deg (reverse primer) were manually designed from clustalW alignments

      How small was this alignment that you manually design primers?

    2. we constructed a reference database including ~ 45000 sequences; this database is available from the FROGS website (http://frogs.toulouse.inra.fr/).

      Does database have full rpoB or only 434 bp region?

    1. In many cases, such variations reflect differences in the essentiality of genes. Genes with higher connectivity are often more essential for the reproductive success of a cell or organism

      This assumption will not hold true for auxiallary genes or genes not in the core genome but still contribute to essential functions conditional to certain circumstances? for example: antibiotic resistance genes?

    1. poses challenges for many classical methods, such as parametric statistical tests (for example, Student’s t-test and ANOVA) and measures of correlation, including Spearman’s rank correlation, often leading to completely unacceptable false discovery rates above 90%
    2. We recommend that these methods replace OTU-based approaches for all applications, except when it is necessary to combine sequence data that were generated using different technologies (that is, Illumina sequencing and 454 pyrosequencing) or with different primer sets, when mapping to a common reference database of full-length sequences is often still needed
    1. If rearrangement events and horizontal transfers are rare for the 16S rRNA gene, as is widely believed to be the case, then its true gene tree is likely to be a good approximation to the true phylogenetic tree based on vertically inherited traits, assuming that the latter tree can be meaningfully defined

      Is this really true? If so, it must be true for every gene right?

    2. If an environmental sequence is annotated as belonging to a taxon which is defined by traits, then this is a prediction which can always be checked in principle

      taxonomy by phenotype~?

    1. The diversity of bacteria can also be accessed by using COI, rpoB, cpn60 (encodes for chaperonin protein), tuf (elongation factor), RIF (Replication initiation factor), and gnd (Gluconate-6-phosphate dehydrogenase) gene as barcode
    1. The origin of the rain is not clear. Rain often is attributed to delayed PCR onset [3] or partial PCR inhibition in individual droplets [4]. However, it could also be a consequence of damaged positive droplets with corresponding reduced fluorescence, or damaged negative droplets with increased background fluorescence, or a mixture of both [5].
    1. we found that the clouds can become more compact and produce substantially less rain upon: (i) reducing the ramp rate to 1 °C/sec in every PCR step (Fig. 10a), (ii) increasing the annealing/extension time to 2 minutes (up from 1 minute; Fig. 10b), and (iii) increasing the number of cycles to 50 (Fig. 10c)28
    1. Trans-splicing ribozymes can, in principle, target every uridine residue of a substrate RNA, but the target sites need to be accessible.

      Can RNA folding prediction tools be used to predict accessibility?

    2. In this assay, the mRNA is incubated with trans-splicing ribozymes that carry a randomized internal guide sequence (IGS). This enables the ribozyme population to splice on every accessible site on the mRNA. The sites at which trans-splicing occurred were identified by RT-PCR, cloning, and sequencing

      This might be a way to test for accessibility of the site for splicing from a secondary structure point of view?

    1. we performed RT-qPCR on the high-performing RENDR design, split site 15. We observed a 93-fold increase in the abundance of spliced mRNA in cells expressing both RENDR and RNA input compared to control cells lacking the RNA input

      This split site 15 from Fig 2 was used in the RAM paper as well (RAM = Ribozyme addressable memory)

      • 15 corresponds to: (IGS / 6 bp + P1_loop_01 / 9 bp)
    2. RENDR variants sensing different RNA inputs from RFP

      These are all based on splice site 15 from fig 2. This should have been explicitly mentioned :😞

    3. best design delivers a 93-fold dynamic range of splicing with RENDR controlling fluorescent protein production in response to an RNA input

      wasn't the dynamic range much higher (10^4 fold?!) when we checked with qPCR?

    1. P1_loop_03 TAGTTACCTTT

      Why was this T>G mutation used here?

    Annotators

    1. P1_loop_03 TAGTTACCTTT

      Look for the reasoning for this T>G substitution

    2. AAATAGCAATATTTACCTTTGGGTCA

      WT P1 loop and IGS annotated here

    Annotators

    1. adjustments must be made in the IGS to allow the formation of a stable P10 helix

      How can you adjust the IGS when there are two constrains on it from both P1 and P10?

  12. Aug 2024
    1. Here is the information you may need in order to complete page 2 of the Form I-983:

      If your employer is Rice University, here's the E-verify info -

      Employer's Name as Listed in E-Verify: Rice University Rice's E-Verify ID: 698729

    1. Quantification of native and barcoded 16S rRNA in E. coli expressing each cat-RNA using RT-qPCR.

      explain what normalized RNA copies means

    1. We demonstrate here that bulk protein content partitions to wastewater solids. Using a combination of western blotting, ELISA, and mass spectrometry, we identify a robust repertoire of intact human antibodies, predominantly secreted IgA

      Wastewater has a lot of junk that could bind to the sandwich ELISA non-specifically.

      To validate this, I was wondering if there would be a good negative control antigen binder that you could look for - for example, some Ebola antibodies that you won't expect to be in this wastewater?

    1. used model strains Escherichia coli (E. coli) K12 MG1655 as donors and recipients along with the IncPα model conjugative plasmid RP4

      Does this effect still matter if using an auxotrophic donor such as MFD-pir?

    1. However, it is unknown whether PFASs affect the HGT of bacterial antibiotic resistance.

      This is a very poor rationale for why it should be studied. There are many things that are unknown, that does not mean they are worth knowing

    1. At all stop signs, cyclists must stop and yield the right-of-way to other vehicles and pedestrians already at the intersection. RUPD will ticket cyclists for right-of-way violations at intersections.

      So if there is no other entities, the bikes don't need to stop? Could this be regarded as a Yield sign instead?

    2. Registration helps RUPD to identify owners of lost, stolen or impounded bicycles and to disseminate safety information

      Have there been any examples or recovering stolen bicycles by RUPD yet?

    1. Bacteria isolated from humans and livestock are much more likely to have duplicated antibiotic resistance genes

      Is this controlled for other factors? Such as more bacteria being isolated from these environments than others?

    1. Recipient community cells were sorted from the same samples using the same conditions, including both colorless recipient and green fluorescent transconjugal cells

      Would classifying the non-uptaking community as "recipients" rather than the initial starting community cause confusion?

    2. Plasmid transfer was detected both in abundant and rare taxa of the initial recipient community

      were there any OTUs that did not appear in the initial recipient community at detectable levels??

    1. Venn diagram of the number of genera identified in recipient and the corresponding transconjugant pool in the non-pharmaceutical control

      The transconjugant pool has genera that don't overlap with the recipient pool. How do you explain this?

    2. Conjugation events were visualized by a confocal laser scanning microscope

      Why didn't you quantify from the flow cytometry runs?

    1. applied saliva from P- and NP-caterpillars to plant wounds and then assayed for a subset of the plant-defense genes including PIN2, TD2, and AspPI and the defense protein PPO

      How did you chose this subset?

    1. development of a flow cytometry optimized GFP variant, gfpmut3 (Cormack et al., 1996), which is still extensively used for monitoring the fate of plasmids in natural environments.

      what about the variant causes it to be optimized for flow cyt?

    1. This corresponds to more sequences than sorted transconjugants for most samples (Supplementary Table 1), providing an adequate picture of the observed plasmid transfer range.

      # of final reads / # of Tc sorted > 1 is that they mean

    2. gate for only particles of bacterial size

      How do you determine where the "bacterial" sized particles should appear?

      Set a gate for bacterial size on a bivariate SSC-A vs FSC-A plot for events of bacterial size by including the donor strain and excluding all events caused by a sterile pyrophosphate buffer control. Source: Klumper, 2018 Spring protocol handbook

  13. Jul 2024
    1. ll label_() functions return a "labelling" function, i.e. a function that takes a vector x and returns a character vector of length(x) giving a label for each input value.

      This function when called seems to return an expression rather than a character vector.

      Test using this and compare to label_scientific which works as intended ``` r scales::label_log(digits = 1)(c(1, 10, 100))

      > expression(10^0, 10^1, 10^2)

      scales::label_scientific(digits = 1)(c(1, 10, 100))

      > [1] "1e+00" "1e+01" "1e+02"

      ```

      <sup>Created on 2024-07-31 with reprex v2.1.0</sup>

    1. human cells could serve as an orthogonal system for studying PopZ condensation outside of the context of its Caulobacter binding clients

      Wouldn't using a gamma-proteobacteria like E. coli be easier?

    1. to improve the accuracy of taxonomic assignment at the species level for full-length 16S rRNA sequences, we manually curated the three databases and removed the sequences that did not have a species name

      So these sequences won't be classified anymore?

    1. for example, Vandeputte et al. (2017) measured total-community abundance using flow cytometry

      how did you measure abundance properly without noise from particulates?

    1. However, the abundance of one species may not influence the abundance of another; the area may contain both tigers and ladybugs, and the migration of several ladybugs into the area would not be expected to affect the number of tigers. The assumption of true independence can not hold in high-throughput sequencing (HTS) experiments because the sequencing instruments can deliver reads only up to the capacity of the instrument.

      good example, compositional data

    1. Its -best_hit_overhang parameter, H, controls when an HSP is considered short enough to be filtered due to presence of another HSP

      Does this parameter help return a single/best match when blasting against a custom database?

    1. echo "AATGTACTAT" | tr 'ATCGatcg' 'TAGCtagc' | rev

      More thorough version is to account for all the IUPAC degenerate DNA codes like this bash echo sequence | tr '[ATUGCYRSWKMBDHVNatugcyrswkmbdhvn]' '[TAACGRYSWMKVHDBNtaacgryswmkvhdbn]' |rev

    1. Assume your fragment of interest is mysequence and the adapter is ADAPTER. The reads may look like this:

      5' adapter example -g

    1. up to 90 days before your current OPT employment authorization expires, and within 60 days of the date your designated school official (DSO) enters the recommendation for OPT into your Student and Exchange Visitor Information System (SEVIS) record.

      I guess it means dso enters the recommendation for STEM OPT into the SEVIS record?

    1. dadasnake wrapper eases DADA2 use and deployment on computing clusters without the overhead of larger pipelines with DADA2 such as QIIME 2

      [dadasnake vs Qiime2] on clusters

      Where does this overhead come from?

    1. Despite its utility, man is not always the answer. Sometimes grepping the help prompt for a term is all one needs.

      Good idea!

  14. Jun 2024
    1. "IAM & admin" -> "Service Accounts".

      To navigate here: Credentials (left menu) -> Service Accounts -> Manage service accounts

  15. May 2024
    1. In Linux, port numbers below 1024 are reserved for well-known services and can only be bound to by root. Although you can use a port within a 1-1024 range for the SSH service to avoid issues with port allocation in the future, it is recommended to choose a port above 1024.

      why recommended above 1024?

    1. translocation occurred from an IncF plasmid into a cryptic conjugative plasmid showing how cryptic conjugative plasmids are a significant concern because they can capture and disperse ARGs from the vast gene pool in the environments

      Why only cryptic? Any conjugative plasmid can do the same?

    1. The sensitivity of the assay is estimated to be 90% as 10% of the influenza A H5 subtype sequences in GISAID and NCBI have single nucleotide polymorphisms in the primer and probe regions.

      This change might cover that additional 10%? - AGTGGKTAYGCTGCRGAC (note the Y in the middle is bolded there) instead of having a C in that position

      Source: Mike Nute/Treangan lab @Rice

      Btw in that boems paper they report their assay as 90% sensitive. I’m fairly sure that the C in that position is what is causing that 10% loss, so they may have chosen not to make that a Y for some very good reason because all the other ambiguous bases are based on much lower frequency variants, so I would suspect they tried a Y there somehow.

    1. we compared the sensitivity of qPCR, HRM and dPCR in detecting the allele A from two pools of bulk beet DNA composed of 90 biennial + 10 annual plants (B1) and 99 biennial + 1 annual plant (B2), respectively

      Read about probe design - One probe per allele?

    1. Samples must be received by 3 pm ET Wednesday

      Which means, samples should be submitted by 3 pm Tuesday to Genewiz dropbox. - Remember that it takes 30 mins to fill the Amplicon EZ form and 15 mins to do the qubit and dilutions too

      There could be some delays in shipping, so it is best to have it picked up on Monday if timeline is urgent

    1. HTML Options

      This was not intuitive but these options go under this section shown below and this Posit community page was very helpful format: html: ..

    1. You can use inline R code (see Section 3.1) anywhere in an Rmd document, including the YAML metadata section. This means some YAML metadata can be dynamically generated with inline R code, such as the document title

      Does this apply to .qmd documents?

    1. buffers with high salt
      • Cutsmart has 50 mM KoAc, 10 mM MgoAc
      • Buffer 2.1 has 50 mM NaCl, 10 mM MgCl2
      • Buffer 3.1 has 100 mM NaCl, 10 mM MgCl2
    2. Dilute the restriction enzyme using the recommendeddiluent buffer

      Did you mean reaction buffer? Because diluent is different from the reaction buffer. For HindIII this is diluent B

    1. Diluent Buffers (A, B or C) are recommended for making dilutions of restriction endonucleases. When necessary, we recommend diluting enzymes just prior to use and suggest that the final concentration of diluted enzymes be at least 1,000 units/ml

      How is the diluent better than the reaction buffer?