855 Matching Annotations
  1. Last 7 days
    1. Dr Samiran Panda, a scientist at the Indian Council of Medical Research (ICMR), told The Wire Science earlier this week that the “mode” is effectively a single-arm clinical trial that wouldn’t have have a placebo and whose results wouldn’t be published in peer-reviewed journals – but with everything else being the same.
    1. Key points from explainer video - Soil biodiversity conservation Youtube

      1. Need to be able to see the soil biodiversity (microscopic) - visuals
        • to get people excited
      2. Need data to figure out where this needs conservation
      • Above ground biodiversity is not correlated with below ground (!)
      • Need to harmonize protocols to collect this across the world
      • Along with biodiversity, we should measure function - how the biodiversity affects ecosystem functions
    1. Here, we present the development and application of the BioMe plate, a redesigned microplate device in which pairs of wells are separated by porous membranes
    1. This variant presents 14 non-synonymous mutations, 6 synonymous mutations and 3 deletions. The multiple mutations present in the viral RNA encoding for the spike protein (S) are of most concern, such as the deletion Δ69-70, deletion Δ144, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H
    1. RSF1010 is maintained at a copy-number of about 10-12 per chromosome in E coli, P. aeruginosa and S. enterica sv.Typhimurium (Frey and Bagdasarian, 1989)
    1. Recently, redox-responsive biomolecules such as phenazines have been used in several electrochemical strategies to interrogate a range of biological activities30,31 and to control gene expression in living cells32,33, where the redox status of the biomolecules could be measured or manipulated by application of electronic potentials
    1. ResCap capture library is a homemade core reference database (which will be available upon request) that comprises both well-known and hypothetical genes encoding resistance to antimicrobials

      Why is it not deposited along with this open-access paper? Isn't full data disclosure a part of the journal ethics?

    2. SeqCapEZ (NimbleGene) technology, which includes probes for 8667 canonical resistance genes (7963 antibiotic resistance genes and 704 genes conferring resistance to metals or biocides), and 2517 relaxase genes (plasmid markers) and 78,600 genes homologous to the previous identified targets (47,806 for antibiotics and 30,794 for biocides or metals)

      I wonder how the resistome is defined - does this also include single nucleotide variants that confer resistance? I assume it might be hard to capture such single nucleotide variants with probes

      For example of such variants Ramanathan, Babu, et al. "Next generation sequencing reveals the antibiotic resistant variants in the genome of Pseudomonas aeruginosa." PloS one 12.8 (2017): e0182524.

    1. the bacteria of the recipient strain was unable to grow on the plate containing ampicillin (> 100 mg/L) and gentamicin (> 50 mg/L) by drug sensitivity test

      Chlorine could affect the activity of the antibiotic ampicillin - was this tested for in the drug sensitivity test with various antibiotics?

    2. Non-lethal dose chlorine (0.5 mg/L) increased the conjugation transfer frequency,which confirmed that the mRNA expression levels of type IV secretion system (T4SS) proteins vir4D, vir5B and vir10B were significantly enhanced

      Does the fold change of increase in conjugation mirror the fold change of increase in mRNA expression of any of these genes?

      fig 4b -> conjugative transfer frequency increases by ~ 10 fold at 0.5 mg/l chlorine fig 4h -> genes increase only by 1.5 fold

      • on a side note, it is wonderful that the authors looked for a causal expression for increase in the conjugation. It is incredibly rare in these kinds of studies
  2. Jan 2021
    1. something that the alternative online media has been unable to do is where mainstream media platforms are still unrivalled – being a one-stop repository for different sets of news consumers. MSM digital platforms, despite many flaws, thrive as catch-all baskets for round-the-clock information seekers, ranging from politics to cricket, from fashion to music and important news (which doesn’t only mean the unusual massacres) from a hamlet in Arwal district in Bihar to that from a Delhi suburb.

      This will be impossible for a small digital media startup to achieve.

      I rather see the independent digital news as a gateway to important, contentious, controversial or rather plain and non flashy news. News of the kind ignored by mainstream media due to their perverse incentive structures.

      I don't think the coverage on cricket for example or entertainment from newslaundry would be any drastically different from mainstream media. In that sense it would be wiser not to compete and squander resources on such kind of reporting just to be a one stop shop.

    1. we developed a vastly improved INTEGRATE system that uses streamlined expression vectors to direct highly accurate insertions at ~100% efficiency effectively in a single orientation, independent of the cargo size, without requiring selection markers

      Efficiency sounds too exciting to not try!

    1. This work provides CasTn as a new method for host-independent, programmable, targeted DNA insertions to expand the genomic engineering toolbox.
    1. Indeed, the cell-lysate approach was found to be associated with superior sensitivity in some cases5.
    2. using a commercially available reagent (Bio-Rad SPR) that generates RT-qPCR-ready cell lysates with minimal manipulations. Similar reagents are now available from a number of sources (Ambion Cells-to-CT, Invitrogen CellsDirect, Roche RealTime Ready Cell Lysis, etc.)
    1. we demonstrate improved PCR-enhancing cocktails containing nonionic detergent, l-carnitine, d-(+)-trehalose, and heparin. These cocktails, in combination with two inhibitor-resistant Taq mutants, OmniTaq and Omni Klentaq, enabled efficient amplification of exogenous, endogenous, and high-GC content DNA targets directly from crude samples containing human plasma, serum, and whole blood without DNA purification.
    1. We found that a lysis solution containing both the non-ionic detergent (IGEPAL CA-630, chemically equivalent to Nonidet P-40 or NP-40) and bovine serum albumin (BSA) gave the best RT-qPCR yield. This direct lysis to reverse transcription protocol outperformed a column-based extraction method using a commercial kit.
    1. However, by the time scientific studies make it to the real world, shortcomings and limitations are removed to present palatable (and often wrong) conclusions to a general audience.
    2. There are many commercial interests invested in persuading us to eat things that may be edible, but shouldn’t really be considered food

      :) very funny

    1. While no serious climate scientist doubts the fact that human activities are causing climate change, this can’t be proved through experimentation on another Earth.

      In both cases, the answers should be clear when looking at the evidence and the mechanisms at play without an ideological bias

  3. Dec 2020
    1. Biosciences Robert Sabin 713-348-4324 Charles Stewart

      library contact person

    1. Transfer of plasmid RP4 during bacterial conjugation requires the plasmid-encoded TraJ protein, which binds to a 19-base pair invert sequence repetition within the transfer origin

      can it not be encoded in the host or a helper plasmid? Donor E. coli MFDpir already has it

    1. Fluorescence values for sfGFP (excitation, 485 nm; emission, 528 nm) and mCherry (excitation, 580 nm; emission, 610 nm)

      peak emission of sfGFP is 510 nm, why was 528 used here? fpbase

    2. . Some SsGCs exhibited universal activation across all hosts in both reporters (constructs A–C

      What do the sequence IDs (1-12) in this image correspond to the oligo ID?

    1. it was liable to impact the final results of the vaccine trial since, as more participants in the placebo arm would become infected, “the result of those getting the vaccine would obviously look better”.

      Wouldn't patients from both arms be impacted the same way by risky practices induced by the document?

    2. By giving the confidence to participants that they are safe after taking the shots, the participants may become complacent. The people in the placebo group, in reality, have got zero level of protection, hence increasing their chances of getting the infection,” he said.

      editor of the Indian Journal of Medical Ethics Amar Jesani

    1. The discoverers of this Ψ technique

      https://www.sciencedirect.com/science/article/pii/S1074761305002116

      Karikó, Katalin, et al. "Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA." Immunity 23.2 (2005): 165-175.

    1. it remains unclear exactly why resources are exchanged among trees in the first place

      Maybe focusing on the 'why' rather than the 'how' of a novel scientific study or paradigm prevents acceptance in the scientific community and slow down scientific progress?

    1. We recommend the following changes to the default settings when designing ddPCR assays:

      Primer3 : designing primers and probes for ddPCR

      In the General Settings window, change “Concentration of divalent cations” to 3.8, “Concentration of dNTPs” to 0.8, and “Mispriming/Repeat Library” to the correct organism ■In the Advanced Settings window, change both the “Table of thermodynamic parameters” and “Salt correction formula” to SantaLucia 1998 ■In the Internal Oligo window, we recommend setting 15 for the minimum number of bases for the oligo. We recommend 64°C as the minimum Tm for the probe, 65°C as the optimal Tm for the probe, and 70°C as the maximum Tm for the probe. These parameters can be relaxed to allow for smaller/larger oligos, which may be necessary for high GC or low GC targets. Oligo size should be no smaller than 13 and no larger than 30 nucleotides

      Note: After you have made the desired changes in Primer3Plus, select Save Settings under General Settings and save these parameters in a file. To apply these settings in the future, upload them by selecting Browse in the General Settings tab, find this file, and click Activate Settings.

    2. Strive for a Tm between 50 and 65°C. One way to calculate Tm values is by using the nearest-neighbor method. Use the Tm calculator at http://www.basic.northwestern.edu/biotools/oligocalc.html, with values of 50 mM for salt concentration and 300 nM for oligonucleotide concentration
    1. flow cytometry data were analyzed in R using the flowCore Bioconductor package (
    2. flow cytometry using the red fluorescent nucleic acid dye SYTO17 as a counterstain to improve detection of cells with a low GFP signal
    1. has developed novel bioinformatics software called OliVar, which allows researchers and assay developers to automate and design assays that target regions of the virus genome that have the lowest frequency of mutation
    1. mRNA-1273 vaccine candidate, manufactured by Moderna, encodes the S-2P antigen, consisting of the SARS-CoV-2 glycoprotein with a transmembrane anchor and an intact S1–S2 cleavage site. S-2P is stabilized in its prefusion conformation by two consecutive proline substitutions at amino acid positions 986 and 987, at the top of the central helix in the S2 subunit
    1. Lithium Acetate Borate (LAB) buffer is an agarose gel electrophoresis media for DNA gels

      Lithium and Borate are both teratogenic (reproductive toxicity).. Is it worth the risk?

    2. GelRed, SYBR-Gold, and SYBR-Green must be applied after the run (staining bath) and can't be used with the precast method.
    1. Cell densities achieved with TB were over 3 times greater than those seen with the most commonly used broth, LB, and DNA yields were 2.5 fold higher

      high cell density => blocks spin columns?

      Have you observed that?

    2. SOC is added to E. coli cells to aid recovery after exposure to high salt concentrations and heat shock in many chemical-based DNA transformation protocols

      Elbing and Brent, 2002, Green and Sambrook, 2012

    3. In this study, we have quantitated yields of low copy and single copy number plasmid DNAs after growth of cells in four widely used broths (SB, SOC, TB, and 2xYT) and compared results to those obtained with LB, the most common E. coli cell growth medium

      TB (terrific broth) consistently generated the greatest amount of plasmid DNA, in agreement with its ability to produce higher cell titers. The superiority of TB was primarily due to its high levels of yeast extract (24 g/L) and was independent of glycerol, a unique component of this broth. Interestingly, simply preparing LB with similarly high levels of yeast extract (LB24 broth) resulted in plasmid yields that were equivalent to those of TB.

    1. Performcalibrations
    2. ROI/Uniformity plate

      A regions of interest (ROI) calibration maps the positions of the wells on the sample block of the Applied Biosystems 7500/7500 Fast Real-Time PCR System. The 7500 software uses the ROI calibration data to associate increases in fluorescence during a run with specific wells of the plate. The instrument uses a set of optic filters to distinguish the fluorescence emissions gathered during runs. You must generate a calibration image for each individual filter to account for minor differences in the optical path.

      ABI 7500 manual:

    3. Custom dyes must excite between 455–672 nm and emit between 505–723 nm.
    1. occupy the fill scale with a slightly darker version of the palette used for color.

      Using colorspace package.

      geom_boxplot(aes(color = season, fill = after_scale(desaturate(lighten(color, .6), .6))), size = 1)

    1. All the existing color palettes are available in Paletteer. Just specify the package and palette names to use!

      Ggplot, color palettes

    1. We report the preclinical development of BNT162b2, a lipid-nanoparticle (LNP) formulated N1-methyl-pseudouridine (m1Ψ) nucleoside-modified mRNA (modRNA) vaccine candidate that encodes P2 S with a native furin cleavage site resulting in the S1 and S2 cleavage fragments
    2. To generate the template for RNA synthesis, a DNA fragment encoding the SARS-CoV-2 P2 279 S protein (based on GenBank: MN908947), including the amino acid exchanges K986P and 280 V987P, was cloned into a starting plasmid vector with backbone sequence elements for 281 improved RNA stability and translational efficiency19,34

      BNT162b2

    1. The pBHR1 plasmid is a derivative of the small (2.6-kb), mobilizable broad-host-range plasmid pBBR1, which was isolated from the gram-negative bacterium Bordetella bronchiseptica

      pBBR1

    1. Antibiotics, according to strain sensitivity, were used at the following concentrations: tetracycline 2 μg/ml for Rm1021, BM7, BM299 and BM300, 4 μg/ml for LMG18864, 10 μg/ml for other Sinorhizobium strains and for E. coli; streptomycin 600 μg/ml and kanamycin 200 μg/ml were used for Rm1021; kanamycin for E. coli S17.1 was used at 40 μg/ml; gentamicin was used at 20 μg/ml for all strains
    2. All Sinorhizobium strains were grown in TY medium (Beringer, 1974) at 30 °C

      TY contained, per litre, 5 g Difco Bacto- Tryptone, 3 g Difco Bacto-yeast extract and 1-3 g CaC1,.6H20.

      Source

    1. The slopes and efficiency for the SARS-CoV-2 standard curves were not consistent over time, confirming the need to include a standard curve each run rather than using a single curve for multiple plates.

      Is the standard curve performed with matrix or in pure water?

    1. Look at filmmaker Anubhav Sinha’s last three films. He went for Muslim minority story (Mulk) then he went to do a Dalit-related, anti-caste-related story in Article 15, and now he has gone for domestic violence (Thappad). He has touched religion, caste and gender.
    1. Combining acetate with borate retains the deficiencies of both

      This is counter to the argument that the combination works well - https://bitesizebio.com/25078/faster-even-cooler-dna-gels

      • The article recommends a pH of 6.5, which was the best pH found for sodium borate buffers in this paper
    1. The voltage is kept low, ∼10 V/cm, where cm refers to the length of the gel

      This is wrong - the cm refers to the inter-electrode distance. It is a misonomer that people confuse it with the length of the gel

    1. Between them, the three buffers cover all of the molecular biologist’s DNA gel needs
  4. gmo-crl.jrc.ec.europa.eu gmo-crl.jrc.ec.europa.eu
    1. Since most of the power produced in the electrophoretic process is dissipated as heat the following detrimental effects can result: • an increased rate of diffusion of sample and buffer ions leading to broadening of the separated samples • the formation of convection currents, which leads to mixing of separated samples; • thermal instability of samples that are rather sensitive to heat (e.g. denaturation of DNA) • a decrease of buffer viscosity hence a reduction in the resistance of the medium
    1. Using a lower concentration running buffer (0.25x TAE) and higher voltage (300 V), agarose gels can be run 33% faster.
    1. found that the P R promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P R/cmtO and P R/tetO, were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively
    1. Currently, the majority of quorum sensing systems used in synthetic biology rely on self-produced small molecules that result in spatially and temporally self-organized systems, which can not be easily externally regulated

      Why can't the LasI or LuxI proteins be inducible?

    1. All replication in R6K relies on the two essential components of a minimal replicon, the γ ori, and its cognate Rep, π protein, encoded by the pir gene
    1. appropriately selecting sets of functionally redundant species and adding their abundances can help identify environmental drivers of microbiome composition

      The set of functionally redundant species will be specific to the environmental parameter in question and members could possibly be present in multiple functional groups corresponding to different parameters also.

      For example: When looking at nitrate level, species A,B,C are the same functional group, for sulphate species B, D, E are same group, for early colonizers A, D, F etc.

    2. in most conceivable cases, we study a particular microbiome in order to understand, predict, and potentially control its functioning, with no particular regard for species content.

      this is profound

  5. www.jstage.jst.go.jp www.jstage.jst.go.jp
    1. Since currentanalytical technologies for genes and metabolites provideonly a “snapshot” information at the time of measurement,temporal shift s in plan t an d microbial physiologies hav e bee na majo r obstacl e to detaile d analyses. Therefore, a stabl e syn‐thetic system may facilitate clearer investigations of plant-microbe interactions, leading to unique insights in this field

      snapshot vs dynamic information

    1. Vibrio natriegens strain containing a major extracellular nuclease knockout and insertion of an IPTG-inducible T7 RNA polymerase cassette for expression of genes under a T7 promoter.

      dns nuclease- (Gibson et al)

    2. For best results, use only LB-Miller agar plates. Do not use LB-Lennox or LB-Luriaplates (Vmax™ growth will be suboptimal).
  6. Nov 2020
    1. Here we present a detailed, genome-wide transcriptomics and proteomics dataset of E. coli grown under 34 different conditions. Additionally, we provide measurements of doubling times and in-vivo metabolic fluxes through the central carbon metabolism

      34 different conditions:

      We manipulate concentrations of sodium and magnesium in the growth media, and we consider four different carbon sources glucose, gluconate, lactate, and glycerol. Moreover, samples are taken both in exponential and stationary phase, and we include two extensive time-courses, with multiple samples taken between 3 hours and 2 weeks

    1. sequences from tRNAs are italic

      tRNAs are too short - around 76 bp. Not relevant for ribozyme recognition

    1. But humans, we have demonstrated, are not inherently self-interested.

      Would be good to build a tighter argument for this demonstration before writing such a strong statement

    2. some anthropologists now argue that millions of years of evolution have hard-wired us for altruism, not self-interest.

      Altruism has also been difficult to explain, even in more primitive organisms such as microbial communities which have much simpler behaviors.

      Isn't it a stretch to claim that it is hard-wired through evolution by giving specific examples of altruism in primitive humans and primates?

    1. Since each strand is replicated independently, it is possible for the ssDNA form to accumulate.

      How do you deal with ssDNA during plasmid extraction?

    1. Previously, we and others have shown that the inclusion of an antitoxin and the careful balancing of toxin and antitoxin expression levels across relevant conditions can mitigate this effect, resulting in a kill switch that is evolutionarily stable over biologically relevant periods
    1. Wash the culture in fresh LB before adding glycerol, to avoid problems with reviving the culture later

      To prepare V. natriegens cells for −80 °C storage, an overnight culture of V. natriegens was washed in fresh medium before storage in glycerol. Cultures were centrifuged for 1 min at 20,000g and the supernatant was removed. The cell pellet was resuspended in fresh LB3 medium and glycerol was added to 20% final concentration. The stock was quickly vortexed and stored at −80 °C. Bacterial glycerol stocks stored in this manner are viable for at least five years.

      source: Lee, Henry H., et al. "Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi." Nature microbiology 4.7 (2019): 1105-1113.

    1. Cells are aliquoted into chilled tubes, frozen in a dry ice bath and stored at −80 °C until use.

      How long do the cells hold their competency?

    1. Solutions can be autoclaved for 15-20 minutes at a maximum of 121 °C. There will be some hydrolysis to glucose and fructose, depending in part on how rapidly the autoclave comes to the required temperature and pressure. Care must be taken to prevent solutions from caramelizing.
    1. V. natriegens grows rapidly in BHIN complex medium with a μ of up to 4.43 h−1 (doubling time of 9.4 min) as well as in minimal medium supplemented with various industrially relevant substrates.
    1. Antibiotic concentrations used for plasmid selection in V. natriegens: ampicillin–carbenicillin 100 µg ml−1, kanamycin 75 µg ml−1, chloramphenicol 5 µg ml−1, spectinomycin 100 µg ml−1. E. coli experiments were performed in standard LB and M9 media.
    1. model incorporated the time series correlation structure through an autoregressive model of order 1 for the error process

      To understand time series corelation structure (de-trending) - https://www.svds.com/avoiding-common-mistakes-with-time-series/

    2. might also translate to other respiratory

      any refs on other respiratory viruses that stumble into the GI tract and end up in wastewater?

    3. . For example, when applied to the sewershed 177MUD#203 (Fig. 3B) the predictive model could be used to estimate positivity rate during periods 178when clinical testing data was sparse. This approach illustrates the power of using wastewater 179viral load to forecast positivity rates in communitie

      Does this only work when there is good clinical testing in general, but poor testing in a few weeks?

    4. . We observed a 110strong cross-correlation up to fourteen days

      Have you tested cross-correlation shifting in the other direction as well?

    1. A moving average is commonly used with time series data to smooth out short-term fluctuations and highlight longer-term trends or cycles. The threshold between short-term and long-term depends on the application, and the parameters of the moving average will be set accordingly.
    1. Linear mixed models are an extension of simple linear models to allow both fixed and random effects, and are particularly used when there is non independence in the data, such as arises from a hierarchical structure
    1. Adjusted R-squared values

      What does adjusted R-square mean?

    2. Let’s fit regression line to our model:

      plot() and lines() seem to plot regression lines

      • Can they be added to a ggplot?
      • Can they be used to print R2 on the plot?
    1. partial amplification of the dcp gene, located in close proximity to terC, opposite the oriC region

      TerC: qPCR copy number of e coli chromosome

    1. list

      Map on a data frame operates by each column (from example below)

      Working with data frames

    1. Replication begins

      Rolling circle replication overview

      Replication begins when the Rep protein, which is encoded on the plasmid (ORF A), recognizes a specific site on the plasmid (double-strand origin, or DSO) and catalyzes the nicking of one DNA strand. The Rep protein remains bound to the 5′ phosphate after the nicking action. The newly released 3′ hydroxyl on the opposite end serves as a primer for DNA synthesis. The host DNA polymerase uses the unnicked circular strand as a template, so that a single replication fork moves around a plasmid until it regenerates the DSO. A second copy of Rep protein catalyzes the cleavage of the newly formed DSO, effectively releasing a single stranded copy of the plasmid. In the absence of Rep, the replication fork continues to move around the template, forming a single stranded concatemer. The single strand origin (SSO), a non-coding element that forms extensive secondary structure, is required for synthesis of the lagging strand. SSO sequences vary considerably among different RCR plasmids, but are extremely important for robust replication of the plasmid in the cell [10]. Here we describe the engineering of the pWV01 RCR origin to create pBAV1K-T5, a very broad-host range expression vector.

    2. pWV01 is a cryptic plasmid originally purified from Streptococcus cremoris [7]. Its RCR origin has been used to create over 20 cloning vectors
    1. Copy numbers of the oriV region and gfp gene on the plasmid relative to a chromosomal gene were determined by qPCR. The chromosomal gene dapA was set up as the reference gene
    2. Plasmids were isolated from saturated overnight cultures using the PureLink Plasmid DNA Miniprep Kit (Invitrogen)

      Seems like there was not much difficulty in doing miniprep for this mob+ version of RSF1010. Does the strain of E. coli matter?

      • BW25113 here vs MG1655 where minipreps were difficult?
    3. IS186-mediated integration of the plasmid into the chromosome or deletion of these accessory genes from an evolved plasmid that remained capable of self-replication conferred greater fitness benefits than SP formation

      Can we say this is because of the combined fitness benefit

      • by avoiding maintenance of a plasmid and
        • lower expression of proteins?

      Especially considering that there is expression of the accessory genes (ex: GFP in fig.2e)-> so the protein level fitness burden still exists, albeit at a lower extent.

      How much of this burden is attributed to keeping a plasmid around?, maybe this could be tested with a low copy pSC101 type plasmid or by deleting all the accessory genes and repeating the evolution experiment to specifically look for the integrants this time

    4. reduce the copy number of full-length plasmids in a cell, SP evolution can rapidly alleviate much of the burden of newly acquired accessory genes

      Would be interesting to look at the fate of an already very low copy plasmid (pSC101 like?) to see if SPs still form and are beneficial in the same timescale as the RSF1010 used in this paper

    5. consistent with an insertion of an IS186 element into the pQGS plasmid repF gene were detected by day 6 (Fig. 2e, f). IS186 is one of the most active insertion sequences (ISs) in E. coli. It inserted into pQGS at a site matching its preferred target site of 5′-GGGG(N6/N7)CCCC

      insertion sequence (IS) disrupts plasmid repF gene. And could also integrate the plasmid into chromosome!

    6. Plasmid DNA isolated from cultures

      I heard of difficulties in isolation of RSF1010 plasmids due to their abundant single stranded fraction

    7. The deletions leading to SP formation were nearly always flanked by short, near-perfect sequence homologies with lengths of 7–15 base pairs (Supplementary Table 1), suggesting that SPs may form through RecA-independent processes

      deletion in plasmid fragments evolution

    8. serially transferred through 1:2000 daily dilutions

      Serial transfer

    9. RSF1010, R1162, and R300B plasmids isolated independently from Escherichia coli, Pseudomonas aeruginosa, and Salmonella enterica serovar Typhimurium, respectively, are the best-characterized members of this group

      IncQ plasmid

    1. Designed probes were modified at the 5′ end with the fluorophore FAM for the reference gene cysG and HEX for the plasmid marker oriT, and furthermore modified at the 3′ end with the quencher BHQ-1

      plasmid copy number qPCR assay.

      Why cysG: Siroheme synthase gene?

    1. Among the fully sequenced BHR plasmids, most are classified as the well-known incompatibility groups, such as IncP-1 (41 plasmids), IncW (5 plasmids), and IncU (4 plasmids), based on the backbone genes
    1. broad-host-range plasmid RSF1010 is a member of the IncQ group of plasmids, which stably replicate in a wide variety of gram-negative and gram-positive bacteria, including E. coli and several strains of cyanobacteria
    2. although RSF1010 is not self-transmissible, it harbors an origin of transfer and mobilization genes and can co-opt type IV secretion machinery of other self-transmissible plasmids such as RK2 and RP4
    3. impairing the nicking activity of the RSF1010 MobA protein facilitates cloning manipulations, it significantly reduces conjugation efficiency. We addressed this problem by editing the plasmid and conjugation system to restore conjugation efficiency.
    1. S17-1 λpir, which is kanamycin sensitive and streptomycin/trimethoprim resistant
    2. Conditionally replicating plasmids of the R6K family (IncX) are very often used to deliver gene-inactivating elements in enteric bacteria (11, 28, 38). The replication of these plasmids requires the pir-encoded Π protein, which is usually provided in trans in the donor strain
    1. targeting the genome with a single CRISPR RNA (crRNA) and selecting only for survival after editing, PaeCas3c is a rapid, counter-selection-free approach to programmable large-scale genome engineering and genome minimization

      So the size of the deletion is essentially random in this case?

    2. Cas3 systems raises the possibility of its development as a tool for large genomic deletions, such as the targeted removal of entire genes, gene clusters, islands, prophages or plasmids
    1. Orthogonal ribosomes created through association of the altered 16S rRNA with large ribosomal subunit selectively translate the reporter mRNA containing the orthogonal ribosome binding site

      The pool of the [orthogonal ribosome] can be controlled by modulating the transcription rate of the o16s rRNA

    1. Normally Ubuntu swaps files to disk frequently. Since the disk is a microSD card that's a bit slow and has limited write cycles, it's best to reduce swapping to only when needed.
    1. SARS-CoV-2 viral load peaks prior to symptom onset

      viral load in both lungs and gastro intestinal tract were looked at

    1. example of poor target accessibility, manifested by the significant number of mid-level amplitude droplets (that is, rain), which is resolved by performing a restriction digestion on the DNA before ddPCR
    2. probe hydrolysis due to poor long-term storage

      Another reason is due to probe/quencher reactivity with DTT in the ddPCR supermix

    3. To detect foreign DNA in 5 ml of lake water, 15 ml of lake water must be screened.

      Why is this multiplied by 3? Related to statistical error of subsampling - rule of three)

    4. Do not exceed 5,000 copies of target/μl of the final ddPCR reaction mix

      1e5 targets per 20 ul reaction well

    5. average of 5 copies/droplet (the upper end of the recommended loading range), we expect to see about 134 empty droplets in a total of 20,000 droplets
    6. At the extreme ends of the concentration range (for example, fewer than ten copies of target in a well or more than 120,000 copies of target in a well), fewer droplets in a well will lead to slightly larger error bars.
    7. the concentration is calculated based on the fraction of droplets that is empty (that is, the fraction that does not contain any target DNA).
  7. Oct 2020
    1. You need to get out of the habit of thinking using quotes is ugly. Not using them is ugly! Why? Because you've created a function that can only be used interactively - it's very difficult to program with it. – hadley

      Does it seem like Hadley still stands by this statement after tidy evaluation from this article <Do you need tidyeval>

    1. In practice, functional programming is all about hiding for loops, which are abstracted away by the mapper functions that automate the iteration.
    1. If you're using ggplot, you can use scales::pseudo_log_trans() as your transformation object. This will replace your -inf with 0.
    1. All figures were created using R Statistical Computing Software version 3.6.3 (R Core Team, 2020), relying primarily on the dplyr package (Wickham et al., 2015) for data manipulation and the ggplot2 package (Wickham 2016) for plotting. The code used to create each figure can be found at https://github.com/mkc9953/SARS-CoV-2-WW-EPI/tree/master.
    1. While this seems reasonable it is unlikely that tried and true methods for DNA detection that use PCR will ever be significantly deplatformed

      My guess is PCR will be deplatformed after the COVID pandemic, because there will be focus on democratized testing so isothermal diagnostics will boom a lot.

      Could be LAMP, could be CRISPR...

    1. Repeated freezing and thawing of the supermix is not recommended. DTT should be aliquoted to multiple tubes and stored at –20°C to minimize freezing and thawing
  8. Sep 2020
    1. The next viable way is to use Adobe CC Cleaner tool - which is not publically advertised. If anyone reading this is facing the problem I have described above, download the CC Cleaner Tool here: https://helpx.adobe.com/creative-cloud/kb/cc-cleaner-tool-installation-problems.html 
    1. The next set was on saliva samples, directly on saliva samples

      How significant is the RNA degradation known to be significant in saliva samples if a preservative solution is not used?

    1. LOD was defined as <x>bi + ksbi, where <x>bi equals the mean of the no-template controls, sbi is s.d. of no-template controls and k = 2.479 (99% confidence interval)

      ddPCR

    1. combining:5.5 μL probe; 19.8 μL forward primer; 19.8 μL reverse primer; 64.9 μL dH2O(volumes can be scaled up). This 20× master mix can be frozen and used in subsequent experiments

      Good idea to save time!

    1. Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
    1. Nutrient Agar is a general purpose, nutrient medium used for the cultivation of microbes supporting growth of a wide range of non-fastidious organisms.