1,077 Matching Annotations
  1. Last 7 days
    1. Note that for creating perfect PDF files for printing, it’s better to turn to a dedicated desktop publishing software such as Scribus, which can also import SVG files.

      why?

    1. 10-20 sec

      Depends on the amplicon length. For Cheetah Hotstart Qaq it is 1 min / kb reference:

    2. 3 uL diluted ROX per 20 uL reaction

      for undiluted ROX : 1.5ul/1ml master mix -- add this once per aliquot and label in as ROX added

      2.25 ul / 1.5 ml master mix

  2. Aug 2022
    1. Avoid the use of spectral schemes to represent sequential data because the spectral order of visible light carries no inherent magnitude message. Readers do not automatically perceive violet as greater than red even though the two colors occupy opposite ends of the color spectrum. Rainbow color schemes are therefore not appropriate if the data to be mapped or graphed represent a distribution of values ranging from low to high
  3. Jul 2022
    1. A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase.

      The engineered WarmStart Luna Reverse Transcriptase also possesses higher thermostability than many other RTs, allowing an optimal reaction temperature of 55°C. For difficult targets/templates, higher RT step temperatures of up to 60°C can be used without compromising Luna performance. Luna one step RT-qPCR kit E3005 manual

    1. Denature for 5 minutes at 65°C. Put promptly on ice.

      If denaturation of template RNA is desired

  4. Jun 2022
    1. across() is very useful within summarise() and mutate(), but it’s hard to use it with filter() because it is not clear how the results would be combined into one logical vector. So to fill the gap, we’re introducing two new functions if_all() and if_any().
    1. If you are fine making the jump to Rainin, I would recommend that above all. They make the best pipettes in general, and probably by far the best multichannels. Their single pipettes are probably only rivaled by Eppendorf.
    1. Donor and recipients cells were mixed 1:1 (vol/vol, 0.1 to 1 ml), pelleted (2,000g for 10 min), resuspended in 10–100 µl LB + 300 µM DAP, pipetted onto a LB + 300 µM DAP plate and incubated at 37 °C for 2 h

      conjugation with DAP

  5. May 2022
    1. This class serves the same purpose as the flowFrame class from the flowCore package: to storequantitative data on cell populations from a single FCS run. The primary difference is in the un-derlying representation of the data. While flowFrame objects store the underlying data matrix inthe exprs slot as an R object, cytoframe objects store the matrix (as well as the data from theother slots) in a C data structure that is accessed through an external pointer. This allows for greateroptimization of data operations including I/O, parsing, transformation, and gating.
    1. The original or engineered proteins used in the R6, R7, R7.3, R10 and R10.3 nanopores have not been disclosed by the company to date

      trade secret

    1. One such behavioral trait is seeing all non-human animals as commodities, believing they have been “put on this planet for us to consume”

      This could be extended even to plants

    1. Autofluorescence was not subtracted from these populations.

      why? Is it mathematically sound to combine the autofluorescence histograms and subtract the mode/median etc. from the rest of the populations?

    2. average (n ≥ 3) population geometric MEFL mean

      so arithmetic mean of 3 geometric mean values?

    1. We visualized population-level cellular fluorescence using frequency distributions and violin plots.

      How are replicates handled in these plots?

      Appendix S5 says

      All violins represent data combined from experiments on three separate days except for the max and DAPG sensor violins, where only one replicate was measured.

    1. For background information on how tiling amplicon sequencing works, please prefer to the original “PrimalSeq” protocol paper as tested on Zika Quick et al. Nature Protocols and a follow-up paper Grubaugh, Gangavaparu et al. Genome Biology that focuses on in-host variation and Illumina sequencing.
    1. Indira Gandhi’s image as someone who cared for the poor was seriously dented.

      How then did she manage to win again in 1980? This question always seems to puzzle me about our electorate during that time

    1. A "negative lookahead assertion" can be used to remove from consideration any apostrophes, before they are even tested for being punctuation characters. gsub("(?!')[[:punct:]]", "", str2, perl=TRUE)

      How does this work? From my knowledge, negative lookahead assertion is used in this format lookfor(?!x) Source: Regex cheat sheet

    1. Substitution of SuperScript IV for LunaScript RT SuperMix and reaction volume reduced to 10 uL.

      Why was this substituted? - Could be lower cost : Superscript (350$/25 rxn) vs Lunascript (250$/50 rxn)

    1. As you can see, the theme author has included a .Site.Params variable called commentsrepo

      figure out how to do this for themes that don't have it

    1. a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.

      Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?

    1. However, they were so fond of its diverse uses that they minimized the hazards it posed

      by 'minimized' you mean downplayed

    1. can be a file path to the package or a package object.

      This installs the branch that is currently checked out -- since that is what is in the directory that devtools::install() looks at.

      Stackoverflow comment

  6. Apr 2022
    1. putative ∼97 kbp crAssphage genome (accession code: JQ995537)

      This record was removed because the sequence was not directly determined by the submitter. GenBank: JQ995537.1

      Instead check this : MAG Genbank : BK010471

    1. Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).

      The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way

    1. GenExpDB is the world’s largest repository for E. coli gene expression data. This site is a widely used public resource for gene expression analysis.
    1. while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources

      ROX increases precision of technical replicates (which we don't do much of in our lab)

    2. ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges

      ROX helps normalize these variations

    1. ROX is normalising for the attributes of the qPCR mixture, such as volume differences, presence of bubble etc.

      passive reference ROX helps with these

    2. differences in reaction volumes due to pipetting errors can bias the results. Also, issues associated with the qPCR instrument, such as the optics, can also influence the fluorescent signal generated.

      passive reference ROX helps with these

    1. Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).

      This is an interesting argument as to what individual users can do to keep Firefox alive. But the biggest dent on anti-competitive behavior should come from well enforced proper anti-trust regulations the way Europe is doing it. How can browser users contribute to this?

  7. Mar 2022
    1. If I am applying for a J visa, my current DS-2019 is issued by the same institution as the institution listed on my previous visa.

      Same for F visa, mentioned in this page - https://www.ustraveldocs.com/cn/cn-niv-visarenew.asp

      Is this requirement specific to Chinese applicants?

    1. The MRV fee is valid and may be used to schedule an interview appointment in the country where it was purchased within one year of the date of payment
    1. For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.
    1. no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.

      Sounds like most probe qPCR reactions right? I assume this is in the raw data before baseline subtraction

    2. Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)

      Why sample id? Isn't target and sample type not enough?

    1. a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (

      KanR here is a aminoglycoside nucleotidyltransferase (aadD1), uniprot = P05057 from Staph aureus. This is different from the usual phosphotransferase aphA1/3 used in e.coli

  8. Feb 2022
    1. When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases

      Does this mean that probe-based data without plateau phase cannot be analyzed effectively?

    2. For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample

      For clinical samples where each sample is expected to have a different inhibitor load hence different efficiency

    1. One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package

      The $AsXML exported .rdml file is not valid in RDML-ninja.

      Error message : No rdml_data.xml in compressed RDML file found.

      How to fix this?

  9. Jan 2022
    1. The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.

      using qpcR package for analysis

    1. Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.

      Using qpcR package for qPCR data analysis..

    1. Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1

      I wonder why this fit information was not used for quantification as well?

    1. The ability of a community to receive genes located on mobilizable non-self-transmissible plasmids, on the other hand, would rely on the community’s own content of conjugal plasmids

      Are we assuming here that the secondary conjugation events within the community are more significant than the primary donor with the conjugation helper plasmid?

    1. the sigmoidal response curve is symmetric on the logarithm of x

      will not fit when 0 is included in the data, right?

    1. Try with an actual exponential. You’ll probably want a self-starting function to avoid the “singular gradient” error — read more in my post on the subject.
    1. To ensure unambiguous selection of data points within the window-of-linearity, an iterative algorithm is formulated to search for lines consisting of at least 4 and no more than six data points with the highest R2 value and a slope close to the maximum slope

      Isn't this too small a subset of data? Or is the exponential phase usually <= 6 points?

    1. To cancel out the random variation in individual PCR efficiencies, web-based LinRegPCR, determines for each reaction the centre of the exponential phase from the baseline-corrected fluorescence values and, using the mean PCR efficiency of the assay, constructs an ideal amplification curve which is then used to call the Cq value for the reaction

      Wouldn't this lead to too much dependency on just one data point of the assay - the midpoint of the log-phase?

    1. RT-qPCR targeting SARS-CoV-2 is sensitive to inhibitors that are present in wastewater, leading to false-negative results

      How sensitive is LAMP to contaminants considering the a lot more intricate primer binding reactions are involved. Could there be mispriming and false positives due to contaminants?

  10. Dec 2021
    1. the rapid approach uses a transposase enzyme to simultaneously cleave DNA and attach barcode/adapter sequences

      How efficient is the transposase with supercoiled plasmid DNA compared to long linear genomic DNA fragments it was originally designed for?

    1. The basic idea is that abundant sequences are more likely to generate erroneous sequences than rare sequences

      hmm?

    1. an accumulation of single base pair errors will clearly lead to removal of more reads prior to downstream analyses when using an ESV-based approach versus an OTU-based approach.

      I would say the removal of reads caused by errors is better than somehow squeezing them into OTU clusters and risking spurious OTUs (singletons or otherwise). Thoughts?

    2. If your data is high quality, you want improved taxonomic resolution, and you are not concerned about the intra-genomic heterogeneity in the targeted marker genes, an ESV-based approach could be advantageous. Otherwise, a more standard OTU-based approach might be your best bet.
    1. Tm enhancers for probes are recommended for single nucleotide polymorphism (SNP) and rare mutation detection assays in order to keep the background fluorescence to a minimum. Shorter probes discriminate better between single base differences in the target amplicon(s)

      Does higher T annealing mean lower background? Or is there something else that relate Tm enhancers to background fluor

    1. runcate reads after truncLen bases.Reads shorter than this are discarded.

      Is this from 5' end or 3' end?

      How to prevent shorter reads from being discarded?

  11. Nov 2021
    1. You can also overwrite records in a while loop to avoid excessive memory allocation.

      Does for record in reader not overwrite record the same as the while loop?

    1. , independent inference by sample is trivially parallelizable and enables total computation time to scale linearly and memory requirements to remain flat with increasing sample number, allowing ASVs to be inferred from arbitrarily large data sets.

      It is observed that parallel processing of individual samples (unpooled) underestimates rare taxa (discarding them among sequencing noise) Reference: Fierer lab

    1. Side scatter measurement provides information about the internal complexity (i.e. granularity) of a cell. The interface between the laser and intracellular structures causes the light to refract or reflect. Cellular components that increase side scatter include granules and the nucleus (1). 
    2. FSC intensity is proportional to the diameter of the cell, and is primarily due to light diffraction around the cell.
    1. Chimeric reads occur when one sequencing read aligns to two distinct portions of the genome with little or no overlap. Chimeric reads are indicative of structural variation. Chimeric reads are also called split reads.
    1. The mergePairs(..., justConcatenate=TRUE) option allows the paired reads to be joined without any overlap, but with 10Ns inserted in between the forward and reverse reads. The chimera removal and assignTaxonomy functions will handle such merged reads

      In case of non-overlapping paired ends

    1. or replicates, no statistics should be shown, because they give only an indication of the fidelity with which the replicates were created: they might indicate how good the pipetting was, but they have no bearing on the hypothesis being tested6.

      technical replicates

    1. For a fully functional device you additionally require four magnets with a diameter of 3 mm and a height of 2 mm.

      magnets here -https://www.apexmagnets.com/magnets/3mm-x-2mm-disc-neodymium-magnet

      Where are the magnets going in?

    1. we designed the medium to contain a minimal amount of undefined ingredients that are typically used to cover unknown nutrient requirements

      yeast extract

    1. A self-transmissible RK2 helper plasmid facilitated the spread of mobilizable CRISPR/Cas

      Why have two plasmids instead of having just one self transmissible one?

    1. direct labelling”, in which the plot region itself contains the labels for groups of points instead of using a legend. This usually makes the plot easier to read because it puts the labels closer to the data.
  12. Oct 2021
    1. SNAP-Capture Magnetic Beads are used to selectively immobilize and magnetically separate a SNAP-tag fusion protein from solution using magnetic agarose beads
    1. transmembrane β-strands are highly conserved and that the surface-exposed regions display the highest variability, not only in sequence but also in length.

      Promise for Broad host membrane surface display?

    1. we establish Saturated Programmable Insertion Engineering (SPINE), an unbiased, comprehensive, and targeted domain insertion library generation technique using oligo library synthesis and multi-step Golden Gate cloning
    1. So, here is how I manage it, if the line height cannot be reduced sufficiently by the numeric entry/spinbox: Try clicking the question-mark (un-set variable inline height).If that does not resolve the issue, activate the Tt button ("outer" text style) and set the font height to something small and linespacing to something small and click the questionmark.Then de-activate Tt (outer) and edit the text normally.i.e. The outer style overrides the inner style.
    1. high-throughput 16S rRNA analysis were used to track changes in the bacterial community with Rpf addition, which could reveal the key functional populations contributing to the enhanced phenol degradation under high salinity conditions

      Why would the 16s DNA content change with the resuscitation?

      Do viable, non culturable organisms have lower 16s gene abundance or are harder to lyse and extract from?

    1. Kraken (https://ccb.jhu.edu/software/kraken2/) is one of the most frequently used tools to classify microbial community taxonomic information

      Really? I thought it is relatively new to the taxonomic field

    1. openCyto package is designed to facilitate the application of automated gating methods in a sequential way to mimic the construction of a manual gating scheme.
    1. We sought to reduce the time needed for allele enrichment by putting a selective pressure against the WT allele at the nucleotide level using CRISPR-Cas9 nuclease.

      Using this will make HiSCRIBE the same as SCRIBE?

    1. There are several widely used tool collections, e.g., QIIME 2 [13], mothur [14], usearch [15], and vsearch [16], and 1-stop pipelines, e.g., LotuS [17], with new approaches continually being developed, e.g., OCToPUS [18] and PEMA [19]
    1. Exercising caution when interpreting oligotyping results is warranted, because the 16S rRNA gene, even at full length, can miss important genetic variation underlying ecological and evolutionary differentiation between species

      On the other hand, an individual bacterial cell can house multiple copies of 16s gene that differ slightly to each other.

  13. Sep 2021
    1. print_median(@benchmark linear_access(data, 4096))

      The linear access is taking 435 times longer than random access?

      This is in contradiction from the explanation above. Is this a mistake in the order the results are presented?

  14. Aug 2021
    1. scale_x_discrete(guide = guide_axis(n.dodge = 2))

      With guide_axis(), we can add dodge to our axis label texts to avoid overlapping texts. In the code below, we have used guide_axis() function with n.dodge=2 inside scale_x_discrete() to dodge overlapping text on x-axis.

    1. Considering that DNA molecules consist of double strands of phosphate-deoxyribose backbone and bases that contain a large number of phosphate groups, we next tested if the DNA in the used columns could be effectively removed using a phosphoric acid solution

      phosphate will compete with DNA for binding the column?

    1. High pH favors the breakage of the hydrogen bonds

      probably by de-protonating the OH groups involved in the hydrogen bonding?

    1. The ability of RSF1010 to transfer at high frequencies is remarkable considering its dependency on the availability of compatible conjugation machinery in trans. These data indicate a high prevalence of naturally occurring conjugative elements in sand filter communities

      Or more likely is the possibility that the first transfer is much more abundant than subsequent secondary transfers in the 24 hour duration of this experiment

    2. extracted

      enriched?

    3. In contrast to previous work (Li et al., 2018), pKJK5 showed relatively lower transfer frequencies than RP4 (~1 order of magnitude difference) across all water work microbial communities

      Are you able to explain the possible reasons for this difference?

    1. The best estimate of the PCR efficiency of an assay is obtained by calculating the arithmetic mean of the Eamc determined from all reactions of a specific target

      Assumption is that errors in efficiency across replicates is additive..?

    2. ΔCq indicates the difference between the mean Cq in control and treatment groups for the target as well as the reference

      By writing \(E_{tar}\) in the equation, the assumption is the the efficiency is the same for the control and the treatment groups. This would hold unless there is large differences in efficiency between those -- assuming they differ by batch of processing/extraction etc.

      This assumption wouldn't hold if each reaction has a slightly different efficiency

    1. a ‘single’ curve model ignores sources of run-to-run variability

      ignores variability that is intrinsic to the standard curve and not universal to both standards and unknown samples -- this variability is taken care of in the single curve per run model

    2. Previous studies report from repeated instrument runs of the same calibration curve that there are often minor variations in the slope (<3%), but significant differences between intercept values

      does "same calibration curve" implies the same serial dilutions or freshly made dilutions for each run?

    1. this mechanism may broadly contribute to the importance of IncQ plasmids as agents of bacterial gene transfer in nature

      what special features of IncQ make this mechanism viable? - the replication mechanism?

  15. Jul 2021
    1. that uses highly accessible and inexpensive materials.

      How easily are these materials available?

      1. Gold nanoparticles
      2. ACE2 protein
      3. The electrical detection unit
    2. gold nanoparticles (AuNPs)

      are gold nanoparticles highly accessible in developing countries?

    1. pBGC was introduced into the wild-type isolate collection by electroporation, and all pOXA-48-carrying and pOXA-48-free clones were competed against their pBGC-carrying parental strain

      Is the burden of carrying pBGC included somehow in the analysis?

      Were pBGC carrying isolates competed with the parent isolates without any plasmid to do this?

    2. The presence of the entire pOXA-48_K8 plasmid was confirmed by sequencing the complete genomes of the 50 transconjugant clones, which also revealed the genetic relatedness of the isolates

      was this done after the growth to determine fitness effects? could the plasmid be lost midway through that experiment?

    3. replicate plasmid fitness effects in natural bacterial hosts, which remain largely unexplored

      fitness effects would also be greatly dependent on the environment and measuring fitness as max growth rate, max OD in well shaken single species liquid cultures also might not replicate plasmid fitness effects in the natural gut ecosystem.

      Given this, what is the specific advantage in using natural isolates?

    4. select clones which were naive to pOXA-48_K8, but ecologically compatible with it

      How can residence in a patient from a certain ward be termed as "ecological compatibility"

    1. all downstream manipulations with V. natriegens ATCC14048 Δdns cells were performed with antibiotic selection (kanamycin (200 μg/mL), chloramphenicol (2 μg/mL), carbenicillin (100 μg/mL))
    1. To facilitate indel identification, we developed an online tool called Poly Peak Parser (available at http://yost.genetics.utah.edu/software.php) that is able to separate chromatogram data containing ambiguous base calls into wild-type and mutant allele sequences
    1. TURBO™ DNase is a genetically engineered form of bovineDNase I with greater catalytic efficiency than conventionalDNase I at higher salt concentrations and lower DNAconcentrations.

      salt here => monovalent salts (Na+ etc.)

    1. Encapsulation also helped cells survive acidic environments (pH 4)

      How? isnt the media in equilibrium with the core?

  16. Jun 2021
    1. Escherichia coli was not reliably distinguished from Shigella and other Escherichia species sharing the high 16S rRNA gene sequence similarity to each other

      Is this due to sequencing error rate of nanopore or the 16s are really that identical?

    1. Goals of this paper

      1. What are the barriers of HGT across organisms of increasing phylogenetic distance?
      2. What determines the host range of conjugative elements (ICE, MGE, plasmids etc.)

      Questions

      1. What does two plasmids being "related" mean to you guys? What does the sequence similarity or proteome similarity tell?

      Evidence for functional relevance of PTU

      1. PTUs have some correspondence with Inc groups and Mob types (both being more functionally informative) `
    2. ANIL20 refers to the total length of the shortest plasmid in the comparison.

      What does this mean if the shortest plasmid is really short - < 5 kb like the engineered plasmids and the larger plasmid is a real 50 kb plasmid? What does similarity of such a small region to such a large plasmid mean?

    3. This causes that otherwise unrelated plasmids show certain fragments of their genomes with high ANI values

      If they share the same MGE sequences, what else do you mean by otherwise unrelated? What does two plasmids being related mean to you guys?

    4. this trend dissipated when we looked within the Enterobacteriaceae family (Fig. 1e, f), indicating that the plasmid-encoded genome is widely shared among different genera in this family

      This could be an artifact due to proteobacteria being by far, the most studied family among bacteria?

    5. it is unclear whether, at the distal end of this phylogeny, there is anything similar to a “molecular species”: a group of genetically coherent genomes that evolve together.

      Considering that the concept of microbial species with functional similarity based on genetic similarity is itself debated. For example: There could be two strains, differing by a single nucleotide of some important gene, loosing a function with a huge consequence.. The same could be true for plasmids too if there are mutations in a particular origin of replication etc.

    6. determining the host range of a certain plasmid requires ways to establish which plasmids can be considered equivalent

      Or to determine the functional elements that determine host range and establish equivalence only within those sequences

    1. To separate cells from electronic background noise and abiotic particles, it is recommended to include nucleic acid stains

      Is a stain expected to be more homogenous signal compared to a fluorescent protein expression population of cells?

    1. Bacterial cells are typically one thousandth the volume of mammalian cells, which places them near the edge of instrument detection. At this size it can be challenging to differentiate viable cells from debris of similar size
    1. Because of the technical complexity of manufacturing coronavirus vaccines, waiving intellectual-property rights, by itself, would have little effect

      Is this only relevant to the newer mRNA technology?

    1. However, even in unexposed barley seedlings 16% of the cells were induced after 24 h, suggesting the presence of other aromatic compounds were inducing xis-int expression from the regulatable tbuT promoter.

      or leaky expression of the Xis-int?

    1. two isogenic mutants of the bacterium Pseudomonas stutzeri.

      If they each have a deletion in individual genes, how can they be called isogenic?

      Their growth rates might also be different

    2. . Thus, we conclude that genetic variants of the consumer are unlikely to cause the emergence of the two patterns of spatial self-organization.

      The conclusion should be that this assay cannot test for the genetic variant theory unless variants can be isolataed prima-facie and the experiment reproduced with variant (of one or both strains) vs the original mixed population

    3. If the “consumer first” pattern were caused by genetic variants, then the number of “consumer first” patterns that emerge per range expansion should depend on the initial cell densities of the producer or consumer.

      The pattern is caused by the interaction of the two strains, so altering their ratio will also change the pattern even if it is not caused by genetic variants. How do you control for that?

    1. From this result, we considered that las promoter (BBa_J64010) was not regulated by lasR and 3O-C12-HSL.

      Could the RBS be too weak that expression is not seen?

    1. As the speed of unperturbed electrophoretic polynucleotide passage precludes the resolution of individual nucleotides, a DNA- or RNA-binding motor enzyme is added to the system to gain a processive and slowed down passage (millisecond scale per nucleotide) of the polynucleotide through the nanopore
    2. single-stranded polynucleotide is electrophoretically threaded through a protein or solid-state nanopore.
    1. . For example, if a miscalling occurs at the end of a hairpin in a top strand read, the bottom strand read would correctly basecall this sequence before the hairpin is encountered

      strand bias example

    2. prepared for nanopore sequencing. This procedure involves end preparation, adapter ligation and incubation with the motor protein

      What is this motor protein, helicase? It is not mentioned in the nanopore ligation sequencing kit explanation. Does it come attached to the adapters?

    1. The Hardware may be used solely with the Consumables.

      this is very limiting and seems to go overboard to normal patent protection

    1. sequencing adapters, supplied in the kit, are ligated onto the prepared ends.

      What is the function of these adapters

  17. May 2021
    1. The basal level of T7-dependent tran-scription in this strain can be reduced by constitutive produc-tion of T7 lyzozyme, a natural inhibitor of T7 RNAP, usingplasmids pLysS and pLysE

    Tags

    Annotators

    1. simultaneously regulating transcription and translation, we show how basal expression of an inducible system can be reduced, with little impact on the maximum expression rate. Using this approach, we create several stringent expression systems displaying >1000-fold change in their output after induction

      From fig 4a: basal expression did not really reduce in 2 out of 3 stringent expression systems designed and seems to be already low in the native Ptac (black line). This is a misleading claim in the abstract which could have been worded better. file


      I do see that table 1 reflects basal expression as a percentage of the maximum expression, so maybe this is what is being referred to in the abstract?

    2. Both L2 and the gene of interest (GOI) are separately transcribed by PL1 promoters and the product of L2 activates translation of the GOI transcript.

      Repeating the same promoter Pl1 twice could cause evolutionary instability due to recombination. How to avoid that?

    1. mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli

      I wonder if this insulation will be applicable to other gram negatives? (or other gram positives too?)