It is very surprising that left and right side of colerectal cancers have heterogeneity!

How do you prevent such partisan and vindictive actions by federal government on states?

Same thing is happening in India - Is there any framework people have seen in a more federated country, maybe Germany?

This could have been elaborated a bit more. It is too generic and rather obvious

TODO: try bringing this up to Todd on Slack..

Interesting study that expands the similarity metric used to mark core-genes that determine clade membership and phylogeny by their homology. They sub-sample the similarity problem by predicting 3Di structural strings as opposed to full structure prediction

• To identify core-genes, we traditionally use amino acid similarity (better than nucleotide.. codon usage differences)
• Going one step ahead, we can use protein structures/folds to generalize this further for deep clades where amino acid homology is quite low.

Read more to see how they implement this and how robust is this homology inferred an approximate subsampling like scheme onto 3Di structural strings generated from amino acids like alphafold

You mean protein structure

nim = Interesting cool and fast python like programming language

How does this compare to Julia?

Audio transcription is available with a plug in?

Would keeping the secretion system enable easier protein purification through secretion tags?

Text in and text out: - Answers questions like

What are biological effects of this mutation and what disease it causes - (Summarized the example from fig 1)

Designs primers for clade specific (pan-specific) viral qPCR, single or tiled amplicon sequencing

• Can include degeneracy..

• How is single different from qPCR? only amplicon length maybe?

• Is it really better than Olivar? Why?

• Can this make the MSA as well? That’s too specialized - there are already CLI tools out there

Really cool citizen science campaign!

I'm curious who are the scientists behind this. Find and document here/in a page note

Is the drip tray really that cold? Would be nice to get a temperature measurement as well!

how do you know their ground truth / if these are false calls?

How much of this is due to automatic factors such as stock valuation gains?

Good to add more support than self reported diet by surveys

potential visa problems: argue for USA re-entry issues

Interesting paper about nucleotide sequence divergence using SCO genes (single-copy ortholog). They are thinking about a threshold for species identification in Eukaryotes like we do in prokaryotes

Neat part is they bring different taxa of wide ranging kingdoms to compare on the same plots! (don’t know if this is novel…)

In prokaryotes, homologous recombination, the basis of gene flow, depends directly on the degree of genomic sequence divergence, whereas in sexually reproducing eukaryotes, reproductive incompatibility can stem from changes in very few genes

Although no single threshold delineates species, eukaryotic populations with >1% genome-wide sequence divergence are likely separate species, whereas prokaryotic populations with 1% divergence are still able to recombine and thus can be considered the same species.

Does sister species = same genus?

On avg, how many SCOs are common to taxonomic groups. Is that a large enough number (> 10s?..) to estimate variation like this?

Does the data in the fig 1 change drastically if any of the BUSCO genes are involved in reproductive compatibility? Since variation in these won't be representative of the rest of the eukaryotic genome?

Intereresting choice of phrases: - in hand = isolated - witnessed = ? / microscopy?

These must be experimentalists writing this!

See how this tool is different from seqera.

(Peter van Heusden @ Slack) The problem has been finding the right combination of platform and business model. So you've got Seven Bridges and DNANexus, but they're not playing in our world. Funding from Gates et al have turned Terra into a low cost to use platform and Theiagen has built what seems like a effective business on that. Again, platform and business model seem key. Seqera, those others I just mentioned, the platform is the business. Because of nextflow, Seqera can leverage the vast volunteer effort of the nf-core community but it still is different to the low-cost platform with paid support that Theiagen has developed (and made useable through their investment in workflows, containers, etc). I think that some of those other platforms that were discussed over on #infrastructure give potential for similar developments.

Interesting paper that claims to improve 16S taxonomic classification -- on par with WGS using ML. Read more to figure out -

• How does this work? What’s the ML magic doing here?

• Is it really as good as WGS?:

  • Considering that the 16S region itself doesn’t have full information to resolve species..!?

  • And this is also using short read only: 16S-V4,V4

This is short read data of 16S V3,V4 regions. Not 16S full length // Should have been clarified in the paper!

V3-V4 hypervariable region of the 16S rRNA gene was amplified using the primers 338 F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT).

How are Cells and Taxa defined here?

They are calculating the fraction of taxa within metagenomic datasets (like earth microbiome project) that have been fully genome sequenced.

They are doing this by sequence alignment of the 16S-V4 region - For cell: 100% identity to genome - ?/ For taxa:> 97% identity to {some set of genomes?}

How is this different from taxonomic profiling that the earth microbiome project would have already done?

I would say shopify and Wix are definitely useful for quite a few people who wouldn't otherwise make a website.

But for those who are able to do it with other means, giving up freedoms with a vendor lock-in might not be worth it will be my interpretation of this statement

profound!

from yeast; does this translate to marine eukaryotes? - Yeast media is also pretty salty like E. coli 's LB and seawater so this might translate?

Summary: Compression is achieved by merging the colour sets of k-mers by "similarity"

(from Our contribution section)

In short, our solution merges the color sets of k-mers in a coherent way, e.g., those that share the same minimizer (smallest substring). This allows to save storage space (as the number of indexed sets reduces dramatically).Unlike Bloom- filter based solutions, where approximate color sets are created by merging the color sets of k-mers drawn at random (k-mers that hash to the same bit positions in the filter), we merge them based on their “similarity”.

what is d in this equation? characteristic length scale or diameter of object

• creeping flow = stokes flow ; low reynold's number / high viscousity conditions

Bag of genes model

Summary: human mitochondrial DNA is harder to remove than nuclear DNA from metagenomic datasets meant to house microbial sequences. Stool, oral and skin are especially prone to this mtDNA contamination - Removal by mapping paired reads to a reference genome - Reference genomes lacking mtDNA implicated in leaving them in the databases? - Stringency in having both pairs of read map don't work for small & circular mtDNA (16.5 kb) - + having a single end map to the reference increases spurious matches off-target reads reducing microbial reads

Therefore, extensive validation of the available pipelines is still required.

In our view, the most reliable approach to systematically minimize human DNA and mtDNA contamination in public metagenomic samples would be for the maintainers of public archives to routinely check for this information prior to making records public.

How is this paper different from StrainPhlAn? - What makes it more sensitive for closely related genomes?

Also how does this compare to LoFreq

Do you disagree with this statement then?

Does it really? In a place enabled with public transport?

?

The mock community data is that of whole genomes of ~20 organisms

Reference genomes of 14 bacterial species frequently observed in AGS and activated sludge microbial communities were downloaded from NCBI RefSeq ... + - genomes of Candidatus Moranbacteria and Solirubrobacter bacterium 67 − 14 (reported in AGS and activated sludge studies), retrieved from GenBank, -- as these genera lack official reference genomes. - To incorporate microbial eukaryotes and bacteriophages, the reference genomes of Diploscapter spp., Paramecium spp. and a T4 bacteriophage species were also included. Notably, Paramecium spp. were selected

Simulated untargeted sequencing of these genomes was performed using InSilicoSeq (ISS) v2.01 [27], emulating sequencing via Illumina NovaSeq

This is confusing. Do you mean had lower sensitivity / higher LOD?

From Discussion

This globally aligns with previously reported detection limits of 90 CFU/mL for Gram positive S. aureus and 15 CFU/mL for Gram negative E. coli [16].

Interesting. Good paper with a well setup experiments. It is intuitive that the long term effect of the toxin-antitoxin (TA) system would outselect any efforts to degrade a plasmid carrying it by any means, including CRISPR-cas.

It is nice to see that this this toy example system has been validated in a broader ecosystem with bioinformatic analysis.

Finally, we further tested our theory and generalized our experimental results by bioinformatically analysing plasmids carrying CRISPR-Cas systems and their target plasmids and found that these targeted plasmids did not typically encode TA systems.

CRISPR-Cas systems are common on bacterial chromosomes (∼42% of chromosomes carry a CRISPR-Cas system), but are also found on ∼3% of plasmids. (Pinilla-Redondo et al., 2022). Plasmid-borne CRISPR-Cas systems can be nucleolytic or silence gene expression, and have been implicated in plasmid warfare (reviewed in (Koonin and Makarova, 2024)): plasmids’ CRISPR spacers tend to match other, competing plasmids – particularly those of similar size which occupy the same niche (Pinilla-Redondo et al., 2022; Benz et al., 2024).

Summary

• Uses marker gene list to differentiate between strains ; could it work will a full core genome alignment?

ChronoStrain: a sequence quality- and time-aware Bayesian model for profiling strains in longitudinal samples

define a ‘strain’ as a cluster of marker sequences (subsequences from reference genomes) where the threshold used to define these clusters is an arbitrary user-specified variable.

How many eggs have they used for this!?

why?

Does snakemake fit?

Redun satisfies many of these criteria Desirable criteria - python, cloud support, GUI for monitoring

This is from a twitter poll of 230 people 😒

Seen dummy files used here?

Issue with running this

Tmux sessions persist only as long as at least one window or pane remains open (usually with a running shell or a long-lived process). If the command finishes instantly, the session will terminate right away and won't appear in the session list (source: perplexity)

Summary - ANI is good for closely related microbial species - For distant ones, Amino acid is better (AAI)

Implementation: - Identify markers among the 122 single copy proteins with HMMs - Break protein sequence into k-mers, k = 4 amino acids - Find jacard distance between 2 organisms as an estimator of AAI! - Process done very fast and comparable accuracy to rRNA phylogeny!

Briefly, FastAAI performs, (i) identification of marker proteins in each genome using a set of 122 universal SCP represented by hidden Markov models (HMMs) (Supplementary Table S6, and below), (ii) extraction of tetramers for each protein per genome, (iii) estimation of Jaccard indices based on the tetramers extracted from proteins shared by a genome pair, (iv) estimation of the average Jaccard index (⁠ ⁠) followed by its translation to estimated AAI values

How does this compare to IGV?

Bakta: improved accuracy to Prokka, in finding short ORFs - assigns cross-refs to RefSeq, UniProt - higher memory footprint, database size

by Dr. An Dinh (Houston methodist)

Variant calling tool default settings are robust ; good for bacteria.

Underneath the hood, it simply is a pipeline that utilizes a short-read alignment using bwa mem followed by variant calling using FreeBayes. It works incredibly well for multiple tasks

Any alternative to this for Windows?

how is this letter different from the letter of recommendation?

Why chatGPT can't replace writing

no need to polish assembly with higher accuracy illumina or PacBio?

This is a very useful feature. Windsurf can also do this now?

use for top display as well

Micromonas pusilla

surface area to volume ratio

Check for similar affirmations from other sources

due to their tiny size, all picoplankton, whether eukaryotic or prokaryotic, have low Reynolds numbers (Re), indicating that their movement is dominated by viscous forces, rather than inertial force

for small celled diatom species ~ 5 - 50 um size range. - What is the physical effect that causes the flocs to sink? - Higher density vs larger size?

This might work the same for microalgae as well?

Action of coding mutation on fitness = evolutionary importance of site \(*\) amino acid similarity

Do you also store the counts of each k-mer then?

k-mer counting is quite resource-intensive, as storing large numbers of k-mers along with their counts is expensive in terms of both memory and time.

Find homology, construct phylogenetic tree, overlap detection + graphs (for genome assembly) etc.

Comparing a set of given sequences is a common task involved in many bioinformatics applications, such as homology detection [1], overlap detection and the construction of overlap graphs [2,3,4], phylogenetic tree reconstruction, and isoform detection from circular consensus sequence (CCS) reads [5], to name a few.

is this R9?

Read this paper to figure out why 95% cutoff is called "Principled"

This tool is good for taxonomic assignment of low abundance organisms from metagenome sequencing data. - low abundance makes it harder to assemble genomes, which is the standard way to assign taxonomy confidently?

Key innovation

key innovation in sylph is a statistical model based on zero-inflated Poisson statistics to debias containment ANI under low coverage

How does this differ from kraken2? - Kraken 2 uses short exact matches to a database (causes false positives) which are controlled by abundance cutoffs and confidence thresholds

Differ from sourmash? - k-mer sketching approaches have ANI estimation bias for low-abundance genomes due to incomplete read coverage - Will need arbitrary thresholds to work for low abundance micro-organisms

I guess universal marker gene methods use shortgun/metagenomic sequencing data so is not comparable to amplicon sequencing of 16S?

such methods =

Species-specific or universal marker gene methods (hereafter denoted as ‘marker gene methods’

Is the antibiotic treatment hitting the cells at the maximum growth rate stage? Or can we assume the proportion of current growth rate to maximum observed is the same across all clones?

It gives higher primacy to primers of earlier amplicons?

This isn't an issue if k-mer size can be tweaked automatically? Don't know if there is any tool doing this?

Functions of Sequences of Concern (FunSoCs)

Use fine tuning when

What is the input to this network?

requires only the amino acid sequences of two proteins and predicts a probability of interaction

Intrusive Judicial Inquiry into Parent Company Liability Lord Bingham’s statement in the House of Lords highlights the level of scrutiny that a parent company may face in transnational tort claims. Courts assess whether the parent company played an active role in controlling the subsidiary’s operations, particularly in matters of health, safety, and environmental standards. This includes an inquiry into:

Corporate Oversight – The extent to which the parent company exercised control over subsidiaries. Knowledge and Responsibility – What the parent company’s directors and employees knew or ought to have known about the subsidiary’s activities. Decision-Making and Action – Whether the parent company took positive steps to ensure compliance or failed to act, leading to harm. Documentary Evidence – Courts examine internal company records, including: Board meeting minutes Reports from directors and employees Correspondence related to oversight of the subsidiary Jurisdiction and Access to Justice The House of Lords upheld jurisdiction in the UK by applying the Connelly principle, which states that English courts should hear cases if there is a real risk that justice would not be accessible in the foreign jurisdiction. This was based on:

The complexity of the litigation, making it difficult to fund and pursue in South Africa. The need for extensive corporate records, which were primarily located in the UK parent company’s offices. Precedents in Parent Company Liability By 2001, English courts had ruled on three key cases affirming parent company liability, establishing that:

The legal principle was not controversial. UK courts should retain jurisdiction under forum non conveniens grounds when justice could not be obtained abroad. Impact on Transnational Litigation This judicial approach set an important precedent, paving the way for future cases like Chandler v Cape (2012) and Okpabi v Shell (2021), reinforcing the principle that parent companies may owe a duty of care to individuals harmed by the actions of their foreign subsidiaries.

DOI: 10.1093/infdis/jiad149

Resource: (NIH Nonhuman Primate Reagent Resource Cat# PR-0817, RRID:AB_2716320)

Curator: @giovanni.decastro

SciCrunch record: RRID:AB_2716320

What is this?

for final

.kjgjjhk

??

??

can induce?

this sounds horrible

!!

history of toolchaining for bioinformatics

Seems to be an early paper on toolchaining for bioinformatic workflows. Would be a good reference for introduction when talking about the modern Nextflow and Snakemake workflows

why pipelines vs ad hoc scripts - track dependencies (statically inferred, DAGs) - rules reused for many files (parallelization) - data tracking (rapid development in subsets of pipeline ~ changing parameters,ie. avoid duplicate work when resuming workflows.)

laborious work of setting up multiple packages

Where is this domain expertise coded? RAG?

what does a use case mean?

Would be useful to store the Anndata into some cache for papers that are reused? assuming this generation is an intensive process

where do I find these?

Sugars here is a proxy for vegetable fibres?

means Genus vs order etc.

These things are more important than billions in the long term

Can the EU provide something short term to compensate the cost of digital regulations for companies that are smaller/struggling?

Master tech roadside assistance

"codon-optimized"

Did you mean different "concentrations", because I couldn't find any figure that shows different growth phases of bacteria.

It might be useful to discuss that coli forms that contaminate drinking water or other low nutrient samples might typically be in the stationary phase. You can cite this paper for evidence of phage T4 infecting stationary phase bacteria -

Bryan, D., El-Shibiny, A., Hobbs, Z., Porter, J., & Kutter, E. M. (2016). Bacteriophage T4 infection of stationary phase E. coli: life after log from a phage perspective. Frontiers in microbiology, 7, 1391.

fig 6D: did you test without any bacteria or not? Could indicate with a non-detected (ND) label in the chart and clarify in the legend

fig 6B: x-axis should list organism names instead of the ATCC numbering for understandability. Organism name could be shortened as P. putida etc. the ATCC numbers can be clarified in the figure legend or methods section as a table/list. Clarify what Mix means in legend

fig 6C: mention in legend what the non-viable E. coli is such as heat killed E. coli etc.

fig 6H: mention the type of sample in the x-axis label. Clarify the colour map title, is it CFU/ml?

mention which figure panel shows the 5 CFU/ml detection limit

Extensions to this work should be added to the discussions 1. Detecting different concentrations of E. coli among a mixture of other bacteria would be interesting to know about the specificity. 2. Detecting contamination in real samples or when spiked with unknown contaminating source such as sewage wastewater would be a useful extension to this work.

fix sentence

Does the detection depend on the growth phase of E. coli and how does this correspond to the real world scenario?

For perspective, you could mention an estimate of the quickest possible detection with this method using short latency, high burst size T4 phages with citations

Fig 5A: figure legend is too short. Add a short one line description of capture efficiency / how it was measured. This is useful to make the figure self explanatory without referring to methods

fig 3B,C: Use bars of a single colour to improve readability and minimize distraction with multiple colours

fig 3B-E: Describe what the a, b, c, d above the bars are in the figure legend

need to mention what samples were used

? / fig 3H: Needs a negative control of phage without E. coli cells to confirm that the luminiscence happens only upon infection

fig 2E: explain the 1-72 numbers in the y-axis briefly in the legend

Fig 2B: Avoid the use of bars on a log plot. Show raw data points with dots and use a line to show the mean. - re-order the x axis in descending order and shorten the x-axis labels to just the numbers to minimize redundancy

Fig 1 image could be improved for better understanding 1. Avoid yellow which is hard to see 2. show much fewer particles and phages for more clarity (2-3 only) 3. could merge C, D and E and Zoom into B

need to mention everywhere (except abstract) that editing was carried out by homologous recombination with CRISPR based counter-selection.

Please show individual data points as well

This might not be applicable for frugal South Asian women who are likely to spend less on non-essential purchases and delay their health check-ups and anything preventative until things get serious. - Will look for a good citation for this..

Is this somewhat the German model of funding?

There might be downsides to this too

discussion tomorrow / > 11/Mar/25

Anshumali's prime research work on SLIDE algorithms.

Sewall Hall 301

I am concerned about this and hence default towards impromptu presentation delivery all the time.

This works great if there's no hard time constraint, such as in casual settings such as lab meetings, but for talks, there needs to be some hybrid strategy?

Interesting, I would disagree as a gut feeling. Read more

changing an image size syntax

This seems likely to be inaccurate

TDS is not a harmful substance. This is misleading

need to do a pre-test to see if the water actually contains any of these in concerning levels before hasting into an RO setup

insert image

small sample size ~ < 30 (source?) - (logic) If the sample size is large, central limit theorem will rescue non-normal data to apply t-test

If you have more than 15 observations in each group, you might want to use the t-test even when you have nonnormal data. The central limit theorem causes the sampling distributions to converge on normality, making the t-test an appropriate choice.

quick thoughts glancing the paper - Why are you flipping the gene instead of the promoter? :

Better efficiency with a larger flipping region.. - Why did you choose integrase12?

401(a)

Take aways: AI will become cheaper and more efficient. - closed source models can cache responses and save computations for repetitive queries - closed source also has possibility of iterative improvements using constant reinforcement learning. - Prioritizing capabilities and deliberate strategy in data selection, carefully designed training objectives.

read this paper. AI improvements

AAA website has 60% discount right now so it's cheaper to get directly

great example! RAG's => special expertise that is domain specific that is retrieved from a well curated library of text.

Does replacing tires improve this? these are fuel efficient though!

Source: discounttire

Autotrader private seller exchange

ls sorted output by time ; use -d for descending order

difference in the number of sequences across databases

introductory AI courses at Rice University

battery tips,

Any issues with expressing new proteins when non-growing?

• Does this provenance record the parameters used for reach step?
• Is there also a way of sharing the whole recipe with others that enables something like a one-click reproducibility?

Because dadasnake has these features which will make it a better tool for particular NGS sequence analysis

2021 Nissan leaf

This paper is too specific to transcriptomic analysis but it has some inspiration. - This seems more of a substitute for R and python workflows as opposed to a complete tool-chain philosophy that could put together mature command line tools like Nextflow. So this is more relevant for final polishing etc. - They don't mention what backend they are using as the LLM. Is it just making API calls to chatGPT or something they coded themselves? this would be most relevant to know for Omi

can automate running the code too?

LLM advances

useful. Need to have customizable sections and added explanations of terms and meanings of measures if user requires.

How does a html work with clickable/hover hyperlinks for defining key complex terms for first time users?