[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the Brca1 p.L1363P variant contributes to tumor formation and accelerates tumor development in a mouse model, indicating its role in tumor progression. Functional: The passage indicates that the Brca1 p.L1363P variant has a functional defect that compromises BRCA1-mediated homologous recombination repair (HRR), suggesting an alteration in molecular function.

Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P

Genes: 7158

Variants: L1363P p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Justification: Oncogenic: The variant p.L1363P is associated with a defect in mammary tumor suppression, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses increased sensitivity to cisplatin and PARP1 inhibition in the context of the Brca1 p.L1363P variant, indicating a correlation with treatment response. Functional: The variant p.L1363P is shown to severely attenuate BRCA1-PALB2 binding, which alters the molecular function related to homologous recombination repair (HRR).

Gene→Variant (gene-first): 672:leucine to proline 7158:p.L1363P 672:p.L1407P

Genes: 672 7158

Variants: leucine to proline p.L1363P p.L1407P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the variant p.L1363P alters the binding ability of BRCA1 to PALB2 and affects its activity in homologous recombination repair (HRR), demonstrating a change in molecular function.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses the evaluation of the functional consequences of the Brca1 p.L1363P variant, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses a functional analysis of the Brca1 p.L1363P variant, indicating that it alters embryonic development and leads to growth defects in mice, which demonstrates its impact on molecular or biochemical function. Oncogenic: The analysis of the Brca1 p.L1363P variant in the context of embryonic development and its comparison to Brca1-null mice suggests that it may contribute to tumor development or progression, as it is associated with severe phenotypes similar to pathogenic mutations in Brca1.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the homozygous variant p.L1363P in Brca1 leads to embryonic lethality in mice, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variant p.L1407P disrupts the interaction of BRCA1 with PALB2 and predicts that it disables the alpha-helical structure of the coiled-coil domain, indicating an alteration in molecular function. Oncogenic: The use of CRISPR/Cas9 to model the BRCA1 variant in mice suggests that the variant contributes to tumor development or progression, as it is being studied in the context of a gene essential for embryonic development and cancer biology.

Gene→Variant (gene-first): 672:4220T>C 7158:p.L1363P 672:p.L1407P

Genes: 672 7158

Variants: 4220T>C p.L1363P p.L1407P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 2

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic

Justification: Diagnostic: The passage discusses the correlation of MIB-1 labeling indices with the diagnosis and grade of tumors, indicating that the K27M variant is associated with specific tumor classifications.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 5

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the transformation of tumors associated with the K27M variant, indicating its role in tumor development and progression, particularly in the context of glioblastoma transformation.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of H3 K27M-mutant tumors and provides demographic information, indicating that the variant is associated with specific histological diagnoses and patient characteristics. Oncogenic: The mention of H3 K27M in the context of tumors suggests that this somatic variant contributes to tumor development or progression, as it is identified in mutant tumors.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Prognostic, Oncogenic

Justification: Diagnostic: The passage discusses the H3 K27M mutation's association with various tumor types, indicating its role in defining and classifying these tumors, particularly in pediatric and adult cohorts. Prognostic: The passage mentions survival outcomes for patients with H3 K27M-mutant tumors, comparing mean survival times between adults and pediatric patients, which indicates a correlation with disease outcome. Oncogenic: The H3 K27M mutation is described as contributing to tumor development in various glioma types, indicating its role as a somatic variant involved in tumor progression.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC3288377 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of the p.K27M mutation in DIPGs and its association with this specific subtype of brain tumors, indicating its role in defining or classifying the disease. Oncogenic: The p.K27M and p.G34R mutations are described as somatic mutations found in pediatric gliomas, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 3021:p.G34R 3021:p.K27M

Genes: 3021

Variants: p.G34R p.K27M

[Paragraph-level] PMCID: PMC6368247 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the emergence of the ESR1 Y537S mutation in the context of resistance to CDK4/6 inhibitors, indicating a correlation with treatment response and resistance. Oncogenic: The mention of the ESR1 Y537S mutation as a new driver mutation suggests that it contributes to tumor development or progression, particularly in the context of breast cancer.

Gene→Variant (gene-first): 5728:Y537S

Genes: 5728

Variants: Y537S

[Paragraph-level] PMCID: PMC5122709 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Diagnostic, Oncogenic

Justification: Predictive: The passage discusses patients treated with BRAF inhibitors, specifically mentioning the BRAF V600E mutation, which correlates with response to these therapies. Diagnostic: The passage states that all patients tested positive for the BRAF V600E mutation, indicating its use in defining or confirming the presence of a specific subtype of melanoma. Oncogenic: The BRAF V600E mutation is implicated in the development of melanoma, suggesting its role as a somatic variant contributing to tumor progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC2789045 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the FGFR3 mutations (S249C, Y375C, and K652E) alter molecular signaling pathways, specifically the phosphorylation of various proteins, indicating a change in biochemical function. Oncogenic: The passage describes how the mutant FGFR3 variants induce morphological transformation, cell proliferation, and anchorage-independent growth, which are indicative of their role in tumor development and progression.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Prognostic

Justification: Prognostic: The passage indicates that the SNPs are suggested to play a crucial role in the prognosis of HNSCC, which correlates with disease outcome.

Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936

Genes: NA 388325 341019

Variants: rs16879870 rs2641256 rs2761591 rs854936

[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Functional

Justification: Prognostic: The passage discusses the association of SNPs with HNSCC survival, indicating that these variants correlate with disease outcome, specifically overall survival, independent of therapy. Functional: The passage mentions that the genotype of rs16879870 and rs854936 is significantly associated with the expression of specific genes in cancer tissues, suggesting that these variants alter molecular function.

Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936

Genes: NA 388325 341019

Variants: rs16879870 rs2641256 rs2761591 rs854936

[Paragraph-level] PMCID: PMC7612475 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Functional

Justification: Predictive: The K700E mutation in SF3B1 increases cellular sensitivity to ionising radiation and various chemotherapeutic agents, including PARP inhibitors, indicating a correlation with treatment response. Functional: The K700E mutation alters HR efficiency and induces unscheduled R-loop formation, replication fork stalling, and defective replication fork restart, demonstrating an impact on molecular function.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC9900321 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the efficacy of a small-molecule KRASG12D inhibitor, MRTX1133, in treating pancreatic ductal adenocarcinoma, indicating a correlation between the Gly-to-Asp mutation and response to therapy. Oncogenic: The Gly-to-Asp mutation in the KRAS oncogene is described as contributing to tumor development in pancreatic ductal adenocarcinoma, as it is found in more than 90% of patients with this cancer type.

Gene→Variant (gene-first): 3845:Gly-to-Asp

Genes: 3845

Variants: Gly-to-Asp

[Paragraph-level] PMCID: PMC3542862 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses somatic mutations in PIK3CA (including R115P, E542K, H1047L, and H1047R) that contribute to the pathophysiology of macrodactyly, indicating their role in tumor development or progression through activation of the PI3K/AKT signaling pathway. Functional: The passage mentions that the identified mutations lead to AKT activation, which indicates that these variants alter molecular or biochemical function related to cell signaling pathways.

Gene→Variant (gene-first): 5290:E542K 5290:H1047L 5290:H1047R 5163:R115P

Genes: 5290 5163

Variants: E542K H1047L H1047R R115P

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 9

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that KRAS G12C and G13D mutations are associated with inferior progression-free survival (PFS) and overall survival (OS) in mCRC patients, suggesting a correlation with disease outcome independent of therapy. Diagnostic: The mention of KRAS mutations being associated with heterogeneous outcomes compared to unmutated tumors implies that these variants can be used to classify or define a disease subtype in mCRC.

Gene→Variant (gene-first): 3845:G12C 3845:G13D

Genes: 3845

Variants: G12C G13D

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the correlation of KRAS mutations, including specific variants like G12C and G13D, with inferior overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Diagnostic: The passage mentions that mutations in KRAS were diagnosed in tumors, indicating that these mutations are used to classify or define the disease.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses how KRAS G12C and G13D mutations correlate with inferior progression-free and overall survival in metastatic colorectal cancer patients, indicating their prognostic significance. Diagnostic: The mention of KRAS mutations being associated with tumor characteristics suggests their role in classifying or defining the disease subtype in colorectal cancer.

Gene→Variant (gene-first): 3845:G12C 3845:G13D

Genes: 3845

Variants: G12C G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.

Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

Genes: 3845

Variants: A146T G12C G12D G13D Q61H

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC9837058 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how mutations in PIK3CA, including G1049R, H1047R, and M1043I/L, contribute to the activation of the PI3K pathway, indicating their role in tumor development or progression. Functional: The passage describes how specific mutations alter the conformation and binding properties of the p110alpha subunit, indicating that these variants affect molecular function related to PI3K activation.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043I/L

Genes: 5290

Variants: G1049R H1047R M1043I/L

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the H1047R variant alters the binding interactions and structural dynamics of the protein in response to pY binding, indicating a change in molecular function.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 18

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the H1047R and G1049R variants alter the molecular interactions and conformations within the kinase domain, indicating a change in biochemical function related to the protein's activity. Oncogenic: The evidence suggests that the H1047R and G1049R variants contribute to activation through disruption of the inhibitory conformation, which is indicative of their role in tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 17

Evidence Type(s): Functional

Justification: Functional: The passage discusses changes observed for the H1047R variant in the context of HDX-MS experiments, indicating that it alters molecular or biochemical function, specifically in terms of perturbations in conformation.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how C-terminal mutations, including M1043L, H1047R, G1049R, and N1068fs, affect the inhibitory interaction with the C-terminus, indicating an alteration in molecular function. Oncogenic: The mention of "oncogenic mutation" in relation to M1043L, H1047R, and G1049R suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants H1047R, G1049R, M1043L, and N1068fs alter membrane binding and ATPase activity, indicating changes in molecular function. Oncogenic: The variants are described in the context of their effects on membrane binding and ATPase activity, which suggests a role in tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the intrinsic ATPase activity of the p110alpha mutants, indicating that the variants G1049R, H1047R, and M1043L alter molecular function by exhibiting significantly increased ATPase activity compared to wild type. Oncogenic: The context of the passage implies that the variants are somatic mutations in a cancer-related gene, contributing to tumor development or progression through their altered biochemical activity.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses frequent oncogenic mutants and their role in tumor samples, indicating that these variants contribute to tumor development or progression. Functional: The analysis of the mutants and their binding to full-length p85alpha suggests that these variants alter molecular or biochemical function, specifically in the context of their interaction with regulatory complexes.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:H1047R/L 5290:M1043L 5290:M1043L/I 5290:N1044K 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R H1047R/L M1043L M1043L/I N1044K N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the H1047R mutation in the context of its role in activating the kinase domain and increasing membrane binding, indicating its contribution to tumor development or progression. Functional: The passage describes how the H1047R mutation alters the molecular interactions and structural organization of the kinase domain, affecting its binding properties and functionality.

Gene→Variant (gene-first): 5290:H1047R 5290:His1047 5290:Met1043

Genes: 5290

Variants: H1047R His1047 Met1043

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the E726K variant in the context of oncogenic mutations and its association with conformational changes that contribute to tumor development, indicating its role in cancer progression. Functional: The passage describes how the E726K variant leads to conformational changes affecting the interaction between the ABD and p85 with the catalytic core, suggesting an alteration in molecular function.

Gene→Variant (gene-first): 5290:E726K

Genes: 5290

Variants: E726K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the N345K variant affects the molecular interactions and binding of the p110alpha/p85alpha complex to membranes, indicating an alteration in biochemical function.

Gene→Variant (gene-first): 5290:N345K

Genes: 5290

Variants: N345K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses oncogenic mutants (N345K, G106V, and G118D) and their expected role in promoting ABD/iSH2 disengagement, indicating their contribution to tumor development or progression. Functional: The data suggests that the variants alter the dynamics of the ABD-p85 complex and its interaction with the p110alpha catalytic core, indicating a change in molecular function related to binding and mobility.

Gene→Variant (gene-first): 5290:G106V 5290:G118D 5290:N345K

Genes: 5290

Variants: G106V G118D N345K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 2

Evidence Type(s): Functional

Justification: Functional: The passage discusses the D915N mutation in the context of its effect on protein conformation and membrane binding, indicating that it alters molecular function as assessed by HDX-MS experiments.

Gene→Variant (gene-first): 5290:D915N

Genes: 5290

Variants: D915N

[Paragraph-level] PMCID: PMC6280667 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the correlation of mutations, including those in splicing components like ZRSR2, with sensitivity to various drugs, indicating a relationship between the variant and treatment response.

Gene→Variant (gene-first): 8233:serine/arginine

Genes: 8233

Variants: serine/arginine

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the tumor forming capacity of cells expressing the ERBB2 E401G variant, indicating that this somatic variant contributes to tumor development as evidenced by increased tumor growth in vivo.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the effects of the ERBB2 E401G and S310F variants on the proliferative and invasive capacities of cancer cells, indicating that these variants alter molecular or biochemical functions related to cell behavior. Oncogenic: The evaluation of the proliferative and invasive capacities of cells expressing the ERBB2 variants suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 15

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants E401G and S310F alter the phosphorylation of downstream signaling pathway proteins, indicating a change in molecular function related to the MAPK pathway. Oncogenic: The evidence suggests that the variants contribute to tumor development or progression by activating signaling pathways associated with cancer, specifically through the ERBB2 dimerization and its effects on downstream signaling.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the E401G and S310F mutations affect the dimer interface stability of the EGFR-HER2 complex, indicating that these variants alter molecular interactions and stability.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the variant p.(E401G) alters the stability of the ligand-free EGFR HER2 heterodimer, which suggests a change in molecular function.

Gene→Variant (gene-first): 2176:p.(E401G)

Genes: 2176

Variants: p.(E401G)

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants E401G and S310F lead to increased phosphorylation levels of HER2 and EGFR, indicating that these variants alter molecular function related to protein activity. Oncogenic: The context of the passage suggests that the variants E401G and S310F contribute to tumor development or progression by enhancing the phosphorylation of key HER family proteins involved in oncogenesis.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage discusses the identification of potential dimerization partners of the HER2 E401G protein, indicating that the variant alters molecular interactions.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants S310F and E401G alter the C-terminal phosphorylation of HER2, indicating a change in molecular function.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses the ability of the variants E321G, E401G, and S310F to form disulfide-linked dimers, indicating that these variants alter molecular function related to protein interactions.

Gene→Variant (gene-first): 7157:E321G 2176:E401G 2064:S310F

Genes: 7157 2176 2064

Variants: E321G E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional

Justification: Functional: The passage mentions the evaluation of mechanisms for multiple ERBB2 variants, including E321G, E401G, S310F, and D845A, which suggests that these variants are being assessed for their biochemical functions.

Gene→Variant (gene-first): 2064:D845A 7157:E321G 2176:E401G 2064:S310F

Genes: 2064 7157 2176

Variants: D845A E321G E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 4

Evidence Type(s): Functional

Justification: Functional: The passage indicates that ERBB2 E401G has functional properties similar to S310F, suggesting that these variants alter molecular or biochemical function.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes the ERBB2 E401G variant as a somatic mutation that is associated with ERBB2 gene amplification, indicating its contribution to tumor development or progression. Functional: The passage mentions that multiple computational tools supported a deleterious effect of the ERBB2 E401G variant on the encoded gene product, suggesting that it alters molecular or biochemical function.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic

Justification: Diagnostic: The passage mentions the detection of the ERBB2 E401G variant of uncertain significance (VUS) in a patient, indicating its use in defining or classifying a disease context, specifically in a patient with cancer of unknown primary (CUP).

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC6938308 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that KRAS codon p.12G and BRAF codon p.600V somatic mutations have been linked to brain AVMs, suggesting their role in defining or classifying the disease. Oncogenic: The mention of likely somatic disease-causing mutations, including KRAS mutations (p.G12D and p.G12V) and BRAF mutations (p.V600E and p.Q636X), indicates that these variants contribute to tumor development or progression.

Gene→Variant (gene-first): 3845:p.12G 673:p.600V 3845:p.G12D 3845:p.G12V 673:p.Q636X 673:p.V600E

Genes: 3845 673

Variants: p.12G p.600V p.G12D p.G12V p.Q636X p.V600E

[Paragraph-level] PMCID: PMC8307492 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the association of the L858R variant with overall survival (OS) in patients treated with first-line EGFR inhibitors, indicating its relevance to treatment response. Oncogenic: The L858R variant is mentioned in the context of EGFR mutations in non-small-cell lung cancer (NSCLC), suggesting its role in tumor development or progression as part of the broader analysis of clinically actionable EGFR mutations.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the T790M mutation as a mechanism of resistance to the EGFR inhibitor osimertinib, indicating its correlation with treatment response. Oncogenic: The T790M mutation is described as contributing to resistance in patients treated with EGFR inhibitors, suggesting its role in tumor progression.

Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

Genes: 1956

Variants: G719S L858R L861Q T790M

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses overall survival (OS) outcomes associated with the L858R variant, indicating that it correlates with disease outcome independent of therapy. Diagnostic: The mention of the type of EGFR mutation, including L858R, being associated with overall survival suggests its role in classifying or defining disease outcomes.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Prognostic

Justification: Predictive: The passage discusses the proportion of patients receiving first-line targeted therapy based on the presence of the L858R mutation, indicating a correlation with treatment response. Prognostic: The median overall survival (OS) for patients with the L858R mutation is reported, demonstrating its correlation with disease outcome independent of therapy.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses overall survival (OS) in patients with the L858R variant, indicating a correlation between this variant and disease outcome, independent of therapy. Diagnostic: The mention of distinct survival patterns observed in different EGFR mutation subclasses, including L858R, suggests that this variant is used to classify or define a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the prevalence of EGFR mutations, including L858R and L861X, in patients at initial diagnosis, indicating their association with the disease and their use in defining the mutation status of patients. Oncogenic: The variants L858R and L861X are described as actionable mutations within the context of EGFR, suggesting their role in tumor development or progression.

Gene→Variant (gene-first): 1956:L858R 1956:L861X

Genes: 1956

Variants: L858R L861X

[Paragraph-level] PMCID: PMC10805385 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage discusses the overexpression of HOXC10 in KRAS-mutant tumors, specifically mentioning the genotype KRAS G12C/TP53 G245V, indicating that these somatic variants contribute to tumor development or progression. Predictive: The passage mentions the efficacy of combined MEK/BET inhibitors causing tumor regression in KRAS-mutant patient-derived xenograft models, suggesting a correlation between the variants and response to therapy.

Gene→Variant (gene-first): 3845:G12C 7157:G245V

Genes: 3845 7157

Variants: G12C G245V

[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of KRASG12D mutant MEFs to a drug combination, indicating that the variant is associated with resistance to growth inhibition by the therapies tested. Oncogenic: The KRASG12D variant is implicated in tumor behavior, as it is described in the context of MEFs (mouse embryonic fibroblasts) and their growth characteristics, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 3845:G12D

Genes: 3845

Variants: G12D

[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of KRAS G12C-mutant cells to specific therapies, indicating a correlation between the variant and sensitivity to the drugs MRTX849/AMG510 and KPT9274. Oncogenic: The variant KRAS G12C is implicated in tumor development, as the passage describes its presence in cancer cell lines and their proliferation in response to treatment, suggesting a role in cancer progression.

Gene→Variant (gene-first): 3845:G12C

Genes: 3845

Variants: G12C

The use of the word 'should' is a dark piece of diction in the education world. The public is the populace reading this article; they are the clientele in charge of voting to pass levies, voting for representatives to change the rules educators work with, and they are the ones to call the school when educators attempt to do their jobs. This word might be one of the culprits that drives the most educators from the profession when young teachers are introduced to the occupation, and the position is not what the new teacher believed it ‘should’ be.

Taking the time to examine why young teachers are no longer teachers should be the focus of all final semesters, in my opinion. Granted, institutions are tasked with producing educators, but to address the nationwide shortage, those same institutions have the obligation to shift their focus to developing teachers with longevity.

With teaching experience as a guide, this is absolutely true, but there is so much more to it. It is the extra things that those two actions force you to do as an educator that help teachers stay teachers.

The problem with being resilient and persistent is that burnout is far more prevalent in our world. You cannot light yourself on fire to keep others warm and survive to tell about it, or even better, keep doing it.

T'Challa is realizing that he's being talked about poorly.

start the speech with a statement that the united Indian nations want to address congress as equals

Former SPEAKER OF THE HOUSE

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.

Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

Genes: 672 675

Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.

Gene→Variant (gene-first): 1956:G719X 1956:L858R

Genes: 1956

Variants: G719X L858R

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.

Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

Genes: 2322

Variants: D835 D835Y F691

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

Genes: 2322

Variants: D835Y F691 F691 L F691I

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

Genes: 2322

Variants: D835Y F691 L/I

[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.

Gene→Variant (gene-first): 1956:L858R 1956:T790M

Genes: 1956

Variants: L858R T790M

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

ça ressemble un peu à cette extension "Hypothesis" au final, sans avoir besoin d'installer d'extension.

The state of { journalism, the Web–industrial complex, and understanding about the fundamentals of research and scholarship } are so poor that the staff actually had to justify something as simple as citing your sources.

(In 2010, but still… 2010!)

[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional

Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.

Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

Genes: 673 1956 324

Variants: L597V L858 L858R V855 V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:L858R 324:V855A

Genes: 1956 324

Variants: L858R V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.

Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

Genes: 2065 324

Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

https://github.com/solbjorg/oberon-riscv

term / defintion

When writing it is important to follow these steps to make the best form of your essay. Following these steps can help you be organized and lay out your thoughts so it can make since when you write the final product.

I think that this is especially helpful for young children who don’t have strong reading skills yet.

It is important to have a positive relationship with your librarian because they can be a great resource for materials, books, and other technology.

[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).

Gene→Variant (gene-first): 7298:rs3786362

Genes: 7298

Variants: rs3786362

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.

Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

Genes: 2260

Variants: c.1681G>A c.1966A>G p.K656E p.V561M

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

Genes: 3417 673

Variants: p.R132H p.V600E

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.

Gene→Variant (gene-first): 2064:p.L755P

Genes: 2064

Variants: p.L755P

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

Genes: 2064

Variants: c.2262_2264delinsTCC p.(L755P)

[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.

Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

Genes: 79728

Variants: c.2514+1G>C c.3114-1G>A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

Genes: 2232 367 1387 10514 10499

Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.

Gene→Variant (gene-first): 9611:M886I

Genes: 9611

Variants: M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.

Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

Genes: 367 1387 10514

Variants: H874Y M749I Q798E

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.

Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

Genes: 2908 10499

Variants: I672 I672T R629 R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.

Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

Genes: 2232 367

Variants: G142V L57Q P390L P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.

Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

Genes: 367 10499

Variants: P390L R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.

Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

Genes: 10499 367

Variants: D879G H874Y Q919R T877A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

Evidence Type(s): Predisposing, Functional

Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.

Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

Genes: 367 9611

Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.

Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

Genes: 367 9611 1387 10514

Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

Genes: 367 9611

Variants: K910R M886 M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.

Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

Genes: 597 367 2908 10499

Variants: A586V A587S I672T R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

Genes: 2232 367

Variants: G142V G524D M523V M537V P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.

Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

Genes: 367 10514

Variants: P269S P390L P514S S515G

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.

Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 207 367 2232 9611

Variants: D221H D528G E198G P269S P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).

Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 1387 207 367 2232 9611

Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.

Gene→Variant (gene-first): 367:G166S 367:M537R

Genes: 367

Variants: G166S M537R

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.

Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

Genes: 2908 10499

Variants: I672 R629 T575

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Functional

Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.

Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

Genes: 1387 207 367 2232 10514

Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

Genes: 596

Variants: E152 E152A G101V V101

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.

Gene→Variant (gene-first): 596:G101V

Genes: 596

Variants: G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

Genes: 596

Variants: E152 E152A G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the role of E152 in venetoclax affinity, indicating a correlation with response or sensitivity to the therapy.

Gene→Variant (gene-first): 596:E152

Genes: 596

Variants: E152

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.

Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

Genes: 596

Variants: F104C F104L G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.

Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

Genes: 596

Variants: F104 F104L L104

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

Genes: 596

Variants: E152 G101 G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 596:F104

Genes: 596

Variants: F104

[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage describes a missense point mutation (Trp557Gly) identified in the KIT gene associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Diagnostic: The variant Trp557Gly is mentioned in the context of identifying and characterizing the tumors associated with neurofibromatosis type 1, suggesting its role in defining the disease subtype.

Gene→Variant (gene-first): 3815:Trp557Gly

Genes: 3815

Variants: Trp557Gly

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Functional

Justification: Diagnostic: The passage discusses the identification of rare germline variants (V37M, R181H) in patients with B-ALL, indicating their association with the disease. Functional: Luciferase assays performed on the variants showed no significant changes in transcriptional repression activity compared to WT ETV6, indicating an assessment of their molecular function.

Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

Genes: 2120

Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The detection of different localization patterns for the mutants P214L, R369Q, and R399C also suggests alterations in their molecular or biochemical function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the mutations L349P, N385fs, P214L, R369Q, and R399C impair the transcriptional repression function of ETV6, indicating that these variants alter molecular function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the L349P and N385fs mutations are predicted to alter the molecular function of the ETV6 protein, including conformational changes and truncation that affect DNA interaction.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs

Genes: 2120

Variants: L349P N385fs

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of a heterozygous deletion in ETV6 that is associated with the diagnosis of acute lymphoblastic leukemia (ALL) in the proband, indicating its role in defining the disease. Oncogenic: The variant N385fs is described as leading to a truncation of the ETV6 protein, which is implicated in tumor development, specifically in the context of acute lymphoblastic leukemia (ALL).

Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

Genes: 2120

Variants: N385fs c.1153-5_1153_1delAACAG

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Predisposing, Oncogenic

Justification: Diagnostic: The variant 415 T>C is associated with thrombocytopenia and leukemia, as it was identified in all affected family members and absent in unaffected individuals, indicating its role in defining the disease. Predisposing: The passage describes the variant as being present in affected individuals and absent in unaffected individuals, suggesting it confers inherited risk for developing the disease, although it does not explicitly state that it is germline. Oncogenic: The variant is described in the context of leukemia, indicating its potential role in tumor development or progression, particularly as it is a missense mutation in a gene associated with leukemia.

Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

Genes: 10320 2120

Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the impact of the insertions on the catalytic Gln61 might be stronger, indicating an alteration in molecular function related to GTP hydrolysis.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the HRAS p.G12V variant alters the signaling capability by affecting GTP hydrolysis and inducing phosphorylation of ERK and AKT, indicating a change in molecular function. Oncogenic: The HRAS p.G12V variant is implicated in inducing signaling pathways that are associated with tumor development, as evidenced by the increased levels of phosphorylated ERK and AKT in the transfected cells.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the classical oncogenic variant KRAS p.G12V in the context of its effect on GTP hydrolysis, indicating its role in tumor development or progression. Functional: The passage describes how the variant KRAS p.G12V affects the biochemical function of GTP hydrolysis, demonstrating its impact on molecular activity in the presence of RAS-GAP.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the p.G12V variant alters the intrinsic GTP hydrolysis rates, indicating a change in molecular function related to protein activity. Oncogenic: The p.G12V variant is described as a classical oncogenic variant, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression. Functional: The passage discusses how KRAS p.G12V alters the intrinsic dissociation rate of mGppNHp compared to wild type, indicating a change in molecular function.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the impact of the p.Q61L variant on nucleotide exchange, effector binding, and GTP hydrolysis, indicating that it alters molecular or biochemical function. Oncogenic: The p.Q61L variant is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 4893:p.Q61L

Genes: 4893

Variants: p.Q61L

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the insertions around Gln61 likely alter the molecular interactions and functions of the protein, particularly affecting GTP hydrolysis and interactions with GEFs and GAPs.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses mutations in RAS genes, including p.G12A, p.G13H, and p.Q22K, which are described as classical oncogenic mutations that affect tumor development and progression. Functional: The passage indicates that the p.Q22K mutation is associated with increased GTP loading, suggesting that it alters molecular function related to protein activity.

Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

Genes: 3845

Variants: p.G12A p.G13H p.Q22K

[Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, and this is validated by the success of RAF and MEK inhibitors in clinical trials, indicating a correlation with treatment response. Oncogenic: The passage discusses oncogenic mutations in B-RAF, specifically the B-RAFV600E mutation, which is implicated in tumor development and progression in malignant melanomas.

Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

Genes: 673

Variants: B-RAFV600E serine/threonine

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how several variants, including K131, R168G, G130R, and others, alter the molecular function of RAD51C by disrupting the ATP-binding site and influencing RAD51C activity, as demonstrated in HDR assays. Oncogenic: The passage indicates that the variants are deleterious and influence RAD51C function, which is relevant to tumor development or progression, particularly in the context of HDR assays.

Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu

Genes: 5889 5892

Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how various RAD51C variants affect the ability to form protein complexes involved in DNA damage repair, indicating that these variants alter molecular function. Oncogenic: The mention of deleterious variants that lose the ability to form complexes suggests a role in tumor development or progression, as these variants are associated with impaired DNA repair mechanisms.

Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

Genes: 5889 5892

Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how RAD51C variants alter cell proliferation and the formation of RAD51 foci in response to ionizing radiation, indicating changes in molecular function related to DNA damage signaling and repair. Oncogenic: The variants are implicated in a proliferation defect and disruption of homologous recombination (HR) repair, suggesting their role in tumor development or progression.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the L138F variant alters HDR activity in different cell lines, indicating a change in molecular function. Predictive: The passage mentions the sensitivity of variants, including L138F, to cisplatin and olaparib, suggesting a correlation with response to these therapies.

Gene→Variant (gene-first): 5889:L138F

Genes: 5889

Variants: L138F

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the sensitivity of specific RAD51C variants (G130R, K131I, T132R, Q133E, and G302V) to olaparib, indicating a correlation with response to therapy. Functional: The passage describes the introduction of RAD51C variants into a cell line and assesses their effects on homologous recombination repair (HDR), indicating that these variants alter molecular function.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how RAD51C missense variants alter RAD51 foci formation in response to DNA damage, indicating a change in molecular function related to DNA repair mechanisms. Predictive: The mention of "drug response findings" suggests that the variants may correlate with sensitivity or resistance to a specific therapy, indicating predictive evidence.

Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu

Genes: 5889 5888

Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the influence of RAD51C missense variants on the response to cisplatin and olaparib, indicating a correlation between the variants and treatment sensitivity. Functional: The passage describes how the variants affect IC50 values in the HDR assay, suggesting that they alter molecular function related to drug response.

Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg

Genes: 5889

Variants: E94K G306R p.Glu94Lys p.Gly306Arg

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the influence of missense mutations on RAD51C HR DNA repair activity, indicating that the variants alter molecular function as assessed by HDR activity in a cell-based assay. Oncogenic: The mention of deleterious variants categorized based on their impact on HDR activity suggests that these somatic variants contribute to tumor development or progression through their effects on DNA repair mechanisms.

Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala

Genes: 5889

Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the treatment of ruxolitinib and its effects on the phosphorylation level of STAT3 in tumors with the JAK1 S703I mutation, indicating a correlation with treatment response. Oncogenic: The mention of the JAK1 S703I mutation in the context of tumor models suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutation to the JAK1/2 inhibitor ruxolitinib, indicating a correlation with treatment response. Oncogenic: The passage suggests that the JAK1S703I mutation may play a critical role in tumorigenesis, indicating its contribution to tumor development.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the anti-tumor activity of ruxolitinib in a model with the JAK1 S703I mutation, indicating a correlation with response to therapy. Oncogenic: The mention of the JAK1 S703I mutation in the context of a PDX model suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the transformation ability of JAK1 mutations, specifically noting that JAK1S703I and JAK1S729C are capable of continual proliferation in the absence of IL-3, indicating their contribution to tumor development or progression. Functional: The passage mentions that JAK1S703I activates the JAK-STAT signaling pathway, which indicates an alteration in molecular function related to the variant.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the introduction of JAK1 mutations, including E483D, S703I, and S729C, alters the expression levels of phosphorylated JAK1 and STAT proteins, indicating a change in molecular function. Oncogenic: The passage mentions that JAK1S729C is a known and recurrent activating mutation, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the S703I mutation is an activating mutation of the JAK1 gene and was found in tumors, suggesting it contributes to tumor development or progression. Functional: The S703I mutation is described as potentially causing disruption of auto-inhibition of the JAK1 kinase, indicating an alteration in molecular or biochemical function.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how NRG1 levels increase after androgen deprivation therapy (ADT) and suggests that these elevated levels are sufficient to promote resistance to ADT, indicating a correlation with treatment response. Oncogenic: The mention of NRG1 promoting resistance to ADT implies a role in tumor development or progression, which aligns with the definition of an oncogenic variant.

Gene→Variant (gene-first): 8850:S7C

Genes: 8850

Variants: S7C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage discusses the detection of NRG1 expression in patients with localized prostate cancer, indicating its potential role in classifying or defining the disease based on the presence or absence of NRG1 staining. Predictive: The analysis includes a comparison of NRG1 expression in patients who received neoadjuvant ADT versus those who were hormonally intact, suggesting a correlation with treatment response.

Gene→Variant (gene-first): 3084:S6 8850:S7

Genes: 3084 8850

Variants: S6 S7

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:S2 3084:S6C

Genes: 1956 3084

Variants: S2 S6C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses resistance-promoting activity and its correlation with HER3 phosphorylation, indicating a relationship with response or resistance to therapy. Functional: The passage describes how the variant affects HER3 phosphorylation activity, suggesting an alteration in molecular function related to resistance-promoting activity.

Gene→Variant (gene-first): 5979:Q8

Genes: 5979

Variants: Q8

[Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the somatic mutations Y641F and Y646F in the EZH2 gene contribute to tumor development, specifically leading to high-penetrance lymphoma and melanoma in a mouse model. Functional: The variant Ezh2Y641F is shown to alter molecular function by increasing global H3K27 trimethylation and causing a redistribution of this mark, which affects transcription at various loci.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F