Similar tumorigenesis between KrasLSL-G12D/+ and KrasLSL-G12D/C118S mice
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 12
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage indicates that the variants G12D and C118S are involved in similar tumorigenesis, suggesting that they contribute to tumor development or progression.
Gene→Variant (gene-first): 4843:C118S 3845:G12D
Genes: 4843 3845
Variants: C118S G12D
To assess whether there was also an impact on tumor progression, lesions were graded as being atypical adenomatous hyperplasia (AAH), adenoma (AD), or adenocarcinoma (AC) by histology (Supplementary Fig. 3). This analysi
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the impact of the KrasC118S variant on tumor progression and its association with different tumor types, indicating that this somatic variant contributes to tumor development or progression. Functional: The analysis shows that the KrasC118S variant is associated with reduced P-Akt signaling, suggesting that it alters molecular function related to signaling pathways involved in tumor biology.
Gene→Variant (gene-first): 4843:C118S
Genes: 4843
Variants: C118S
Comparison of the number and size of visible surface lung lesions revealed that Kras+/C118S or KrasC118S/C118S mice developed fewer tumors with a smaller average tumor size, resulting in an overall reduction in tumor bur
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 10
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the KrasC118S variant contributes to tumor development by resulting in fewer tumors and smaller average tumor sizes in mice, indicating its role in tumor progression. Functional: The presence of the KrasC118S allele is shown to alter the tumor characteristics, specifically leading to a shift towards smaller tumors, which suggests an alteration in molecular or biochemical function related to tumor development.
Gene→Variant (gene-first): 4843:C118S
Genes: 4843
Variants: C118S
To determine the impact of the KrasC118S mutation on carcinogenesis, we assessed the effect of treating Kras+/+, Kras+/C118S, and KrasC118S/C118S mice with the carcinogen urethane (ethyl carbamate), which induces lung tu
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 9
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the KrasC118S mutation in the context of its role in carcinogenesis and tumor development, particularly in relation to urethane-induced lung tumors characterized by oncogenic Q61R/L mutations in Kras. Functional: The passage implies that the KrasC118S mutation alters the molecular behavior of Kras in the context of tumorigenesis, as it is assessed for its impact on carcinogenesis and tumor development.
Gene→Variant (gene-first): 4843:C118S 3845:Q61R/L
Genes: 4843 3845
Variants: C118S Q61R/L
Identification of genotypes of 580 offspring from crossing Kras+/C118S mice revealed that there was no statistical difference between the observed frequency versus the expected Mendelian ratio of the three genotypes of K
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 7
Evidence Type(s): Oncogenic, Prognostic
Justification: Oncogenic: The passage discusses the KrasC118S variant in the context of its role in mouse models, indicating that it does not lead to significant developmental or physiological defects, which suggests its involvement in tumor development or progression. Prognostic: The passage mentions the median lifespan of KrasC118S/C118S mice compared to Kras+/+ mice, indicating a potential correlation with disease outcome, although the difference was not statistically significant.
Gene→Variant (gene-first): 4843:C118S
Genes: 4843
Variants: C118S
KrasC118S/C118S mice appear normal
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 6
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 4843:C118S
Genes: 4843
Variants: C118S
We confirmed that the strategy to introduce the G353>C transversion into the Kras gene did not overtly affect alternative splicing of terminal exons 4A and 4B, an important consideration as both splice forms are importan
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the C118S mutation affects the ability of eNOS to stimulate the MAPK pathway and provides evidence of altered molecular function through immunoblot analysis of protein levels and activity. Oncogenic: The passage indicates that the C118S mutation is important for carcinogen-induced lung tumorigenesis, suggesting that it contributes to tumor development or progression.
Gene→Variant (gene-first): 4843:C118S 4843:G353>C 4846:S1177D
Genes: 4843 4846
Variants: C118S G353>C S1177D
To investigate the effect of mutating C118 on Ras function in vivo during tumorigenesis, a targeting vector was created to insert a single point mutation, namely a G353 transversion to C (G353>C) encoding the C118S mutat
[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 3
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the C118S mutation specifically blocks redox-dependent reactions that lead to Ras activation, indicating an alteration in molecular function. Oncogenic: The context of the study involves investigating the effect of the C118S mutation on Ras function during tumorigenesis, suggesting that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 4843:C118 4843:C118S 4843:G353 transversion to C 4843:G353>C
Genes: 4843
Variants: C118 C118S G353 transversion to C G353>C
All the mutations were in the TK domain that is critical for EGFR activity (Figure 2). Sequence alignment of the human wild- type EGFR with the Pfam model of protein kinase domain indicates W731, E734, T785, C797, Y801,
[Paragraph-level] PMCID: PMC2970593 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses mutations in the TK domain of EGFR that are critical for its activity, indicating that these variants alter molecular function related to protein activity. Oncogenic: The context of the mutations being in the TK domain of EGFR suggests that they may contribute to tumor development or progression, as this domain is often implicated in oncogenic signaling pathways.
Gene→Variant (gene-first): 1956:C797 NA:E734 NA:T785 1956:E868 1956:L858 1956:R831 NA:W731 1956:Y801
Genes: 1956 NA
Variants: C797 E734 T785 E868 L858 R831 W731 Y801
We analyzed a cohort of MPM samples (n = 29) by DHPLC and sequencing analysis, and identified eight mutations in the tyrosine kinase domain (TKD) of EGFR. Of the 8 mutations in the TK domain, 7 were novel (W731L, E734Q,
[Paragraph-level] PMCID: PMC2970593 Section: RESULTS PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage states that the L858R mutation was found to increase sensitivity to the EGFR inhibitor, Erlotinib, indicating a correlation with treatment response. Oncogenic: All mutations mentioned in the passage, including C797Y, E734Q, E868G, L831H, L858R, T785A, W731L, and Y801H, are described as somatic mutations that contribute to tumor development, as they were identified in the tyrosine kinase domain of EGFR in cancer samples.
Gene→Variant (gene-first): 1956:C797Y 1956:E734Q 1956:E868G 1956:L831H 1956:L858R 1956:T785A 1956:W731L 1956:Y801H
Genes: 1956
Variants: C797Y E734Q E868G L831H L858R T785A W731L Y801H
Since our data indicates that the SF3B1K700E mutation gives rise to an HR defect, we hypothesised that this could be exploited therapeutically to treat tumours that have acquired this mutation. To test this hypothesis, w
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 19
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how the SF3B1K700E mutation can be therapeutically targeted, indicating a correlation with treatment response to etoposide and olaparib, which are specific therapies. Oncogenic: The SF3B1K700E mutation is implicated in tumor development, as the passage describes its role in creating an HR defect and its effects on tumor growth in xenograft models.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
Lastly, it is known that following replication arrest, several proteins, including BRCA1 and BRCA2, are required for preventing uncontrolled nucleolytic degradation of damaged forks and loss of this function contributes
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 17
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the SF3B1 K700E variant contributes to cellular deficits characteristic of BRCA1/2 loss, indicating its role in tumor development or progression. Functional: The variant K700E is shown to alter the recruitment of Rad51 to replication forks and affects replication fork stability, demonstrating a change in molecular function.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
To assess whether the increased R-loops present in the SF3B1K700E mutant expressing cell line affects DNA replication, we examined replication fork dynamics using the DNA fibre assay (Figure 3B). Notably, this analysis r
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the SF3B1K700E variant affects replication fork dynamics and efficiency of replication fork restart, indicating an alteration in molecular function related to DNA replication. Oncogenic: The context of the study involves assessing the impact of the SF3B1K700E mutation on cellular processes relevant to tumor development, such as replication fork dynamics, which suggests a role in oncogenesis.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
Our data clearly suggests a role for SF3B1 in the DDR, particularly in HR mediated DNA repair following DNA damage. However, we have also observed increased DSBs and reduced HR in unperturbed SF3B1K700E cells. Importantl
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The D210N variant is described as being catalytically inactivated, which alters its ability to resolve R-loops, indicating a change in molecular function. Oncogenic: The passage discusses the role of the D210N variant in the context of R-loop accumulation and genome instability, which are associated with tumor development and progression.
Gene→Variant (gene-first): 246243:D210N
Genes: 246243
Variants: D210N
SF3B1K700E mutation induces unscheduled R-loops, stalled replication forks, and reduced replication fork protection and restart
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the K700E mutation alters molecular function by inducing unscheduled R-loops and affecting replication fork dynamics.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
To directly determine the impact of the SF3B1K700E mutation on HR, we assessed the formation and resolution of Rad51 foci, a key marker of HR function, in our isogenic models following IR induced DNA damage. Intriguingly
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 9
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the SF3B1K700E mutation alters the molecular function of homologous recombination (HR) by affecting the formation and resolution of Rad51 foci, indicating a defect in the later stages of HR. Oncogenic: The SF3B1K700E mutation is implicated in tumor development or progression as it affects the ability of cells to resolve recombination intermediates, which is a critical process in maintaining genomic stability in cancer cells.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
To assess the biological impact of this deregulated splicing and export, we performed Ingenuity Pathway Analysis (IPA) on genes with 3ASS and SE in SF3B1K700E cells. Consistent with a role for SF3B1 in DNA repair, this a
[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the SF3B1K700E variant alters the ability of cells to resolve DNA double-strand breaks (DSBs) and impairs homologous recombination (HR) repair, indicating a change in molecular function related to DNA repair mechanisms. Oncogenic: The SF3B1K700E mutation is described as cancer-associated and is shown to contribute to defects in DNA repair, which is a characteristic of oncogenic variants that promote tumor development or progression.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
Mutations in SF3B1 have been identified across several cancer types. This key spliceosome component promotes the efficient mRNA splicing of thousands of genes including those with crucial roles in the cellular response t
[Paragraph-level] PMCID: PMC7612475 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Functional
Justification: Predictive: The K700E mutation in SF3B1 increases cellular sensitivity to ionising radiation and various chemotherapeutic agents, including PARP inhibitors, indicating a correlation with treatment response. Functional: The K700E mutation alters HR efficiency and induces unscheduled R-loop formation, replication fork stalling, and defective replication fork restart, demonstrating an impact on molecular function.
Gene→Variant (gene-first): 23451:K700E
Genes: 23451
Variants: K700E
In the placebo arm, patients with E545K/E542K mutation had shorter PFS and overall survival than those with wild-type PIK3CA (Supplementary Table 2), suggesting that PIK3CA mutations in the helical domain might play a ro
[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Prognostic
Justification: Predictive: The passage suggests that patients with E545K/E542K mutations had shorter progression-free survival (PFS) and overall survival, indicating a potential role of these mutations in resistance to hormone therapy. Prognostic: The mention of shorter PFS and overall survival in patients with the E545K/E542K mutations indicates a correlation with disease outcome independent of therapy.
Gene→Variant (gene-first): 5290:E542K 5290:E545K
Genes: 5290
Variants: E542K E545K
To examine the role of domain-specific mutations in PIK3CA on everolimus efficacy, patients were categorised by mutation site, H1047R in the catalytic domain, and E545K and E542K in the helical domain. Everolimus prolong
[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 8
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the correlation between PIK3CA mutations (H1047R, E545K, E542K) and the efficacy of everolimus, indicating that these variants are associated with prolonged progression-free survival (PFS) in patients treated with this therapy. Oncogenic: The mention of PIK3CA mutations in the context of their role in tumor development and the efficacy of a cancer treatment suggests that these somatic variants contribute to tumor progression.
Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R
Genes: 5290
Variants: E542K E545K H1047R
Of the 724 patients in BOLERO-2, 550 patients (76%) underwent PIK3CA cfDNA analysis. The baseline characteristics and clinical outcomes were similar between the cfDNA and overall population (Supplementary Table 1). PIK3C
[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 3
Evidence Type(s): Diagnostic, Predictive
Justification: Diagnostic: The passage discusses the prevalence of PIK3CA mutations, including specific variants, in a patient population, indicating their association with the disease context. Predictive: The mention of higher prevalence of PIK3CA mutations in the everolimus arm compared to the placebo arm suggests a correlation with treatment response, indicating predictive value.
Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R
Genes: 5290
Variants: E542K E545K H1047R
We report the discovery of the GATA2 gene as a new myelodysplastic syndrome (MDS)/acute myeloid leukemia (AML) predisposition gene. We found the same, novel heterozygous c.1061C>T (p.Thr354Met) missense mutation in the G
[Paragraph-level] PMCID: PMC3184204 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predisposing, Diagnostic, Functional
Justification: Predisposing: The passage describes the discovery of the GATA2 gene as a predisposition gene for myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML), indicating that the variants are associated with inherited risk for developing these diseases. Diagnostic: The variants are used to define and classify familial forms of MDS and AML, as they are reported to segregate with the disease in multiple families, which supports their role in diagnosis. Functional: The passage mentions that the mutations have differential effects on transactivation of target genes, cellular differentiation, apoptosis, and global gene expression, indicating that they alter molecular or biochemical function.
Gene→Variant (gene-first): 2624:c.1061C>T 2624:c.1063_1065delACA 2624:p.Thr354Met 6688:p.Thr355del
Genes: 2624 6688
Variants: c.1061C>T c.1063_1065delACA p.Thr354Met p.Thr355del
Advances in the understanding of the molecular basis for acute myeloid leukemia (AML) have generated new potential targets for treatment. Fms-like tyrosine kinase 3 (FLT3) is one of the most frequently mutated genes in A
[Paragraph-level] PMCID: PMC5613053 Section: ABSTRACT PassageIndex: 2
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the ability of gilteritinib to block mutated FLT3, including the D835Y and F691 mutations, and its correlation with improved survival in models of FLT3-driven AML, indicating a response to therapy. Oncogenic: The D835Y and F691 mutations in FLT3 are implicated in the pathogenesis of acute myeloid leukemia (AML), suggesting that these somatic variants contribute to tumor development or progression.
Gene→Variant (gene-first): 2322:D835Y 2322:F691
Genes: 2322
Variants: D835Y F691
The finding that gilteritinib inhibited FLT3-D835Y and FLT3-ITD-D835Y, both of which harbor mutations in the activation loop essential for binding type 2 inhibitors, suggests that gilteritinib is a type 1 FLT3 inhibitor.
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.
Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691
Genes: 2322
Variants: D835 D835Y F691
Since mutations within the TKD of FLT3 (eg, FLT3-D835Y or FLT3-F691) often confer resistance to FLT3 inhibitors that were previously effective against FLT3-ITD, the effect of gilteritinib on these resistance mutations wa
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.
Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I
Genes: 2322
Variants: D835Y F691 F691 L F691I
Inhibitory activity of gilteritinib against FLT3 containing ITD +- D835Y or F691 L/I mutations
[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.
Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I
Genes: 2322
Variants: D835Y F691 L/I
Of the 106 variants tested, we classify 50 as Pathogenic, including 31 ASD. We further classify 10 variants, including 4 ASD, as Likely Pathogenic. We consider 24 variants to be Likely Benign, including 3 ASD: P354Q, T20
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 25
Evidence Type(s): Diagnostic
Justification: Diagnostic: The passage discusses the classification of variants as Pathogenic and Likely Pathogenic, indicating their association with specific diseases or subtypes, which aligns with the definition of diagnostic evidence.
Gene→Variant (gene-first): 5728:A79T 5728:C211W 5728:E157G 5728:H123Q 5728:I135V 5728:I203V 5728:I400V 5728:K342N 5728:K402N 5728:L345V 5728:L70V 5728:M35V 5728:N117S 5728:N228S 5728:N340D 5728:N340H 5728:N356D 5728:P354Q 5728:Q298E 5728:S229T 5728:T202I 5728:T78A 5728:W274L 5728:Y176C 5728:Y180H 5728:Y65C
Genes: 5728
Variants: A79T C211W E157G H123Q I135V I203V I400V K342N K402N L345V L70V M35V N117S N228S N340D N340H N356D P354Q Q298E S229T T202I T78A W274L Y176C Y180H Y65C
PTEN functions as a negative regulator of the PI3-AKT signaling pathway by decreasing the pool of available PI(3,4,5)P3 via its lipid phosphatase activity, causing a reduction in the level of activated, phosphorylated AK
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how various PTEN variants, including A126D, A126P, C124S, G129E, H123Q, P354Q, P38H, Q396R, R130L, and R130Q, alter the molecular function of PTEN by affecting pAKT levels, indicating changes in biochemical activity. Oncogenic: The variants are described in the context of their effects on the PI3-AKT signaling pathway and their ability to exhibit loss of function (LoF) or gain of function (GoF), which are indicative of their roles in tumor development or progression.
Gene→Variant (gene-first): 5728:A126D 5728:A126P 5728:C124S 5728:G129E 5728:H123Q 5728:P354Q 5728:P38H 5728:Q396R 5728:R130L 5728:R130Q
Genes: 5728
Variants: A126D A126P C124S G129E H123Q P354Q P38H Q396R R130L R130Q
To identify molecular mechanisms underlying variable effects of MS variants, we measured impact on protein stability, a known mechanism of PTEN dysfunction. We measured PTEN protein abundance for WT and 97 variants teste
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the variants affect protein stability and abundance, indicating that they alter molecular function, which is supported by the use of western blot analysis and flow cytometry to measure these changes.
Gene→Variant (gene-first): 5728:H93Y 5728:P354Q 5728:R130L 5728:R14G 5728:R15S 5728:T78A
Genes: 5728
Variants: H93Y P354Q R130L R14G R15S T78A
Since ASD is a behaviorally diagnosed disorder, and deficits in sensory processing are a core feature of ASD present in >95% of cases, we tested the effects of PTEN variants on sensorimotor neural circuit function in an
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how PTEN variants affect sensorimotor neural circuit function and chemotaxis in C. elegans, indicating that these variants alter molecular or biochemical function. Oncogenic: The context of the passage suggests that the PTEN variants are involved in a pathway related to tumor development or progression, particularly given the focus on mutations in a cancer-related gene.
Gene→Variant (gene-first): 5728:A79T 5728:C124S 5728:D268E 5728:G132D 5728:P354Q 5728:T167N 5728:Y176C
Genes: 5728
Variants: A79T C124S D268E G132D P354Q T167N Y176C
Aberrant neuronal morphology and excitatory/inhibitory synapse balance are hallmarks of ASD, and ASD rodent models. Reducing PTEN expression results in increased neuronal growth, with larger soma size, increased dendriti
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how various PTEN variants, including C124S, I101T, G132D, D268E, and A79T, alter neuronal growth processes and synapse density, indicating that these variants affect molecular or biochemical functions in neuronal cultures. Oncogenic: The passage mentions that the PHTS variant A79T exhibits a gain-of-function (GoF) phenotype in axonal growth, suggesting that it contributes to tumor development or progression in the context of its association with ASD.
Gene→Variant (gene-first): 5728:A79T 5728:C124S 5728:D268E 5728:G132D 5728:I101T
Genes: 5728
Variants: A79T C124S D268E G132D I101T
We generated 88 transgenic lines of Drosophila melanogaster expressing WT human PTEN and 86 PTEN variants, each integrated into the attP2 locus, with attP2 used as an empty vector (EV) control, allowing quantitative comp
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how various PTEN variants, including C124S, G129E, N117S, and Q298E, alter developmental rates in Drosophila, indicating that these variants affect molecular or biochemical function related to insulin signaling and eclosion timing. Oncogenic: The mention of the known gain-of-function variant 4A inducing lethality suggests that some variants contribute to tumor development or progression, aligning with oncogenic behavior.
Gene→Variant (gene-first): 5728:C124S 5728:G129E 5728:N117S 5728:Q298E
Genes: 5728
Variants: C124S G129E N117S Q298E
We took advantage of the high-throughput capacity of the Saccharomyces cerevisiae synthetic dosage lethality screen as an unbiased assay to identify genetic interactions of PTEN. By overexpressing human WT PTEN (WT), emp
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the C124S variant alters molecular interactions and functions within the context of PI3P metabolism and signaling, indicating a change in biochemical activity. Oncogenic: The C124S variant is described in the context of genetic interactions that may contribute to tumor development or progression, as it is involved in a synthetic dosage lethality screen related to PTEN's role in cancer biology.
Gene→Variant (gene-first): 5728:C124S
Genes: 5728
Variants: C124S
We selected PTEN MS and nonsense (NS) mutations identified in individuals with ASD, intellectual disability (ID), developmental delay (DD), somatic cancer and PHTS, as well as variants found among the general population
[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 3
Evidence Type(s): Diagnostic, Oncogenic, Functional
Justification: Diagnostic: The passage discusses the classification of variants, including C124S, G129E, R130X, and R335X, in relation to their association with conditions such as ASD, PHTS, and somatic cancer, indicating their role in defining or confirming these diseases. Oncogenic: The passage mentions that C124S and G129E have been found in somatic cancer, indicating that these variants contribute to tumor development or progression. Functional: The passage describes several variants, including C124S and G129E, as having well-characterized disruptions on protein function, indicating that they alter molecular or biochemical function.
Gene→Variant (gene-first): 5728:C124S 5728:G129E 5728:R130X 5728:R335X 5728:Y138L
Genes: 5728
Variants: C124S G129E R130X R335X Y138L
To clarify the relationship between CYP3A4 expression and resistance to FOLFIRI and cetuximab, we compared the expression levels of CYP3A4 in CRCs displaying different therapeutic responses (GEO data sets GSE13294 and GS
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the relationship between p53 mutations (including R175H, R248W, R273H, R282W) and resistance to chemotherapy, specifically noting that cells with these mutations showed higher viability and increased IC50 for various drugs, indicating a correlation with drug resistance. Oncogenic: The passage implies that the p53 mutations contribute to tumor behavior by affecting cell response to chemotherapy, suggesting their role in tumor development or progression.
Gene→Variant (gene-first): 7157:R175H 7157:R248W 7157:R273H 7157:R282W
Genes: 7157
Variants: R175H R248W R273H R282W
The GSEA analysis revealed that most of the drug metabolism enzymes in association with p53 R248/R282 mutations are responsible for the clearance of chemotherapeutic drugs. Among these, the most relevant one was cytochro
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 10
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the association between p53 mutations (R248, R282) and the expression of CYP3A4, a drug metabolism enzyme, indicating a correlation with drug clearance and potential response to chemotherapeutic drugs. Functional: The passage describes how p53 mutations (R248, R282) alter the expression levels of the CYP3A4 enzyme, demonstrating a change in molecular function related to drug metabolism.
Gene→Variant (gene-first): 7157:R175 7157:R175H 7157:R248 7157:R248W 7157:R273 7157:R273H 7157:R282 7157:R282W
Genes: 7157
Variants: R175 R175H R248 R248W R273 R273H R282 R282W
To probe the characteristic pathways associated with different p53-hotspot mutations, we selected the colorectal cancer (CRC) data set in TCGA as an example. The CRC cases contain more mortality-associated mutations (R24
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 8
Evidence Type(s): Prognostic, Functional
Justification: Prognostic: The passage mentions that R248Q/W and R282W are associated with mortality, indicating a correlation with disease outcome. Functional: The passage discusses the enrichment of specific gene sets linked to cellular respiration and drug metabolism enzymes for certain mutations, suggesting alterations in molecular function.
Gene→Variant (gene-first): 7157:R175H 7157:R248Q/W 7157:R248W 7157:R273H 7157:R282W
Genes: 7157
Variants: R175H R248Q/W R248W R273H R282W
R248 and R282 mutations associate with drug metabolism enzymes
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 7
Evidence Type(s): Diagnostic, Predictive
Justification: Diagnostic: The passage indicates that the R282 mutation is associated with drug metabolism enzymes, suggesting its role in defining or classifying a specific biological context related to drug metabolism. Predictive: The mention of the R282 mutation in relation to drug metabolism enzymes implies a potential correlation with response or sensitivity to therapies that involve these enzymes.
Gene→Variant (gene-first): 7157:R282
Genes: 7157
Variants: R282
We tested the association between R248/R282 mutations and cancer patient survival using an independent data set extracted from published literatures (data in Supplementary Table 1), and found these mutations are indeed a
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 6
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage discusses the association of R248 and R282 mutations with shorter patient survival, indicating a correlation with disease outcome independent of therapy. Oncogenic: The mention of mice carrying the humanized mutation on R248 exhibiting significantly shorter survival time suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 7157:R175 7157:R248 7157:R273 7157:R282
Genes: 7157
Variants: R175 R248 R273 R282
Kaplan-Meier survival analysis revealed that patients carrying p53 mutations on Arg248 and Arg282 residues had significantly shorter overall survival time than those carrying nonsense mutations (Figures 2a and b). Other
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 4
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage discusses how mutations at Arg248 and Arg282 correlate with significantly shorter overall survival times, indicating a relationship between these variants and disease outcome independent of therapy. Oncogenic: The mention of p53 mutations, including those at Arg248 and Arg282, suggests a role in tumor development or progression, as these mutations are associated with survival outcomes in cancer patients.
Gene→Variant (gene-first): 7157:Arg248 7157:Arg282 7157:G245 7157:R175 7157:R248 7157:R249S 7157:R273 7157:R282 7157:Y220
Genes: 7157
Variants: Arg248 Arg282 G245 R175 R248 R249S R273 R282 Y220
Mutations on Arg282 and Arg248 residues associate with shorter patient survival
[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 2
Evidence Type(s): Prognostic
Justification: Prognostic: The passage indicates that mutations at Arg282 and Arg248 are associated with shorter patient survival, which correlates with disease outcome independent of therapy.
Gene→Variant (gene-first): 7157:Arg248 7157:Arg282
Genes: 7157
Variants: Arg248 Arg282
Our next goal was to define the molecular signatures of each TSC hamartomatous lesion type using genome-wide DNA methylation and transcript profiling. Unsupervised clustering of DNA methylation array data revealed lesion
[Paragraph-level] PMCID: PMC5481739 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the somatic DNMT3A-V716F mutation and its predicted effect on methyltransferase activity, indicating that the variant alters molecular function. Oncogenic: The mention of the somatic DNMT3A-V716F mutation in the context of a tumor suggests that it contributes to tumor development or progression.
Gene→Variant (gene-first): 1788:V716F
Genes: 1788
Variants: V716F
Next, we determined whether metformin had superior antitumor activity in KRAS-mutated CRC cell lines to those with KRAS wild type through a cell-viability test. As shown in SI Appendix, Fig. S2A, metformin inhibited the
[Paragraph-level] PMCID: PMC7293710 Section: RESULTS PassageIndex: 7
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses how the KRASG12V mutation correlates with increased sensitivity to the antiproliferation therapy of metformin, indicating a predictive relationship between the variant and treatment response. Oncogenic: The KRASG12V mutation is implicated in tumor development as it is mentioned in the context of its effect on cell viability and sensitivity to therapy in colorectal cancer cell lines.
Gene→Variant (gene-first): 3845:G12V
Genes: 3845
Variants: G12V
To analyze the response of KB1(L1363P)P mammary tumors to HRR deficiency-targeted therapy, we performed orthotopic transplantations with spontaneous donor tumors as previously described. To capture the heterogeneity of K
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 15
Evidence Type(s): Predictive, Oncogenic, Functional
Justification: Predictive: The passage discusses the response of KB1(L1363P)P mammary tumors to targeted therapies, indicating that these tumors responded significantly better to cisplatin and the PARP inhibitor AZD2461, which correlates the variant with treatment response. Oncogenic: The variant is associated with tumor development and progression, as it is discussed in the context of mammary tumors and their response to therapies, suggesting a role in cancer biology. Functional: The passage describes how the variant affects the ability of tumor cells to induce RAD51 foci in response to gamma-radiation, indicating an alteration in molecular function related to DNA repair mechanisms.
Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P
Genes: 7158
Variants: L1363P p.L1363P
KB1(L1363P)P mammary tumors respond to cisplatin and PARP inhibition
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 14
Evidence Type(s): Predictive
Justification: Predictive: The variant L1363P is associated with a response to cisplatin and PARP inhibition, indicating its correlation with treatment sensitivity.
Gene→Variant (gene-first): 7158:L1363P
Genes: 7158
Variants: L1363P
KB1P mammary tumors are mainly adenocarcinomas, defined by their epithelial nature and solid growth pattern (Fig. 3D; Supplementary Fig. S4B). In contrast, KB1(L1363P)P mammary tumors are predominantly carcinosarcomas wi
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 13
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses how KB1(L1363P)P mammary tumors are classified as predominantly carcinosarcomas, indicating that the variant is used to define and classify a specific tumor subtype. Oncogenic: The variant L1363P is associated with the development of carcinosarcomas, suggesting that it contributes to tumor progression and development, which aligns with oncogenic behavior.
Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P
Genes: 7158
Variants: L1363P p.L1363P
KB1(L1363P)P mammary tumors show EMT-like phenotypes and limited genomic instability
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 12
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage indicates that the variant L1363P is associated with mammary tumors exhibiting EMT-like phenotypes, suggesting a role in tumor development or progression.
Gene→Variant (gene-first): 7158:L1363P
Genes: 7158
Variants: L1363P
The embryonic lethality of Brca1LP/LP mice indicates that an intact BRCA1 coiled-coil domain is functionally important in vivo, in line with its requirement for BRCA1-mediated HRR. To analyze whether the functional defec
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the Brca1 p.L1363P variant contributes to tumor formation and accelerates tumor development in a mouse model, indicating its role in tumor progression. Functional: The passage indicates that the Brca1 p.L1363P variant has a functional defect that compromises BRCA1-mediated homologous recombination repair (HRR), suggesting an alteration in molecular function.
Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P
Genes: 7158
Variants: L1363P p.L1363P
Brca1 p.L1363P shows a defect in mammary tumor suppression
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 10
Evidence Type(s): Oncogenic
Justification: Oncogenic: The variant p.L1363P is associated with a defect in mammary tumor suppression, indicating its contribution to tumor development or progression.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
To verify whether mouse Brca1 p.L1363P phenocopies human BRCA1 p.L1407P, we analyzed Brca1LP/LP;Trp53Delta/Delta (LP/LP) mutant and Brca1LP/+;Trp53Delta/Delta (LP/+) control MEFs for BRCA1-PALB2 interaction and HRR defec
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses increased sensitivity to cisplatin and PARP1 inhibition in the context of the Brca1 p.L1363P variant, indicating a correlation with treatment response. Functional: The variant p.L1363P is shown to severely attenuate BRCA1-PALB2 binding, which alters the molecular function related to homologous recombination repair (HRR).
Gene→Variant (gene-first): 672:leucine to proline 7158:p.L1363P 672:p.L1407P
Genes: 672 7158
Variants: leucine to proline p.L1363P p.L1407P
BRCA1 p.L1363P is unable to bind PALB2 and shows hypomorphic activity in HRR
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional
Justification: Functional: The passage indicates that the variant p.L1363P alters the binding ability of BRCA1 to PALB2 and affects its activity in homologous recombination repair (HRR), demonstrating a change in molecular function.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
In the complete absence of TP53, Brca1LP/LP mice developed apparently normal until at least E13.5, although no postnatal survival was observed upon compound heterozygous intercrosses (Table 3). This allowed us to isolate
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 7
Evidence Type(s): Functional
Justification: Functional: The passage discusses the evaluation of the functional consequences of the Brca1 p.L1363P variant, indicating that it alters molecular or biochemical function.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
For a first functional analysis of Brca1 p.L1363P in vivo, heterozygous Brca1LP mice were intercrossed and their offspring was genotyped. No Brca1LP/LP mice were born; therefore, embryos were analyzed at different stages
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses a functional analysis of the Brca1 p.L1363P variant, indicating that it alters embryonic development and leads to growth defects in mice, which demonstrates its impact on molecular or biochemical function. Oncogenic: The analysis of the Brca1 p.L1363P variant in the context of embryonic development and its comparison to Brca1-null mice suggests that it may contribute to tumor development or progression, as it is associated with severe phenotypes similar to pathogenic mutations in Brca1.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
Homozygous Brca1 p.L1363P (FVB) mice die during embryonic development
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 4
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage indicates that the homozygous variant p.L1363P in Brca1 leads to embryonic lethality in mice, suggesting that it contributes to tumor development or progression.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
We used CRISPR/Cas9-mediated genome editing in FVB mouse zygotes to model the BRCA1 coiled-coil domain VUS c.4220T>C p.L1407P, which disrupts the interaction of BRCA1 with PALB2. The BRCA1 coiled-coil domain is well cons
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 3
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variant p.L1407P disrupts the interaction of BRCA1 with PALB2 and predicts that it disables the alpha-helical structure of the coiled-coil domain, indicating an alteration in molecular function. Oncogenic: The use of CRISPR/Cas9 to model the BRCA1 variant in mice suggests that the variant contributes to tumor development or progression, as it is being studied in the context of a gene essential for embryonic development and cancer biology.
Gene→Variant (gene-first): 672:4220T>C 7158:p.L1363P 672:p.L1407P
Genes: 672 7158
Variants: 4220T>C p.L1363P p.L1407P
Generation of Brca1 p.L1363P (FVB) mice
[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 2
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 7158:p.L1363P
Genes: 7158
Variants: p.L1363P
MIB-1 labeling indices correlated with the diagnosis and grade assigned prior to H3 K27M IHC testing (Table 1). For the adult cohort, 1 case met WHO criteria for diffuse astrocytoma, WHO grade II (MIB-1 < 1%), 7 cases me
[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 6
Evidence Type(s): Diagnostic
Justification: Diagnostic: The passage discusses the correlation of MIB-1 labeling indices with the diagnosis and grade of tumors, indicating that the K27M variant is associated with specific tumor classifications.
Gene→Variant (gene-first): 3417:K27M
Genes: 3417
Variants: K27M
The known lower frequency of ATRX mutation/loss of ATRX nuclear immunostaining in only 10 - 15% of H3 K27M-mutant tumors makes this feature less amenable to comparisons between the 2 cohorts. However, of the 7 adult case
[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 5
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3417:K27M
Genes: 3417
Variants: K27M
Four cases had other morphologies at initial biopsy, including pure GG (n = 3, pediatric) and PA (n = 1, adult) histologies. One of the GGs was a 16-year-old girl with an original biopsy demonstrating a pure thalamic GG
[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 4
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses the transformation of tumors associated with the K27M variant, indicating its role in tumor development and progression, particularly in the context of glioblastoma transformation.
Gene→Variant (gene-first): 3417:K27M
Genes: 3417
Variants: K27M
Table 1 summarizes the ages, gender, anatomical location, initial histological diagnoses, and p53 IHC labeling indices discerned prior to H3 K27M IHC in the 28 H3 K27M-mutant tumors identified in our databases. There wer
[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 2
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of H3 K27M-mutant tumors and provides demographic information, indicating that the variant is associated with specific histological diagnoses and patient characteristics. Oncogenic: The mention of H3 K27M in the context of tumors suggests that this somatic variant contributes to tumor development or progression, as it is identified in mutant tumors.
Gene→Variant (gene-first): 3417:K27M
Genes: 3417
Variants: K27M
Background: H3 K27M mutation was originally described in pediatric diffuse intrinsic pontine gliomas (DIPGs), but has been recently recognized to occur also in adult midline diffuse gliomas, as well as midline tumors wit
[Paragraph-level] PMCID: PMC5822176 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Diagnostic, Prognostic, Oncogenic
Justification: Diagnostic: The passage discusses the H3 K27M mutation's association with various tumor types, indicating its role in defining and classifying these tumors, particularly in pediatric and adult cohorts. Prognostic: The passage mentions survival outcomes for patients with H3 K27M-mutant tumors, comparing mean survival times between adults and pediatric patients, which indicates a correlation with disease outcome. Oncogenic: The H3 K27M mutation is described as contributing to tumor development in various glioma types, indicating its role as a somatic variant involved in tumor progression.
Gene→Variant (gene-first): 3417:K27M
Genes: 3417
Variants: K27M
To identify somatic mutations in paediatric diffuse intrinsic pontine gliomas (DIPGs), we performed whole genome sequencing of 7 DIPGs and matched germline DNA, and targeted sequencing of an additional 43 DIPGs and 36 no
[Paragraph-level] PMCID: PMC3288377 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the frequency of the p.K27M mutation in DIPGs and its association with this specific subtype of brain tumors, indicating its role in defining or classifying the disease. Oncogenic: The p.K27M and p.G34R mutations are described as somatic mutations found in pediatric gliomas, suggesting their contribution to tumor development or progression.
Gene→Variant (gene-first): 3021:p.G34R 3021:p.K27M
Genes: 3021
Variants: p.G34R p.K27M
CDK4/6 inhibition with endocrine therapy is now a standard of care for advanced estrogen receptor positive breast cancer. Mechanisms of CDK4/6 inhibitor resistance have been described pre-clinically, with limited evidenc
[Paragraph-level] PMCID: PMC6368247 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the emergence of the ESR1 Y537S mutation in the context of resistance to CDK4/6 inhibitors, indicating a correlation with treatment response and resistance. Oncogenic: The mention of the ESR1 Y537S mutation as a new driver mutation suggests that it contributes to tumor development or progression, particularly in the context of breast cancer.
Gene→Variant (gene-first): 5728:Y537S
Genes: 5728
Variants: Y537S
Twenty-seven patients with a median age of 49 years (range 23-82) were treated with BRAF inhibitors. Eleven patients received dabrafenib with trametinib, and 16 were treated with vemurafenib. Patients received 150 mg of
[Paragraph-level] PMCID: PMC5122709 Section: RESULTS PassageIndex: 3
Evidence Type(s): Predictive, Diagnostic, Oncogenic
Justification: Predictive: The passage discusses patients treated with BRAF inhibitors, specifically mentioning the BRAF V600E mutation, which correlates with response to these therapies. Diagnostic: The passage states that all patients tested positive for the BRAF V600E mutation, indicating its use in defining or confirming the presence of a specific subtype of melanoma. Oncogenic: The BRAF V600E mutation is implicated in the development of melanoma, suggesting its role as a somatic variant contributing to tumor progression.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
Although activating mutations of FGFR3 are frequent in bladder tumors, little information is available on their specific effects in urothelial cells or the basis for the observed mutation spectrum. We investigated the ph
[Paragraph-level] PMCID: PMC2789045 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the FGFR3 mutations (S249C, Y375C, and K652E) alter molecular signaling pathways, specifically the phosphorylation of various proteins, indicating a change in biochemical function. Oncogenic: The passage describes how the mutant FGFR3 variants induce morphological transformation, cell proliferation, and anchorage-independent growth, which are indicative of their role in tumor development and progression.
Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C
Genes: 2261
Variants: K652E S249C Y375C
Conclusion: Our findings suggested that the SNPs (rs16879870, rs2641256, rs2761591, rs854936) might play a crucial role in prognosis of HNSCC.
[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Prognostic
Justification: Prognostic: The passage indicates that the SNPs are suggested to play a crucial role in the prognosis of HNSCC, which correlates with disease outcome.
Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936
Genes: NA 388325 341019
Variants: rs16879870 rs2641256 rs2761591 rs854936
Results: After combining the result of the two stages, 4 SNPs were significantly associated with HNSCC survival (rs16879870 at 6q14.3: adjusted HR = 2.02, 95%CI = 1.50-2.73, P = 3.88 x 10-6; rs2641256 at 17p13.2: adjuste
[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Prognostic, Functional
Justification: Prognostic: The passage discusses the association of SNPs with HNSCC survival, indicating that these variants correlate with disease outcome, specifically overall survival, independent of therapy. Functional: The passage mentions that the genotype of rs16879870 and rs854936 is significantly associated with the expression of specific genes in cancer tissues, suggesting that these variants alter molecular function.
Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936
Genes: NA 388325 341019
Variants: rs16879870 rs2641256 rs2761591 rs854936
Mutations in the KRAS oncogene are found in more than 90% of patients with pancreatic ductal adenocarcinoma (PDAC), with Gly-to-Asp mutations (KRASG12D) being the most common. Here, we tested the efficacy of a small-mole
[Paragraph-level] PMCID: PMC9900321 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the efficacy of a small-molecule KRASG12D inhibitor, MRTX1133, in treating pancreatic ductal adenocarcinoma, indicating a correlation between the Gly-to-Asp mutation and response to therapy. Oncogenic: The Gly-to-Asp mutation in the KRAS oncogene is described as contributing to tumor development in pancreatic ductal adenocarcinoma, as it is found in more than 90% of patients with this cancer type.
Gene→Variant (gene-first): 3845:Gly-to-Asp
Genes: 3845
Variants: Gly-to-Asp
Macrodactyly is a discrete congenital anomaly consisting of enlargement of all tissues localized to the terminal portions of a limb, typically within a 'nerve territory'. The classic terminology for this condition is 'li
[Paragraph-level] PMCID: PMC3542862 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses somatic mutations in PIK3CA (including R115P, E542K, H1047L, and H1047R) that contribute to the pathophysiology of macrodactyly, indicating their role in tumor development or progression through activation of the PI3K/AKT signaling pathway. Functional: The passage mentions that the identified mutations lead to AKT activation, which indicates that these variants alter molecular or biochemical function related to cell signaling pathways.
Gene→Variant (gene-first): 5290:E542K 5290:H1047L 5290:H1047R 5163:R115P
Genes: 5290 5163
Variants: E542K H1047L H1047R R115P
Mutations in KRAS and BRAF were associated with inferior PFS and OS of mCRC patients compared with patients with non-mutated tumors. KRAS exon 2 mutation variants were associated with heterogeneous outcome compared with
[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 9
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage indicates that KRAS G12C and G13D mutations are associated with inferior progression-free survival (PFS) and overall survival (OS) in mCRC patients, suggesting a correlation with disease outcome independent of therapy. Diagnostic: The mention of KRAS mutations being associated with heterogeneous outcomes compared to unmutated tumors implies that these variants can be used to classify or define a disease subtype in mCRC.
Gene→Variant (gene-first): 3845:G12C 3845:G13D
Genes: 3845
Variants: G12C G13D
In 664 tumors, no mutation was detected, 462 tumors were diagnosed with KRAS-, 39 patients with NRAS- and 74 patients with BRAF-mutation. Mutations in KRAS were associated with inferior progression-free survival (PFS) an
[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 7
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses the correlation of KRAS mutations, including specific variants like G12C and G13D, with inferior overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Diagnostic: The passage mentions that mutations in KRAS were diagnosed in tumors, indicating that these mutations are used to classify or define the disease.
Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D
Genes: 3845
Variants: G12C G12D G12V G13D
In this pooled analysis of metastatic colorectal cancer patients, mutations in KRAS, and BRAF were associated with inferior progression-free and overall survival compared with patients with non-mutated tumors. KRAS exon
[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses how KRAS G12C and G13D mutations correlate with inferior progression-free and overall survival in metastatic colorectal cancer patients, indicating their prognostic significance. Diagnostic: The mention of KRAS mutations being associated with tumor characteristics suggests their role in classifying or defining the disease subtype in colorectal cancer.
Gene→Variant (gene-first): 3845:G12C 3845:G13D
Genes: 3845
Variants: G12C G13D
Comparisons of PFS and OS (univariate and multivariate) of patients with mutation variants to patients with non-mutated tumors revealed the KRAS exon 2 G12C-variant (n = 28) to correlate with inferior OS compared with no
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11
Evidence Type(s): Prognostic, Oncogenic
Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.
Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D
Genes: 3845
Variants: G12C G12D G12V G13D
The median PFS of patients with KRAS exon 2 mutant tumor subtypes ranged from 8.8 [95% confidence interval (CI) 7.6-10.0] months (G13D mutation) to 10.5 (95% CI 9.0-11.9) months in (G12D variants). The median OS widely r
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.
Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H
Genes: 3845
Variants: A146T G12C G12D G13D Q61H
Of 1239 analyzed tumors, in 664 tumors (53.6%), no mutation was detected, whereas 462 tumors harboring KRAS (37.3%) mutations and 39 NRAS (3.1%) mutations were found. Additionally, a total of 74 tumors (6.0%) were carryi
[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
PIK3CA encoding the phosphoinositide 3-kinase (PI3K) p110alpha catalytic subunit is frequently mutated in cancer, with mutations occurring widely throughout the primary sequence. The full set of mechanisms underlying how
[Paragraph-level] PMCID: PMC9837058 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how mutations in PIK3CA, including G1049R, H1047R, and M1043I/L, contribute to the activation of the PI3K pathway, indicating their role in tumor development or progression. Functional: The passage describes how specific mutations alter the conformation and binding properties of the p110alpha subunit, indicating that these variants affect molecular function related to PI3K activation.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043I/L
Genes: 5290
Variants: G1049R H1047R M1043I/L
We also compared HDX-MS differences in full-length p110alpha-p85alpha between WT, H1047R and DeltaC in the presence and absence of pY (Supplementary Fig. 6). The binding of pY led to significant increases for all three c
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 19
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the H1047R variant alters the binding interactions and structural dynamics of the protein in response to pY binding, indicating a change in molecular function.
Gene→Variant (gene-first): 5290:H1047R
Genes: 5290
Variants: H1047R
The H1047R, G1049R, and the DeltaCter constructs showed similar significant increases compared to the WT in the kinase domain (Fig. 5A-C). These included regions covering 850-858 (hinge between the N and C lobes), the ac
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 18
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the H1047R and G1049R variants alter the molecular interactions and conformations within the kinase domain, indicating a change in biochemical function related to the protein's activity. Oncogenic: The evidence suggests that the H1047R and G1049R variants contribute to activation through disruption of the inhibitory conformation, which is indicative of their role in tumor development or progression.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs
Genes: 5290
Variants: G1049R H1047R M1043L N1068fs
HDX-MS experiments were carried out for 4-5 timepoints of exchange (3 s at 1 C, 3, 30, 300, and 3000 s at 20 C) for each complex. The full set of all peptides analysed for both p110alpha and p85alpha are shown in the Sou
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 17
Evidence Type(s): Functional
Justification: Functional: The passage discusses changes observed for the H1047R variant in the context of HDX-MS experiments, indicating that it alters molecular or biochemical function, specifically in terms of perturbations in conformation.
Gene→Variant (gene-first): 5290:H1047R
Genes: 5290
Variants: H1047R
To test if C-terminal mutations worked by disrupting the inhibitory interaction with the C-terminus, we carried out HDX-MS studies on six constructs of full-length p110alpha (WT, M1043L, H1047R, G1049R, N1068fs, and a co
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how C-terminal mutations, including M1043L, H1047R, G1049R, and N1068fs, affect the inhibitory interaction with the C-terminus, indicating an alteration in molecular function. Oncogenic: The mention of "oncogenic mutation" in relation to M1043L, H1047R, and G1049R suggests that these somatic variants contribute to tumor development or progression.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs
Genes: 5290
Variants: G1049R H1047R M1043L N1068fs
For these mutants, we had difficulty in obtaining sufficient yield of the proteins for extensive biophysical analysis. To circumvent this, we used the kinase dead variants to characterise their membrane binding using pro
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants H1047R, G1049R, M1043L, and N1068fs alter membrane binding and ATPase activity, indicating changes in molecular function. Oncogenic: The variants are described in the context of their effects on membrane binding and ATPase activity, which suggests a role in tumor development or progression.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs
Genes: 5290
Variants: G1049R H1047R M1043L N1068fs
We characterised the intrinsic ATPase activity of each p110alpha mutant (Fig. 4A + B), and while this assay does not measure biologically relevant PIP3 activity, it can measure intrinsic differences in PI3K activity inde
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the intrinsic ATPase activity of the p110alpha mutants, indicating that the variants G1049R, H1047R, and M1043L alter molecular function by exhibiting significantly increased ATPase activity compared to wild type. Oncogenic: The context of the passage implies that the variants are somatic mutations in a cancer-related gene, contributing to tumor development or progression through their altered biochemical activity.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs
Genes: 5290
Variants: G1049R H1047R M1043L N1068fs
To understand the regulatory mechanisms underlying the inhibitory interface with the C-terminus we analysed the most frequent oncogenic mutants that occur at or near this interface. While H1047R/L is the most frequent mu
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 12
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses frequent oncogenic mutants and their role in tumor samples, indicating that these variants contribute to tumor development or progression. Functional: The analysis of the mutants and their binding to full-length p85alpha suggests that these variants alter molecular or biochemical function, specifically in the context of their interaction with regulatory complexes.
Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:H1047R/L 5290:M1043L 5290:M1043L/I 5290:N1044K 5290:N1068fs
Genes: 5290
Variants: G1049R H1047R H1047R/L M1043L M1043L/I N1044K N1068fs
While the disengagement of the ABD and p85 being involved in membrane binding provides a molecular rationale for activation by oncogenic mutations in the ABD, C2, and helical domains, it does not fully explain the molecu
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the H1047R mutation in the context of its role in activating the kinase domain and increasing membrane binding, indicating its contribution to tumor development or progression. Functional: The passage describes how the H1047R mutation alters the molecular interactions and structural organization of the kinase domain, affecting its binding properties and functionality.
Gene→Variant (gene-first): 5290:H1047R 5290:His1047 5290:Met1043
Genes: 5290
Variants: H1047R His1047 Met1043
When comparing our data to the full set of missense oncogenic mutations in the ABD, ABD-RBD linker, C2, helical and the N-lobe of the kinase domain we find that all mutations found in >30 tumours except one (E726K) are l
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 9
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the E726K variant in the context of oncogenic mutations and its association with conformational changes that contribute to tumor development, indicating its role in cancer progression. Functional: The passage describes how the E726K variant leads to conformational changes affecting the interaction between the ABD and p85 with the catalytic core, suggesting an alteration in molecular function.
Gene→Variant (gene-first): 5290:E726K
Genes: 5290
Variants: E726K
We have extensively characterised the membrane binding of the p110alpha/p85alpha complex using HDX-MS, however, the disengagement of the ABD and p85 from the catalytic core has likely complicated the analysis of membrane
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the N345K variant affects the molecular interactions and binding of the p110alpha/p85alpha complex to membranes, indicating an alteration in biochemical function.
Gene→Variant (gene-first): 5290:N345K
Genes: 5290
Variants: N345K
This data comparing the full-length heterodimer vs p110alpha core allowed us to define the effect of ABD removal on the contact site at the ABD-RBD linker. This region still is protected from exchange at early time point
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 4
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses oncogenic mutants (N345K, G106V, and G118D) and their expected role in promoting ABD/iSH2 disengagement, indicating their contribution to tumor development or progression. Functional: The data suggests that the variants alter the dynamics of the ABD-p85 complex and its interaction with the p110alpha catalytic core, indicating a change in molecular function related to binding and mobility.
Gene→Variant (gene-first): 5290:G106V 5290:G118D 5290:N345K
Genes: 5290
Variants: G106V G118D N345K
To investigate the role of the ABD domain/p85 regulatory subunit in controlling PI3K enzyme activity, we needed a construct that allowed us to interrogate the dynamic effects of full ABD disengagement. We engineered and
[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 2
Evidence Type(s): Functional
Justification: Functional: The passage discusses the D915N mutation in the context of its effect on protein conformation and membrane binding, indicating that it alters molecular function as assessed by HDX-MS experiments.
Gene→Variant (gene-first): 5290:D915N
Genes: 5290
Variants: D915N
Mutation of several genes, most notably TP53 or ASXL1 transcriptional regulator 1 (ASXL1), were shown to cause a broad pattern of drug resistance. Interestingly, a few drugs trended more sensitive to TP53 mutant cases, s
[Paragraph-level] PMCID: PMC6280667 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive
Justification: Predictive: The passage discusses the correlation of mutations, including those in splicing components like ZRSR2, with sensitivity to various drugs, indicating a relationship between the variant and treatment response.
Gene→Variant (gene-first): 8233:serine/arginine
Genes: 8233
Variants: serine/arginine
To examine tumor forming capacity in vivo, we constructed H460 cells that stably express ERBB2 (Fig. 8a) and assessed tumor growth after subcutaneous inoculation of these cells into mice. On the 21st day after transplant
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 17
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses the tumor forming capacity of cells expressing the ERBB2 E401G variant, indicating that this somatic variant contributes to tumor development as evidenced by increased tumor growth in vivo.
Gene→Variant (gene-first): 2176:E401G
Genes: 2176
Variants: E401G
To examine the biologic effects of ERBB2 E401G in cancer cells, we evaluated the proliferative and invasive capacities of H460 cells. We found that cells expressing ERBB2 S310F exhibited a significantly higher proliferat
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the effects of the ERBB2 E401G and S310F variants on the proliferative and invasive capacities of cancer cells, indicating that these variants alter molecular or biochemical functions related to cell behavior. Oncogenic: The evaluation of the proliferative and invasive capacities of cells expressing the ERBB2 variants suggests that these somatic variants contribute to tumor development or progression.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
Biological effects of ERBB2 E401G
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 15
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 2176:E401G
Genes: 2176
Variants: E401G
Our simulation data showed that the activating mechanisms of ERBB2 E401G and S310F were related to the EGFR-HER2 heterodimer. The dimerization partner appears to be an important determinant of signaling activity. The two
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants E401G and S310F alter the phosphorylation of downstream signaling pathway proteins, indicating a change in molecular function related to the MAPK pathway. Oncogenic: The evidence suggests that the variants contribute to tumor development or progression by activating signaling pathways associated with cancer, specifically through the ERBB2 dimerization and its effects on downstream signaling.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
In a previous simulation study, the dimer interfaces of both the EGFR homodimer and the EGFR-HER2 heterodimer were destabilized when the EGFR lost EGF (a specific ligand of EGFR). We therefore conducted MD simulations of
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the E401G and S310F mutations affect the dimer interface stability of the EGFR-HER2 complex, indicating that these variants alter molecular interactions and stability.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
To confirm whether HER2 homodimers or EGFR-HER2 heterodimers are more relevant to the mechanisms of ERBB2 E401G and S310F activation, we analyzed HER-family dimers using microsecond-timescale MD simulations. With regard
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 11
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
HER2 p.(E401G) stabilizes ligand-free EGFR HER2 heterodimer
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional
Justification: Functional: The passage indicates that the variant p.(E401G) alters the stability of the ligand-free EGFR HER2 heterodimer, which suggests a change in molecular function.
Gene→Variant (gene-first): 2176:p.(E401G)
Genes: 2176
Variants: p.(E401G)
C-terminal phosphorylation of HER family proteins is caused by dimerization followed by trans-autophosphorylation, in which one receptor subunit of the dimer phosphorylates the other. Among the HER family proteins, EGFR,
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 9
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants E401G and S310F lead to increased phosphorylation levels of HER2 and EGFR, indicating that these variants alter molecular function related to protein activity. Oncogenic: The context of the passage suggests that the variants E401G and S310F contribute to tumor development or progression by enhancing the phosphorylation of key HER family proteins involved in oncogenesis.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
Identification of potential dimerization partners of HER2 E401G protein
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional
Justification: Functional: The passage discusses the identification of potential dimerization partners of the HER2 E401G protein, indicating that the variant alters molecular interactions.
Gene→Variant (gene-first): 2176:E401G
Genes: 2176
Variants: E401G
Next, we analyzed C-terminal phosphorylation of HER2 using conventional SDS/PAGE and Western blotting. Compared with cells expressing ERBB2 WT, cells expressing ERBB2 S310F (a positive control variant elevating C-termina
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 7
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the variants S310F and E401G alter the C-terminal phosphorylation of HER2, indicating a change in molecular function.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
First, we examined whether E401G can form disulfide-linked dimers using SDS/PAGE under non-reducing conditions (for preserving disulfide bonds) and Western blotting. Compared with cells expressing ERBB2 WT, H460 cells ex
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 6
Evidence Type(s): Functional
Justification: Functional: The passage discusses the ability of the variants E321G, E401G, and S310F to form disulfide-linked dimers, indicating that these variants alter molecular function related to protein interactions.
Gene→Variant (gene-first): 7157:E321G 2176:E401G 2064:S310F
Genes: 7157 2176 2064
Variants: E321G E401G S310F
To examine the functional properties of ERBB2 E401G, an ECD III variant, we evaluated two types of mechanisms of activation of ECD variants previously reported: formation of disulfide-linked dimers and elevation of C-ter
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional
Justification: Functional: The passage mentions the evaluation of mechanisms for multiple ERBB2 variants, including E321G, E401G, S310F, and D845A, which suggests that these variants are being assessed for their biochemical functions.
Gene→Variant (gene-first): 2064:D845A 7157:E321G 2176:E401G 2064:S310F
Genes: 2064 7157 2176
Variants: D845A E321G E401G S310F
ERBB2 E401G has functional properties similar to those of S310F
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 4
Evidence Type(s): Functional
Justification: Functional: The passage indicates that ERBB2 E401G has functional properties similar to S310F, suggesting that these variants alter molecular or biochemical function.
Gene→Variant (gene-first): 2176:E401G 2064:S310F
Genes: 2176 2064
Variants: E401G S310F
A 67-year-old Japanese woman, previous healthy, presented with right inguinal pain with no family history of cancer. Fluorodeoxyglucose (FDG)-positron emission tomography with CT showed increased FDG accumulation in the
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage describes the ERBB2 E401G variant as a somatic mutation that is associated with ERBB2 gene amplification, indicating its contribution to tumor development or progression. Functional: The passage mentions that multiple computational tools supported a deleterious effect of the ERBB2 E401G variant on the encoded gene product, suggesting that it alters molecular or biochemical function.
Gene→Variant (gene-first): 2176:E401G
Genes: 2176
Variants: E401G
Detection of ERBB2 E401G VUS in a patient with CUP
[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 2
Evidence Type(s): Diagnostic
Justification: Diagnostic: The passage mentions the detection of the ERBB2 E401G variant of uncertain significance (VUS) in a patient, indicating its use in defining or classifying a disease context, specifically in a patient with cancer of unknown primary (CUP).
Gene→Variant (gene-first): 2176:E401G
Genes: 2176
Variants: E401G
After collapsing smMIPs with the same barcode, we achieved > 150-fold coverage for 85% of the protein coding sequences for KRAS, BRAF, HRAS, NRAS, and MAP2K1. Because KRAS codon p.12G and BRAF codon p.600V somatic mutati
[Paragraph-level] PMCID: PMC6938308 Section: RESULTS PassageIndex: 2
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage indicates that KRAS codon p.12G and BRAF codon p.600V somatic mutations have been linked to brain AVMs, suggesting their role in defining or classifying the disease. Oncogenic: The mention of likely somatic disease-causing mutations, including KRAS mutations (p.G12D and p.G12V) and BRAF mutations (p.V600E and p.Q636X), indicates that these variants contribute to tumor development or progression.
Gene→Variant (gene-first): 3845:p.12G 673:p.600V 3845:p.G12D 3845:p.G12V 673:p.Q636X 673:p.V600E
Genes: 3845 673
Variants: p.12G p.600V p.G12D p.G12V p.Q636X p.V600E
EGFR mutation analysis in non-small-cell lung cancer (NSCLC) patients is currently standard-of-care. We determined the uptake of EGFR testing, test results and survival of EGFR-mutant NSCLC patients in the Netherlands, w
[Paragraph-level] PMCID: PMC8307492 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the association of the L858R variant with overall survival (OS) in patients treated with first-line EGFR inhibitors, indicating its relevance to treatment response. Oncogenic: The L858R variant is mentioned in the context of EGFR mutations in non-small-cell lung cancer (NSCLC), suggesting its role in tumor development or progression as part of the broader analysis of clinically actionable EGFR mutations.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
HOXC10 is overexpressed in 51% of primary KRAS-mutant tumors (Figure 3A; TCGA, >= 2SD over expression in normal lung), consistent with observations in cell lines (Figure 2B). By analyzing KRAS-mutant tumor/normal matched
[Paragraph-level] PMCID: PMC10805385 Section: RESULTS PassageIndex: 17
Evidence Type(s): Oncogenic, Predictive
Justification: Oncogenic: The passage discusses the overexpression of HOXC10 in KRAS-mutant tumors, specifically mentioning the genotype KRAS G12C/TP53 G245V, indicating that these somatic variants contribute to tumor development or progression. Predictive: The passage mentions the efficacy of combined MEK/BET inhibitors causing tumor regression in KRAS-mutant patient-derived xenograft models, suggesting a correlation between the variants and response to therapy.
Gene→Variant (gene-first): 3845:G12C 7157:G245V
Genes: 3845 7157
Variants: G12C G245V
This drug combination was also tested on NCI "Rasless" MEFs carrying KRASG12C or KRASG12D mutations. KPT9274 synergized with MRTX849 at all dose combinations yielding suppressed growth of KRASG12C-mutant MEFs (Supplement
[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 7
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the response of KRASG12D mutant MEFs to a drug combination, indicating that the variant is associated with resistance to growth inhibition by the therapies tested. Oncogenic: The KRASG12D variant is implicated in tumor behavior, as it is described in the context of MEFs (mouse embryonic fibroblasts) and their growth characteristics, suggesting a role in tumor development or progression.
Gene→Variant (gene-first): 3845:G12D
Genes: 3845
Variants: G12D
KRAS G12C-mutant MIA PaCa-2 (PDAC) and NCI-H358 (NSCLC) cells were exposed to MRTX849/AMG510 and KPT9274 at different dose combinations. As shown in Fig. 2A and B, all three dose combinations tested demonstrated synergis
[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 6
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the response of KRAS G12C-mutant cells to specific therapies, indicating a correlation between the variant and sensitivity to the drugs MRTX849/AMG510 and KPT9274. Oncogenic: The variant KRAS G12C is implicated in tumor development, as the passage describes its presence in cancer cell lines and their proliferation in response to treatment, suggesting a role in cancer progression.
Gene→Variant (gene-first): 3845:G12C
Genes: 3845
Variants: G12C
the reader should understand that the resultsof this study cannot be generalized to the teacher candidate population as a whole
The use of the word 'should' is a dark piece of diction in the education world. The public is the populace reading this article; they are the clientele in charge of voting to pass levies, voting for representatives to change the rules educators work with, and they are the ones to call the school when educators attempt to do their jobs. This word might be one of the culprits that drives the most educators from the profession when young teachers are introduced to the occupation, and the position is not what the new teacher believed it ‘should’ be.
The literature on teacher education has focused on novice teachers who leavethe profession, which has substantially contributed to our understanding ofimportant variables related to teacher retention.
Taking the time to examine why young teachers are no longer teachers should be the focus of all final semesters, in my opinion. Granted, institutions are tasked with producing educators, but to address the nationwide shortage, those same institutions have the obligation to shift their focus to developing teachers with longevity.
The studiespresented in this review also point to self-efficacy and reflection as two importantcomponents related to teacher retention, persistence, and resiliency
With teaching experience as a guide, this is absolutely true, but there is so much more to it. It is the extra things that those two actions force you to do as an educator that help teachers stay teachers.
Studies on teacher retention demonstrate that some teachers are both resilientand persistent, remaining in the profession despite being confronted with the samechallenges and obstacles of those who leave
The problem with being resilient and persistent is that burnout is far more prevalent in our world. You cannot light yourself on fire to keep others warm and survive to tell about it, or even better, keep doing it.
T'Challa is realizing that he's being talked about poorly.
Brethren
start the speech with a statement that the united Indian nations want to address congress as equals
Notable names rejected include Eric Cantor, a former Republican U.S. representative
Former SPEAKER OF THE HOUSE
Amongst the 91 patients we collated data from, most (68/91, 75%) had unique pathogenic mutations (Figure 1E, annotated as "single-patient mutations" and Supplementary Figure 1). There were eight pathogenic mutations repr
[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.
Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG
Genes: 672 675
Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG
Median OS was 48 weeks (range=4-140). None of the following factors had a significant impact on OS: PS (P=0.403), histology (P=0.198), smoking (P=0.242), sex (P=0.475), skin rash (P=0.182) and EFGR IHC expression (P=0.63
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The median follow-up period was 109 weeks and the median time to tumour progression (TTP) 20 weeks (range=4-140). A total of 23 (36%) patients had a TTP>24 weeks and 7 (10.9%) >52 weeks (Table 5). There was no difference
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
The DCR was significantly higher in patients of the 'classical' mutations than in patients of the 'wild-type' (90.9 and 43.3%, respectively; P=0.006) group; conversely, there was no significant difference between the DCR
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.
Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R
Genes: 1956
Variants: E746V G719D L858R
A total of 1 (1.1%) patient (no. 13) had two 'other' mutations, while 3 (3.4%) patients (nos. 9, 11 and 18), who were included in the 'classical mutations' group, had both the exon 21 L858R mutation and an 'other' mutati
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
According to the mutational status, three groups of patients were identified as follows: (i) the 'wild-type' group (n=61 patients; 71%) with no detectable mutations; (ii) 'classical' mutations group (n=11 patients, 13%;
[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.
Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R
Genes: 1956
Variants: E746V G719D L858R
'Classical' mutations in the EGFR tyrosine kinase domain (exons 18, 19 and 21) have been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. The aim of the current study was to evalua
[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.
Gene→Variant (gene-first): 1956:G719X 1956:L858R
Genes: 1956
Variants: G719X L858R
Four human NSCLC cell lines expressing different forms of the EGFR were investigated. Sensitivity of each cell line to the anti-proliferative effect of erlotinib was evaluated by methylene blue assay and is presented in
[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.
Gene→Variant (gene-first): 1956:L858R 1956:T790M
Genes: 1956
Variants: L858R T790M
In addition to the main driver mutations discussed above, several patients carry recurrent mutations that are clearly subclonal (present in some but not all tumour areas in a patient) and occur at later stages of tumour
[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.
Gene→Variant (gene-first): 5290:H1047R
Genes: 5290
Variants: H1047R
We analysed 134 punch cores from nine DIPG whole brain specimens obtained at autopsy as previously described. Selected punch cores represented multiple spatial regions of the primary tumour and adjacent areas within the
[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic
Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.
Gene→Variant (gene-first): 8358:K27M
Genes: 8358
Variants: K27M
Si ! Cela sert à vous qui développez et aux personnes qui liront le code source de votre page
ça ressemble un peu à cette extension "Hypothesis" au final, sans avoir besoin d'installer d'extension.
So, this is an attempt to provide a comprehensive description of the DOI system, why we use it, and why it doesn’t always work smoothly. Referencing, effort, and reward For most of our readership, reading an Ars science article is the beginning and end of their exposure to a topic. But we also have a notable population of scientists who read, and they may find themselves interested in reading the academic paper that led to our coverage. There are any number of good reasons for doing that: the paper may be relevant to their work, they may want details we did not provide in our coverage, they suspect we might have gotten something wrong and want to correct us, etc. As a result, some form of reference to the paper is a definite good—it’s a benefit for some of our readership, and may help correct errors that are read by the rest of our audience.
The state of { journalism, the Web–industrial complex, and understanding about the fundamentals of research and scholarship } are so poor that the staff actually had to justify something as simple as citing your sources.
(In 2010, but still… 2010!)
Somatic mutations found within the tyrosine kinase domain (TKD) of the human epidermal growth factor (HER) family of receptors have been implicated in the development and progression of non-small cell lung cancer (NSCLC)
[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Predictive, Functional
Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Taken together, these data suggest that the V855A mutation alters the activity of HER3, which may correlate with a malignant phenotype.
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To elucidate and predict the impact of mutant V855A on the conformation of the wild-type HER3, protein modeling was performed via the automated I-TASSER server. Server predicted models were further refined by submitting
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Impact of V855A on HER3 protein structure
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24
Evidence Type(s): Functional
Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We further examined the effects of the inhibitors on HER-related signaling activity and survival using the Ba/F3 model system. Afatinib (100nmol/L) potently inhibited NRG1beta-induced phosphorylation of HER3, wild type H
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23
Evidence Type(s): Predictive
Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To assess the effect of the inhibitors on colony formation, Ba/F3 co-transfectants were seeded onto methyl-cellulose and treated with HER inhibitors in the presence of NRG1beta. As shown in Fig 6b, afatinib (100 nmol/L)
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To investigate whether HER3-V855A can be therapeutically targeted; we examined the growth inhibitory effects of inhibitors targeting the extracellular and kinase domain of the HER receptors. These inhibitors include: erl
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To further confirm that the V855A mutation provides increased activity to HER3 through enhanced physical interaction with HER2, we performed co-immunoprecipitaton experiments on Ba/F3 co-transfectants stimulated with or
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
Tyrosine trans-phosphorylation is a major event in HER signaling. To examine if HER3-V855A enhances trans-phosphorylation of HER2, we performed immunoblot analysis on Ba/F3 and HEK 293Tlysates after 16hr incubation in se
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We next examined the effect of chronic treatment with NRG1beta on HER3/HER2 phosphorylation and their downstream targets AKT and ERK 1/2 in the Ba/F3 co-transfectants. As shown in Figure 3e, a five-day chronic treatment
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
We also investigated the functional relevance of stable Ba/F3 transfectants co-expressing HER3-V855A and EGFR (Supplemental Fig. 1a). While Ba/F3 cells co-expressing HER3-V855A and EGFR exerted a robust growth response t
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To assess the ability of HER3-V855A to form colonies we performed a methyl cellulose-based colony formation assay. As shown in Fig 3c & 3d, while NRG1beta treatment did not induce an increase in colony number between the
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To determine the transforming potential of HER3-V855A in the context of IL-3 -independent growth, Ba/F3 transfectants were grown in the absence or presence of IL-3, or HER cognate ligands (neuregulin1beta (NRG1beta) or t
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
HER3 has been described as a contributor to oncogenic transformation and tumorigenesis, particularly when combined with its HER2 dimerization partner. Therefore, we hypothesized that the HER3 kinase mutation may cause a
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
To analyze the location and significance of the novel HER3-V855A mutation, we performed protein sequence alignment of exon 21 of the EGFR and HER3. Although, the amino acid at position 855 in HER3 is not conserved relati
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.
Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A
Genes: 673 1956 324
Variants: L597V L858 L858R V855 V855A
EGFR pathogenic mutations sensitize in varying degrees to inhibition by small molecule TKIs. These mutations include both class I short in-frame deletions and class II missense mutations. One of these mutations, the L858
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.
Gene→Variant (gene-first): 1956:L858R
Genes: 1956
Variants: L858R
Homology between the HER3-V855A and EGFR-L858R kinase mutation
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 1956:L858R 324:V855A
Genes: 1956 324
Variants: L858R V855A
A single arm multicenter phase II clinical study initiated in 2006 (FIELT1 study; NCT00339586) was coordinated by our department to evaluate the safety and efficacy of first-line erlotinib in patients with advanced NSCLC
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5
Evidence Type(s): Oncogenic, Predictive
Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.
Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855
Genes: 2065 324
Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855
Identification of a novel HER3-V855A mutation
[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 324:V855A
Genes: 324
Variants: V855A
A single case with p.N822K (c.2466T>A) [Figure 4b] was identified. The tumor originated in jejunum in an elderly man with spindle morphology.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.
Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K
Genes: 3815
Variants: c.2466T>A p.N822K
Three cases involving p.K642E mutation (c.1924A>G) [Figure 4a], 2/3 were in elderly men, at gastric, an anorectal site with mixed morphology. One was a double mutation in association with exon 11 [Table 2].
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E
Genes: 3815
Variants: c.1924A>G p.K642E
Mutations were identified in 10 cases located in the small intestine with significant association (P = 0.004). One was located in the retroperitoneum. Ninety percent (9/10) tumors revealed internal tandem duplications (I
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.
Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY
Genes: 3815
Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY
Insertion of 3 nucleotides, p.K558delinsBP (c.1673_1674insTCC), and duplication p.Y577_K580dup (c.1731_1742dupTTATGATCACAA) was seen 1 case (1.8%) each, respectively.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.
Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP
Genes: 3815
Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP
The substitution mutations were p.V559D (3/57; 5%), p.V560D (3/57; 5%), p.V559A (2/57; 3.5%), and 1 (1.8%) cases each with p.V560G, p.T574I, and p.L576P among this 9 were homozygous and 2 heterozygous.
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.
Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G
Genes: 3815
Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G
One case with simultaneous mutations in exons 11 and 13 harbored in-frame deletion in exon 11; p.M552_K558del (c.1654_1674delATGTATGAAGTACAGTGGAAG) and a novel substitution mutation; p.K642R (c.1925A>G) [Figure 1d] in ex
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R
Genes: 3815 5156 728378
Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R
Exon 11 mutations were heterogeneous with in-frame deletion of 3-51 nucleotides (codons 550-576) in classic hot-spot region at the 5' end of the exon (codons 550-560). Double mutations were identified in 9 cases (16%), 8
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.
Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup
Genes: 728378 3815
Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup
Exon 11 mutations were in 57% of cases [Table 2]. In-frame deletions in 35 (61.4%), 11 substitutions (19.3%), 9 double mutations (15.7%), 1 insertion and duplication (1.8%), respectively. Common mutation was p.W557_K558
[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.
Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D
Genes: 3815
Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D
Oberon compilers for RISC-V exist and are in active development
ics. Cultural
term / defintion
These are the five most common steps in the writing process: Prewriting Outlining the structure of ideas Writing a rough draft Revising Editing
When writing it is important to follow these steps to make the best form of your essay. Following these steps can help you be organized and lay out your thoughts so it can make since when you write the final product.
When appropriate, use graphics in place of text. For instance, rather than describing a display screen, include a screen shot.
I think that this is especially helpful for young children who don’t have strong reading skills yet.
Librarians produce many types of written materials, including brochures, pamphlets, reading lists, flyers, fact sheets, and informational guides
It is important to have a positive relationship with your librarian because they can be a great resource for materials, books, and other technology.
Results: We found that rs3786362 G allele of thymidylate synthase (TYMS) gene was significantly associated with PFS (P = 1.10 x 10-2), OS (P = 2.50 x 10-2) and DCR (P = 5.00 x 10-3). The expression of TYMS was overexpres
[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Prognostic, Diagnostic
Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).
Gene→Variant (gene-first): 7298:rs3786362
Genes: 7298
Variants: rs3786362
Thirty-two patients with BRAF V600E positive metastatic colorectal cancer (mCRC) and 7 patients with other cancers were enrolled. No dose-limiting toxicities were observed in escalation, with vemurafenib 960 mg twice dai
[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
BRAF V600E mutant metastatic colorectal cancer represents a significant clinical problem, with combination approaches being developed clinically with oral BRAF inhibitors combined with EGFR-targeting antibodies. While co
[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.
Gene→Variant (gene-first): 673:V600E
Genes: 673
Variants: V600E
Whole exome sequencing identified a total of 15 somatic mutations, including nine missense mutations. Interestingly, we identified two activating mutations affecting FGFR1, including FGFR1 p.K656E (NM_023110.3:c.1966A>G)
[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.
Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M
Genes: 2260
Variants: c.1681G>A c.1966A>G p.K656E p.V561M
Patient is an 18-month-old otherwise healthy boy who presented with acute onset nausea, vomiting, and gait instability, resulting in a fall on the day of presentation. On arrival to the ED, vital signs were notable for h
[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3
Evidence Type(s): Oncogenic
Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.
Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E
Genes: 3417 673
Variants: p.R132H p.V600E
This is the first report to our knowledge to demonstrate activity of osimertinib in a patient with NSCLC harboring HER2 exon 19, p.L755P mutation resulting in intra- and extracranial response. In the future, osimertinib
[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6
Evidence Type(s): Predictive, Diagnostic
Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.
Gene→Variant (gene-first): 2064:p.L755P
Genes: 2064
Variants: p.L755P
A 68-year-old female with a past medical history of type 2 diabetes and minimal smoking was diagnosed with stage IV NSCLC. Next generation sequencing on tumor tissue demonstrated an ERBB2 exon 19 c.2262_2264delinsTCC, p.
[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Predictive, Oncogenic
Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.
Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)
Genes: 2064
Variants: c.2262_2264delinsTCC p.(L755P)
Extracranial arteriovenous malformation (AVM) is most commonly caused by MAP2K1 mutations in the endothelial cell. The purpose of this study was to determine if local tissue overgrowth associated with AVM is caused by di
[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.
Gene→Variant (gene-first): 5604:p.K57N
Genes: 5604
Variants: p.K57N
We describe a 57-year-old woman with resected stage IIIB pancreatic cancer who underwent several lines of conventional chemotherapy after multiple lymph node metastases. When the disease progressed again, the patient rec
[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4
Evidence Type(s): Diagnostic, Oncogenic
Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.
Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A
Genes: 79728
Variants: c.2514+1G>C c.3114-1G>A
This analysis examined 45 single missense mutations detected in PCa with metastasis or high Gleason scores, and which extend along the entire length of the protein. Our sensitive assay system uncovered a previously unide
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.
Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A
Genes: 2232 367 1387 10514 10499
Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A
Mutations with no apparent change of activity from WT may be able to drive cancer progression though several diverse routes. These include altered binding to co-repressors or co-regulators e.g. M886I, regulatory element-
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41
Evidence Type(s): Oncogenic, Functional
Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.
Gene→Variant (gene-first): 9611:M886I
Genes: 9611
Variants: M886I
The LBD mutations had a greater dependence on the regulatory elements, emphasizing the importance of interdomain communication for receptor function. While the major losses of function seen with M749I at 10 nM DHT were c
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.
Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E
Genes: 367 1387 10514
Variants: H874Y M749I Q798E
Mutations within the DBD and hinge domains of the AR would be expected to have the greatest influence on regulating ARE binding and indeed, the profile for T575A in the first zinc finger of the DBD was markedly different
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.
Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A
Genes: 2908 10499
Variants: I672 I672T R629 R629Q T575A
The results for the AR NTD mutations investigated with PSA61Luc closely matched those for GRE2-TATA-Luc. AR mutation L57Q had loss of function at all concentrations of DHT with both reporters although they were less pron
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.
Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S
Genes: 2232 367
Variants: G142V L57Q P390L P533S
In general, the profiles of PSA61Luc stimulation for the different AR mutations were very similar to those for GRE2-TATA-Luc; indicating that the findings in the broad GRE2-TATA-Luc study accurately reveal the effects of
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.
Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A
Genes: 367 10499
Variants: P390L R629Q T575A
The LBD contained two mutations, D879G and Q919R, which fall within the grouping of loss to gain of function, although recovery to a modest 19% gain of function and WT levels respectively took place at only the highest c
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.
Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A
Genes: 10499 367
Variants: D879G H874Y Q919R T877A
Mutations K720E and R726L, which is implicated in a 6-fold increased risk of prostate cancer, reside in a positive cluster in helix 3 with lysine 720 creating a charged clamp with glutamate 897, and both residues partici
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29
Evidence Type(s): Predisposing, Functional
Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.
Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720
Genes: 367 9611
Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720
Within the LBD, all but two loss of function mutations were clustered between residues 720 and 798. Of these, half had essentially no transactivational activity at physiological levels of DHT and comprise of L744F, A748V
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.
Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C
Genes: 367 9611 1387 10514
Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C
Mutations in the LBD have historically been considered as the most likely candidates for driving PCa, therefore, the finding that the majority of mutations under investigation had no change from WT or loss of function wa
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.
Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I
Genes: 367 9611
Variants: K910R M886 M886I
Within the hinge region, mutation I672T has been included in the arbitrary classification of no change from WT due to deviation of less than 10% at 0 and 0.1 nM DHT changing to a 14% gain of function at 10 nM. Interestin
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.
Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A
Genes: 597 367 2908 10499
Variants: A586V A587S I672T R629Q T575A
The only mutation to function like WT at low DHT and then gain function compared to WT upon DHT binding was P533S in the NTD. As with other groupings, mutations leading to constitutive transactivation activity were prese
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.
Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S
Genes: 2232 367
Variants: G142V G524D M523V M537V P533S
The novel class of mutation, namely loss of function at low levels or in the absence of DHT recovering to WT values or a gain of function upon binding of DHT was present in the NTD. Mutations P269S and S515G had WT level
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.
Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G
Genes: 367 10514
Variants: P269S P390L P514S S515G
Interestingly, there was exiguous rescue at the highest concentration of DHT with D221H, P504L and D528G, while P340L manifested a striking dose-dependent recovery. The S296R mutation has been shown to have altered inter
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.
Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P
Genes: 207 367 2232 9611
Variants: D221H D528G E198G P269S P340L P504L S296R S334P
The predominant type of mutation i.e. loss of function, was well represented in the NTD. Mutations L57Q, E198G, D221H, A234T, S296R; S334P, P340L, P504L and D528G all displayed loss of function with E198G showing the gre
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).
Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P
Genes: 1387 207 367 2232 9611
Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P
All five classes of mutation were represented within the NTD. Of the five mutations in AR classified as having no change from WT, G166S showed the least variance from the unmutated receptor. The mutation M537R also had m
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.
Gene→Variant (gene-first): 367:G166S 367:M537R
Genes: 367
Variants: G166S M537R
Unsurprisingly, the DBD is virtually unaltered across a wide range of species with 100% homology between the examples shown here; except for two conservative substitutions in Xenopus, one of which T575, has been included
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6
Evidence Type(s): Functional
Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.
Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575
Genes: 2908 10499
Variants: I672 R629 T575
The NTD is by far the least conserved domain with mouse, chicken and Xenopus having only 75, 32 and 34% similarity to human respectively. Alignment of the investigated human AR mutations to the primary sequence of AR in
[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5
Evidence Type(s): Diagnostic, Functional
Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.
Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334
Genes: 1387 207 367 2232 10514
Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334
To further investigate this we solved the structure of BCL-2 G101V bound to S55746 (Table 1). We obtained diffraction to 2.0 A in a P 21 spacegroup with two molecules in the asymmetric unit. The BCL-2 G101V:S55746 struct
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13
Evidence Type(s): Functional, Oncogenic
Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.
Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101
Genes: 596
Variants: E152 E152A G101V V101
S55746 is another BCL-2 selective antagonist that has progressed to the clinic. The recently disclosed crystal structure of BCL-2 WT bound to S55746 revealed binding to the P1, P2 and P3 pockets, in contrast to venetocla
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.
Gene→Variant (gene-first): 596:G101V
Genes: 596
Variants: G101V
E152 moved into the base of the P2 pocket in the BCL-2 G101V:venetoclax structure (Fig. 2b, c). To test the role of E152 in reducing affinity we generated a BCL-2 G101V/E152A double mutant. Alanine does not have a Cgamma
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.
Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V
Genes: 596
Variants: E152 E152A G101A G101V
The role of E152 in venetoclax affinity
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9
Evidence Type(s): Predictive
Justification: Predictive: The passage discusses the role of E152 in venetoclax affinity, indicating a correlation with response or sensitivity to the therapy.
Gene→Variant (gene-first): 596:E152
Genes: 596
Variants: E152
SPR experiments were performed using a BIMBH3 or BAXBH3 immobilised sensor surface with BCL-2 mutants as the analyte and determining venetoclax affinity by competition experiments, (Fig. 3, Table 2 and Supplementary Fig.
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8
Evidence Type(s): Predictive, Functional
Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.
Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V
Genes: 596
Variants: F104C F104L G101V
The crystals of venetoclax complexed with BCL-2 F104L and BCL-2 WT are isomorphous (Table 1). Well-defined electron density for the drug in the mutant complex structure (Supplementary Fig. 1) suggests two conformations f
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.
Gene→Variant (gene-first): 596:F104 596:F104L 596:L104
Genes: 596
Variants: F104 F104L L104
To understand how these BCL-2 mutations compromise drug binding we solved crystal structures of both complexes (Table 1 and Fig. 2). The G101V mutation resides on the BCL-2 alpha2 helix packing against the alpha5 helix a
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5
Evidence Type(s): Functional, Predictive
Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.
Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V
Genes: 596
Variants: E152 G101 G101A G101V
Crystal structures of BCL-2 with ABT-263 and various analogues of venetoclax have been deposited in the PDB and described in the literature (Fig. 1a, b). One of those analogues is 4-[4-((4'-chloro-3-[2-(dimethylamino)eth
[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3
Evidence Type(s): None
Justification: Not enough information in this passage.
Gene→Variant (gene-first): 596:F104
Genes: 596
Variants: F104
Multiple jejunalgastrointestinal stromal tumors (GISTs) were found in a 52-year-old woman with a history of neurofibromatosis type 1. These tumors were composed of interlacing fascicles of uniform spindle cells with eosi
[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1
Evidence Type(s): Oncogenic, Diagnostic
Justification: Oncogenic: The passage describes a missense point mutation (Trp557Gly) identified in the KIT gene associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Diagnostic: The variant Trp557Gly is mentioned in the context of identifying and characterizing the tumors associated with neurofibromatosis type 1, suggesting its role in defining the disease subtype.
Gene→Variant (gene-first): 3815:Trp557Gly
Genes: 3815
Variants: Trp557Gly
Fusions involving ETV6 in leukemia have long been recognized. Other mutation types, including single nucleotide variations, insertions, deletions, frame-shifts and non-sense alterations are also becoming increasingly evi
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12
Evidence Type(s): Diagnostic, Functional
Justification: Diagnostic: The passage discusses the identification of rare germline variants (V37M, R181H) in patients with B-ALL, indicating their association with the disease. Functional: Luciferase assays performed on the variants showed no significant changes in transcriptional repression activity compared to WT ETV6, indicating an assessment of their molecular function.
Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916
Genes: 2120
Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916
To examine whether the L349P and N385fs mutations negatively impact translation or alter subcellular localization of the ETV6 protein, we performed cell fractionation assays and western blotting of HeLa cells transiently
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10
Evidence Type(s): Functional
Justification: Functional: The detection of different localization patterns for the mutants P214L, R369Q, and R399C also suggests alterations in their molecular or biochemical function.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C
Genes: 2120
Variants: L349P N385fs P214L R369Q R399C
To evaluate the functional consequences of these mutations, we first assessed whether L349P and N385fs might impair transcriptional repression by ETV6. HeLa cells were transiently co-transfected with constructs encoding
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the mutations L349P, N385fs, P214L, R369Q, and R399C impair the transcriptional repression function of ETV6, indicating that these variants alter molecular function.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C
Genes: 2120
Variants: L349P N385fs P214L R369Q R399C
Both ETV6 variants were absent in the National Heart Lung Blood Institute (NHLBI) Exome Sequencing Project (ESP) (http://evs.gs.washington.edu/EVS/), Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/),
[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7
Evidence Type(s): Functional
Justification: Functional: The passage discusses how the L349P and N385fs mutations are predicted to alter the molecular function of the ETV6 protein, including conformational changes and truncation that affect DNA interaction.
Gene→Variant (gene-first): 2120:L349P 2120:N385fs
Genes: 2120
Variants: L349P N385fs